| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Biochemistry, Case Western Reserve University, Cleveland, OH 44106; and
Department of Medicine, Case Western Reserve University, Metro Health Campus, Cleveland, OH 44109
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B system, we
explored the effects of overexpressed Rel family members on CRP
expression. Unexpectedly, transactivation assays in transiently
transfected Hep 3B cells showed p50 overexpression to markedly induce
CRP transcription, acting in a region 3' to -86. In the presence of
overexpressed p50, IL-1ß induced a 3-fold increase in CRP expression,
and responses to IL-6 and to IL-6 plus IL-1ß were 4-fold greater than
seen in cells without p50 overexpression. In contrast, overexpressed
p65 abolished CRP induction by p50 and by cytokines. EMSA studies
demonstrated that recombinant p50 bound to a nonconsensus B site
overlapping the proximal C/EBP binding site on the CRP promoter.
Mutation of a polypyrimidine tract in the p50-binding site inhibited
the transactivating effect of cytokines. P50- but not p65-containing
dimers were found in nuclei of Hep 3B cells 18 h after stimulation
with IL-1ß, when C/EBPß is greatly activated, in the presence or
absence of IL-6. These findings suggest that IL-1ß induces nuclear
translocation of p50-containing dimers and that p50 interacts with
C/EBPß activated by both IL-6 and IL-1ß to induce CRP
expression. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The signal transducing pathways regulating CRP induction by cytokines are not fully delineated. IL-6 induces only moderate levels of CRP gene expression in the human hepatoma cell line, Hep 3B. IL-1ß alone has no effect, but when added to IL-6 causes marked synergistic enhancement of CRP gene expression (3). Transcription factors known to mediate at least part of the IL-6 effect include STAT3 and members of the C/EBP family (5, 7). C/EBP family members activate transcription in response to IL-6 through two response elements centered at -52 (7) and -219 (10), while STAT3 participates in induction of CRP through a cis-acting element centered at -108 (5). The responsive DNA sequence mediating the synergistic effect of IL-1ß in the presence of IL-6 has not been identified as yet.
Many of the effects of IL-1 are mediated by the NF-B system
(15, 16). An example is SAA, which exhibits a great deal
of similarity to CRP in magnitude and kinetics of induction and the
cytokines required for its optimal induction in Hep 3B cells
(17). IL-1 has been shown to induce SAA expression by
activation of the classical NF-B heterodimer p65/p50, with
consequent physical interaction between p65 and activated C/EBPß
(11). Besides SAA, NF-B has been shown to play a role
in expression of many inflammation-associated genes including IL-6
(18), IL-1 (19), ICAM-1 (20),
LPS binding protein (21), angiotensinogen
(22), and G-CSF (23). Accordingly, we
explored the possibility that Rel family members might similarly be
involved in the IL-1ß-mediated synergy observed on the CRP promoter.
We found, unexpectedly, that p50 overexpression induced CRP gene
expression, acting through a nonconsensus B site overlapping the
proximal C/EBP binding site on the CRP promoter, while p65
overexpression inhibited CRP gene expression, and that mutation of the
p50-binding site inhibited the transactivating effect of cytokines.
These findings indicate that the NF-B system participates, in a
nonclassical way, in inducing CRP gene expression in response to
cytokines.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recombinant human IL-1ß and IL-6 were obtained from Biosource
International (Camarillo, CA). CRP promoter deletion constructs ranging
from -55 to -904 bp were generous gifts from Dr. Neal Goldman (Food
and Drug Administration, Bethesda, MD). Rsv-p50 and rsv-p65 were gifts
from Dr. Gary Nabel (National Institutes of Health, Bethesda, MD).
PGL-2 basic plasmid, luciferase assay kits, and purified recombinant
human p50 (rhp50) protein were purchased from Promega (Madison, WI).
The pNF-B-LUC vector was purchased from Clontech Laboratories (Palo
Alto, CA). Abs to p50 and p65 were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). FuGENE 6 transfection reagent, DNA
ligase, T4 polynucleotide kinase, and endonucleases were obtained from
Roche Molecular Laboratory (Indianapolis, IN). Oligonucleotides were
purchased from Life Technologies (Gaithersburg, MD) and Genosys (The
Woodlands, TX). Quick-Change Mutagenesis kit was obtained from
Stratagene (La Jolla, CA).
Cell culture
Human hepatoma Hep 3B cells were provided by Dr. G. J. Darlington (Baylor College of Medicine, Houston, TX) and were maintained in RPMI 1640 supplemented with 10% FBS. Cells were subcultured weekly after trypsinization.
Transfection and cytokine treatment
Transfection using the FuGENE 6 reagent was performed as described by the manufacturer. Cells were plated into 6-well plates in RPMI 1640 medium supplemented with 10% FBS so that the cells were 50–80% confluent (105–106 cells) on the day of transfection. Diluted transfection solution (3 µl of FuGENE 6 plus 97 µl of serum-free RPMI 1640 medium) was incubated for 5 min and mixed with 2 µg of DNA (1 µg of luciferase reporter DNA and 1 µg of expression DNA) for 15 min. The FuGENE 6/DNA mixture was then applied to Hep 3B cells for a 24-h incubation.
For cytokine treatment, the transfected cells were washed with serum-free medium twice and exposed to 10 ng (100 U)/ml of IL-6, 20 ng (200 U)/ml IL-1ß, or the combination of the two cytokines for 24 h.
Luciferase assays
Luciferase reporter assays were performed following a protocol
supplied by the manufacturer. Cell extracts were prepared with 50 µl
of 1x reporter lysis buffer and one freeze-thaw cycle. Next, 20 µl
of the cell extract was loaded into each well of a 96-well microtiter
plate. Then, 100 µl of luciferase assay reagent was added, and
luciferase activity was measured in a luminometer (Wallac,
Gaithersburg, MD), which was programmed to read for 3 s following
a 2-s measurement delay. Luciferase activity was normalized to the
protein concentration of the extract measured by a Bio-Rad protein
assay protocol (Richmond, CA). Common internal transfection standards
such as respiratory syncytial virus-ß-galactosidase were not used as
they responded to cytokine treatment in this system. Assays were
carried out in duplicate, and experiments were repeated at least three
times. For Fig. 3
, in which the results are presented as fold change,
the basal level of luciferase activity varied within a narrow range for
all constructs except -55. In some experiments with this construct,
the basal luciferase activity was elevated in the absence of p50
overexpression. However, the fold changes as presented in the figure
were highly reproducible for all constructs.
|
Hep 3B cells were washed with and incubated in serum-free medium for 16 h and then left untreated or treated either with 20 ng (200 U)/ml of IL-1ß or with the combination of 10 ng (100 U)/ml of IL-6 and 20 ng (200 U)/ml of IL-1ß for 15 min or 18 h. The nuclear extracts were prepared according to Schreiber et al. (24) with some modifications. Cells (70–80% confluent) were washed with cold PBS and resuspended in 3x packed cell volume of lysis buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 1 mM PMSF, 0.1 mM sodium orthovanadate, and 0.2% Nonidet P-40) by gentle pipeting on ice for 15 min. The nuclei were pelleted in a microcentrifuge at 12,000 x g at 4°C for 30 s and resuspended in 3x packed nuclear volume of high salt buffer (20 mM HEPES, pH 7.9, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 420 mM NaCl, 20% glycerol, 1 mM DTT, 1 mM PMSF). The suspension was rocked gently for 30 min at 4°C followed by microcentrifugation at 12,000 x g for 10 min at 4°C. The protein concentration in supernatant/nuclear extracts was determined with the BioRad protein assay kit.
EMSA
The oligonucleotide containing the C/EBP-binding site derived
from the CRP promoter and the NF-B consensus oligonucleotide
used in the EMSAs were: 5'-TACATAGTGGCGCAAACTCCCTT-3' and
5'-GATCCAAGGGGATTCCCATG-3', respectively. A B consensus
oligo that preferentially binds p50 homodimers was designed according
to a published sequence (25). Complementary
oligonucleotides were annealed and end-labeled with
[
-32P]ATP using T4 polynucleotide kinase. EMSA was
carried out as published previously with some modification
(5). Recombinant p50 (38 ng/0.4 gel shift units) or
nuclear extracts (6 µg protein/2 µl extract) were incubated with
about 0.5 ng of labeled double-stranded oligonucleotide probe (sp.
act., 
5.0 x 106 cpm/ng) in gel shift incubation
buffer (16 mM HEPES, pH 7.9, 40 mM KCl, 1 mM EDTA, 2.5 mM DTT, 8%
Ficoll, and 1 µg of poly(dI-dC)) for 20 min at room temperature. In
supershift experiments, Ab (2 µg) was added to the reaction mixture
and incubated on ice for 15 min before addition of the probe. In
competition experiments, a 200-fold molar excess of unlabeled oligo was
added to the binding reactions and incubated on ice for 15 min before
addition of the probe. The DNA-protein complexes were resolved by
electrophoresis on a 5% native polyacrylamide gel in 0.25 x TBE
(1 x TBE: 89 mM Tris-HCl, 89 mM boric acid, and 2 mM EDTA) at 10
V/cm. The gels were dried and analyzed by ImageQuant software
(Molecular Dynamics, Sunnyvale, CA) in a phosphor imager.
Plasmid construction and site-directed mutagenesis
Deletion constructs of the CRP promoter (5' flanking/5' untranslated region), -55/+9, -86/+9, -125/+9, -256/+9, -339/+9, -539/+9, and -904/+9 CRP-CAT3M, were subcloned from the CAT3M vector to pGL2-basic by cleaving the promoter fragments with XbaI (5') and BglII (3') and the vector with NheI and BglII. -157/+3 CRP-luciferase has been previously reported (3). Constructs containing a mutated C/EBP site and a p50-binding site, centered at -52 and -43 position, respectively, were generated using a Stratagene Quick-Change site-directed mutagenesis kit according to the manufacturer’s instructions. The natural sequence for C/EBP, -55GGCGCAA-49, was replaced with nucleotides, -55GGATATC-49, using mutagenic primers (5' primer; GGAAAATTATTTACATAGTGGATATCACTCCCTTACTGCTTTGG and 3' primer; CCAAAGCAGTAAGGGAGTGATATCCACTATGTAAATAATTTTCC). The CRP-derived putative p50 binding sequence, -45CCCT-42, was replaced with -45ATAG-42 using mutagenic primers: 5' primer, GTGGCGCAAACTATAGTACTGCTTTGG; and complementary primer, CCAAAGCAGTACTATAGTTTGCGCCAC.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B subunit p50 transactivates CRP gene
expression, while p65 inhibits it
Overexpression of p50 in Hep 3B cells increased basal expression
of a -157/+3 CRP-LUC construct 10-fold (compare lanes 1 and
5, Fig. 1). Similar patterns
of response were seen in other CRP-LUC deletion constructs studied,
-904/+9, -539/+9, -339/+9, and -256/+9 (not shown). The effects of
cytokine treatment on p50-transfected cells were substantially greater
than and differed somewhat from those seen in cells not transfected
with p50 DNA. IL-1ß caused a 3-fold increase in luciferase expression
in cells overexpressing p50 but had no effect in cells not transfected
with the p50 DNA (lanes 2 and 6).
Comparable 4-fold enhancement in expression was caused by IL-6 in Hep
3B cells (lanes 3 and 7), whether or not
they were overexpressing p50, while the 12-fold increase caused by IL-6
plus IL-1ß in p50-overexpressing cells was somewhat less than the
30-fold increase observed in untransfected cells (lanes
4 and 8).
|
; the other CRP-LUC deletion
constructs studied, -904/+9, -539/+9, -339/+9, and -256/+9, showed
similar patterns of response.
Because p65 is usually an activator, the inhibitory effect of p65 on
CRP gene expression that we found prompted us to determine whether the
p50 and p65 plasmids we employed possessed the expected biologic
activity. We determined luciferase activity in Hep 3B cells
cotransfected with either of these plasmids and a construct containing
five B sites linked to a minimal promoter and a luciferase reporter
(pNF-B-LUC). As expected, cells overexpressing p65 exhibited a
marked transactivation activity on pNF-B-LUC expression, while cells
overexpressing p50 did not stimulate this construct and cotransfection
with p50 diminished the effect of p65 (Fig. 2).
|
To map the position of the p50-responsive sequence element, we
determined the effect of p50 overexpression on a series of eight CRP
promoter deletion constructs varying from 904 to 55 bp 5' flanking DNA
(Fig. 3). P50 overexpression in the
absence of cytokines induced a 6- to 10-fold increase in expression of
the luciferase reporter compared to untreated controls in all
constructs but -55. The data in Figs. 1 and 3 are consistent with the
major p50 response region lying 3' to nucleotide -86. Accordingly, we
examined the sequence of this region for a possible p50-binding site
and noted that the C/EBP-binding site centered at -52, previously
shown to be critical to CRP induction (6, 8), overlaps a
nonconsensus B site (-50AAACTCCCTT-41)
(Fig. 4).
|
B site derived from the CRP promoter
overlapping a C/EBP-binding site
To test the hypothesis that p50 might bind to this site, we
performed an EMSA using purified rhp50 as a protein source and a 22-bp
probe (-41/-63), derived from the CRP promoter, that contained both
the C/EBP-binding site and this nonconsensus B site (Fig. 5). We found that rhp50 bound to this
probe (lane 1). The resulting band was supershifted
by an Ab to p50 (lane 2). The specificity of this
interaction was shown by competition with an excess of either
self-oligo or consensus B site oligo (lanes 3 and
10), while a consensus C/EBP-binding site oligo did not
compete (lane 11).
|
B site requires an intact
polypyrimidine sequence. Disrupting two of the three purine residues
that overlapped the core C/EBP site and nonconsensus B site (M6)
affected binding of p50 to the wild-type oligo only moderately
(lane 9). Similar results were obtained when these
oligos were used as labeled probes.
Mutation at the nonconsensus B sequence overlapping the
C/EBP-binding site inhibited the inducing effect of cytokines
We next explored the roles of the nonconsensus B sequence and
of the adjacent C/EBP site in induction of CRP by cytokines. We
performed transient transactivation assays using -125/+3 CRP-LUC
constructs containing mutations at either the polypyrimidine
p50-binding site at -43 or the C/EBP site at -52. In cells
transfected with constructs bearing the C/EBP mutation (Fig. 6), basal expression was virtually
abolished, as were both the modest response to IL-6 and the robust
response to IL-6 plus IL-1ß. The effects of the p50 site mutation
were somewhat less marked. Basal expression was halved, the IL-6
response was abolished, and the response to IL-6 plus IL-1ß decreased
by about half compared to cells transfected with wild-type constructs.
No effect of IL-1ß alone was observed in any condition. The 8.8-fold
incremental effect induced by IL-1ß over that observed with IL-6
alone in wild-type cells did not differ substantively from the 8.6-fold
increase observed in cells transfected with constructs bearing the p50
site mutation. The finding that mutation both at the C/EBP-binding site
and at the adjacent nonconsensus B sequence inhibited the inducing
effect of cytokines demonstrates that binding of both C/EBP proteins
and p50 to DNA is required to achieve optimal transactivation in
response to cytokines.
|
We determined whether p50 and p65 are activated in Hep 3B cells
18 h after cytokine stimulation, a time of marked C/EBPß
activation. We performed EMSA using a consensus B probe to ensure
that any p65 present in the extracts could be detected. Nuclear
extracts from untreated Hep 3B cells formed a complex with the probe,
which was supershifted by an Ab to p50 but was not supershifted by an
Ab to p65 (Fig. 7). Stimulation with
IL-1ß for 15 min yielded a band supershifted by Abs to both p50 and
p65. However, when IL-1ß stimulation was continued for 18 h, the
resulting band was supershifted by an Ab to p50, but only minimally
altered by an Ab to p65. Comparable results were seen following
stimulation with IL-6 plus IL-1ß, while IL-6 alone did not yield
results different from unstimulated cells (data not shown). These
findings indicate that p50- but not p65-containing dimers are present
in nuclei of Hep 3B cells, both unstimulated and 18 h after
stimulation with IL-1ß.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B
sequence overlapping the proximal C/EBP site of the CRP promoter, while
overexpressed p65 repressed both basal and cytokine-induced CRP
expression; 2) binding of p50 to this site was dependent on an intact
pyrimidine-rich sequence; 3) complete transcriptional activation of
the proximal CRP promoter by IL-6 and IL-6 plus IL-1ß required that
both the proximal C/EBP-binding site and this nonconsensus B
sequence be intact; and 4) p50- but not p65-containing dimers were
found in nuclei of Hep 3B cells, 18 h after stimulation with
IL-1ß. We conclude that IL-6 plus IL-1ß causes activation of C/EBP
species and p50-containing dimers, with consequent binding of these
transcription factors to adjacent sites on the CRP promoter.
Furthermore, because this effect is inhibited by overexpressed p65, we
conclude that p50 homodimers (or alternatively the heterodimers
p50/c-rel or p50/rel B), but not the p50/p65 heterodimer, are acting as
activators of CRP gene expression.
Transactivation by overexpressed p50 alone is unusual because p50 lacks
a transactivation domain. In general, it is p65, and not p50, that is
the positive effector of inflammation-associated genes (9, 11, 12, 18, 23, 26, 27, 28). There are only rare studies in which
overexpressed p65 was found to act as a repressor (29).
Interestingly, SAA, which accumulates in blood with kinetics similar to
those of CRP following an acute-phase stimulus and whose induction in
Hep 3B cells also requires the combination of IL-6 and IL-1
(11), uses p65 as an activator of its transcription in
contrast to CRP (30). Our observation that p65
overexpression inhibits the inducing effects of both p50 and of
cytokines can be explained by either displacement or sequestration of
p50, rendering it unable to participate in transactivation. The latter
is more likely because p65-containing dimers are not detected by EMSA
when the nonconsensus B site in the CRP promoter is used as a probe
and nuclear extracts known to contain p65 (Fig. 5) are employed (A.
Agrawal et al., manuscript in preparation).
The functional importance of p50 binding to the CRP promoter was substantial. While mutation in the proximal C/EBP-binding site completely inhibited the effects of IL-6 and IL-6 plus IL-1ß, consistent with previous reports demonstrating the importance of this binding site (6, 10), mutation of the putative p50-binding site similarly completely inhibited IL-6 activity and greatly reduced the effect of IL-6 plus IL-1ß. This finding indicates that p50 plays an active role in response to IL-6, even though p50 is not known to be activated by IL-6 and EMSA studies did not show IL-6 to induce nuclear p50 in our system.
The mechanism by which p50 transactivates CRP is uncertain. Several
recent reports (31, 32, 33) have demonstrated that p50 or p52
homodimers can act as transcriptional activators in systems in which
the IB family member Bcl-3 acts as a coactivator. We have not found
Bcl-3 to be present in p50-DNA complexes in our system. This finding
suggests that this mechanism is not responsible for the inducing effect
of p50 on CRP, although our findings are not definitive. Indeed, our
finding that mutation of the C/EBP-binding site abolishes the response
to p50 (A. Agrawal et al., manuscript in preparation) supports our view
that an alternative mechanism, dependent upon the transactivating
domain of C/EBP proteins, is responsible.
The presence of p50-containing dimers in nuclei of unstimulated cells
of various cell types is well documented (34, 35), and
indeed we have shown such species in our system (Fig. 7). The finding
of p50- but not p65-containing dimers in nuclei of Hep 3B cells 18
h after stimulation with IL-1ß is consistent with interaction between
C/EBPß, known to be greatly activated at this time point, and p50.
Physical interaction in vitro between p50 and C/EBPß has been
reported (36), but a functional role for such binding has
not previously been demonstrated. In addition, physical and functional
interaction between Rel domains of p65 and the bZIP domain of C/EBP
species has also been observed (37). Our results are
consistent with a model in which p50 functionally interacts with
cytokine-activated C/EBP species to activate transcription. It is not
as yet clear whether physical binding of p50 to C/EBP species occurs in
this system.
We propose a model in which p50 enhances cytokine-induced transcription
of CRP indirectly by affecting functional activity of the transcription
factor C/EBPß, which can be activated by both IL-6 and IL-1ß (Fig. 8). We speculate that p50 may physically
interact with C/EBP, enhancing its DNA binding affinity or stabilizing
C/EBP binding to DNA. Alternatively, p50 binding to the nonconsensus
B site may cause a conformational change in DNA, facilitating C/EBP
binding to DNA or bringing C/EBP in closer contact with the basal
transcription machinery.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Cell and Analytical Biology, Bayer
Corporation, Berkeley, CA 94710.
3 Address correspondence and reprint requests to Dr. Irving Kushner, MetroHealth Medical Center, Division of Rheumatology, 2500 MetroHealth Drive, Cleveland, OH 44109.
4 Abbreviations used in this paper: CRP, C-reactive protein; SAA, serum amyloid A; rh, recombinant human.
Received for publication April 25, 2000. Accepted for publication July 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
NF-IL6ß, are induced by IL-6 to promote acute phase gene transcription via different mechanisms. Nucleic Acids Res. 21:289.B-like binding sites on rat serum amyloid A1 gene expression in liver cells. Nucleic Acids Res. 20:4765.B and NF-IL6 transactivating factors in the synergistic activation of human serum amyloid A gene expression by interleukin-1 and interleukin-6. J. Biol. Chem. 268:25624.B and C/EBP heteromer in lipopolysaccharide induction of serum amyloid A gene expression in liver. J. Biol. Chem. 270:7365.B/Rel proteins and cytokine synthesis. Cytokine Growth Factor Rev. 7:175.[Medline]
B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.B site and p65 homodimers. J. Biol. Chem. 270:933.
induced, NFB mediated trans-activation of the angiotensinogen gene acute-phase response element. EMBO J. 9:3933.[Medline]
B p65 and NF-interleukin-6 binding elements in the tumor necrosis factor response region of the granulocyte colony-stimulating factor promoter. Blood 83:2469.B p50 homodimer bound to DNA. Nature 373:311.[Medline]
-1 acid glycoprotein (AGP) gene by synergistic interaction of two alternative activator forms of AGP/enhancer-binding protein (C/EBPß) and NF-B or Nopp140. Mol. Cell Biol. 16:4257.[Abstract]
) stimulates B element-mediated transcription in transfected cells. J. Biol. Chem. 271:5595.B inhibits expression of the 1(I) collagen gene. DNA Cell Biol. 18:751.[Medline]
B and C/EBP in the transcriptional regulation of genes. Int. J. Biochem. Cell Biol. 29:1525.[Medline]
B. Genes Dev. 6:775.B1 (p50) homodimers in vivo. Mol. Cell Biol. 16:1342.[Abstract]
B and IB proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
B during human mononuclear phagocyte differentiation to macrophages and dendritic cells. Biochem. Biophys. Res. Commun. 268:99.[Medline]
B associates with the NF-IL6 transcription factor. Proc. Natl. Acad. Sci. USA 89:8145.B and C/EBP family members: a Rel domain-bZIP interaction. Mol. Cell Biol. 13:3964.This article has been cited by other articles:
|
|
 |
|
  D. P. Young, I. Kushner, and D. Samols Binding of C/EBP{beta} to the C-Reactive Protein (CRP) Promoter in Hep3B Cells Is Associated with Transcription of CRP mRNA J. Immunol., August 15, 2008; 181(4): 2420 - 2427. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nishikawa, K. Hagihara, S. Serada, T. Isobe, A. Matsumura, J. Song, T. Tanaka, I. Kawase, T. Naka, and K. Yoshizaki Transcriptional Complex Formation of c-Fos, STAT3, and Hepatocyte NF-1{alpha} Is Essential for Cytokine-Driven C-Reactive Protein Gene Expression J. Immunol., March 1, 2008; 180(5): 3492 - 3501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Liu, L. Ye, G. J. Christianson, J.-Q. Yang, D. C. Roopenian, and X. Zhu NF-{kappa}B Signaling Regulates Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG via Intronic Binding Sequences J. Immunol., September 1, 2007; 179(5): 2999 - 3011. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. S. Choi, J. Hur, and S. Jeong {beta}-Catenin binds to the downstream region and regulates the expression C-reactive protein gene Nucleic Acids Res., August 17, 2007; (2007) gkm547v1. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. P. Singh, B. Voleti, and A. Agrawal A Novel RBP-J{kappa}-Dependent Switch from C/EBPbeta to C/EBP{zeta} at the C/EBP Binding Site on the C-Reactive Protein Promoter J. Immunol., June 1, 2007; 178(11): 7302 - 7309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cao, X. Zhang, J. P. Edwards, and D. M. Mosser NF-{kappa}B1 (p50) Homodimers Differentially Regulate Pro- and Anti-inflammatory Cytokines in Macrophages J. Biol. Chem., September 8, 2006; 281(36): 26041 - 26050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kathiresan, M. G. Larson, R. S. Vasan, C.-Y. Guo, P. Gona, J. F. Keaney Jr, P. W.F. Wilson, C. Newton-Cheh, S. L. Musone, A. L. Camargo, et al. Contribution of Clinical Correlates and 13 C-Reactive Protein Gene Polymorphisms to Interindividual Variability in Serum C-Reactive Protein Level Circulation, March 21, 2006; 113(11): 1415 - 1423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Kota, C. V. Ramana, F. A. Tenorio, R. I. Enelow, and J. C. Rutledge Differential Effects of Lipoprotein Lipase on Tumor Necrosis Factor-{alpha} and Interferon-{gamma}-mediated Gene Expression in Human Endothelial Cells J. Biol. Chem., September 2, 2005; 280(35): 31076 - 31084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Voleti and A. Agrawal Regulation of Basal and Induced Expression of C-Reactive Protein through an Overlapping Element for OCT-1 and NF-{kappa}B on the Proximal Promoter J. Immunol., September 1, 2005; 175(5): 3386 - 3390. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zelivianski, R. Glowacki, and M.-F. Lin Transcriptional activation of the human prostatic acid phosphatase gene by NF-{kappa}B via a novel hexanucleotide-binding site Nucleic Acids Res., July 7, 2004; 32(12): 3566 - 3580. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Iwasaki, M. Asai, M. Yoshida, T. Nigawara, M. Kambayashi, and N. Nakashima Dehydroepiandrosterone-Sulfate Inhibits Nuclear Factor-{kappa}B-Dependent Transcription in Hepatocytes, Possibly through Antioxidant Effect J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3449 - 3454. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Y. Hong, J. H. Park, R. S. Ahn, S. Y. Im, H.-S. Choi, J. Soh, S. H. Mellon, and K. Lee Molecular Mechanism of Suppression of Testicular Steroidogenesis by Proinflammatory Cytokine Tumor Necrosis Factor Alpha Mol. Cell. Biol., April 1, 2004; 24(7): 2593 - 2604. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.M. Hirschfield and M.B. Pepys C-reactive protein and cardiovascular disease: new insights from an old molecule QJM, November 1, 2003; 96(11): 793 - 807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-Y. Ma, H. Wang, B. Ding, H. Zhong, S. Ghosh, and P. Lengyel The Interferon-inducible p202a Protein Modulates NF-{kappa}B Activity by Inhibiting the Binding to DNA of p50/p65 Heterodimers and p65 Homodimers While Enhancing the Binding of p50 Homodimers J. Biol. Chem., June 13, 2003; 278(25): 23008 - 23019. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Kleemann, P. P. Gervois, L. Verschuren, B. Staels, H. M. G. Princen, and T. Kooistra Fibrates down-regulate IL-1-stimulated C-reactive protein gene expression in hepatocytes by reducing nuclear p50-NFkappa B-C/EBP-beta complex formation Blood, January 15, 2003; 101(2): 545 - 551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Feister, B. J. Auerbach, L. A. Cole, B. R. Krause, and S. K. Karathanasis Identification of an IL-6 response element in the human LCAT promoter J. Lipid Res., June 1, 2002; 43(6): 960 - 970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chi, S. Tridandapani, W. Zhong, K. M. Coggeshall, and R. F. Mortensen C-Reactive Protein Induces Signaling Through Fc{gamma}RIIa on HL-60 Granulocytes J. Immunol., February 1, 2002; 168(3): 1413 - 1418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Agrawal, H. Cha-Molstad, D. Samols, and I. Kushner Transactivation of C-Reactive Protein by IL-6 Requires Synergistic Interaction of CCAAT/Enhancer Binding Protein {{beta}} (C/EBP{{beta}}) and Rel p50 J. Immunol., February 15, 2001; 166(4): 2378 - 2384. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
