| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Cancer Research Campaign Institute for Cancer Studies and Medical Research Council Centre for Immune Regulation, University of Birmingham, Edgbaston, Birmingham, United Kingdom; and
Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and
ß-chains with variable (V), diverse (D; seen in ß-chains only),
joining (J), and constant (C) regions. Several factors contribute to
TCR repertoire diversity, namely, the multiple possible V(D)J
combinations generated during TCR gene rearrangement, the random
mutations or nucleotide additions introduced at V(D)J junctions, and
the random pairings of separately rearranged - and ß-chains
(2). Individual V gene choice and in particular the
structure of the complementarity-determining region
(CDR)3 3 encoded by V(D)J
junction sequences are thought to be critical determinants of TCR
specificity (2, 3, 4). Primary virus infections, both in mouse (5, 6, 7) and the human (8, 9, 10), are often characterized by large expansions of activated CD8+ cytotoxic T cells. Within these one can find preferentially expanded Vß subsets, often with oligoclonal TCR usage (11, 12, 13, 14), implying that such proliferations are Ag driven rather than the result of bystander T cell activation. However, it is only recently that single-cell assays of MHC/peptide tetramer staining and of peptide-induced cytokine release have shown the extent to which a few viral epitope-specific reactivities can dominate the acute CD8+ population (15, 16, 17, 18). The sheer size of this primary response contrasts with the situation subsequently found in memory, where virus-specific reactivities are again detectable both by single-cell assays ex vivo and by functional analysis of in vitro reactivated T cell preparations but now at much lower frequencies.
The lineage relationship between primary and memory responses, and the factors which determine selection into the memory repertoire, remains poorly understood (19, 20). Experiments in murine model systems have mainly focused on agents such as lymphocytic choriomeningitis virus (LCMV) (11, 12, 15, 17, 21) or Listeria monocytogenes (22), which are rapidly cleared by the CTL response. In this study, the composition of specific T cell memory, in the absence of further antigenic challenge, appeared to reflect that seen in the acute primary response. However, the response to rechallenge ranged in different studies from no detectable change between primary and secondary effector populations (12) to a narrowing of the original pathogen-specific repertoire (22), or to varying degrees of repertoire diversification and the emergence of new secondary clonotypes (11, 21). This latter pattern was accentuated under the unusual conditions of high-dose primary infection with the LCMV mutant c13, where failure of the immune response to control the infection was associated with rapid sequential exhaustion of virus-specific clonotypes (11). Clonotype loss has also been reported in patients undergoing primary HIV infection (23), another situation where there is overwhelming virus replication throughout the lymphoid system. Here, however, interpreting prospective change in the virus-specific CTL repertoire is complicated not only because new viral variants are continually emerging in vivo (24) but also because HIV itself targets the CD4+ T cell pool, upon which the successful maintenance of CD8+ memory is thought to depend (25).
The present work examines maturation of the human CD8+ T cell response to EBV, a genetically stable B lymphotropic agent which induces a clinically obvious primary infection with marked CD8+ T cell activation (infectious mononucleosis (IM)) but subsequently persists for life as a low-grade asymptomatic infection in balance with host immune surveillance (26). Most work in the EBV system to date has concerned CD8+ T cell responses to virus-latent cycle Ags, in particular to the EBV-encoded nuclear Ags (EBNAs) 3A, 3B, and 3C which are preferentially recognized by the memory T cell response in virus carriers (27, 28, 29). Interestingly, one of the best-studied memory responses, to the HLA-B8-restricted FLRGRAYGL epitope (designated FLR) in EBNA 3A, is characterized by a highly focused use of particular TCR clonotypes (30). This prompted studies on HLA-B8-positive IM patients showing that the same dominant clonotypes were also abundant in the primary CTL response and suggesting that the composition of the FLR-specific repertoire does not vary dramatically over time (31, 32).
Recent work has shown, however, that individual latent Ag-specific reactivities account for only a very small fraction (rarely above 1%) of the total CD8+ response in IM patients (18, 33). By contrast, reactivities to immunodominant lytic Ag-derived epitopes (34) such as the B8+-restricted RAKFKQLL epitope (designated RAK) from the immediate early lytic cycle protein BZLF1 or the A2.01-restricted GLCTLVAML epitope (designated GLC) from the early lytic cycle protein BMLF1 are at least 10-fold more abundant as visualized by tetramer staining (18). It remains to be seen 1) whether these much larger responses to lytic cycle Ags can also be dominated by just a few clonotypes and in that way explain some of the preferential Vß subset expansions seen among the CD8+ T cell pool in IM (14), and 2) if that were the case, whether highly expanded T cell clonotypes present within the primary response remain dominant in the longer term. An earlier study of in vitro-derived clones from the RAK-specific response in IM and post-IM patients indicated the involvement of a diverse range of TCRs during primary infection and persistence (35). Indeed, the overall strength of this response has been attributed to its multiclonal composition, a trend that has also been noted with some (but not all) immunodominant EBV-latent cycle epitopes (36). The present work describes a detailed clonotypic analysis of primary and memory responses to the immunodominant lytic cycle epitope GLCTLVAML (BMLF1 residues 280–288).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Patients with acute IM, identified on clinical grounds and by heterophile Ab positivity, were sampled within 7–15 days of the onset of clinical symptoms. Heparinized blood (30–60 ml/patient) was processed by standard methods (33) to prepare PBMC; one aliquot of cells was used for HLA class I genotyping, another aliquot was used to generate a lymphoblastoid cell line (LCL) by B95.8 strain EBV-induced transformation in vitro, and the remaining aliquots were placed in cryostorage until required. All patients showed a complete recovery from disease symptoms within 3–4 wk; the same individuals were rebled on a second occasion 12–40 mo later (mean interval, 26 mo) and PBMC were again prepared and cryopreserved before analysis. A healthy HLA-A2.01-positive individual CMc, who had been EBV seropositive for at least 10 years and who had no history of IM, was included as a reference donor in the analysis of GLC-specific memory.
Cell staining
The PE-conjugated HLA-A2.01/GLC peptide tetrameric complex was prepared as described previously (18). As in earlier work, the specificity of A2.01/GLC tetramer staining was confirmed by testing first on reference GLC-specific T cell clones vs control clones specific for other A2.01-restricted EBV epitopes and second on reference PBMC from A2.01-positive EBV-seropositive donors vs control PBMC from A2.01-positive EBV-seronegative donors and A2.01-negative IM patients (18). As a further control, the IM PBMC populations tested here were shown not to stain with irrelevant tetramers, e.g., an A2.01/HIV gag epitope tetramer and other EBV epitope tetramers, including B8/RAK and B8/FLR tetramers (18), involving HLA class I alleles other than A2.01. For two-color staining, 106 PBMC were incubated on ice for 30 min in PBS + 0.1% BSA + 0.1% sodium azide containing 0.5 µg/ml PE-conjugated tetramer and saturating amounts of a Tricolor-conjugated anti-CD8 mAb (mAb, isotype IgG2a; Caltag, South San Francisco, CA). For three-color staining, the above samples were additionally incubated on ice for another 30 min with one of a panel of anti-human Vß-chain mAbs (Immunotech, Marseille, France): E2.2E7.2 (Vß2-specific, IgG1), TAMAYA1.2 (Vß16-specific, IgG1), BA62.6 (Vß18-specific, IgG2b), and IMMU546 (Vß22-specific, IgG1). Of these, the Vß16- and Vß22-specific mAbs were directly FITC conjugated, whereas binding of the unconjugated Vß2- and Vß18-specific mAbs was detected using a FITC-labeled goat anti-mouse Ig isotype Ab (Southern Biotechnology Associates, Birmingham, AL). Parallel studies with the same set of Vß subset-specific mAbs, in combination with the anti-CD8 mAb, have been conducted on PBMC from a panel of 20 healthy control donors to establish mean values (±SD) for percent Vß representation within the circulating CD8+ T cell pool; the relevant values were 5.01 ± 2.09% for Vß2, 0.69 ± 0.3% for Vß16, 0.27 ± 0.43% for Vß18, and 2.62 ± 1.02% for Vß22 (J. Faint, unpublished observations). Some studies also included staining with a recently developed Vß4-specific mAb (IgM, kindly provided in FITC-conjugated form by F. Romagne, Immunotech). Note that before the analysis of double- or triple-stained PBMC samples, the flow cytometer was carefully color-compensated using aliquots of the same PBMC singly labeled with PE-conjugated or FITC-conjugated anti-CD4 mAbs (Becton Dickinson, San Jose, CA) or with the Tricolor-conjugated anti-CD8 mAb. Then the quadrant boundaries were set using aliquots of the same PBMC stained with the relevant isotype-matched control mAbs (Dako, Cambridge, U.K.) either directly or indirectly labeled as appropriate.
Preparation and functional analysis of CTL clones
Primary CTL clones were established either by limiting dilution of thawed IM PBMC directly into IL-2-enriched medium at 0.3 and 3 cells/0.2-ml round-bottom well as previously described (33) or by FACS of GLC tetramer-positive cells directly into 96-well plates at 1 cell/well in the presence of irradiated preactivated allogeneic PBMC feeders (106/ml) with irradiated autologous LCL cells (105/ml). Growing microcultures were further expanded by transfer into 2-ml wells using the same stimulation protocol as before. Feeder cells were from pooled fresh buffy coats (National Blood Service, Birmingham, U.K.) and were incubated with PHA at 10 µg/ml for 1 h and then washed five times before irradiation and use. Memory CTL clones were established using the optimal protocol for peptide-induced reactivation of human T cell memory originally developed for the EBV system by Lalvani et al. (37) and subsequently confirmed as the most efficient means of accessing the GLC-specific response (N. E. Annels, unpublished observations); note that for CTL memory to an EBV-lytic cycle epitope such as GLC, the epitope peptide is a much more effective in vitro stimulus than are latently infected LCL cells. Thus, PBMC from post-IM donors and from the reference donor CMc were exposed to the synthetic peptide GLCTLVAML at the optimal concentration of 100 µg/ml (37) and, after a 2-h incubation at 37°C in 5% CO2, seeded at 2 x 106/ml in IL-7-conditioned medium. Recombinant IL-2 was added at 10 U/ml on day 3, after which limiting dilution cloning was conducted as above. Procedures for peptide synthesis and solution in DMSO were as previously described.
CTL clones specific for the GLC epitope were identified by the functional analysis in standard chromium release cytotoxicity assays. The target cells were autologous or HLA-A2-matched LCL pretreated with 0.2 µg/ml GLC peptide or, as a control, with an equivalent concentration of DMSO solvent, and preinfected with a recombinant vaccinia virus vacc-BMLF1 expressing the BMLF1-lytic cycle Ag from with the epitope is derived or, as a control, with the vacc-TK-recombinant (34).
Molecular cloning and sequencing of TCR and ß-chains
mRNA was extracted from T cell clones with confirmed GLC
specificity using Tri Reagent (Boehringer Mannheim, Indianapolis, IN).
cDNA was synthesized, tailed with poly(G), and used as a template in
anchored PCR containing a 3' C primer containing a SalI
site (TGACCGCAGTCGACAGACTTGTCACTGGATT) or a 3' Cß primer
containing a SalI site
(ATACTGGAGTCGACGGAGATCTCTGCTTCTGATG) and a 5' poly(C)
primer containing a NotI site
(GCATTCAGCTGCGGCCGCCCCCCCCCCCCCCCC). The PCR conditions were 94°C
for 4 min, followed by 5 cycles of 94°C for 1 min, 65°C for 1 min,
and 72°C for 2 min, followed by 30 cycles of 94°C for 1 min, 58°C
for 1 min, and 72°C for 2 min. The DNA product was cloned into a
Phagescript M13 vector (Stratagene, La Jolla, CA). After transformation
of Escherichia coli (strain XL1 blue MRF'), plaques
containing inserts were sequenced. Only those clones found to express a
single - and/or ß-chain were included in the study. The
nomenclature used for the TCR elements is as described by Arden et al.
(38).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The clonotypic composition of the primary GLC epitope-specific response was studied by in vitro cloning from three HLA-A2.01-positive IM patients, IM74, IM61, and IM69. Each of these had a marked elevation of CD8+ T cell counts in the blood and had shown functional evidence of GLC-specific cytotoxicity when PBMC taken at the acute stage of the disease were tested immediately ex vivo on GLC peptide-loaded targets (34). The same three individuals were also sampled on a second occasion over 2 years later, long after the resolution of the disease, and the GLC-specific memory T cell repertoire again studied by cloning.
IM patient 74. IM74 was studied in the acute phase of primary infection, at a time when 5.6% circulating CD8+ T cells stained with the A2.01/GLC tetramer; in this case, GLC-specific T cell clones were established from the acute phase blood sample both by limiting dilution culture of the PBMC population and by single-cell cloning of cells FACS sorted on the basis of their staining with the A2.01/GLC tetramer. All clones were expanded by culturing on the autologous LCL and pooled allogeneic feeders in IL-2-conditioned medium, and then tested for Ag- and epitope-specific cytotoxicity on vacc-BMLF1-infected and GLC peptide-loaded target cells. A selection of nine limiting dilution clones with the relevant specificity were used for TCR analysis along with the nine clones obtained by tetramer sorting, all of which proved to be GLC specific.
Table I
gives details of TCR usage for
all 18 primary clones, showing the V and J combinations and CDR3 amino
acid sequences for both - and ß-chains of the receptor. Note that
limiting dilution and tetramer-sorted clones showed similar
distributions of TCR usage and therefore the two sets of data are
combined in Table I. The most striking feature of the results is that
three families of clonotypes dominate the primary GLC-specific response
in this patient. The most abundant family (clones 259-3.1*) typically
used an AV23S1/AJ3S2 -chain rearrangement and conserved seven amino
acid CDR3 sequences combined either with a BV16-positive, or less
frequently a BV2-positive, ß-chain with conserved nine amino acid
CDR3 sequences. A second family (clones 158-1.5*) was totally dominated
by one ß-chain combination, namely, AV2S3/AJ17S10 coupled with
BV13S3/BJ2S7, again with highly conserved CDR3 sequences in both
chains. A third smaller family (clones 80-4.2*) all expressed the same
BV1S1/BJ2S7 ß-chain structure coupled with one of two -chains.
|
A. Tetramer-reactive cells
constituted 5.6% of the CD8+ T cell pool in the
acute phase of the disease, and there was a coincident expansion of
Vß16-positive cells such that these now constituted 3.3% of the
CD8+ pool; this represents a significant increase
over the mean level of Vß16 representation in the
CD8+ pool of healthy control donors (0.69 ±
0.3%). More importantly, 23.4% of the tetramer-reactive population
was Vß16 positive, and in fact these cells constituted a substantial
fraction (almost 40%) of the whole Vß16-positive subset present in
the blood at that time (Fig. 1A, right panel).
Much of the Vß16 subset expansion within the circulating
CD8+ T cells of IM74 was therefore attributable
to the primary GLC-specific response. As an additional control, we
repeated the triple stain analysis of IM74 PBMC now using mAbs specific
for Vß2 and Vß22, subsets which in certain other patients do
dominate primary GLC-specific responses (see later) but which were
represented either sparsely (Vß2) or not at all (Vß22) among
IM74-derived primary clones. Only 10% and 7% of tetramer-reactive
cells in IM74 PBMC lay in the Vß2 and Vß22 subsets, and neither
subset was significantly expanded (Fig. 1A legend).
|
; although numbers were small,
none of these memory clones was related to any of the clonotype
families that had dominated the primary response.
IM patient 61.
A second HLA-A2.01-positive patient studied in the acute phase of the
disease, IM61, also showed a marked GLC-specific primary response,
representing 4.4% of the expanded CD8+
population by tetramer staining. Here, an analysis of TCR usage among
limiting dilution clones, detailed in Table II, showed that the bulk of the primary
response was made up of two families of clonotypes, each of which was
obviously related to the most abundant clonotype family seen in the
primary response in IM74. Thus, the first IM61 family (clones 209-63)
used an -chain which, though it involved AV15S1 rather than AV23S1,
was structurally very similar in the CDR3 region and identical in the
AJ region to that of the dominant IM74 family. Furthermore, this
-chain was combined with a ß-chain, involving BV2, which was
closely related to one seen in that same IM74 family (cf Table I,
clones 2.3* and 3.1*). The second family of IM61 clonotypes (clones
183-122) used a ß-chain which was either identical or closely related
to that of the dominant BV16-positive IM74 clones, in this case
combined with one of three different -chains. There were in addition
several other unique clonotypes displayed by isolated clones within the
primary GLC-specific response of IM61 (Table II, clones 190-157). The
results of triple staining the primary PBMC population with the
Vß16-specific mAb, the CD8-specific mAb, and the A2.01/GLC tetramer
(Fig. 1B) again showed that a significant Vß subset
expansion in IM blood could be ascribed to a component of the
epitope-specific response. Thus, tetramer-staining cells constituted
4.4% of the CD8+ T cell pool and 18.4% of
these tetramer-staining cells were Vß16 positive. This coincided with
an expansion of the total Vß16 subset (Fig. 1B) to 2.0% of the total
CD8+ pool (vs a control value of 0.69 ±
0.3%) and, as can be seen in Fig. 1B (right
panel), almost half of this enlarged Vß16-positive population
was made up of tetramer-staining cells.
|
shows the results of their TCR analysis. Only one of
these IM61 memory clones (c20) showed any relation to a dominant
primary clonotype, namely, the use of an AV15S1/AJ3S2 -chain which
was almost identical to that of primary clones 209-63 but was now
combined with a different ß-chain; three other memory clones also
used AV15S1 but without the characteristic CDR3 sequence described
above. Interestingly, however, four memory clones 72-61 all displayed a
characteristic AV3S1/AJ1S7 -chain and BV13S1/BJ2S9 ß-chain which
was highly related to a clonotype represented once (c157) in the
primary response (see Table II, italic sequences).
IM patient 69.
A third HLA-A2.01-positive IM patient, IM69, mounted a GLC-specific
primary response which by tetramer staining constituted 4.0% of the
expanded CD8 population. Here, the analysis of limiting dilution and
tetramer-sorted clones revealed the presence of one dominant clonotype
family (Table III, clones 95-7*) using
AV15-positive -chain and BV2-positive ß-chain structures that were
highly related to those dominant in the IM61 primary response (cf.
Table II, clones 209, 243, and 63). In addition, we noted several
unique clonotypes represented by single clones within the IM69 primary
response (Table III, clones 72-26*). As shown in Fig. 1C,
triple staining of the original PBMC population confirmed that
Vß2-positive cells were numerically dominant (58.6%) within the
tetramer-positive population. Again as a control, we extended the
triple staining to include mAbs specific for Vß16 and Vß22, subsets
which in other patients can dominate primary GLC-specific responses
(Fig. 1, A and B, and see later) but which were
represented either not at all (Vß16) or only once (Vß22) among
IM69-derived primary clones. Only 1 and 9%, respectively, of
tetramer-reactive cells in IM69 PBMC lay in the Vß16 and Vß22
subsets, and neither subset was significantly expanded (Fig. 1C legend).
|
. As in donor IM61, only a single memory clone
(clone 24) showed any relation to the dominant primary clonotype and
here again this involved the AV15S1/AJ3S2 -chain characteristic of
that clonotype, now combined with a different ß-chain BV22S1/BJ2S8.
However, not all components of the primary response had disappeared
(Table III, italic sequences). Thus, two individual clonotypes seen in
the acute infection (clones 72 and 13*) were again detectable as single
clonotypes with exactly the same - and ß-chain sequences in memory
(clones 14 and 18). More interestingly, the dominant family of
clonotypes found in memory (clones 23-25) used AV2S3/AJ16S5 and
BV22S1/BJ2S8 rearrangements which were either identical or very closely
related to a single clone identified in the primary response (clone
26*). Several other unique clones within memory (clones 14-30) also
used AV2S3 but now combined to AJ1S3 and with a different pattern of
CDR3 sequences; not all of these clones could be analyzed for Vß
usage and therefore they are only provisionally grouped as a second
family of related memory clonotypes in Table III.
In the case of IM69, representative clones from the primary and memory
GLC-specific repertoires could be expanded sufficiently to compare
their fine specificities when tested against a set of peptide variants
of the GLCTLVAML epitope sequence. Alanine replacement mutations were
introduced individually at positions 1–6 and 8–9 of this sequence,
and levels of variant peptide recognition were determined in
cytotoxicity assays on peptide-loaded target cells. The results from
individual clones are presented in Fig. 2, lysis of targets loaded with the
variant peptides (shaded bars) being shown alongside that seen using
the cognate peptide (black bar). Three clones representing the dominant
clonotype family in the primary response (clones 104 and 7* with
identical receptors, clone 1 with a related receptor) all showed strong
selectivity for the cognate epitope sequence and only tolerated alanine
substitution at position 3 and also, for clones 104 and 7*, at position
8. Interestingly, two other primary clones with unrelated TCR
structures (clones 62 and 6*) showed a quite similar pattern of
selective recognition. By contrast, another primary clone with a unique
TCR structure, clone 8, showed a much broader pattern of recognition
and could tolerate all alanine substitutions except those at positions
4 and 6 in the sequence. Among memory clones, such broad recognition of
all variants except substitutions 4 and 6 was much more common. This is
exemplified by the data from clones 23, 10, 22, and 31, each
representing slightly different TCRs within the dominant family of
memory clonotypes. A different clone (clone 9), representative of the
second clonotype family found in IM69 memory, showed an even broader
reactivity that now included recognition of the alanine substitution at
position 6. Another clone with this second clonotype family, clone 14,
had a very similar -chain to clone 9 but a different ß-chain. This
clone was functionally distinct from clone 9 in its inability to
tolerate substitutions at C-terminal positions 8 and 9, consistent with
the crystallographic data on TCR/MHC alignment showing an interaction
between the TCRß-chain and the C-terminal region of the peptide in
the MHC class I groove (3, 4). Viewing the results
overall, only the Thr 
Ala mutation at position 4 consistently
abrogated T cell recognition by IM69 clones; since this mutant peptide
satisfies the principle sequence demands for HLA-A2.01 binding
(39), its loss of antigenicity probably reflects the
importance of the Thr residue as a TCR contact point.
|
Cryopreserved PBMC from the memory bleeds of IM74, 61, and 69 were
in very short supply; therefore, we could not analyze these populations
by direct staining to determine how well the observed patterns of Vß
usage among in vitro-derived memory CTL clones (Tables I-III) reflected
the Vß composition of GLC-specific memory in vivo. We therefore chose
to address this issue by studying the GLC-specific response in a
long-term EBV carrier, donor CMc, who was A2.01-positive and who had
shown evidence of CD8+ T cell reactivity with the
A2.01/GLC tetramer in preliminary assays on PBMC. Using the same in
vitro peptide stimulation protocol as employed earlier to analyze
memory CTL responses in the post-IM donors, we established 17 T cell
clones from donor CMc that were identified as GLC specific in
cytotoxicity assays. Fig. 3A
presents their TCR sequence data; 12 of 17 clones used a common
V15/Vß4 receptor structure (which was identical to that seen in a
single memory clone from IM 61: see Table II, clone 64), whereas 2 of
17 clones used a Vß2 chain and 3 of 17 clones used a Vß16
chain.
|
B, 52.0% of the
tetramer-staining cells in donor CMc memory lay within the Vß4
subset; furthermore, smaller proportions of tetramer-positive cells
were also detectable in the Vß2 and Vß16 subsets but were not found
in several other subsets tested, of which Vß22 serves as an example.
The above distribution was observed in several independent blood
samples taken from donor CMc over a 12-mo period. From the two sets of
data presented in Fig. 3, it is clear that the pattern of Vß usage
within GLC-specific memory obtained using our in vitro cloning protocol
is broadly consistent with that identified by direct ex vivo staining
of PBMC; certainly in vitro cloning can identify the dominant Vß
component of memory. Maturation of the GLC-specific response in other IM patients: observations on Vß subset composition
Finally, to augment the earlier prospective studies on IM74, 61, and 69, we collected a new series of HLA-A2.01-positive IM patients and in each case followed the maturation of the GLC-specific response by direct ex vivo staining of PBMC. This work focused on the distribution of tetramer-positive cells among the Vß2, Vß16, and Vß22 subsets since these subsets had each been identified as significant contributors to the GLC-specific response in the original in vitro cloning work (Tables I-III), and the relevant Vß-specific mAbs were available; as a control we also included a Vß18-specific mAb in the analysis, representing a Vß-chain which had not previously been observed among in vitro-derived GLC-specific clones. Five IM patients (IM77, 78, 81, 83, and 96) were analyzed both in the acute phase of the disease, where 4–10% of the expanded CD8+ T cell pool in the blood stained with the A2.01/GLC tetramer, and between 12 and 33 mo later, by which time tetramer staining had fallen to 0.3–1.1% circulating CD8+ T cells. In the acute disease, all five patients showed marked skewing of the primary GLC-specific population into one or more of the Vß2, Vß16, or Vß22 subsets, and this was again coincident with significant expansions in the size of the relevant Vß subset in IM blood. However, when the same donors were rebled after IM, in three of five cases the Vß subsets that had been dominant during primary infection were represented very poorly, if at all, in the tetramer-reactive CD8+ memory cell pool.
Illustrative data from one such patient, IM77, are shown in Fig. 4A. Here, 55.2% of the primary tetramer-reactive population
was Vß22 positive, explaining why the Vß22-positive subset had
expanded to 6.3% of the total CD8+ T cell pool
at this time (compared with a normal mean of 2.6% ± 1.0%, data not
shown). By contrast, when this patient was studied 12 mo later, only
4.5% of the tetramer-reactive memory population was Vß22 positive. A
second smaller component of the primary GLC-specific response in IM77
lay within the Vß2 subset and this was also essentially undetectable
in the memory population, whereas a tetramer-positive Vß16-positive
component was detectable both in the primary response (as a subdominant
component) and in memory. Fig. 4B provides another such
example where 49% of the primary tetramer-reactive population in IM
patient IM81 was Vß22 positive (contributing to an expansion of the
Vß22 subset to 8.5% of the total CD8+ T cell
pool, data not shown) but 32 mo later only 5.3% of the
tetramer-reactive memory population lay in this subset; a smaller
component of the primary response had been Vß2 positive, yet this
later appeared to outnumber the Vß22 component in memory. A third IM
patient, IM83, likewise developed a highly amplified Vß22-positive
component constituting 58% of the primary tetramer-reactive population
in the acute phase of the disease; 21 mo later, the representation of
Vß22-positive cells in the tetramer-stained memory population had
fallen to 2% (data not shown).
|
C with reference to patient IM78. In this case, 48% and
29% of the primary tetramer-reactive population were Vß2 and Vß22
positive, respectively; these same components were clearly still
represented in memory 33 mo later, though they now constituted only
10% and 8% of the total memory population. The primary responses in
patient IM96 also contained significant Vß2 and Vß22-positive
components which remained detectable 12 mo later in memory (data not
shown). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Thus, in patient IM74 the bulk of the primary GLC-specific response was
composed of three families of clonotypes, of which the dominant family
carried an AV23S1 (or occasionally AV15S1) -chain with a distinct
CDR3 sequence and one of two ß-chain structures, either BV16S1 or
BV2S1, each with their own distinct CDR3 motifs (Table I). In patient
IM61 the primary response was dominated by two clonotype families. One
used the characteristic AV15S1 -chain and BV2S1 ß-chain structures
described above for IM74; the other used the characteristic BV16S1
ß-chain seen in IM74, now combined with a different -chain (Table II). Finally, the same AV15S1/BV2S1 ß-chain combination and
associated CDR3 sequences seen in both the above patients was the
dominant clonotype in the primary response of the third patient, IM69
(Table III). Interestingly, some of these same "public" clonotypes
have also been identified within the GLC-specific T cell population
found in the synovium of rheumatoid arthritis patients or in healthy
donors with no recorded history of IM (40).
Further work went on to show that the patterns of clonal dominance
apparent from in vitro cloning were consistent with the results from
direct ex vivo staining of the primary GLC-specific response with the
tetramer and with CD8 and Vß subset-specific Abs. Thus, the dominant
BV16 clonotypes seen among primary clones from IM74 and IM61 in both
cases correlated with a significant concentration of tetramer-positive
cells within the Vß16 subset (Fig. 1, A and B).
Likewise, the dominant BV2 clonotype among IM69 primary clones
reflected the fact that more than half of the tetramer-positive cells
in the original PBMC population were Vß2 positive (Fig. 1C). Such findings suggest that in vitro cloning has
provided a representative picture of the in vivo response in these
patients, at least in terms of identifying the more abundant
clonotypes. Furthermore, in all three cases, the concentration of
tetramer-positive cells within a particular Vß subset was linked to a
preferential expansion of that subset relative to the
CD8+ T cell pool as a whole; later studies on
other A2.01-positive IM patients (Fig. 4) provide further examples of
this same phenomenon. This strengthens the view that many of the
oligoclonal Vß expansions that are frequently seen among
CD8+ T cells in acute IM (14)
actually represent EBV-driven responses, most likely against as yet
unidentified lytic cycle epitopes.
In the context of these triple staining protocols, we noted that in
some cases the profiles of tetramer vs Vß staining appeared to show
two dually stained populations of cells; one had high tetramer
reactivity but relatively low Vß staining, as might arise from
competitive binding between reagents detecting the same molecular
complex, whereas the other had lower tetramer reactivity and standard
levels of Vß staining (see for example Fig. 1, A and
C). It remains to be seen whether these differences do
reflect T cells with different affinities for the GLC tetramer. We
believe however that the values quoted both here and in Fig. 4 for the
size of tetramer-positive/Vß-positive double-stained populations are
not overestimates, even though they may include some cells with low
tetramer staining. Thus, the quadrant boundaries for FACS analysis were
always set carefully using multiple controls, the GLC-tetramer only
produced staining above the relevant boundary when tested on cells from
A2.01-positive EBV-infected individuals, and the IM-PBMCs being
analyzed showed no staining above the boundary either with an A2.01/HIV
epitope tetramer or with various tetramers carrying EBV epitope
peptides complexed with other HLA alleles (data not shown).
The second major objective in the present work was to compare TCR usage
within the epitope-specific primary response with that subsequently
established in T cell memory. To date, this issue has been most closely
examined in the context of the immunodominant latent cycle epitope FLR,
where two independent studies demonstrated the persistence of dominant
clonotypes from acute infection into memory (31, 32).
However, primary responses to FLR are not only quantitatively less
abundant than typical GLC responses but also are less dramatically
culled with the development of memory. Thus, in our previous study,
after allowing for the fall in total CD8+ pool
size with recovery from IM, absolute numbers of circulating
FLR-specific cells identifiable by tetramer-staining fell 5- to 20-fold
between primary and memory bleeds (18); in contrast, the
mean reduction in GLC-specific cell numbers in the eight patients
studied here was 50- to100-fold. Although the detailed prospective
analysis of TCR usage among GLC-specific clones was limited to three
patients, it was interesting that in each case the clonotypes
dominating the primary response were not detected in the in
vitro-reactivated memory population; instead, there were new dominant
clonotypes in memory that had only been detectable as unique
subdominant clones within the primary response of the same individual.
In the case of IM69, consistent differences in fine specificity were
apparent between the dominant primary and memory clonotypes on testing
against alanine-substituted versions of the cognate GLC sequence. Here,
the memory clones were more tolerant of epitope sequence variation than
primary clones (Fig. 2); further work will be required to see whether
this is a general feature of maturing GLC-specific responses or simply
a consequence of the particular clonotypes that come to dominate IM69
memory. Limitations on cell numbers prevented a detailed analysis of
the affinity of these clones for the A2.01/GLC epitope, but initial
peptide titration assays did not reveal obvious differences between
clones (our unpublished observations). Recent work in murine models has
provided interesting examples of epitopes where either
CD4+ or CD8+ recall
responses tend to recruit the higher affinity clonotypes from within a
more heterogeneous primed population (40, 41, 42). In both of
these models, however, maturation of the response was induced
experimentally by a single re-exposure to Ag and involved only a slight
narrowing of the primary TCR repertoire (42, 43). These
circumstances are clearly different from the present study of a
naturally persistent virus infection where, over a longer time period,
one dominant clonotype appears to be replaced by another.
Again, from examples in other experimental systems
(44, 45, 46, 47), it is possible that a reliance on in
vitro-derived clones might have misrepresented the true content of
functional epitope-specific memory in our donors, especially since
additional aliquots of PBMC from the memory bleeds of IM74, IM61, and
IM69 were not available for direct ex vivo analysis. Hence, the switch
in dominant clonotype usage could be more apparent than real. Three
points argue against this possibility. First, we used an optimized
protocol for peptide-induced in vitro reactivation of GLC-specific
memory (37) which, when applied to a healthy virus carrier
with no history of IM, yielded a range of clonotypes that broadly
concurred with the results of direct tetramer/Vß double staining on
PBMC ex vivo (Fig. 3). Second, after the initial in vitro stimulation
with peptide, the cloning conditions used here were essentially the
same as those used in our earlier prospective study of FLR
epitope-specific responses during and up to 3 years after acute IM
(32), a study in which the hierarchy of dominant
clonotypes seen in individual donors remained constant over time. This
strongly implies that in vitro cloning is capable of detecting a stable
clonotype distribution where such a distribution is maintained in vivo.
Third, and most important, extension of the work to five new
A2.01-positive IM patients revealed further examples of changing
patterns of TCR usage within the GLC-specific response over time. Here,
the evidence came from the direct analysis of PBMC populations without
clonal selection in vitro. In all five individuals the primary
GLC-specific population, identified by tetramer and CD8 staining,
showed highly skewed Vß usage with dominant contributions from
Vß2-, Vß16-, and/or Vß22-positive cells. However, in three of
five cases, the Vß components that dominated the primary response
were subsequently found to be represented very poorly, if at all, in
the GLC-specific memory pool.
The overall results from clonotypic analysis and from Vß subset representation indicate that, in a significant number of cases, clonotypes dominating the primary GLC-specific response in A2.01-positive IM patients do not remain dominant in epitope-specific memory, at least as this is visualized in the circulating CD8+ T cell pool. Such clonotypes may in fact be subject to a process of functional exhaustion leading to deletion like that reported for some epitope-specific responses in murine LCMV infection (17, 48). In that work functional exhaustion was ascribed to the effects of continued stimulation with high Ag load since it was best observed under conditions of overwhelming virus challenge with a persistent LCMV mutant (17). A recent analysis of CTL responses to primary HIV infection has also documented cases of apparent clonotype deletion following resolution of the acute symptoms, and this was likewise ascribed to the unusual capacity of HIV to persist at a very high viral load in vivo (23). The present paper suggests that this same phenomenon can occur in a situation where overall control of the viral infection is not lost. Thus, primary EBV infection is associated with high-level virus replication in the oropharynx and with the virus-driven proliferation of latently infected B cells throughout the lymphoid system. However, the virus load in both compartments is then promptly reduced, leading to a low-grade virus carrier state, which thereafter is kept under tight immunological control (26). It remains to be seen how frequently EBV-lytic cycle epitope responses follow the pattern described here and whether functional exhaustion/deletion of CD8+ clonotypes is a direct consequence of high antigenic challenge or a secondary consequence of an effect mediated at the level of CD4+ T cell help.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alan B. Rickinson, Cancer Research Campaign Institute for Cancer Studies, University of Birmingham, Birmingham, B15 2TT, U.K.
3 Abbreviations used in this paper: CDR, complementarity-determining region; LCMV, lymphocytic choriomeningitis virus; IM, infectious mononucleosis; LCL, lymphoblastoid cell line.
Received for publication December 27, 1999. Accepted for publication August 1, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß T cell receptor structure at 2.5Å and its orientation in the TCR-MHC complex. Science 274:209. and ß chains of the human T-cell antigen receptor recognizing HLA-A2 and influenza A matrix peptide. Proc. Natl. Acad. Sci. USA 88:8987.This article has been cited by other articles:
|
|
 |
|
  E. M. Iancu, P. Corthesy, P. Baumgaertner, E. Devevre, V. Voelter, P. Romero, D. E. Speiser, and N. Rufer Clonotype Selection and Composition of Human CD8 T Cells Specific for Persistent Herpes Viruses Varies with Differentiation but Is Stable Over Time J. Immunol., July 1, 2009; 183(1): 319 - 331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Venturi, H. Y. Chin, T. E. Asher, K. Ladell, P. Scheinberg, E. Bornstein, D. van Bockel, A. D. Kelleher, D. C. Douek, D. A. Price, et al. TCR {beta}-Chain Sharing in Human CD8+ T Cell Responses to Cytomegalovirus and EBV J. Immunol., December 1, 2008; 181(11): 7853 - 7862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Venturi, H. Y. Chin, D. A. Price, D. C. Douek, and M. P. Davenport The Role of Production Frequency in the Sharing of Simian Immunodeficiency Virus-Specific CD8+ TCRs between Macaques J. Immunol., August 15, 2008; 181(4): 2597 - 2609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Derre, M. Bruyninx, P. Baumgaertner, E. Devevre, P. Corthesy, C. Touvrey, Y. D. Mahnke, H. Pircher, V. Voelter, P. Romero, et al. In Vivo Persistence of Codominant Human CD8+ T Cell Clonotypes Is Not Limited by Replicative Senescence or Functional Alteration J. Immunol., August 15, 2007; 179(4): 2368 - 2379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. N. Akbar and M. Vukmanovic-Stejic Telomerase in T Lymphocytes: Use It and Lose It? J. Immunol., June 1, 2007; 178(11): 6689 - 6694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Somma, G. Ristori, L. Battistini, S. Cannoni, G. Borsellino, A. Diamantini, M. Salvetti, R. Sorrentino, and M. T. Fiorillo Characterization of CD8+ T cell repertoire in identical twins discordant and concordant for multiple sclerosis J. Leukoc. Biol., March 1, 2007; 81(3): 696 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Kasprowicz, A. Isa, K. Jeffery, K. Broliden, T. Tolfvenstam, P. Klenerman, and P. Bowness A Highly Restricted T-Cell Receptor Dominates the CD8+ T-Cell Response to Parvovirus B19 Infection in HLA-A*2402-Positive Individuals. J. Virol., July 1, 2006; 80(13): 6697 - 6701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sauce, M. Larsen, S. J. Curnow, A. M. Leese, P. A. H. Moss, A. D. Hislop, M. Salmon, and A. B. Rickinson EBV-associated mononucleosis leads to long-term global deficit in T-cell responsiveness to IL-15 Blood, July 1, 2006; 108(1): 11 - 18. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Fletcher, M. Vukmanovic-Stejic, P. J. Dunne, K. E. Birch, J. E. Cook, S. E. Jackson, M. Salmon, M. H. Rustin, and A. N. Akbar Cytomegalovirus-Specific CD4+ T Cells in Healthy Carriers Are Continuously Driven to Replicative Exhaustion J. Immunol., December 15, 2005; 175(12): 8218 - 8225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Miles, S. L. Silins, A. G. Brooks, J. E. Davis, I. Misko, and S. R. Burrows T-cell grit: large clonal expansions of virus-specific CD8+ T cells can dominate in the peripheral circulation for at least 18 years Blood, December 15, 2005; 106(13): 4412 - 4413. [Full Text] [PDF]
|
|
|
|
|
|
C. C. Kemball, E. D. H. Lee, V. Vezys, T. C. Pearson, C. P. Larsen, and A. E. Lukacher Late Priming and Variability of Epitope-Specific CD8+ T Cell Responses during a Persistent Virus Infection J. Immunol., June 15, 2005; 174(12): 7950 - 7960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Curran, O. M. FitzGerald, P. J. Costello, J. M. Selby, D. J. Kane, B. Bresnihan, and R. Winchester Nucleotide Sequencing of Psoriatic Arthritis Tissue before and during Methotrexate Administration Reveals a Complex Inflammatory T Cell Infiltrate with Very Few Clones Exhibiting Features That Suggest They Drive the Inflammatory Process by Recognizing Autoantigens J. Immunol., February 1, 2004; 172(3): 1935 - 1944. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. T. Belz, H. Liu, S. Andreansky, P. C. Doherty, and P. G. Stevenson Absence of a functional defect in CD8+ T cells during primary murine gammaherpesvirus-68 infection of I-Ab-/- mice J. Gen. Virol., January 1, 2003; 84(2): 337 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Dunne, J. M. Faint, N. H. Gudgeon, J. M. Fletcher, F. J. Plunkett, M. V. D. Soares, A. D. Hislop, N. E. Annels, A. B. Rickinson, M. Salmon, et al. Epstein-Barr virus-specific CD8+ T cells that re-express CD45RA are apoptosis-resistant memory cells that retain replicative potential Blood, July 18, 2002; 100(3): 933 - 940. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Hislop, N. H. Gudgeon, M. F. C. Callan, C. Fazou, H. Hasegawa, M. Salmon, and A. B. Rickinson EBV-Specific CD8+ T Cell Memory: Relationships Between Epitope Specificity, Cell Phenotype, and Immediate Effector Function J. Immunol., August 15, 2001; 167(4): 2019 - 2029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Bitmansour, S. L. Waldrop, C. J. Pitcher, E. Khatamzas, F. Kern, V. C. Maino, and L. J. Picker Clonotypic Structure of the Human CD4+ Memory T Cell Response to Cytomegalovirus J. Immunol., August 1, 2001; 167(3): 1151 - 1163. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. D. Hislop, N. E. Annels, N. H. Gudgeon, A. M. Leese, and A. B. Rickinson Epitope-specific Evolution of Human CD8+ T Cell Responses from Primary to Persistent Phases of Epstein-Barr Virus Infection J. Exp. Med., April 1, 2002; 195(7): 893 - 905. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
