HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Louis-Plence, P. Articles by Eliaou, J.-F. Search for Related Content PubMed PubMed Citation Articles by Louis-Plence, P. Articles by Eliaou, J.-F.

The Down-Regulation of HLA-DM Gene Expression in Rheumatoid Arthritis Is Not Related to Their Promoter Polymorphism^{1 ,2}

Pascale Louis-Plence^*, Sophie Kerlan-Candon^3,*, Jacques Morel^3,, Bernard Combe, Jacques Clot^*, Valérie Pinet^* and Jean-François Eliaou^4,*

^* Laboratoire d’Immunologie de Montpellier, Unité de Recherche Immunopathologie des Maladies Tumorales et Autoimmunes, Institut National de la Santé et de la Recherche Médicale Unité 475, Montpellier, Cedex, France; and Service d’Immunorhumatologie, Hôpital Lapeyronie, Montpellier, Cedex, France

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
HLA-DM molecule, a class II-like heterodimer, is a critical factor of HLA class II-dependent Ag presentation. It acts as a molecular chaperone and also functions as a peptide editor favoring the presentation of high-stability peptides. Thus, it appears to skew the peptide repertoire presented to T cells. Variation in HLA-DM expression has considerable effect on Ag presentation and regulation of these genes is likely to be a prerequisite to prevent autoimmunity. In this study, rheumatoid arthritis (RA) was chosen as a model of human autoimmune disease since its genetic susceptibility is known to be associated with the HLA-DR and -DM components. We described a limited nucleotide polymorphism in the HLA-DM promoters with functional impact on basal transcriptional activity and IFN- induction as assessed in vitro. However, no difference of allele frequencies was found between controls and RA patients. Despite of this lack of association, expression of HLA-DM molecules was also investigated. Interestingly, an underexpression of HLA-DM transcripts and protein was shown in peripheral blood B cells from RA patients compared with controls or inflammatory arthritis patients. This underexpression does not affect HLA-DR genes and is responsible for a decrease of the DM:DR ratio in RA patients. This specific HLA-DM down-regulation is likely to have important consequences on Ag presentation and could participate in the autoimmune process in RA.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Major histocompatibility complex class II molecules are peptide receptors involved in the presentation of self and antigenic peptides present in the endocytic pathway to CD4⁺ T cells (1). MHC class II molecules typically assemble in the endoplasmic reticulum as a stoichiometric complex with a nonpolymorphic chain, the invariant chain (Ii)⁵ (2). The nonameric complex (ßIi)₃ is transported to the trans-Golgi network and subsequently sorted to endosomal/lysosomal compartments (3, 4). In this acidic environment, Ii is proteolytically degraded and the ultimate product of degradation, class II-associated Ii peptide (CLIP), forms intermediate complexes with ß dimers. Then CLIP is replaced by antigenic peptides before the transport of the MHC class II molecules to the cell surface can proceed (5). Although CLIP by itself can dissociate from several HLA class II alleles at endosomal pH (6, 7, 8), another class II-like heterodimer, HLA-DM, appears to be required for efficient CLIP release and acquisition of cognate peptides for all class II alleles (9, 10). HLA-DM molecule catalyzes the exchange of CLIP for cognate peptide in an enzyme-like fashion but is not restricted to class II-CLIP complexes and exhibits a rather broad substrate specificity (11, 12, 13, 14). Indeed, HLA-DM was found to release non-CLIP peptides that formed with ß dimers a low-kinetic stability complex, owing to suboptimal anchor-pocket interactions or suboptimal length. After removal of CLIP or low-intrinsic kinetic stability peptides, HLA-DM acts as a molecular chaperone and keeps empty HLA class II-binding grooves accessible for cognate peptide at low lysosomal pH so that loading can be accomplished even when a low amount of peptide is available (15). Therefore, HLA-DM acts as a peptide editor (13) and appears to skew the peptide repertoire presented to T cells toward a population of high-kinetic stability MHC class II-peptide complexes. Thus, HLA-DM reduces the diversity of the set of antigenic peptides exposed at the cell surface and may contribute to the selection of immunodominant epitopes. In the absence of HLA-DM expression, the peptide repertoire bound to HLA class II molecules could be broader, leading to the presentation of new epitope determinants triggering the activation of autoreactive T cells. Thus, variation in HLA-DM expression has considerable effect on the peptide repertoire bound to HLA class II molecules and presented to CD4-T cells (16, 17, 18, 19), and regulation of HLA-DM expression appears to be a prerequisite to prevent autoimmunity.

HLA-DM gene expression seems to be coregulated with the other classical class II genes. As expected, they are expressed in APCs and can be induced by IFN- in some other cells like epithelial cells. The proximal promoter regions of HLA-DMA and DMB genes contain the consensus X1, X2, and Y boxes found in the regulatory regions of all classical HLA class II genes. These motifs are sites of protein-DNA interactions responsible for the expression of HLA-DM genes (20, 21, 22). Polymorphism in the regulatory regions of the classical class II genes, affecting or not the consensus regulatory motifs, has been described with functional consequences on their transcriptional activities and DNA-binding affinities (23, 24, 25, 26). To explore nucleotide polymorphism, we sequenced the HLA-DMA and DMB regulatory regions, and we investigated the functional consequences of the observed substitutions on transcriptional activity, IFN- induction, and affinity for the trans-acting NF-B factor.

Dysregulation of HLA class II molecule expression has been described in several autoimmune diseases and particularly in rheumatoid arthritis (RA) (27, 28). Genetic studies have demonstrated that some HLA-DR (29, 30) and HLA-DM (31) alleles are associated with the disease but the mechanism by which these alleles mediate susceptibility to RA is still unknown. According to the coordinate regulation of HLA class II genes and the genetic association between DM and RA, we compared the level of HLA-DM gene expression in physiology and RA patients. We quantified by semiquantitative RT-PCR the HLA-DMA and -DMB transcripts and by Western blot analysis the HLA-DM protein level. We were able to show an underexpression of HLA-DM transcripts and protein in peripheral blood B cells from RA patients. This down-regulation was restricted to the HLA-DM genes, suggesting a non-coordinate expression of DM and DR gene expression in RA. An arbitrary DM:DR ratio was calculated and was found to be three times decreased in RA patients compared with controls.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Direct sequencing of the HLA-DM proximal promoter regions

One hundred six healthy volunteer bone marrow donors and 96 RA patients with classical disease according to the American College of Rheumatology criteria were studied. Genomic DNA was extracted from PBMC with the QIAamp Blood kit from Qiagen (Courtaboeuf, France). The nucleotide sequences of the HLA-DMA and -DMB regulatory regions were determined following PCR amplification of genomic DNA. Sequences of the oligonucleotide primers used were: sense, 5'-AGATGCGGTTCCCCATTGC-3'; antisense, 5'-TACCTTCTTGCCACACAGTAGG-3' for HLA-DMA, and sense, 5'-ATTCTGCAGAAAA AGAATTAAG-3', antisense, 5'-TGCTCTGCTCTGTAAAGATGCC-3' for HLA-DMB. The -21M13 primer sequence (TGTAAAACGACGGCCAGT) was added 5' to one of the two oligonucleotides in each set, and alternatively on the sense and antisense primers to perform the sequencing of the PCR amplified fragment, on both strands, using the ABI PRISM Dye Primer kit from Applied Biosystems (PE France SA, Courtaboeuf, France). The sequencing reactions were analyzed on an Applied Biosystems 373A DNA automatic sequencer. Each nucleotide substitution was confirmed by sequencing two independent PCR products as well as sequencing the complementary strand of DNA. The sequence Navigator software (PE France SA) was used to perform sequence alignments with the reference sequences found in the database (32).

Semiquantitative and competitive RT-PCR

B cells were purified from fresh peripheral blood with anti-CD19 mAb-coated magnetic beads from Dynal (Compiègne, France) and used directly for RNA extraction. Total RNA was extracted with an RNeasy kit from Qiagen, and RNA samples were stored at -70°C in the presence of RNase inhibitor (RNAguard; Pharmacia, Saclay, France). The reverse transcription reactions were performed with 200 U of reverse transcriptase from the Moloney murine leukemia virus (Life Technologies, Cergy-Pontoise, France) in a 25-µl volume reaction for 1 h at 37°C. cDNA was immediately used for PCR. At least two reverse transcription reactions were performed for each RNA sample and the PCRs were conducted with increasing quantities of RNA to check the linearity of the amplification. Sense oligonucleotides used for the HLA-DM PCR were 5' end-labeled with fluorescein phosphoroamidite (U-FAM; Genosys Biotechnologies, Cambridgeshire, U.K.). The sequences of the oligonucleotides used were 5'^UFAM-CTGTGTGGCAAGAAGGTATGGGT-3' (sense) and 5'-ACAGACATTTGGAGGAAGAGGGA-3' (antisense) for HLA-DMA amplification and 5'^UFAM_-GGCATCTTTACAGAGCAGAGCAT-3' (sense) and 5'-ATGTGAAATCCTTTGGAGTCCCA-3' (antisense) for HLA-DMB amplification. Reverse GAPDH primer was 5' end-labeled with fluorescent dye carboxytetramethyl-rhodamine N-hydroxysuccinimide (TAMRA). Sequences of the primers used for GAPDH amplification were 5'-GGATTTGGTCGTATTGGG-3' (sense) and 5'^TAMRA-GTTCTCAGCCTTGACGGT-3' (antisense). All of the PCRs were performed essentially as described previously (33). Amplified fluorescent PCR fragments were electrophoresed for 5 h on an Applied Biosystems 373A DNA and separated according to their size products (158 bp for DMA, 144 bp for DMB, and 166 bp for GAPDH). Peaks of fluorescence were displayed using the Genescan software (Version 673; PE France SA) and intensities of fluorescence, corresponding to the calculated area of each peak, were determined. The signal for HLA-DM transcripts was then related to the signal obtained for GAPDH transcripts determined in the same way to normalize yields of RNA extraction and reverse transcription between samples.

For quantitative evaluation of the HLA-DRB mRNA expression, the sequences of the primers and the conditions for the competitive PCR have been previously described in detail (33).

Statistical analysis

Allelic frequencies were compared in Fisher’s exact test, values for HLA-DM:GAPDH and DM:DR ratios were compared according to the unpaired t test.

Cells and cell culture

Daudi is a MHC class II-positive B lymphoblastoid cell line and HeLa is an epithelial-like cell line derived from an adenocarcinoma. Daudi cells were grown in RPMI 1640 glutamax supplemented with 10% FCS (Biomedia, Boussens, France), 100 U/ml penicillin, and 100 µ g/ml streptomycin (Life Technologies). HeLa cells were grown in DMEM supplemented as described above. IFN- (Roche, Meylan, France) was added to HeLa cells at a concentration of 500 U/ml for 24 h.

Transient transfections experiments and luciferase assays

Five million Daudi cells were electroporated in 0.8 ml of RPMI 1640 medium containing 5 µg of the indicated luciferase reporter construction DNA at 240 V and 960 µfarads with a Bio-Rad electroporator (GenePulser; Bio-Rad, France). Immediately after electroporation, samples were resuspended in 5 ml of medium and grown for 24 h. HeLa cells were transfected using the calcium phosphate method without glycerol shock. Six micrograms of plasmid DNA was first mixed with CaCl₂ and then with HBSS, incubated for 30 min at room temperature, and added to the cells in 6-well plates for 24 h. Cells were rinsed and incubated with media with or without IFN- for 24 h. Cells were harvested, lysed, and the luciferase activity was quantified using a luciferase assay system kit (Promega, Charbonnieres, France) in a TD20 luminometer counter (Promega) following the manufacturer’s procedure. The transcriptional activity of each construction was tested in five independent transfection experiments. Two plasmid preparations from two different clones for each sequence were used and the relative luciferase activities were compared.

Oligonucleotides for EMSA

The oligonucleotide sequences were as follows (B motifs are in boldface, the mutated nucleotides used to disrupt the binding sites are underlined, and the polymorphic nucleotides in the B site of the HLA-DMB promoter region are in italics): B IL-2R_wt, CAACGGCAGGGGAATCTCCCTCTCCTT; B IL-2R_mut, CAACCTCAGCTCAATCTCCCTCTCCTT; DMB-C, ATATTAGGGGCTGGGTATCCCCACATCACTCATTTGGGGG; DMB-T, ATATCTAGGGGCTGGGTATTCCCACATCACTCATTTGGGGG; nonspecific DNA competitor, TTGCAAGAACCCTTCCCCTAGCAACAGATG CGTCATCTCAAAATATTTTTCTG. The B IL-2R_wt and B IL-2R_mut oligonucleotides were kindly provided by Jean Imbert (Centre d’Immunologie de Marseille-Luminy, Marseille, France). Oligonucleotides and their complementary sequences were annealed, end-labeled, and used as probe or competitor DNA in protein/DNA-binding reactions.

EMSA

Nuclear extracts were prepared from the MHC class II-positive Daudi cell line and HeLa cells treated with or without IFN- following the procedure described previously (34). Protein/DNA-binding reactions were performed on ice in 20-µl reactions containing 12 mM of HEPES-KOH (pH 7.9), 12% glycerol, 30 mM KCl, 5 mM MgCl₂, 0.12 mM EDTA, 0.3 mM DTT, 0.1 µg denatured salmon sperm DNA, 5 µg BSA, and 0.1 µg poly (dI:dC)-poly(dI:dC). Nuclear extracts were preincubated under the above conditions and 50,000 cpm of double-stranded oligonucleotide probe end labeled with [-³²P]ATP were then added to the reaction and incubated on ice for 30 min. For DNA competition assays, protein extracts were preincubated with competitor DNA for 30 min before addition of the probe. Reactions were then incubated for an additional 30 min.

Supershift experiments were conducted as described previously (34) with a rabbit polyclonal anti-p50 antisera from Chemicon (Euromedex, Souffelweyersheim, France), various monoclonal anti-p65 Abs from Santa Cruz Biotechnology (Tebu sc-372-G, sc109x and sc109G references; Le Perray-en-Yvelines, France) and Upstate Biotechnology (Euromedex), anti-p65 specific antiserum from the laboratory of J. Imbert (Centre d’Immunologie de Marseille-Luminy), and irrelevant antisera directed against the RFX5 protein. The reactions were loaded on 5% nondenaturing polyacrylamide gels (29:1 acrylamide:bis ratio) in a glycerol-tolerant electrophoresis buffer containing 89 mM Tris, 28.5 mM taurine, and 0.05 mM EDTA. Electrophoresis was conducted for 2 h at 200 V at 4°C. Gels were then fixed, dried, and exposed to x-ray films.

Quantification of HLA-DM and -DR protein expression by Western blot analysis

Total cell lysates were prepared in lysis buffer (10 mM Tris-HCl (pH 7.5),100 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% deoxycholate sodium, 0.1% SDS, and protease inhibitor) from peripheral B cells after positive selection with Dynabeads CD19 (Dynal France, Compiegne, France). Two dilutions of each sample were loaded on 10% SDS-polyacrylamide gels. The proteins were blotted onto Hybond-P membranes (Amersham Pharmacia Biotech, Les Ullis, France) and probed with anti-DM Ab (5C1Ab kindly provided by P. Creswell, Yale University, New Haven, CT) and anti-ß-actin Ab (clone AC-15 from Sigma-Aldrich, St. Quentin, France), followed by HRP-conjugated goat anti-mouse IgG (Immunotech, Marseille, France) and developed using an enhanced chemiluminescence (ECL+Plus) kit (Amersham Pharmacia Biotech). The membranes were stripped and reprobed with an anti-DR Ab (DA6.147) and anti-ß-actin Ab, followed by HRP-conjugated goat anti-mouse IgG and revealed by an ECL+Plus kit. The films were scanned and quantitated using NIH Image software.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Polymorphism in HLA-DM regulatory regions

We sequenced the proximal regulatory regions of the HLA-DM genes from 106 healthy individuals by direct sequencing of the PCR products to characterize both haplotypes and potential heterozygous positions. A nucleotide polymorphism was found in the regulatory regions of these genes. Concerning the HLA-DMA gene, the similarity between the various sequences was found to be higher than 99%. Only two individuals displayed one substitution at position -292 in regard to the ATG initiation codon (substitution of a guanine by an adenine). This substitution does not map to a consensus regulatory element and is located upstream of the described regulatory motifs. Concerning the HLA-DMB gene, we described two nucleotide variations, one at position -168 and the other one at position -232 in regard to the ATG initiation codon. In both cases, substitutions of a cytosine by a thymine were observed. The substitution at position -168 maps to a putative NF-B-binding site, and the substitution at position -232 is located between the Y regulatory motif and this B site. These two substitutions were found to be independent from each other, leading to the description of three HLA-DMB promoter alleles (Fig. 1). We did not find any homozygous individuals for any of the substitutions observed.

View larger version (32K): [in this window] [in a new window]   FIGURE 1. Alignment of the HLA-DMA and -DMB regulatory sequences. The consensus motifs: B, S, J, X1, X2, CAAT, Sp1, and Y motifs are in boxes. The position of the substitution refers to the ATG initiation codon, and the primers sequences are underlined.

All of the individuals carrying the substitution at position -292 of the DMA gene were HLA-DMA*0101/0102 (Table II). Given that HLA-DMA*0102 allelic frequency is 10% in the general population, the relative overrepresentation of this allele suggests that the HLA-DMA*0102 haplotype carries the substitution. In the same way, the allelic frequency of the HLA-DMB*0103 allele in the population is 18% and was found in all nine individuals presenting the substitution at position -168 of the HLA-DMB gene (Table II). This observation suggests that the HLA-DMB*0103 haplotype carries the substitution at position -168. The HLA-DMB*0101 allele was present in four subjects carrying the substitution at position -232 (Table II). Two of them were homozygous for the coding sequence strengthening the association between this substitution and the HLA-DMB*0101 allele. Thus, the HLA-DMB*0101 gene can be under the control of the wild type (wt) as well as the mutated regulatory sequence. This observation is also true for the other haplotypes described since the allelic frequency of the regulatory region polymorphism is weaker than the one of the coding sequence. These various haplotypes are strongly suggested on the basis of the overrepresentation of certain HLA-DM alleles but we cannot exclude the possibility that various coding sequences can be associated with the substitutions described in the promoter regions. Interestingly, HLA-DMA*0103 that is found more frequently in the RA population (31) is not associated with any of the promoter substitutions. This provides a possible explanation for the absence of association between RA and a particular promoter polymorphism.

It is well established now that mutations in regulatory regions can have important consequences on the transcriptional level of downstream genes. Transient transfection experiments have identified the HLA-DM proximal promoter regions as responsible for their transcriptional activity (20, 21). Thus, the substitutions observed in HLA-DM regulatory regions, and especially the substitution found in the B site of the HLA-DMB promoter, could potentially induce variation of gene expression. To test the transcriptional activity of the different HLA-DM genes regulatory region sequences, we cloned the various sequences upstream of the luciferase reporter gene and transfected Daudi, IFN--treated, and nontreated HeLa cell lines with the various constructions. We tested two constructions for the DMA regulatory sequences: DMA wt for the sequence found in the database and DMA -292A for the sequence with the G to A substitution at position -292; and three constructions for the DMB regulatory sequences: DMB wt for the sequence found in the database, DMB -168T for the sequence with the C to T substitution at position -168 affecting the putative B site, and DMB -232T for the regulatory sequence with the C to T substitution at position -232.

Results of the various transfection experiments in Daudi cell line are shown in Fig. 2A. The relative transcriptional activities for the various constructions were compared as a mean from at least five independent experiments. The transcriptional activity of the two DMA regulatory sequences was five times higher than the HLA-DMB ones. The DMA -292A construct displayed the same transcriptional activity as DMA wt. The same result was observed with the DMB -232T and DMB wt constructs. These data suggest that the substitutions at positions -292 of the HLA-DMA and -232 of the HLA-DMB promoters do not have any consequence on the basal transcriptional activity of these genes in vitro. However, the DMB -168T construction showed a 50% decrease in transcriptional activity compared with the DMB wt construct, suggesting that the substitution in the B site has important functional consequences on the basal transcriptional activity of the HLA-DMB gene in vitro.

View larger version (26K): [in this window] [in a new window]   FIGURE 2. Functional consequences of the polymorphism of the HLA-DMA and –DMB regulatory regions on transcriptional activity. The description of the various HLA-DM constructs are given in the text. The LTR construct used as a positive control contains the long terminal repeat promoter of HIV-1 upstream of the luciferase gene and the PGL3 construct corresponds to the empty vector. A, Basal transcriptional activity in B cells. Relative luciferase activities are expressed as the mean ± SD (n = 5). B, Relative level of induction by IFN- in HeLa cells. Fold inductions were calculated as relative luciferase values of IFN--treated vs untreated cells and are expressed as the mean ± SD of five different experiments.

Taken together, these results suggest that the constitutive and IFN--induced expression of the HLA-DMB genes could vary according to the polymorphism of their regulatory sequence.

The wild-type and mutated B sites of the HLA-DMB promoter are functional in vitro

Since the substitution at position -168 of the HLA-DMB regulatory region affects a potential binding site of the NF-B transcriptional factor family and because of its functional consequences on both basal and inducible transcriptional activities, we investigated by gel shift experiments the in vitro NF-B-binding ability of the two HLA-DMB B sites. These two sites, termed DMB-C (wt sequence) and DMB-T (with the substitution), were tested for their ability to inhibit the NF-B-binding activity obtained from B-EBV nuclear extracts to the functional B site of the IL-2 receptor -chain gene (B IL-2R_wt) (Fig. 3A) (35). An excess of the unlabeled DMB-C or DMB-T oligonucleotides (50–200 times) was able to compete the protein binding to the B IL-2R_wt probe. This binding inhibition was as efficient as the competition with the unlabeled B IL-2R_wt oligonucleotide. The specificity of this competition was confirmed by showing that a nonspecific competitor or a mutated B sequence (B IL-2R_mut), containing three mutations disrupting the binding site, was not able to compete the NF-B binding. These experiments strongly suggest that the wt and mutated B sites of the HLA-DMB regulatory regions are both functional in vitro.

View larger version (70K): [in this window] [in a new window]   FIGURE 3. In vitro protein-binding capacity of the different HLA-DMB B sites with nuclear extracts from the Daudi cell line. A, Competition of the NF-B binding to the IL2-R B site (B IL-2Rwt). Various quantities of DNA competitor (excess of 50 or 200 times) were added to the reactions. The competitor oligonucleotides were B IL-2Rwt oligonucleotide, B IL-2Rmut oligonucleotide containing three mutations that disrupt the binding site, DMB-C and DMB-T oligonucleotides corresponding to the DMB B sites, and an irrelevant oligonucleotide (NS, nonspecific). B, Supershift experiments on the binding to the IL2-R and HLA-DMB B sites with anti-p50, anti-p65, and anti-RFX5 Abs. Supershift bands are indicated by triangles.

Fig. 3B

Quantification of HLA-DM and DR transcripts in controls and RA patients

To investigate the variability of HLA-DM expression, as well as to compare the level of expression in controls and RA patients, we performed semiquantitative RT-PCR analysis on HLA-DM transcripts from peripheral B lymphocytes isolated from 7 healthy individuals and 10 RA patients. The polymorphism of the regulatory regions of the HLA-DM genes from all individuals was determined by sequencing. Only one RA patient displays a polymorphism in the regulatory region of the HLA-DMB gene (substitution at position -232). The quantification of the HLA-DM transcripts was normalized using the GAPDH transcripts and the HLA-DM:GAPDH ratios were compared for the various individuals (Fig. 4A). First, we observed similar levels of HLA-DMA and -DMB transcripts within each population with a weak variability leading to a homogenous group of values. Mean values of the HLA-DMA:GAPDH ratio were 1.4 ± 0.2 for controls (n = 3) and 0.5 ± 0.2 for RA patients (n = 5). We compared the mean values using the unpaired t test, and the difference between controls and RA appeared to be extremely significant (p = 0.0007). Concerning the HLA-DMB:GAPDH ratios, the means values were 1.3 ± 0.2 for controls (n = 7) and 0.5 ± 0.2 for RA patients (n = 10). The difference between RA and controls was also extremely significant (p < 0.0001). To determine the specificity of the results observed for RA, a third group containing five patients suffering from non-autoimmune inflammatory rheumatism (ankylosing spondylitis, AS) was included in this study. Mean value of the HLA-DMA:GAPDH ratio for AS patients was 1 ± 0.2 (n = 4). The difference between controls and AS was not significant (p = 0.0632), whereas the difference between RA and AS was considered very significant (p = 0.0021). Mean value of the HLA-DMB:GAPDH ratio for AS patients was 1 ± 0.2 (n = 5). The difference between controls and AS patients was not significant (p = 0.0562), in contrast to the difference between RA and AS patients that was extremely significant (p = 0.0002).

View larger version (28K): [in this window] [in a new window]   FIGURE 4. Down-regulation of HLA-DM transcripts in RA. A, Quantification of HLA-DMA and -DMB transcripts by semiquantitative RT-PCR. The ratios of fluorescence intensities for DM and GAPDH transcripts are indicated with means and SD in each group (see text for details). The differences of the mean values were compared according to the unpaired t test and the p values are indicated. B, Quantification of HLA-DRB transcripts by competitive RT-PCR in controls and RA patients. The ratios between DRB and GAPDH cDNAs are represented with means and SD in each group. C, Calculated DMB:DRB ratios.

HLA class II genes are usually known to be coordinately expressed. To see whether the HLA-DR genes were also down-regulated, we investigated the HLA-DRB expression using quantitative RT-PCR as previously described (33). The quantification of the HLA-DRB transcripts was normalized to the GAPDH transcripts and the HLA-DRB:GAPDH ratios were compared for the various individuals (Fig. 4B). Mean values of the HLA-DRB:GAPDH ratios were 0.5 ± 0.06 (n = 6) for controls and 0.6 ± 0.2 for RA patients (n = 10). The relative HLA-DRB expression was found to be similar between RA and controls; however, the SD of the values was higher in the RA population.

An arbitrary DM:DR ratio was calculated for the two populations as illustrated in Fig. 4C. This ratio was found to be three times higher in controls than in RA patients (2.8 ± 0.5 for controls vs 1 ± 0.6 for RA). As the HLA-DRB expression is similar in the two populations, the difference of the DM:DR ratios observed reflects the HLA-DM down-regulation in RA patients. This difference was considered to be extremely significant using the unpaired t test (p < 0.0001). These results strongly suggested a specific HLA-DM down-regulation in RA patients.

Quantification of HLA-DM and DR protein levels in controls and RA patients

The expression of the HLA-DM molecules has been reported to be directly correlated to the level of the transcripts (16). To investigate the variability of the HLA-DM protein levels in RA patients, we quantified the DM protein by Western blot analysis of total cell lysate from B lymphocytes isolated from 12 RA and 10 controls. The blots were probed with anti-DM and anti-ß-actin Abs (Fig. 5A), stripped, and reprobed with anti-DR and anti-ß-actin Abs (Fig. 5B). The ß-actin expression was detected to check the relative protein quantity loaded on the gel and to compare the HLA-DM and -DR protein levels between the various individuals. Because of the short linearity of the signal emission in Western blot experiments, we cannot normalize the DM and DR expression to ß-actin for all of the individuals tested on the various gels. Thus, we performed numerous experiments to gather individual results obtained with the same hybridization and revelation conditions. Gels representative of all of the results obtained for HLA-DM and -DR protein expression are shown in Fig. 5. In Fig. 5A, the two gels showed clearly a down-expression of the DM protein in RA patients. Intensities of the signal were quantitated using NIH image software and the ratio between DM and ß-actin were compared for the various individuals (Table III). Considering the data obtained from the various gels in the range of signal linearity, we detected a 1.5- to 4-fold lower DM expression in RA patients compared with controls. The DR protein expression was found to be slightly affected or unchanged in RA patients. Indeed, some of the RA patients showed no variation of DR expression (Fig. 5B and Table III: compare a/b to c/d and also j to l), whereas others displayed a weaker (compare j to k and also e/f to g/h) or higher (compare i to k/l) DR expression.

View larger version (50K): [in this window] [in a new window]   FIGURE 5. Down-regulation of HLA-DM protein expression in RA. A, Comparison of the HLA-DM protein expression between controls (C) and RA patients (RA). Two dilutions of protein samples were loaded on the gels (labeled 1:2 and 1:1). The protein was revealed by an anti-DM Ab (5C1) and an anti-ß-actin Ab to check the relative protein quantity loaded on the gels. The two gels shown are representative of the results obtained for all controls and RA patients tested. B, Comparison of the DR protein expression between controls and RA patients. The same gels were reprobed with an anti-DR Ab (DA6.174) and the same anti-ß-actin Ab. Three gels representative of the results obtained for all individuals are shown. One dilution of the samples is represented and the individuals are labeled (a–l). The same individuals (a–g) are shown in A and B.

View this table: [in this window] [in a new window]   Table III. Intensities of the signal obtained in Western blot experiments shown in Fig. 51

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
HLA-DM is able to affect the peptide repertoire bound to HLA class II molecules mainly by two ways: 1) HLA-DM acts as a peptide editor, selecting high-intrinsic kinetic stability class II-peptide complexes for presentation on the cell surface, and (2) HLA-DM keeps empty class II-binding grooves suitable for peptide loading at low lysosomal pH even when a low amount of peptide is available (36). It is reasonable to assume that the efficiency of the editing process is dependent on numerous factors, such as the amount of foreign or self peptide available for peptide loading, the ratio of high- vs low-intrinsic kinetic stability class II-peptide complexes, the pH, the relative amount of HLA-DM in the respective compartment of APC compared with the total amount of class II molecules, the residence time of class II molecules in HLA-DM-positive compartments, and also the HLA-DR allele (18). The action of the HLA-DM molecule is dose dependent (37), suggesting that a variation of the HLA-DM gene expression would have important consequences on the peptide repertoire bound to HLA class II molecules and presented to CD4⁺ T cells (19).

We described in this study for the first time a nucleotide polymorphism in the regulatory regions of the HLA-DM genes. One substitution was observed 292 bp upstream of the ATG initiation codon in the regulatory region of the HLA-DMA gene, and two substitutions were found in the HLA-DMB regulatory regions (at positions - 168 and -232 in regard to the ATG initiation codon), leading to the description of respectively two and three different regulatory sequences for the HLA-DMA and -DMB genes. This polymorphism has a frequency of <3% in the general population. It seems to be preferentially associated with certain HLA-DM alleles. To entirely eliminate a possible influence of linkage disequilibrium between alleles at the DM locus and RA-associated DRB1 alleles, the control population was chosen as a group of HLA-DRB1-matched controls. The allelic frequencies of the described alleles are not statistically different between RA and control populations.

We also investigated the in vitro functional consequences of the nucleotide substitutions described on the transcriptional activity using a reporter system assay. The polymorphism of the HLA-DMA regulatory region did not affect the basal transcriptional activity in the B-EBV lymphoblastoid cell line nor the IFN- induction in HeLa cell lines. By contrast, the substitution in the HLA-DMB regulatory region at position -232 was found to be responsible for a 20% decrease in the IFN- induction in HeLa-treated cells, without affecting the basal transcriptional activity in the Daudi cell line. Furthermore, the substitution at position -168 of the HLA-DMB regulatory region, located in a putative NF-B-binding site, was found to be responsible for a 50% decrease in transcriptional activity in both conditions (basal and IFN- induction). To further analyze the consequence of this substitution, we evaluated the in vitro protein-binding ability of the HLA-DMB wt vs mutated B sites. These two B sites were found to be functional in vitro, with similar binding ability for all nuclear extracts tested (Daudi, IFN--treated or nontreated HeLa cell lines). The differences in transcriptional activity observed in transfection experiments could not be explained by the NF- B-binding properties of the different HLA-DMB B sites. Nevertheless, the polymorphism found in the proximal regulatory regions of the HLA-DMB genes is responsible for variations in transcriptional activity and IFN- inducibility in vitro and could be responsible for variation of HLA-DM gene expression in vivo.

We evaluated the variability of HLA-DM and -DR expression in control and RA populations by semiquantitative or competitive RT-PCR as well as Western blot experiments. We observed similar levels of HLA-DMA and -DMB transcripts within each population, with a weak variability for each group of values. In the RA population, we observed an underexpression of HLA-DM with a highly significant difference between the RA and control population. This underexpression seems to be specific for RA patients, or at least an autoimmune situation, since the HLA-DM transcript expression appeared to be normal in the inflammatory arthritis group. The down-regulation observed could not be the consequence of DM promoter polymorphism since only one RA patient carries a substitution at position -232 in the HLA-DMB regulatory region. This substitution does not affect the HLA-DMB transcriptional activity in vitro as it is demonstrated in the first part of this study. HLA-DM is specifically down-regulated in RA since the HLA-DR expression appeared to be not or slightly affected. An arbitrary DM:DR ratio was found to be three times higher in controls than in RA patients, confirming the specific DM down-regulation in RA patients. We investigated the HLA-DR and -DM protein expression and confirmed the DM down-regulation at the protein level. These data suggest that disease specific transcriptional or posttranscriptional regulatory mechanisms are involved in HLA-DM gene expression in RA.

To see whether the reduced expression of DM molecules could be due to the treatment, we examine drug regimens of the RA patients. All of the patients studied received either various treatments (methotrexate, cyclosporine, sulfalazine, corticoids, hydroxychloroquine) or no treatment (one patient in remission), suggesting that the underexpression observed is not a consequence of the treatment. This argument is supported by the fact that similar treatments (sulfalazine and corticoid) were given to the four AS patients without any consequence on the HLA-DM expression. Another explanation for this down-regulation could be the activation state of the peripheral B cells from RA patients. To rule out this hypothesis, the expression of B cell activation markers (CD23, CD5, CD80, CD86, CD69, CD71, CD95, and CD25) was compared between controls and RA patients. An increase of CD23-positive B cells and a decrease of CD5-positive B cells were found in RA patients with active disease compared with controls (data not shown). No differences in the expression of CD23 and other activation markers were found between controls and patients with nonactive disease, although all patients displayed a low expression of HLA-DM molecules.

Even if HLA-DM genes are usually considered to be coexpressed and coregulated with classical HLA class II genes, this study demonstrated a specific underexpression of HLA-DM transcripts and protein in RA. The non-coordinate regulation of HLA-DM and -DR genes has been previously described in a mutant cell line (38) and suggests that beside the basic coregulation within the classical class II genes, some mechanisms could be more specific for HLA-DM genes. HLA-DM and -DR molecules are colocalized in the class II peptide-loading compartment in a 1:5 ratio (15, 39). The down-regulation of the HLA-DM molecule observed in RA could be responsible for a decreased amount and function of HLA-DM in this compartment. If the down-regulation observed is restricted to the periphery, the diversity of the peptide repertoire presented by HLA class II molecules would be broader than in the thymus, leading to the potential activation of autoreactive T cell clones in periphery that would not have been deleted during the negative selection. This hypothesis agrees with the description of a higher number of autoreactive T cell clones in RA (40).

The modification of the MHC class II-bound peptides could be monitored by several approaches. A widely used parameter to determine the intrinsic kinetic stability of the MHC class II-peptide complex is to study the stability of the complex in SDS (41). Another possibility would be to investigate the level of expression of the class II-CLIP complexes at the cell surface; however, the DRB1*0401 molecule associated with RA has been demonstrated to release CLIP independently of the DM molecule. The last approach will be the elution of the peptide-bound HLA class II molecule with the comparison of the peptide profile according to the level of HLA-DM expression.

Beside the role of HLA-DM as peptide editor, this molecule is able to keep empty class II-binding grooves in a suitable conformation for peptide loading at low lysosomal pH. The HLA-DRB1*0401 molecule, associated with RA, has a low-intrinsic stability and thus exhibits a high dependency on HLA-DM to prevent its aggregation and denaturation (15). In the absence of HLA-DM, beside the possibility that the class II molecules would be stabilized by low-kinetic stability peptides, it is possible that the DRB1*0401 molecule would be chaperoned by other molecules like heat shock protein. This hypothesis has already been suggested after the demonstration that the DRB1*0401 molecule interacts with the constitutive 70-kDa heat shock protein, directly targeting the HLA class II molecules to lysosomes (42). Recently, the involvement of the heat shock cognate protein 73 in MHC class II Ag presentation had been confirmed by another group (43).

In conclusion, we demonstrated a polymorphism of the regulatory regions of the HLA-DM genes with functional consequences on their transcriptional activities, and our present work brings evidence for a specific down-regulation of HLA-DM RNA and protein expression in RA. The molecular basis of this down-regulation is unknown and even if it is just a secondary event due to autoimmune and/or other processes, this underexpression, observed in the peripheral blood B cells from RA patients, may have important consequences on the Ag presentation.

	Acknowledgments

 
We thank O. Avinens and K. Foucher for technical assistance with HLA class II and HLA-DM typing and B. Kahn Perles, J. Imbert, and M. Benkirame for providing oligonucleotides, anti-p65-specific Abs, and helpful discussion concerning the NF-B-binding experiments. We also thank P. Cresswell for providing 5C1 Ab and N. Mechti for providing HeLa and Daudi cell lines and for giving helpful advice concerning transfection experiments.

	Footnotes

 
¹ This work was supported in part by Association pour la Recherche sur la Polyarthrite, and La Société Française de Rhumatologie.

² Accession numbers of the sequences described in this paper are registered with the European Molecular Biology Laboratory: AJ249712, AJ249713, and AJ249714.

³ S.K.-C and J.M. contributed equally to this work.

⁴ Address correspondence and reprint requests to Dr. Jean-François Eliaou, Laboratoire d’Immunologie, Hôpital Saint-Eloi, 34295 Montpellier, Cedex 5, France.

⁵ Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated Ii peptide; RA, rheumatoid arthritis; AS, ankylosing spondylitis; wt, wild type.

Received for publication December 8, 1999. Accepted for publication August 1, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Germain, R. N., F. Castellino, R. Han, C. Reis e Sousa, P. Romagnoli, S. Sadegh-Nasseri, G-M. Zhong. 1996. Processing and presentation of endocytically acquired protein antigens by MHC class II and class I molecules. Immunol. Rev. 151:5.[Medline]
2. Roche, P. A., P. Cresswell. 1990. Invariant chain association with HLA-DR molecules inhibits immunogenic peptide binding. Nature 345:615.[Medline]
3. Bakke, O., B. Dobberstein. 1990. MHC class II-associated invariant chain contains a sorting signal for endosomal compartments. Cell 63:707.[Medline]
4. Lamb, C. A., J. W. Yewdell, J. R. Bennink, P. Cresswell. 1991. Invariant chain targets HLA class II molecules to acidic endosomes containing internalized influenza virus. Proc. Natl. Acad. Sci. USA 88:5998.[Abstract/Free Full Text]
5. Avva, R. R., P. Cresswell. 1994. In vivo and in vitro formation and dissociation of HLA-DR complexes with invariant chain-derived peptides. Immunity 1:763.[Medline]
6. Urban, R. G., R. M. Chicz, J. L. Strominger. 1994. Selective release of some invariant chain-derived peptides from HLA-DR1 molecules at endosomal pH. J. Exp. Med. 180:751.[Abstract/Free Full Text]
7. Kropshofer, H., A. B. Vogt, L. J. Stern, G. J. Hammerling. 1995. Self-release of CLIP in peptide loading of HLA-DR molecules. Science 270:1357.[Abstract/Free Full Text]
8. Kropshofer, H., A. B. Vogt, G. J. Hammerling. 1995. Structural features of the invariant chain fragment CLIP controlling rapid release from HLA-DR molecules and inhibition of peptide binding. Proc. Natl. Acad. Sci. USA 92:8313.[Abstract/Free Full Text]
9. Morris, P., J. Shaman, M. Attaya, M. Amaya, S. Goodman, C. Bergman, J. J. Monaco, E. Mellins. 1994. An essential role for HLA-DM in antigen presentation by class II major histocompatibility molecules. Nature 368:551.[Medline]
10. Fling, S. P., B. Arp, D. Pious. 1994. HLA-DMA and -DMB genes are both required for MHC class II/peptide complex formation in antigen-presenting cells. Nature 368:554.[Medline]
11. Denzin, L. K., P. Cresswell. 1995. HLA-DM induces CLIP dissociation from MHC class II ß dimers and facilitates peptide loading. Cell 82:155.[Medline]
12. Vogt, A. B., H. Kropshofer, G. Moldenhauer, G. J. Hammerling. 1996. Kinetic analysis of peptide loading onto HLA-DR molecules mediated by HLA-DM. Proc. Natl. Acad. Sci. USA 93:9724.[Abstract/Free Full Text]
13. Sloan, V. S., P. Cameron, G. Porter, M. Gammon, M. Amaya, E. Mellins, D. M. Zaller. 1995. Mediation by HLA-DM of dissociation of peptides from HLA-DR. Nature 375:802.[Medline]
14. Sherman, M. A., D. A. Weber, P. E. Jensen. 1995. DM enhances peptide binding to class II MHC by release of invariant chain-derived peptide. Immunity 3:197.[Medline]
15. Kropshofer, H., S. O. Arndt, G. Moldenhauer, G. J. Hammerling, A. B. Vogt. 1997. HLA-DM acts as a molecular chaperone and rescues empty HLA-DR molecules at lysosomal pH. Immunity 6:293.[Medline]
16. Ramachandra, L., S. Kovats, S. Eastman, A. Y. Rudensky. 1996. Variation in HLA-DM expression influences conversion of MHC class II ß: class II-associated invariant chain peptide complexes to mature peptide-bound class II ß dimers in a normal B cell line. J. Immunol. 156:2196.[Abstract]
17. Kropshofer, H., A. B. Vogt, G. Moldenhauer, J. Hammer, J. S. Blum, G. J. Hammerling. 1996. Editing of the HLA-DR-peptide repertoire by HLA-DM. EMBO J. 15:6144.[Medline]
18. Vogt, A. B., H. Kropshofer, G. J. Hammerling. 1997. How HLA-DM affects the peptide repertoire bound to HLA-DR molecules. Hum. Immunol. 54:170.[Medline]
19. Singh, N., L. Van Kaer. 1999. Unexpected reactivities of T cells selected by a single MHC-peptide ligand. J. Immunol. 163:3583.[Abstract/Free Full Text]
20. Westerheide, S. D., P. Louis-Plence, D. Ping, X. F. He, J. M. Boss. 1997. HLA-DMA and HLA-DMB gene expression functions through the conserved S-X-Y region. J. Immunol. 158:4812.[Abstract]
21. Ting, J. P., K. L. Wright, K. C. Chin, W. J. Brickey, G. Li. 1997. The DMB promoter: delineation, in vivo footprint, trans-activation, and trans-dominant suppression. J. Immunol. 159:5457.[Abstract]
22. Kern, I., V. Steimle, C. A. Siegrist, B. Mach. 1995. The two novel MHC class II transactivators RFX5 and CIITA both control expression of HLA-DM genes. Int. Immunol. 7:1295.[Abstract/Free Full Text]
23. Shewey, L. M., J. S. Beaty, L. C. Andersen, G. T. Nepom. 1992. Differential expression of related HLA class II DQ ß genes caused by nucleotide variation in transcriptional regulatory elements. J. Immunol. 148:1265.[Abstract]
24. Andersen, L. C., J. S. Beaty, J. W. Nettles, C. E. Seyfried, G. T. Nepom, B. S. Nepoom. 1991. Allelic polymorphism in transcriptional regulatory regions of HLA-DQB genes. J. Exp. Med. 173:181.[Abstract/Free Full Text]
25. Louis, P., R. Vincent, P. Cavadore, J. Clot, J. F. Eliaou. 1994. Differential transcriptional activities of HLA-DR genes in the various haplotypes. J. Immunol. 153:5059.[Abstract]
26. Perfetto, C., M. Zacheis, D. McDaid, J. W. Meador, B. D. Schwartz. 1993. Polymorphism in the promoter region of HLA-DRB genes. Hum. Immunol. 36:27.[Medline]
27. Teyton, L., V. Lotteau, P. Turmel, F. Arenzana-Seisdedos, J. L. Virelizier, J. P. Pujol, G. Loyau, D. Piatier-Tonneau, C. Auffray, D. J. Charron. 1987. HLA DR, DQ, and DP antigen expression in rheumatoid synovial cells: a biochemical and quantitative study. J. Immunol. 138:1730.[Abstract]
28. Eliaou, J. F., M. Andary, F. Favier, P. Carayon, P. Poncelet, J. Sany, J. Brochier, J. Clot. 1988. Increase of class II HLA molecules on the membrane of B lymphocytes from patients with rheumatoid arthritis. Autoimmunity 1:217.[Medline]
29. Stasny, P.. 1978. Association of the B-cell alloantigen DRw4 with rheumatoid arthritis. N. Engl. J. Med. 298:869.[Abstract]
30. Winchester, R.. 1994. The molecular basis of susceptibility to rheumatoid arthritis. Adv. Immunol. 56:389.[Medline]
31. Pinet, V., B. Combe, O. Avinens, S. Caillat-Zucman, J. Sany, J. Clot, J. F. Eliaou. 1997. Polymorphism of the HLA-DMA and DMB genes in rheumatoid arthritis [see comments]. Arthritis Rheum. 40:854.[Medline]
32. Radley, E., R. P. Alderton, A. Kelly, J. Trowsdale. 1994. Genomic organization of HLA-DMA and -DMB: comparison of the gene organization of all six class II families in the human major histocompatibility complex. J. Biol. Chem. 269:18834.[Abstract/Free Full Text]
33. Vincent, R., P. Louis, C. Gongora, I. Papa, J. Clot, J. F. Eliaou. 1996. Quantitative analysis of the expression of the HLA-DRB genes at the transcriptional level by competitive polymerase chain reaction. J. Immunol. 156:603.[Abstract]
34. Louis-Plence, P., C. S. Moreno, J. M. Boss. 1997. Formation of a regulatory factor X/X2 box-binding protein/nuclear factor-Y multiprotein complex on the conserved regulatory regions of HLA class II genes. J. Immunol. 159:3899.[Abstract]
35. Kahn-Perlès, B., C. Lipcey, P. Lécine, D. Olive, J. Imbert. 1997. Temporal and subunit-specific modulations of the Rel/NF-B transcription factors through CD28 costimulation. J. Biol. Chem. 272:21774.[Abstract/Free Full Text]
36. Vogt, A. B., H. Kropshofer. 1999. HLA-DM: an endosomal and lysosomal chaperone for the immune system. Trends Biochem. Sci. 24:150.[Medline]
37. Weber, D. A., B. D. Evavold, P. E. Jensen. 1996. Enhanced dissociation of HLA-DR-bound peptides in the presence of HLA-DM. Science 274:618.[Abstract/Free Full Text]
38. Fling, S. P., J. Rak, K. A. Muczynski, B. Arp, D. Pious. 1997. Novel mutants define genes required for the expression of human histocompatibility leukocyte antigen DM: evidence for loci on human chromosome 6p. J. Exp. Med. 186:1469.[Abstract/Free Full Text]
39. Schafer, P. H., J. M. Green, S. Malapati, L. Gu, S. K. Pierce. 1996. HLA-DM is present in one-fifth the amount of HLA-DR in the class II peptide-loading compartment where it associates with leupeptin-induced peptide (LIP)-HLA-DR complexes. J. Immunol. 157:5487.[Abstract]
40. Weyand, C. M., J. J. Goronzy. 1999. T-cell responses in rheumatoid arthritis: systemic abnormalities-local disease. Curr. Opin. Rheumatol. 11:210.[Medline]
41. Nelson, C. A., S. J. Petzold, E. R. Unanue. 1994. Peptides determine the lifespan of MHC class II molecules in the antigen-presenting cell. Nature 371:250.[Medline]
42. Auger, I., J. M. Escola, J. P. Gorvel, J. Roudier. 1996. HLA-DR4 and HLA-DR10 motifs that carry susceptibility to rheumatoid arthritis bind 70-kD heat shock proteins. Nat. Med. 2:306.[Medline]
43. Panjwani, N., O. Akbari, S. Garcia, M. Brazil, B. Stockinger. 1999. The HSC73 molecular chaperone: involvement in MHC class II antigen presentation. J. Immunol. 163:1936.[Abstract/Free Full Text]

This article has been cited by other articles:

				Q.-H. Sun, J.-P. Peng, H.-F. Xia, Y. Yang, and M.-L. Liu Effect on expression of RT1-A and RT1-DM molecules of treatment with interferon-{gamma} at the maternal--fetal interface of pregnant rats Hum. Reprod., September 1, 2005; 20(9): 2639 - 2647. [Abstract] [Full Text] [PDF]

				A. Muntasell, M. Carrascal, I. Alvarez, L. Serradell, P. van Veelen, F. A. W. Verreck, F. Koning, J. Abian, and D. Jaraquemada Dissection of the HLA-DR4 Peptide Repertoire in Endocrine Epithelial Cells: Strong Influence of Invariant Chain and HLA-DM Expression on the Nature of Ligands J. Immunol., July 15, 2004; 173(2): 1085 - 1093. [Abstract] [Full Text] [PDF]

				J. D. Lich, J. A. Jayne, D. Zhou, J. F. Elliott, and J. S. Blum Editing of an Immunodominant Epitope of Glutamate Decarboxylase by HLA-DM J. Immunol., July 15, 2003; 171(2): 853 - 859. [Abstract] [Full Text] [PDF]

				N. S. Patil, A. Pashine, M. P. Belmares, W. Liu, B. Kaneshiro, J. Rabinowitz, H. McConnell, and E. D. Mellins Rheumatoid Arthritis (RA)-Associated HLA-DR Alleles Form Less Stable Complexes with Class II-Associated Invariant Chain Peptide Than Non-RA-Associated HLA-DR Alleles J. Immunol., December 15, 2001; 167(12): 7157 - 7168. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed