| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Pathology, Harvard Medical School, Boston, MA 02115; and
Millennium Pharmaceuticals, Cambridge, MA 02139
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-6 transcripts were also noted, as
was autocrine induction of MIP-2 and KC message. In addition, low
levels of MIP-1 and MIP-1ß were induced following treatment with
MIP-2 or KC. These effects are specific to astrocytes as MIP-2
treatment of microglial cells failed to elicit chemokine production.
The astrocyte chemokine receptor for MIP-2 has 2.5 nM affinity for
ligand. Astrocytes from CXCR2-deficient mice still respond to KC and
MIP-2, indicating the presence of an alternative or novel high affinity
receptor for these ligands. We propose that this KC/MIP-2 chemokine
cascade may contribute to the persistence of mononuclear cell
infiltration in demyelinating autoimmune
diseases. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The potential involvement of chemokines in the pathogenesis of various
infectious and inflammatory diseases has drawn considerable attention
(3, 5, 6, 7). Multiple sclerosis
(MS)3 is an
inflammatory demyelinating disease of the CNS in which immunologic
processes contribute to the initiation and continuation of disease.
Several studies suggested that cytokines and chemokines are involved in
the pathogenesis of MS. Histochemical analysis of MS brain or spinal
cord indicates that expression of the CC-chemokines, monocyte
chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1
(MIP-1), inflammatory protein-10 (IP-10), and RANTES correlated with
the local infiltration of macrophages (8, 9, 10, 11). These
and other data suggest a role for chemokines in the mononuclear
cell infiltrates associated with various forms of MS.
Recruitment of leukocytes is a crucial feature of neuroimmune
disorders. Chemokines have been associated with neuroinflammatory
processes such as experimental allergic encephalomyelitis (EAE) that
share clinical and pathological features with MS. In rodents, message
for MCP-1 and MIP-1 correlated with disease severity and occurred
along with, or before, disease onset (12, 13, 14, 15). Independent
experiments using anti-chemokine Abs also indicate a role for
CC-chemokines in the evolution of CNS pathogenesis. Administration of
Abs directed to MIP-1 reduced inflammation and CNS damage, as
evidenced by reduction of clinical symptoms in acute EAE disease models
(16, 17). Treatment with anti-MCP-1 reduced clinical
signs and inflammation in mice with relapsing-remitting EAE
(16). Although the appearance of neutrophils is uncommon
during EAE (18, 19), expression of some neutrophil
chemoattractants, e.g., the CXC-chemokine KC, is associated with
disease (12).
Most studies of chemokines have focused on their roles in leukocyte migration and activation. In this report, we examine the effects of chemokines on the parenchymal cells of the CNS, especially astrocytes. We previously demonstrated that the CXC-chemokine KC induced pertussis toxin-sensitive astrocyte chemotaxis (20). This report extends these observations, demonstrating that treatment of astrocytes with KC or MIP-2 induces expression of chemokines and cytokines. This astrocyte-associated inflammatory cascade may contribute to the persistence of inflammation in the CNS.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to 12-wk-old C57BL/6, BALB/cJ, and SJL/J female mice were purchased from The Jackson Laboratory (Bar Harbor, ME). CXCR2-deficient mice were purchased from The Jackson Laboratory and bred in our animal facilities. The mice used in these studies were genotyped to confirm the homozygous deficiency. Mice were maintained under the guidelines of the Committee on Animals of the Harvard Medical School and those prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Research Council (Department of Health and Human Services Publication, NIH 85-23: revised 1985).
Reagents
Recombinant mouse TNF-, MIP-2, KC, and MCP-1 were purchased
from R&D Systems (Minneapolis, MN). Recombinant mouse TCA4 was prepared
as described previously (21). All chemokine reagents were
passaged over Detoxi-Gel (Pierce Chemical, Rockford, IL) to eliminate
potential endotoxin contamination. Murine IFN-
was purchased from
Genzyme (Cambridge, MA), and LPS and thrombin were obtained from Sigma
(St. Louis, MO). Mouse IL-1ß, 2H5 anti-MCP-1 mAb, and
biotinylated monoclonal 4E2 anti-MCP-1 were purchased from
BD-PharMingen (San Diego, CA). The 5F11 anti-MCP-1 Ab was prepared
as detailed elsewhere (22). Anti-KC antisera and
monoclonal anti-KC Ab were obtained from R&D Systems. BSA was
purchased from U.S. Biochemicals (Cleveland, OH).
Experimental allergic encephalomyelitis
For acute EAE, SJL/J mice were injected s.c. at the base of the tail and the nape of the neck with a total of 50 µg proteolipid protein (PLP) peptide 139–151 emulsified in CFA, containing 400 µg of Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI) as reported elsewhere (23). Twenty-four hours later, mice were injected i.v. with 200 ng pertussis toxin (List Biological Laboratories, Campbell, CA). To induce chronic relapsing-remitting EAE, SJL/J mice were given 25 µg PLP peptide in CFA followed by 100 µg pertussis toxin 24 h later.
Immunohistochemistry
Mice were sacrificed by CO2 asphyxiation and immediately perfused via the left ventricle with sterile PBS before isolation of spinal cord, brain, and other tissues. Spinal cord was carefully dissected to preserve the meninges. Tissues were snap frozen in liquid nitrogen and kept at -80°C until preparation of RNA. Lumbar spinal cord was embedded in Tissue Tek OCT (Sakura Finetek, Torrance, CA) on dry ice and stored at -80°C for immunohistochemistry. Pieces of tissue were also fixed for standard histology in 10% phosphate-buffered formalin.
Cryostat sections were initially stained with hematoxylin and eosin. For immunohistochemistry, tissue sections were incubated overnight with primary Abs (Santa Cruz Biotechnology, Santa Cruz, CA); bound Abs were detected using a peroxidase-antiperoxidase method and the substrate diaminobenzidine, and counterstained as described (24). The following chemokines were analyzed; MCP-1, RANTES, KC, and MIP-2. The specificity of labeling was monitored by use of isotype-matched control mAbs, and controls for endogenous peroxidase (24). All samples were examined in blinded fashion, using at least five levels per sample for each marker.
Astrocyte isolation
Astrocytes were prepared from neonatal (<24 h) mouse brains, as described earlier (25). Briefly, after removal of the meninges, the brains were separated into single-cell suspensions by passage through a cell strainer (100 µm; Falcon, Becton Dickinson Labware, Franklin, NJ). The primary glial cell cultures were maintained in MEM (Life Technologies, Grand Island, NY) supplemented with 10% FCS (Sigma), 2 mg/ml glucose, and 5 µg/ml bovine pancreas insulin (Sigma.) referred to as "complete medium" in 10% CO2 at 37°C. After 10–12 days, the flasks were agitated on an orbital shaker (Lab-Line Orbit-Shaker; Lab-Line Instruments, Melrose Park, IL) for 5–14 h at 250 rpm at 37°C, and the nonadherent oligodendrocyte and microglial cells were removed. The astrocytes were trypsinized and expanded in complete medium. Three days after expansion, the flasks were agitated as described above and the medium was changed. Astrocytes used in the current experiments were cultured for a total of 20–26 days. To remove any residual oligodendrocytes and microglial cells, the flasks were agitated for 5–14 h as described above before harvest. Thereafter, the cells were trypsinized and washed three times. Astrocytes were reseeded with complete medium in 6-well plates and assayed on the following day in MEM without supplements. The purity of astrocytes was more than 95%, as determined by indirect immunofluorescence assay with anti-Mac-1 to detect microglial cells, anti-galactocerebroside to detect oligodendrocyte contamination, and anti-glial fibrillary acidic protein Abs to identify astrocytes (26).
Culture of microglial cells
Primary microglial cells were prepared from day-13 mixed glial cell cultures prepared as described above. Briefly, mixed glial cultures were agitated on an orbital shaker for 4 h at 250 rpm at 37°C. The supernatant was collected, and microglia were filtered through a 70-µm cell strainer (Falcon). Microglia were incubated on petri dishes in a moist 10% CO2 atmosphere for 20 min at 37°C. The unattached cells were removed, and the adherent microglial cells were collected with a cell scraper. The purity of microglia obtained by this procedure was >95% as determined by immunofluorescence with anti-Mac-1 Ab (27).
Detection of endotoxin
Limulus amebocyte lysate assays for the semiquantitation of endotoxin were conducted according to the manufacturer’s protocol (E-toxate; Sigma).
MCP-1 and KC quantitation
Immulon II 96-well microtiter plates (Dynatech Laboratories, Chantilly, VA) were coated with 50 µl containing 10 µg/ml purified anti-MCP-1 mAb (5F11) or 2 µg/ml anti-KC mAb (48415) in 50 mM sodium carbonate-bicarbonate buffer (pH 9) at room temperature for 5 h. The wells were blocked with 200 µl 3% BSA in PBS and incubated at 4°C overnight. After three washes, the experimental samples diluted in 3% BSA/PBS were incubated on the plates for 2–3 h at 37°C. After three additional washes, 50 µl biotinylated anti-MCP-1 mAb (4E2) or purified biotinylated anti-KC antiserum in 3% BSA/PBS was added to the wells and incubated for 2 h at room temperature. The ELISA plates were incubated with alkaline phosphatase-conjugated avidin for 2 h, and the reaction was developed with p-nitrophenylphosphate (Sigma). Titrations of purified recombinant mouse MCP-1 (BD-PharMingen) or KC (R&D Systems) were included in each experiment for preparation of standardization curves.
RNA isolation
RNA was isolated from cell suspensions using isolation procedures described previously (20). The RNA was further cleansed by precipitation followed by washing with isopropanol and 75% ethanol, respectively. RNA was finally suspended in 50 µl of diethyl pyrocarbonate-treated water.
RNase protection assay
Assays for chemokine message were conducted with multiprobe
templates according to the manufacturer’s protocol (RiboQuant assay
kit; BD-PharMingen). The assay kits can simultaneously detect message
for each of the following mouse chemokines: lymphotactin, RANTES,
eotaxin, MIP-1ß, MIP-1, MIP-2, IP-10, MCP-1, TCA3, plus mRNA for
the L32 and GAPDH housekeeping genes. In some experiments, RNase from
Torrey Pines Biolabs (San Diego, CA) was substituted for that included
with the above kit.
RT-PCR
Single-stranded cDNA was synthesized from RNA using the
Superscript Preamplification System for First Strand cDNA Synthesis
(Life Technologies, Gaithersburg, MD) with the following modifications.
Three µg total RNA was treated with 2 U DNase-I (bovine pancreas;
Sigma) for 15 min at room temperature in an 18-µl volume containing
1x PCR buffer and 2 mM MgCl2. It was then
inactivated by incubation with 2 µl 25 mM EDTA at 65°C for 10 min.
Three-µl random hexamers were added and annealed to the RNA according
to the manufacturer’s protocol. The reverse transcription reaction was
performed according to protocol for a doubled reaction with the
modification that 1.6 µl 10x PCR buffer and 1.4 µl 1.5 mM
MgCl2 were added. Half of the reaction mix (19
µl) was reserved for use as a control without addition of reverse
transcriptase. cDNA was then synthesized in a 20-µl reaction
containing 1.5 µg total RNA and 50–100 U reverse transcriptase. The
sequences of the MIP-2 primers were CAGAATTCACTTCAGCCTAGCGCCAT and
GCTCTAGAGTCAGTTAGCCTTGCCTTTG; the KC primers were
GCGAATTCACCATGATCCCAGCCACCCG and GCTCTAGATTACTTGGGGACACCTTTTAG; and
the ß-glucuronidase primers were ATCCGAGGGAAAGGCTTCGAC and
GAGCAGAGGAAGGCTCATTGG. PCR was conducted in a 20-µl reaction
mixture with 0.4 µl cDNA, 0.5 mM of each primer, and the
manufacturer’s Taq DNA polymerase conditions (Qiagen,
Valencia, CA). The PCR program included preincubation at 94°C for 2
min, amplification for 24–30 cycles of PCR at 94°C for 50 s
plus 55–58°C annealing for 50 s plus 72°C extension for
50 s, and a final 72°C 10-min extension. Six milliliters of the
PCR mixtures were visualized on 3% agarose minigels. 
174 RF
DNA/HaeIII fragments (Life Technologies) were included as
m.w. standards.
Radiolabeling of MIP-2
One microgram MIP-2 in 20 µl 0.1 M borate buffer, pH 8.5, was added to 250 µCi 125I-labeled Bolton-Hunter reagent (DuPont NEN Products, Boston, MA) and incubated on ice for 2 h. The reaction was terminated by addition of 300 µl of buffer containing 0.2 M glycine and 0.1 M sodium borate, pH 8.5. After 10 min on ice, the reaction mixture was applied to a Sephadex G-25 (Bio-Rad Laboratories, Hercules, CA) column. The radiolabeled MIP-2 fraction was collected after elution with PBS. The specific activity of radiolabeled MIP-2 was 1–5 x 107 cpm/µg.
125I-labeled MIP-2 binding to cells
The cell binding assay was conducted as previously described (28). Briefly, 2 x 104 astrocytes cultured in 96-well plates were washed twice with DMEM containing 1% BSA. Binding of 125I-labeled MIP-2 to astrocytes was performed for 2 h at 4°C in 96-well tissue culture plates. Excess ligand was removed by washing with DMEM containing 1% BSA, and the plates were cut into single wells for counting in a Packard Cobra gamma scintillation counter (Downers Grove, IL). Competition experiments with nonlabeled ligands were performed as detailed previously (28).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Localization of MIP-2, KC, RANTES, and MCP-1 expression was
followed in SJL mice primed with the encephalitogenic PLP peptide
(residues 139–151). During acute spikes of severe disease, resulting
paralysis of the tail and both hind limbs MIP-2 expression was dense in
leukocytes and astrocytes (Fig. 1
).
Moderate to strong staining of astrocytes plus focal staining of
leukocytes and some endothelial cells was noted with anti-KC Ab.
RANTES was also found in astrocytes and some leukocytes. During
episodes of peak disease MCP-1 was prominent in leukocytes and
astrocytes (Fig. 1). Spinal cord sections from normal mice were not
stained with the above Abs (data not shown).
|
). Although expression of the
neutrophil chemoattractants (MIP-2 and KC) were noted in both active
disease and remission, neutrophils were rarely observed within CNS
lesions. RNase protection assays were used to compare expression of
lymphotactin, RANTES, eotaxin, MIP-1ß, MIP-1, MIP-2, IP-10, MCP-1,
and TCA3 RNA in spinal cord specimens from mice with an acute flare
of relapsing-remitting EAE or after 1–3 wk of remission. Protected
bands were noted for RANTES, eotaxin, MIP-1, MIP-1ß, MIP-2, MCP-1,
and IP-10 in mice with active EAE, fewer transcripts were detected
during remission but a similar pattern of chemokine expression
persisted, whereas normal mice only express message for the L32 and
GAPDH housekeeping genes (Fig. 2A).
|
To further define the cellular sources and targets of the
chemokines MIP-2 and KC, we examined the ability of CNS parenchymal
cells to produce and respond to these stimuli in vitro. Primary
C57BL/6, BALB/c, or SJL/J-derived astrocyte cultures were incubated
with various cytokines or chemokines for 16 h and then harvested
for RNA isolation. Untreated astrocytes expressed message for the
housekeeping genes L32 and GAPDH and occasionally traces of RANTES or
MCP-1. Following treatment of astrocytes with LPS, thrombin, or
TNF-, the expression of RANTES, MIP-2, IP-10, and MCP-1-specific
bands was up-regulated (Fig. 2). Stimulation with IL-1ß induced
RANTES and MCP-1 but little IP-10, whereas IFN- treatment primarily
induced IP-10 transcripts (Fig. 2B). Because the probe for
IP-10 includes polymorphic sequences (Ref. 29 , and F.
R. Fischer, M. Berman, and M. E. Dorf, unpublished observations),
the protected bands exhibit differential localization in the C57BL/6
(Fig. 2B) and BALB/c (Fig. 2C) or SJL/J strains
(Fig. 2A). In contrast, treatment with the chemokines TCA4
or MCP-1 had little or no effect on chemokine expression. However,
incubation with KC or MIP-2 induced message for RANTES, MIP-2, IP-10,
and MCP-1 (Fig. 2, B and C). Because MIP-2
treatment induced the autocrine synthesis of MIP-2 and because KC and
MIP-2 are structurally related chemokines, we also examined the
autocrine activity of KC by RT-PCR. Indeed, treatment of astrocytes
with KC or MIP-2 in serum-free medium induces autocrine synthesis of KC
and MIP-2 message (Fig. 3). Controls
included examination of all samples for the housekeeping gene
ß-glucuronidase. The specificity of these responses was demonstrated
by the failure of medium, MCP-1, or TCA4 to induce message for either
of these chemokines (Fig. 3).
|
, IL-6, IFN-, IFN-ß, TGFß1,
TGFß2, and the housekeeping genes L32 and GAPDH by RNase protection
assay. As shown in Fig. 4, incubation
with KC or MIP-2 specifically up-regulated TNF-, IFN-, and IL-6
production, whereas treatment with MCP-1 or SDF-1 failed to induce
these transcripts. There were no significant increases in transcripts
of the other cytokines examined (Fig. 4).
|
A, incubation with
25 ng/ml MIP-2 or KC induced KC protein synthesis. The levels of KC
protein production are less than the input, implying that autocrine KC
synthesis may be self-regulating. For MCP-1 ELISA, the chemokine
stimulants remained in the cultures for 48 h, after which the
supernatants were harvested. Again, treatment with 25 ng/ml MIP-2 or
KC induced chemokine (MCP-1) protein synthesis (Fig. 5B).
Maximal MCP-1 production was noted 48 h after KC or MIP-2
addition. Incubation of astrocytes with 100 ng/ml TCA4 failed to induce
MCP-1 synthesis even after 4 days of stimulation (Figs. 5B
and 6A). Boiling of KC or MIP-2 chemokines for 30 min
completely destroyed the ability to induce MCP-1, contrasting with the
thermal resistance of LPS (Fig. 5C).
|
The kinetics of MIP-2 and KC induced chemokine expression were examined
at the protein level. After 2 days, MCP-1 responses reached a plateau
(Fig. 6A). In addition, the
kinetics of chemokine mRNA synthesis were examined; chemokine
transcripts were barely detectable after 1.5 h (Fig. 6B), 3 h after KC treatment 3- to 10-fold increases
were noted in the synthesis of MIP-1ß, MIP-1, MIP-2, MCP-1, and
IP-10 RNA (Fig. 6, B and C).
|
The ability of KC and MIP-2 to induce TNF-, which also
stimulates chemokine synthesis (Fig. 4), along with the 3-h delay in
messenger RNA synthesis (Fig. 6B) suggested that cytokines
may serve as intermediaries for chemokine synthesis. To assess whether
production of chemokine transcripts were regulated by de novo protein
synthesis, astrocytes were treated with 20 µg/ml cycloheximide, alone
or in combination with 100 ng/ml KC for 3 or 1.5 h. Cycloheximide
is a protein synthesis inhibitor that can cause superinduction of many
genes by preventing the degradation of otherwise labile mRNA.
Superinduction of MIP-2 and MCP-1 messages were noted after 3- or 1.5-h
incubations with KC and cycloheximide (Fig. 6, B and
C). Cycloheximide treatment induced smaller increases in
message levels for the other chemokines. Without addition of
cycloheximide or KC astrocytes produced little or no chemokine message
(Fig. 6B). However, following a 1.5-h treatment with only
cycloheximide, astrocytes expressed at least 4-fold more message for
the chemokines MIP-1, MIP-1ß, MIP-2, and MCP-1 suggesting that
newly synthesized proteins normally degrade these transcripts (Fig. 6, B and C).
Astrocyte specificity
To determine whether the astrocyte response to MIP-2 was cell
type-specific, microglial cells were treated with 1 µg/ml LPS, 10
ng/ml IL-1ß, 200 ng/ml MIP-2, or medium. In contrast to the data
reported on astrocytes (Fig. 5), microglia demonstrate little or no KC
protein production following stimulation with this high concentration
of MIP-2 (Fig. 7). In contrast, LPS or
IL-1ß treatment stimulated vigorous KC protein synthesis.
|
CXCR2, a seven-transmembrane-spanning G protein-coupled receptor,
is the established neutrophil receptor for KC and MIP-2
(30). However, in a previous report, CXCR2 was never
detected on mouse astrocytes by RT-PCR (20). We now extend
these results by demonstrating that astrocytes from CXCR2-deficient
mice make RANTES, MIP-1, MIP-2, MCP-1, and IP-10 RNA following
treatment with either KC or MIP-2 (Fig. 8A). Scatchard analyses were
performed to directly examine the binding of
125I-MIP-2 to astrocytes. Nonspecific binding was
evaluated by incubating astrocytes in the presence of 100-fold
molar excess unlabeled MIP-2. Specific binding data were used to derive
the equilibrium dissociation constant
(Kd). The plot of specific MIP-2
binding to astrocytes displayed a curvilinear pattern (Fig. 8B). Scatchard plots indicate a single class of receptor
with a calculated Kd of 2.5 x
10-9 M and 47,000 sites/cell (Fig. 8B).
|
C, KC efficiently competed for MIP-2 binding, MCP-1 was
much less efficient, and TCA4 was unable to compete for MIP-2 binding.
The inhibition was dose-dependent, with 50% inhibition at 7, 20, and
120 nM for MIP-2, KC and MCP-1, respectively (Fig. 8C). Even
though high concentrations of MCP-1 partially competed for MIP-2
binding, 100 ng/ml MCP-1 failed to stimulate chemokine synthesis (data
not shown). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, or IL-1, astrocytes also release many
of these chemokines (27, 37, 38). In this report, an
additional pathway for chemokine induction is demonstrated. The
CXC-chemokines MIP-2 or KC readily induced MCP-1, IP-10, RANTES, IL-6,
and TNF- expression in astrocytes, whereas message for MIP-1 and
MIP-1ß was induced with lower efficiency (Fig. 2). Interestingly, KC
displays autocrine activity, stimulating production of KC RNA and
protein (Figs. 3 and 5). MIP-2 also demonstrated autocrine activity on
astrocytes. The ability to amplify chemokine production provides a
mechanism that could at least temporarily sustain inflammatory
responses in the CNS. In addition, the induction of cytokines such as
IL-6 following KC/MIP-2-mediated astrocyte activation may contribute to
the development of reactive gliosis and scaring (39),
whereas TNF- and IFN- expression could contribute to
immunoreactivity (Fig. 4).
The KC amplification cascade is self-limiting as more KC is consumed
than generated (Fig. 5A). Furthermore, this chemokine
cascade was noted with astrocytes derived from EAE-sensitive SJL/J mice
and EAE-resistant C57BL/6 and BALB/c donors, a finding consistent with
the notion that genetic control of EAE susceptibility resides in the
afferent phase of the immune response.
Autocrine properties were previously reported for the human CXC
chemokine MGSA/gro-, which stimulated autoinduction in human
umbilical vein endothelial cells (40). The recent
description of chemokine autoinduction in mesengial cells
(41) suggests this may represent a general mechanism for
amplifying chemokine responses within the parenchyma. The ability of
MIP-2 and KC to amplify chemokine synthesis is tissue-specific because
similar effects were not noted using microglial cells.
Only a limited number of reports have described the effects of
chemokines on astrocytes. Heesen et al. (20) demonstrated
that KC stimulated astrocyte migration. We further reported that the
astrocyte KC receptor was novel as the conventional KC/MIP-2 receptor,
CXCR2, was not expressed in astrocytes. We extended these findings by
demonstrating that astrocytes from CXCR2-deficient mice also respond to
KC and MIP-2, indicating that CXCR2 is not required for astrocyte
responsiveness to these ligands. The affinity of the astrocyte MIP-2
receptor is 2.5 nM (Fig. 8B). This affinity is similar to
that of other chemokine receptors (30, 42). MIP-2 binding
was chemokine-specific, as another chemokine TCA4 did not compete.
However, the ability of MCP-1 to compete for MIP-2 binding albeit with
low affinity and without activating chemokine synthesis suggests that
only high affinity interactions successfully signal chemokine synthesis
(Fig. 8). The competition binding studies imply that KC and MIP-2 share
a common receptor. The parallel bioactivity of these structurally
related CXC-chemokines supports this interpretation.
Although chemokine production is generally associated with
inflammation, we noted sustained chemokine expression during EAE
remission even when the levels of inflammation were reduced (Fig. 1).
These findings were mirrored by in vitro data demonstrating prolonged
chemokine production by astrocytes even after the stimulus was removed
(Fig. 5A). Considering these kinetic features, we cannot
exclude the possibility that chemokine-activated astrocytes may also
provide repair and/or protective functions to the CNS especially during
EAE remission (33, 43). Astrocytes may also serve as a
MIP-2/KC sponge, reducing the amount of chemokine available to attract
neutrophils that are infrequent within the inflammatory lesions of EAE
and MS.
Cycloheximide dramatically up-regulated the levels of chemokine mRNA in resting astrocytes and cells stimulated for 1.5 or 3 h with KC. These observations suggest constitutive expression of inhibitory proteins that regulate chemokine mRNA degradation. Similar inhibitory proteins appear to regulate IL-8 production in bone marrow stromal cells (44) and endothelial cells (45) presumably by interactions with AU-rich sequences in the 3' untranslated region that confer instability to the RNA (46).
In summary, the data show that MIP-2 and KC stimulate a chemokine amplification cascade in astrocytes. These chemokine reactions may serve to extend chemokine production within the CNS parenchyma. The tissue-specific nature of this chemokine amplification pathway implies distinct signaling pathways are triggered in astrocytes vs hematopoetic-derived cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Martin E. Dorf, Department of Pathology, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115.
3 Abbreviations used in this paper: MS, multiple sclerosis; EAE, experimental allergic encephalomyelitis; MCP, monocyte chemoattractant protein; MIP, macrophage inflammatory protein; IP, inflammatory protein; PLP, proteolipid protein.
Received for publication March 10, 2000. Accepted for publication June 29, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IP-10 are expressed in demyelinating brain lesions. Proc. Natl. Acad. Sci. USA 96:6873. in the pathogenesis of the T cell-mediated autoimmune disease, experimental autoimmune encephalomyelitis. J. Immunol. 155:5003.[Abstract]
T cell depletion on chemokine and chemokine receptor expression in the central nervous system. J. Immunol. 164:2120. and MCP-1 differentially regulate acute and relapsing autoimmune encephalomyelitis as well as Th1/Th2 lymphocyte differentiation. J. Leukocyte Biol. 62:681.[Abstract]
shapes immune invasion of the central nervous system via regulation of chemokines. J. Immunol. 164:2759. and MIP-1ß in rat experimental autoimmune encephalomyelitis by in situ hybridization. J. Neuroimmunol. 77:17.[Medline]
promotes spinal cord oligodendrocyte precursor proliferation. J. Neurosci. 18:10457.This article has been cited by other articles:
|
|
 |
|
  S. Sinha, S. Subramanian, T. M. Proctor, L. J. Kaler, M. Grafe, R. Dahan, J. Huan, A. A. Vandenbark, G. G. Burrows, and H. Offner A Promising Therapeutic Approach for Multiple Sclerosis: Recombinant T-Cell Receptor Ligands Modulate Experimental Autoimmune Encephalomyelitis by Reducing Interleukin-17 Production and Inhibiting Migration of Encephalitogenic Cells into the CNS J. Neurosci., November 14, 2007; 27(46): 12531 - 12539. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Polanczyk, R. E. Jones, S. Subramanian, M. Afentoulis, C. Rich, M. Zakroczymski, P. Cooke, A. A. Vandenbark, and H. Offner T Lymphocytes Do Not Directly Mediate the Protective Effect of Estrogen on Experimental Autoimmune Encephalomyelitis Am. J. Pathol., December 1, 2004; 165(6): 2069 - 2077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhang, Q. Zhai, Y. Luo, and M. E. Dorf RANTES-mediated Chemokine Transcription in Astrocytes Involves Activation and Translocation of p90 Ribosomal S6 Protein Kinase (RSK) J. Biol. Chem., May 17, 2002; 277(21): 19042 - 19048. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Schuh, K. Blease, and C. M. Hogaboam CXCR2 Is Necessary for the Development and Persistence of Chronic Fungal Asthma in Mice J. Immunol., February 1, 2002; 168(3): 1447 - 1456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. J. McMahon, D. N. Cook, K. Suzuki, and G. K. Matsushima Absence of Macrophage-Inflammatory Protein-1{alpha} Delays Central Nervous System Demyelination in the Presence of an Intact Blood-Brain Barrier J. Immunol., September 1, 2001; 167(5): 2964 - 2971. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. R. Fischer, Y. Luo, M. Luo, L. Santambrogio, and M. E. Dorf RANTES-Induced Chemokine Cascade in Dendritic Cells J. Immunol., August 1, 2001; 167(3): 1637 - 1643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R.-F. Guo, A. B. Lentsch, R. L. Warner, M. Huber-Lang, J. V. Sarma, T. Hlaing, M. M. Shi, N. W. Lukacs, and P. A. Ward Regulatory Effects of Eotaxin on Acute Lung Inflammatory Injury J. Immunol., April 15, 2001; 166(8): 5208 - 5218. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP |
), KC (•), or TCA4 (
) at 37°C. After
24 h, the cultures were washed to remove the stimulus and the
cells were incubated an additional 48 h in serum-free medium. The
latter supernatants were collected and assayed for KC by ELISA. Data
represent a pooled composite of three independent experiments.
B, KC and MIP-2 induce MCP-1. Two x
104 cultured mouse astrocytes were treated with the
indicated concentrations of recombinant mouse MIP-2 (
) or untreated (
) before addition to the astrocyte cell
cultures. Supernatants were collected and assayed for MCP-1 by ELISA.
Data represent a pooled composite of three independent experiments
± SD.
) as indicated. The percent
inhibition of binding by unlabeled ligands was calculated as: 1 -
cell-bound cpm in the presence of unlabeled ligand/cell-bound cpm in
the absence of unlabeled ligand x 100%.