|
|
||||||||
CUTTING EDGE |

*
Department of Internal Medicine, Yale University School of Medicine, New Haven, CT, 06520; and the
Center of Comparative Medicine, Schools of Medicine and Veterinary Medicine, University of California, Davis, CA 95616
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Mouse CD1d is constitutively expressed on antigen-presenting cells and thymic epithelium (12), where it is believed to play a role in selection of NK T cells based on the absence of this subset in CD1d-/- mice (13, 14, 15). However, the highest level of expression is found on splenic marginal zone B (MZB)3 cells, a minor subset of B cells that are a source of Ab to T-independent Ag (12, 16). This noncirculating B cell subset is confined to the spleen in a region adjacent to the marginal sinuses, where it is in a position to sample bloodborne Ag (17, 18). Whether CD1d facilitates MZB cell activation and/or production of Ab by this cell population is unknown.
The Lyme disease spirochete, Borrelia burgdorferi (Bb), is an example of a pathogen for which Ab to Bb lipoproteins, and not T cells, are critical for early protective immunity (19). In the mouse model of Lyme borreliosis, protective Ab are directed toward Bb outer surface membrane lipoproteins, which are recognized B cell mitogens (20). Passive immunization of infected B cell-deficient (µMT) or SCID mice with immune serum can reduce spirochete numbers in tissues and attenuate arthritis, which is a principal disease manifestation in this model (19). This protective and disease-modulating immunity can arise independently of conventional T cell helper function, as has been shown by the presence of effective immunity in mice deficient in the B cell costimulatory molecule CD40 ligand expressed on T cells (21) or lacking MHC class II and CD4+ T cells (22).
Bb lipoproteins and lipopeptides activate innate immune cells and may be the major spirochete component leading to disease manifestations (23). The lipid moiety, common to all spirochete lipoproteins, is formed by the posttranslational attachment of three palmitoyl residues to the N-terminal glycerylcysteine residue of the polypeptide chain (24). This N-terminal tripalmitoyl cysteine moiety shares structural similarity to lipid and glycolipid Ags from other microorganisms which are known to bind CD1 molecules (1). Because Bb contains lipoprotein Ags that have the potential to bind CD1, Bb infection could provide a model for assessing the role of CD1d in the response to extracellular bloodborne pathogens for which Ab, but not T cells provide host immunity. In this study, we examined the immune responses and evolution of disease in CD1d-deficient (CD1d-/-) mice experimentally infected with Bb.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 (B6) x 129 (B6129) CD1d-/- mice (F6 generation) produced by targeted disruption of the CD1d1 gene were the kind gift of Dr. Luc van Kaer (Vanderbilt University School of Medicine and the Howard Hughes Medical Institute, Memphis, TN; Ref. 15). B6.CD1d-/- mice (N7-N9 generation), derived from ES line of 129/Ola origin and used after six to eight backcrosses to B6, were generously provided by Dr. Albert Bendelac (Princeton University, Princeton, NJ; Ref. 25). Control mice included age-matched heterozygote littermates and B6129 CD1d+/+ (F2 generation; Taconic Laboratories, Germantown, NY). Mice were housed and fed in microisolator cages according to Yale University institutional animal care and use guidelines.
Infection of mice
Low passage, cloned Bb strain N40 (cN40) spirochetes were expanded in modified Barbour-Stoenner-Kelly medium (26) and enumerated using a Petroff-Hausser counting chamber before inoculation into mice. Mice were inoculated intradermally into the shoulder with 104 cN40 in 100 µl Barbour-Stoenner-Kelly medium. Infection status of mice was evaluated at the time of sacrifice by Bb immunoblot and by culturing blood and urinary bladders as described (26).
Histopathology
Bilateral hind limb joints (knee and tibiotarsal joints) were processed and stained with hematoxylin and eosin by routine histologic techniques (27). The tibiotarsal joints were scored for arthritis severity on a scale of 0 (negative) to 3 (severe) in a blinded fashion as described (26).
PCR of Bb DNA
DNA was isolated from urinary bladders according to standard methods (28). The Bb plasmid encoded ospA gene and the eukaryotic tubulin gene were amplified by PCR in a total reaction volume of 50 µl containing 1 µg DNA template, 25 µM each primer, 20 mM MgCl2, and 0.5 µl Taq (Qiagen, Valencia, CA). The following primer pairs were used: Osp A sense primer 5'AAAACAGCGTTTCAGTAGATTTGCCTGGTG3', and antisense primer 5'CAACTGCTGACCCCTCTAATTTGGTGCC3'; tubulin sense primer 5'GGCGCCCTCTGTGTAGTGGCCTTTGGCCAA3' and antisense primer 5'CAGGCTGGTCAATGTGGCAACCAGATCGGT3'. Amplification of targeted DNA sequences was performed on the Robocycler Gradient 40 (Stratagene, La Jolla, CA) with 40 cycles of denaturation at 95°C for 1.5 min, annealing at 56°C for 1 min and extension at 73°C for 1.5 min, followed by a 4-min extension at 73°C. For tubulin amplification, PCR was conducted for 35 cycles with denaturation at 94°C for 45 s, annealing at 60°C for 45 s and amplication at 74°C for 1.5 min, followed by a 10-min extension at 74°C. Amplified products were separated by 2% agarose gel electrophoresis and visualized by ethidium bromide staining.
ELISA and immunoblot
ELISA was performed using microtiter plates (ICN Biomedicals, Aurora, OH) coated with 2.5 µg/well Bb lysate or the indicated purified recombinant Bb proteins (29). Recombinant lipidated decorin-binding protein A (lpp-DbpA, a gift from MedImmune, Gaithersburg, MD), recombinant delipidated Osp A produced as a fusion protein with glutathione transferase (GT)-Osp A or cleaved from GT (rOsp A), and recombinant delipidated GT-Osp B were purified as described (30, 31, 32). Bb Ab endpoint-titers in serial 2-fold serum dilutions were determined by ELISA using alkaline phosphatase-conjugated anti-mouse IgM, IgG, or IgG isotypes and the Vector Elite visualization kit (Vector Laboratories, Burlingame, CA). OD values > 2 SD from the mean of negative samples were considered positive. For immunoblot analysis, proteins were separated by SDS-PAGE and transferred to nitrocellulose (33). Seven-day-infected mouse sera were used at 1:50 dilution, whereas 14-day-infected mouse sera were used at 1:100 dilution. Where indicated, Osp A mAb VIIIC3.78 (34), Osp B mAb VIIB10.36 (31), or mouse polyclonal antisera to lppDbpA-N40 (32) were incubated with individual nitrocellulose strips to mark the location of specific Bb Ag. Bound Bb Ab were detected using alkaline phosphatase-conjugated goat anti-mouse IgM or IgG (Vector Laboratories) and visualized with 5-bromo-4-chloro-3-indoyl phosphatase p-toluidine and nitroblue tetrazolium substrate (Kirkegaard and Perry Laboratories, Gaithersburg, MD).
| Results |
|---|
|
|
|---|
C57BL/6 (B6) and 129 mice are highly resistant to disease
manifestations associated with Bb infection, and intercrosses of these
mouse strains remain disease-resistant (35). We examined
the influence of CD1d molecules in knockout mice on these resistant
backgrounds after intradermal inoculation with
104 cN40. As expected, infected control mice were
resistant to disease and showed no joint or soft tissue abnormalities
at any of the three time points (4, 7, and 14 days) analyzed. In
contrast, within 7 days CD1d-/- mice developed
arthritis that progressed in severity by day 14 (Table I
). Joint infiltrates were typical of
murine Lyme arthritis, with soft tissue edema and neutrophilic
infiltrates of tendon sheaths and joint synovium (Ref. 35 ;
data not shown). Acute inflammation was also present on histopathologic
examination of the skin inoculation site in
CD1d-/- but not similarly infected control mice
at infection days 4, 7, and 14. In dose-response studies,
CD1d-/- mice seroconverted to Bb at 10-fold
lower inoculum than control mice (data not shown).
|
PCR amplification of Bb DNA was performed to assess whether
spirochetes disseminate from skin to urinary bladders at a different
rate in the absence of CD1d. DNA for the Bb ospA gene was
more prevalent in urinary bladders of 7-day-infected
CD1d-/- mice when compared with infected
control mice (Table II
); in one
experiment, Osp A DNA could be detected as early as day 4 in
CD1d-/- mice. Blood cultures were negative in
both groups of mice at these time points, reflecting the limited
sensitivity of this method for detecting spirochetes.
|
Serum from 14-day-infected CD1d-/- mice
contained significantly higher levels of Bb-specific IgG (reciprocal
endpoint titer
25,600 in CD1d-/- mice (range
25,60051,200) compared with titers
3,200 (range 1,6003,200) in
control mice (Students t test, p <
0.0001)). IgM titers trended lower when compared with controls but
values were not statistically different (data not shown). IgG to Osp A
and Osp B was present in infected CD1d-/- mouse
serum, two Ag rapidly down-modulated by spirochetes adapting from
culture to the mammal (Fig. 1
); these Ab
are usually absent from the early Ab repertoire (33). Osp
A was the dominant Ag targeted by IgM during the first week in
CD1d-/- mice (Fig. 2
, lanes 812), whereas a
26-kDa band that included the lipoprotein Osp C (Fig. 2
, lanes
37) was recognized by infected control sera.
CD1d-/- mice possessed strong IgG2a to Bb
lipoproteins, although all isotypes were enhanced at 7 days of
infection (Table III
). The presence of
Bb-specific IgG2a, a feature commonly seen in Bb-infected
disease-susceptible mice (36), contrasts with the absence
of expansion of this isotype in 14-day-infected control mouse sera, in
which Bb-specific IgG is predominantly IgG2b and IgG3
(36).
|
|
|
| Discussion |
|---|
|
|
|---|
In murine Lyme borreliosis, pathology is believed to be due to the activation of innate immune cells by spirochete lipoproteins and can arise in the absence of B and T cells (23). Spirochetes vary surface expression of lipoproteins depending upon their environment and naturally shed lipoprotein membrane blebs in vitro (37). Spirochete lipoprotein expression and the rate at which the immune system clears lipoprotein Ag may be critical parameters determining extent and duration of disease. In this study, absence of CD1d permitted the development of typical Lyme arthritis in mice normally resistant to Bb-induced disease. Although an increased pathogen burden could account for these findings, spirochete numbers in joints do not always correlate with arthritis severity (38). An alternative explanation for our findings is that Bb lipoproteins may not be eliminated as readily in the absence of CD1d. Bb-infected CD1d-/- mice developed IgG to Osp A, a lipoprotein dominantly expressed on cultured spirochetes but rapidly lost in vivo (33). Mice only seroconvert to Osp A when inoculated with large numbers of spirochetes (39), suggesting that transiently expressed lipoproteins may be efficiently removed by phagocytes and Ab without the development of detectable serum Ab; in the absence of CD1d, such clearance mechanisms may be impaired. Both spirochete phenotypic change and Osp A Ag clearance must occur rapidly in the control mice used in the present study, because neither IgM nor IgG directed against Osp A could be detected in their serum at any time.
Although CD1d-deficiency rendered the disease-resistant mice used in
this study susceptible to enhanced IgG and pathology similar to
Bb-susceptible mice, it remains unclear why CD1d is not sufficient to
prevent disease in the latter group. The mechanism through which CD1d
impacts on Bb infection and disease in the mice used in this study may
involve CD1d presentation of Bb lipid Ag to NK T cells. Indeed, Bb
lppDbpA but not delipidated DbpA can compete with
-galactosylceramide for CD1d-binding sites and inhibit activation of
a CD1d-restricted NK T cell hybridoma (L. Bockenstedt, K. Benlagha, A.
Bendelac, unpublished observations), providing evidence that CD1d can
bind lipidated Bb Ag. However, distal effects of NK T cells on
CD4+ Th1 and 2 cell subset differentiation cannot
explain our findings. B6 mice that lack either
ß T cells (TCR
-/- mice (3) or TCR
ß-/-
-/-
(40)) or MHC class II (22) do not exhibit
more severe arthritis (22), and interruption of the
B7/CD28 T cell costimulatory pathway (29) or absence of
CD40 ligand (21) does not enhance arthritis.
Because Ab that arise in the absence of T cell help are sufficient to protect against Bb infection, we were intrigued by the fact that CD1d is constitutively expressed at high levels on splenic MZB cells, a source of inducible Ab to T-independent Ag. CD1d or CD1d-restricted NK T cells could facilitate the production of Bb-specific Ab by the MZB cell population. Paradoxically, CD1d-/- mice produced higher titer Ab to Bb Ag early after infection, suggesting that MZB cell Ab can be induced. Rapid production of these Ab may be required within the first hours to days of infection to limit spirochete burden and to eliminate pro-inflammatory Ag. This period was not examined in our study.
Our results parallel the effects of absence of natural Ab on experimental infection of mice with lymphocyte choriomeningitis virus (LCMV). I.v. injection of LCMV into B6 µMT mice leads to increased viral burden, enhanced CTL responses, and loss of splenic architecture when compared with similarly infected control mice (41). In that system, natural Ab and complement are important for trapping LCMV Ag in the marginal zone of the spleen. In the absence of Ab to initially control pathogen burden, stronger T cell responses are elicited resulting in secondary pathology. In the case of Bb infection, an impaired early host defense leads to the induction of stronger Ab responses, but this occurs too late to prevent disease.
Previously, the role of CD1 in the host response to infectious agents had been best characterized for intracellular pathogens. Our study is the first demonstration that CD1d deficiency impairs resistance to disease due to an extracellular pathogen. Further work is in progress to elucidate CD1d-mediated immune events during Bb infection.
Note added in proof.
The immunologic changes noted in Bb-infected CD1d-/- mice are both spirochete dose and mouse age dependent, as has been shown for disease-susceptible mouse strains (27).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Linda K. Bockenstedt, Section of Rheumatology, 609 LCI, Yale University School of Medicine, P.O. Box 208031, 333 Cedar Street, New Haven, CT 06520-8031. ![]()
3 Abbreviations used in this paper: MZB, marginal zone B; Bb, Borrelia burgdorferi; NMS, normal mouse serum; B6, C57BL/6; B6129, B6 x 129; cN40, cloned Bb strain N40; LCMV lymphocyte choriomeningitis virus; GT, glutathione transferase. ![]()
4 L. K. Bockenstedt, I. Kang, M.-C. Shanafelt, H. Kumar, M. Campbell, D. Persing, A. Hayday, and S. W. Barthold. 2000. Lyme borreliosis in B- and
ß T cell deficient mice: distinct roles for specific immunity in disease regression. Submitted for publication. ![]()
Received for publication July 7, 2000. Accepted for publication September 1, 2000.
| References |
|---|
|
|
|---|
14 NKT cells by glycosylceramides. Science 278:1626.
-Galactosylceramide-activated V
14 natural killer T cells mediate protection against murine malaria. Proc. Natl. Acad. Sci. USA 97:8461.
+TCR
ß+ intestinal intraepithelial lymphocytes in the absence of both classical MHC class I and non classical CD1 molecules. J. Exp. Med. 190:885.This article has been cited by other articles:
![]() |
E. Bialecki, C. Paget, J. Fontaine, M. Capron, F. Trottein, and C. Faveeuw Role of Marginal Zone B Lymphocytes in Invariant NKT Cell Activation J. Immunol., May 15, 2009; 182(10): 6105 - 6113. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Olson Jr., T. C. Bates, H. Izadi, J. D. Radolf, S. A. Huber, J. E. Boyson, and J. Anguita Local Production of IFN-{gamma} by Invariant NKT Cells Modulates Acute Lyme Carditis J. Immunol., March 15, 2009; 182(6): 3728 - 3734. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tupin, M. R.-E.-I. Benhnia, Y. Kinjo, R. Patsey, C. J. Lena, M. C. Haller, M. J. Caimano, M. Imamura, C.-H. Wong, S. Crotty, et al. NKT cells prevent chronic joint inflammation after infection with Borrelia burgdorferi PNAS, December 16, 2008; 105(50): 19863 - 19868. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Vas, J. Mattner, S. Richardson, R. Ndonye, J. P. Gaughan, A. Howell, and M. Monestier Regulatory Roles for NKT Cell Ligands in Environmentally Induced Autoimmunity J. Immunol., November 15, 2008; 181(10): 6779 - 6788. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiba, C. C. Dascher, G. S. Besra, and M. B. Brenner Rapid NKT Cell Responses Are Self-Terminating during the Course of Microbial Infection J. Immunol., August 15, 2008; 181(4): 2292 - 2302. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Stevenson, E. C. Crossley, N. Thirumalapura, D. H. Walker, and N. Ismail Regulatory Roles of CD1d-Restricted NKT Cells in the Induction of Toxic Shock-Like Syndrome in an Animal Model of Fatal Ehrlichiosis Infect. Immun., April 1, 2008; 76(4): 1434 - 1444. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Lang, T. S. Devera, and M. L. Lang Requirement for CD1d expression by B cells to stimulate NKT cell-enhanced antibody production Blood, February 15, 2008; 111(4): 2158 - 2162. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Belperron, C. M. Dailey, C. J. Booth, and L. K. Bockenstedt Marginal Zone B-Cell Depletion Impairs Murine Host Defense against Borrelia burgdorferi Infection Infect. Immun., July 1, 2007; 75(7): 3354 - 3360. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Borchers, N. L. Harris, S. C. Wesselkamper, S. Zhang, Y. Chen, L. Young, and G. W. Lau The NKG2D-Activating Receptor Mediates Pulmonary Clearance of Pseudomonas aeruginosa. Infect. Immun., May 1, 2006; 74(5): 2578 - 2586. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Lang and A. Glatman-Freedman Do CD1-Restricted T Cells Contribute to Antibody-Mediated Immunity against Mycobacterium tuberculosis? Infect. Immun., February 1, 2006; 74(2): 803 - 809. [Full Text] [PDF] |
||||
![]() |
M. S. Vincent, X. Xiong, E. P. Grant, W. Peng, and M. B. Brenner CD1a-, b-, and c-Restricted TCRs Recognize Both Self and Foreign Antigens J. Immunol., November 15, 2005; 175(10): 6344 - 6351. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bilenki, S. Wang, J. Yang, Y. Fan, A. G. Joyee, and X. Yang NK T Cell Activation Promotes Chlamydia trachomatis Infection In Vivo J. Immunol., September 1, 2005; 175(5): 3197 - 3206. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Smiley, P. A. Lanthier, K. N. Couper, F. M. Szaba, J. E. Boyson, W. Chen, and L. L. Johnson Exacerbated Susceptibility to Infection-Stimulated Immunopathology in CD1d-Deficient Mice J. Immunol., June 15, 2005; 174(12): 7904 - 7911. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Belperron, C. M. Dailey, and L. K. Bockenstedt Infection-Induced Marginal Zone B Cell Production of Borrelia hermsii-Specific Antibody Is Impaired in the Absence of CD1d J. Immunol., May 1, 2005; 174(9): 5681 - 5686. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wu, G.-W. Xing, M. A. Poles, A. Horowitz, Y. Kinjo, B. Sullivan, V. Bodmer-Narkevitch, O. Plettenburg, M. Kronenberg, M. Tsuji, et al. Bacterial glycolipids and analogs as antigens for CD1d-restricted NKT cells PNAS, February 1, 2005; 102(5): 1351 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Duthie, M. Kahn, M. White, R. P. Kapur, and S. J. Kahn Critical Proinflammatory and Anti-Inflammatory Functions of Different Subsets of CD1d-Restricted Natural Killer T Cells during Trypanosoma cruzi Infection Infect. Immun., January 1, 2005; 73(1): 181 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Parekh, A. K. Singh, M. T. Wilson, D. Olivares-Villagomez, J. S. Bezbradica, H. Inazawa, H. Ehara, T. Sakai, I. Serizawa, L. Wu, et al. Quantitative and Qualitative Differences in the In Vivo Response of NKT Cells to Distinct {alpha}- and {beta}-Anomeric Glycolipids J. Immunol., September 15, 2004; 173(6): 3693 - 3706. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Campos, M. Szczepanik, A. Itakura, M. Akahira-Azuma, S. Sidobre, M. Kronenberg, and P. W. Askenase Cutaneous Immunization Rapidly Activates Liver Invariant V{alpha}14 NKT Cells Stimulating B-1 B Cells to Initiate T Cell Recruitment for Elicitation of Contact Sensitivity J. Exp. Med., December 15, 2003; 198(12): 1785 - 1796. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Skold and S. M. Behar Role of CD1d-Restricted NKT Cells in Microbial Immunity Infect. Immun., October 1, 2003; 71(10): 5447 - 5455. [Full Text] [PDF] |
||||
![]() |
T. Chun, M. J. Page, L. Gapin, J. L. Matsuda, H. Xu, H. Nguyen, H.-S. Kang, A. K. Stanic, S. Joyce, W. A. Koltun, et al. CD1d-expressing Dendritic Cells but Not Thymic Epithelial Cells Can Mediate Negative Selection of NKT Cells J. Exp. Med., April 7, 2003; 197(7): 907 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Huber, D. Sartini, and M. Exley Role of CD1d in Coxsackievirus B3-Induced Myocarditis J. Immunol., March 15, 2003; 170(6): 3147 - 3153. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Gansert, V. Kiebler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, S. A. Porcelli, R. L. Modlin, and S. Stenger Human NKT Cells Express Granulysin and Exhibit Antimycobacterial Activity J. Immunol., March 15, 2003; 170(6): 3154 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Johnson, R. A. Parker, J. E. Johnson, and B. S. Graham IL-13 Is Sufficient for Respiratory Syncytial Virus G Glycoprotein-Induced Eosinophilia After Respiratory Syncytial Virus Challenge J. Immunol., February 15, 2003; 170(4): 2037 - 2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Grubor-Bauk, A. Simmons, G. Mayrhofer, and P. G. Speck Impaired Clearance of Herpes Simplex Virus Type 1 From Mice Lacking CD1d or NKT Cells Expressing the Semivariant V{alpha}14-J{alpha}281 TCR J. Immunol., February 1, 2003; 170(3): 1430 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Johnson, S. Hong, L. Van Kaer, Y. Koezuka, and B. S. Graham NK T Cells Contribute to Expansion of CD8+ T Cells and Amplification of Antiviral Immune Responses to Respiratory Syncytial Virus J. Virol., March 27, 2002; 76(9): 4294 - 4303. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Gumperz, S. Miyake, T. Yamamura, and M. B. Brenner Functionally Distinct Subsets of CD1d-restricted Natural Killer T Cells Revealed by CD1d Tetramer Staining J. Exp. Med., March 4, 2002; 195(5): 625 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Jahng, I. Maricic, B. Pedersen, N. Burdin, O. Naidenko, M. Kronenberg, Y. Koezuka, and V. Kumar Activation of Natural Killer T Cells Potentiates or Prevents Experimental Autoimmune Encephalomyelitis J. Exp. Med., December 17, 2001; 194(12): 1789 - 1799. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Singh, M. T. Wilson, S. Hong, D. Olivares-Villagomez, C. Du, A. K. Stanic, S. Joyce, S. Sriram, Y. Koezuka, and L. Van Kaer Natural Killer T Cell Activation Protects Mice Against Experimental Autoimmune Encephalomyelitis J. Exp. Med., December 17, 2001; 194(12): 1801 - 1811. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.M. Rhind CD1--The Pathology Perspective Vet. Pathol., November 1, 2001; 38(6): 611 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wang, Y.-B. Geng, and C.-R. Wang CD1-restricted NK T Cells Protect Nonobese Diabetic Mice from Developing Diabetes J. Exp. Med., August 6, 2001; 194(3): 313 - 320. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Motsinger, D. W. Haas, A. K. Stanic, L. Van Kaer, S. Joyce, and D. Unutmaz CD1d-restricted Human Natural Killer T Cells Are Highly Susceptible to Human Immunodeficiency Virus 1 Infection J. Exp. Med., April 1, 2002; 195(7): 869 - 879. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |