The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukumura, R.
Right arrow Articles by Abe, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukumura, R.
Right arrow Articles by Abe, M.
The Journal of Immunology, 2000, 165: 3883-3889.
Copyright © 2000 by The American Association of Immunologists

Signal Joint Formation Is Also Impaired in DNA-Dependent Protein Kinase Catalytic Subunit Knockout Cells1

Ryutaro Fukumura*,{dagger}, Ryoko Araki*, Akira Fujimori2,*, Yoko Tsutsumi*, Akihiro Kurimasa{ddagger}, Gloria C. Li§, David J. Chen{ddagger}, Kouichi Tatsumi* and Masumi Abe3,*

* National Institute of Radiological Sciences, Chiba, Japan; {dagger} Graduate School of Science and Technology, Chiba University, Chiba, Japan; {ddagger} Lawrence Berkeley National Laboratory, Berkeley, CA 94720; and § Memorial Sloan-Kettering Cancer Center, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The effort to elucidate the mechanism of V(D)J recombination has given rise to a dispute as to whether DNA-dependent protein kinase catalytic subunit (DNA-PKcs) contributes to signal joint formation (sjf). Observations reported to date are confusing. Analyses using DNA-PKcs-deficient cells could not conclude the requirement of DNA-PKcs for sjf, because sjf can be formed by end-joining activities which are diverse among cells other than those participating in V(D)J recombination. Here, we observed V(D)J recombination in DNA-PKcs knockout cells and showed that both signal and coding joint formation were clearly impaired in the cells. Subsequently, to directly demonstrate the requirement of DNA-PKcs for sjf, we introduced full-length cDNA of DNA-PKcs into the knockout cells. Furthermore, several mutant DNA-PKcs cDNA constructs designed from mutant cell lines (irs-20, V3, murine scid, and SX9) were also introduced into the cells to obtain further evidence indicating the involvement of DNA-PKcs in sjf. We found as a result that the full-length cDNA complemented the aberrant sjf and that the mutant cDNAs constructs also partially complemented it. Lastly, we looked at whether the kinase activity of DNA-PKcs is necessary for sjf and, as a result, demonstrated a close relationship between them. Our observations clearly indicate that the DNA-PKcs controls not only coding joint formation but also the sjf in V(D)J recombination through its kinase activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Variable diversity joining recombination occurs during lymphocyte development to generate active forms of the immunoglobulin and TCR genes. The recombination creates two kinds of DNA recombination products; one is the coding joint created by the recombination between protein coding gene segments (V, D, and J segments), and the other is the signal joint occurring between the recombination signal sequences neighboring the protein coding sequence (1).

The process of V(D)J recombination is roughly divided into four steps: recognition of the signal sequences, digestion, removal and/or addition of a few nucleotides, and ligation. The molecules participating in V(D)J recombination have been elucidated. These reactions are catalyzed by recombination activating gene (RAG)4-1, RAG-2, Ku70, Ku86, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), the x-ray cross complementation group (XRCC)4 gene product, and ligase IV (2, 3, 4, 5, 6, 7, 8). However, the precise role of these gene products in each of the steps is still unclear. Regarding DNA-PKcs, it has been demonstrated that DNA-PKcs contributes to the ligation step of the break sites. In this study, we attempted to clarify the role of DNA-PKcs in the recombination followed by the RAG digestion.

The mutants of DNA-PKcs are categorized to XRCC7 group and include murine scid, V3, irs-20, equine scid, SX9, and XR-C1 cells (9, 10, 11, 12, 13, 14, 15). There is a discrepancy among reports on the effect of the mutations in the DNA-PKcs gene on signal joint formation (sjf). Studies using murine scid, V3, and irs-20 cells have shown that only the coding joint formation (cjf) is impaired significantly (16), while other studies indicated that sjf was also impaired in equine scid, SX9, and XR-C1 cells in addition to cjf (14, 15, 17). Moderate impairment of sjf in murine scid cells has also been observed (18).

One of the hypotheses attempting to accommodate these conflicting observations proposes that murine scid, V3, and irs-20 cells have residual DNA-PKcs activity while the other mutant cells, equine scid, SX9, and XR-C1 cells, do not have any activity. Indeed, reports supporting this hypothesis have appeared recently (14, 19, 20, 21). An effective way to clarify this issue is to conduct an analysis using the DNA-PKcs knockout cells, because the knockout cells should be defective in both joint formations. Although some investigations of V(D)J recombination with DNA-PKcs knockout mice and cell lines have been conducted, it was reported, contrary to our expectation, that cjf was defective but sjf was relatively normal (20, 21, 22). Thus, the null phenotype of DNA-PKcs cells reflects impaired cjf but not impaired sjf.

To help solve this puzzle, we report our observations of sjf in two independent cell lines established from DNA-PKcs knockout mice. Furthermore, we used the full-length cDNA of DNA-PKcs to confirm the responsibility of DNA-PKcs for sjf.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

The cell lines PK33N and PK33S were established from the lung fibroblast cells of DNA-PKcs knockout mice. The exon 3 of the DNA-PKcs gene was knocked out in the mice (23). Meanwhile, the control cell lines PK34N and PK34S were derived from the lung fibroblast cells of a 129SV mouse bearing wild-type alleles of the DNA-PKcs gene. The PK33N and PK34N cell lines were established spontaneously whereas PK33S and PK34S were established with SV40 virus. These cells were cultured in {alpha}-MEM (Life Technologies, Rockville, MD) supplemented with 10% FCS, 1% L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin and were grown at 37° in 5% CO2.

V(D)J recombination assay

V(D)J recombination assay has been described (14, 24). Briefly, the eukaryotic expression vector BCMGSNeo which contains the CMV promoter bearing RAG-1 or RAG-2 (17.8 µg BCMGSNeo-TAG1 and 22.2 µg BCMGSNeo-TAG2); pME-PK7, 17.5 µg of which contains the SR{alpha} promoter bearing the murine DNA-PKcs gene; and the assay vector pJH200 (2 µg) were cotransfected into 5 x 106 cells using lipofect Amine plus reagent (Life Technologies). A pME18S vector (3.8 µg), which is identical with pME-PK7 except for the DNA-PKcs gene, was cotransfected as a control experiment. Furthermore, to test the role of the kinase activity in sjf, a DNA-PKcs cDNA (17.5 µg pME-mt-phosphatidylinositol 3-kinase (PI3K)) in which two point mutations were introduced in the kinase domain region, was used for the assay. After 48 h, the transfectants were harvested and the assay vectors were recovered by the rapid isolation method. The recovered DNA was digested with the restriction enzyme DpnI to eliminate unreplicated assay vectors, RAG, and DNA-PKcs expression vectors. Digested DNA was then transfected into Escherichia coli, DH10B strain (Life Technologies). The accuracy of sjf was assessed by digestion of the recovered plasmids from the E. coli using restriction enzyme ApaLI or DNA sequencing.

Preparation of mutant DNA-PKcs constructs

Two amino acids existing in the highly conserved PI3K motif (DXXXXN) were substituted (Asp3921 to Ala and Asn3926 to Lys) for preparing the kinase-defective construct, pME-mt-PI3K, using a QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Substitutions of Glu4125 to Lys, Gly4025 to ter, Tyr4046 to ter, and Leu3191 to Pro, which correspond to the mutations in the irs-20, V3, murine scid, and SX9 cell lines, respectively, were introduced. The methods used to prepare these constructs are listed below.

pME-PK7 (50 ng) was added as template DNA into 50 µl 1x mutagenesis buffer containing 125 ng of the following mutagenesis primers: CCTCGGGATTGGAGCCAGACACCTGAACAAATTCATGGTG and CACCATGAATTTGTTCAGGTGTCTGGCTCCAATCCCGAGG for the kinase-defective construct, pME-mt-PI3K; GGCAGGACTTGGGAAGGATGGAAGCCCTGGATGTAAAGTC and GACTTTACATCCAGGGCTTCCATCCTTCCCAAGTCCTGCC for the irs-20-type construct, pME-PK-irs20; GAGCAGACAATGCTGAGAAAAGGATGATCATGGATTCAAG and CTTGAATCCATGATCATCCTTTTCTCAGCATTGTCTGCTC for the V3-type construct, pME-PK-V3; CCACAACATAAAATACGCTAAGCTAAGAGAAAGTTAGCAG and CTGCTAACTTTCTCTTAGCTTAGCGTATTTTATGTTGTGG for the murine scid-type construct, pME-PK-scid; CAAATCGCTGCTTCTTTCCCAGTAAAATAGAAGAGAGACTG and CAGTCTCTCTTCTATTTTACTGGGAAAGAAGCAGCGATTTG for the SX9-type construct, pME-PK-SX9; and 2.5 units of Pfu DNA polymerase. The template was amplified for 12 cycles with a 9700 PCR thermocycler (Perkin-Elmer, Norwalk, CT; denaturation at 95°C for 30 s, annealing at 55°C for 1 min, and extension at 68°C for 40 min for each cycle). The amplified DNA was treated with the restriction enzyme DpnI to eliminate the template pME-PK7 DNA and then transfected into E. coli, strain SURE 2 (Stratagene). The introduction of the mutations in the isolated clones was confirmed by DNA sequencing.

Western blot analysis

Western blot analysis was conducted as described previously. Briefly, proteins in total cell lysates were separated by 5% SDS-polyacrylamide gel electrophoresis and electroblotted onto polyvinylidene diflouride membranes. Monoclonal 18-2 Ab (Kamiya Biomedical, Seattle, WA) was used. Immunoreactive bands were visualized with Lumi-Lightplus Western blotting substrate (Roche Diagnostics, Mannheim, Germany) and recorded on x-ray film followed by quantitation with an image analyzer (Light Capture; ATTO, Tokyo, Japan).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sjf in DNA-PKcs null cells is impaired

We established a DNA-PKcs knockout mouse strain in which exon 3 of the DNA-PKcs gene was disrupted. Disruption of the DNA-PKcs gene via homologous recombination gene and the absence of its products were confirmed (23). Two cell lines were independently established from the lung fibroblasts of the knockout mice. One (PK33N) was spontaneously established, and the other (PK33S) was established with SV40 virus.

To analyze the V(D)J recombination, RAG-1, RAG-2 expression vectors, and the pJH200 assay vector for sjf were simultaneously transfected into these knockout cells (24). Consequently, the recombination frequency of sjf decreased 2- to 4.5-fold in the DNA-PKcs-null cells. Next, the fidelity of sjf was clarified by digestion with the restriction enzyme ApaLI, because the recognition site for this enzyme must be created when sjf occurs precisely. Signal joint products recovered from PK33N and PK33S cells (13.8 and 19.3%) could be digested with ApaLI (Table IGo), a finding that showed the defect of sjf in the knockout cells. Next, we analyzed ApaLI-negative products. Forty ApaLI-resistant clones recovered from PK33N cells were sequenced (Fig. 1Go). All of these clones contained various lengths of deletions. Furthermore, interestingly, most of deletions in the ApaLI-negative clones occurred relatively symmetric from the break site created by the RAG proteins (Fig. 1GoB). The same observation was made in at least four additional experiments (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. Analysis of signal joint formation in DNA-PKcs knockout cells by extrachromosomal vector assay

 


View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. Analysis of sjf in PK33N. A, The sequence of signal joints recovered from PK33N cells. The signal joint sequence on pJH200 is shown at the top. Twenty-seven representative cases are shown. The solid bars indicate deleted nucleotides. The vertical bar indicates the break site of the joints. Short-stretch homologous regions of >1 bp are underlined. B, Symmetrical deletions in sjf observed in PK33N. A total of 40 ApaLI-negative clones recovered from PK33N cells were sequenced, and the number of nucleotides deleted from each side of the recombination signal sequence was plotted on the graph. The deletion numbers for the 23-spacer side and 12-spacer side were plotted on the x- and y-axis, respectively.

 
It is noteworthy that the frequency of recombination was reduced more in the PK33S cells than in the PK33N cells while the fidelity of recombination was impaired to 6-fold in both cell lines (Table IGo and Fig. 2Go). When the assay was performed on PK33S, significant numbers of ampicillin-resistant chloramphenicol-resistant colonies were obtained similar to the clones obtained from PK33N; however, the plasmids in these cells were shown to contain large deletions and to expand clonally. The ApaLI-negative clones recovered from PK33S cells were comprised of expanded oligoclones in which the recombination took place with large deletions (data not shown). Although we selected ampicillin-resistant chloramphenicol-resistant clones randomly and checked the length of the recombined region, we detected a large deletion and observed oligoclonal expansion, as mentioned above, but did not detect any other products generated by aberrant sjf (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. Complementation of sjf by a full-length DNA-PKcs cDNA. A, The frequency of sjf in DNA-PKcs knockout cells and their transformants with a full-length DNA-PKcs cDNA. The relative value when the absolute value of each parent cell is defined as 1.0 is shown. B, The fidelity of sjf in DNA-PKcs knockout cells and their transformants with a full-length DNA-PKcs cDNA. Vertical bar means SD.

 
Full-length DNA-PKcs cDNA complements the aberrant sjf in the PK33N and PK33S cells

To verify whether the defect of sjf in null cells was due specifically to the absence of DNA-PKcs, a full-length DNA-PKcs cDNA was introduced into the knockout cell lines, PK33N and PK33S. As a result, the fidelity of sjf in both knockout cell lines was dramatically restored (Table IGo and Fig. 2Go). Although the restoration of the recombination frequency in the two cell lines was different (0.92 for PK33N and 0.48 for PK33S), the recombination fidelity was similar (~70%). This observation, which was confirmed by more than four experiments, clearly verifies that the defect of sjf is due to a defect of DNA-PKcs in both knockout cells.

Sjf in knockout cells transfected by irs-20-, V3-, murine scid-, or SX9-type mutant cDNA constructs

To obtain further evidence for the contribution of DNA-PKcs to sjf, we also attempted to observe the sjf activity of known mutant DNA-PKcs molecules. We prepared mutant constructs corresponding to the published mutant sequences for irs-20, V3, murine scid, and SX9, in addition to the wild-type construct for analysis (Fig. 3GoA). The transfection of these DNA-PKcs constructs revealed that the irs-20 and V3 cells have partial activity while the SX9 cells do not have any activity (Table IIGo and Fig. 3GoC). The murine scid cells seemed to have partial activity, but more extensive experiments are required to obtain a conclusion (Fig. 3GoC).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Sjf activity of mutant constructs in knockout cells. A, The mutation in each construct. The shaded box shows the PI3K region (3654–4128). The position of the mutated amino acid is indicated above the rectangle. The amino acid number is indicated. Each amino acid is shown as one letter symbol. B, The expression of introduced constructs in the DNA-PKcs null cells. DNA-PKcs (upper) and Ku86 (lower) products detected by Western blotting using anti-DNA-PKcs (monoclonal 18–2, MBL) and anti-Ku86 (polyclonal M-20, SANTA CRUZ) are shown. A total of 20 µg whole-cell extract harvested at 24 h after transfection was loaded on each lane. Lane C, PK34S; lane 1, PK33S; lane 2, PK33S+pME-PK7; lane 3, PK33S+pME-PK-irs20; lane 4, PK33S+pME-PK-scid; lane 5, PK33S+pME-PK-V3; lane 6, PK33S+pME-PK-SX9; and lane 7, PK33S+pME-PK-mt-PI3K. C, The fidelity of sjf in PK33S cells following transfection of mutant DNA-PKcs constructs. Closed bars show relative value. Each lane is the same as B except lane C.

 

View this table:
[in this window]
[in a new window]
 
Table II. Analysis of signal joint formation in PK33S cells with mutant dna-pkcs constructs

 
This is the first direct evidence for the partial activity of mutant constructs irs-20 and V3.

Expression of each construct

The expression of constructs was measured by Western blot analysis. The expression of each transfected construct within the DNA-PKcs knockout cells was significant. No substantial difference was observed among V3, murine scid, SX9, and pME-mt PI3K, but the expression of the wild-type and irs-20 constructs was higher than that of the other constructs.

The amount of products expressed from the wild-type and irs-20 DNA-PKcs constructs in the knockout cells was approximately equal to that from endogenous DNA-PKcs gene in the parental cells (Fig. 3GoB).

Sjf requires the kinase activity of DNA-PK

Lastly, to clarify the relationship between sjf activity and kinase activity of DNA-PK, we attempted to determine whether the kinase activity of DNA-PKcs was required for complementation of the aberrant sjf in knockout cells by employing DNA-PKcs constructs encoding kinase-defective DNA-PKcs products. Two kinds of kinase-defective constructs, one considered to be a putative kinase negative and the other a kinase-negative construct, were prepared and used for the assay. In one construct, two amino acid residues in the PI3K motif were replaced (i.e., Asp3921 to Ala and Asn3926 to Lys), and in the other construct a leucine to proline substitution at nucleotide number 3191 was introduced. The former was designed according to mutations in ATM, which is another member of the PI3K family, while the latter is responsible mutation for SX9 (14, 25). Each construct was transfected together with RAG-1, RAG-2, and pJH200 into the DNA-PKcs null mutant cells. As a result, the defect of sjf in the null cells could not be complemented with SX9 construct and could be only moderately complemented with the another construct, pME-mt-PI3K (Table IIGo and Fig. 3GoC).

On the basis of these observations we conclude that the kinase activity of DNA-PKcs contributes to the sjf.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Confusion has inhibited an understanding of the role of the DNA-PKcs molecule in V(D)J recombination. In the past few years, a rather large number of groups have reported analyses of DNA-PKcs mutant cell lines. However, these results are inconsistent. Some groups reported a severe defect of sjf while others reported little or no defect in the XRCC7 cells. The sjf in murine scid, V3, irs-20, and M059J cells is not significantly impaired, but in equine scid, SX9, and XR-C1 it is drastically impaired (14, 15, 17, 18, 26, 27, 28).

A hypothesis attempting to resolve these contradictory observations proposed that murine scid, V3, and irs-20 are DNA-PKcs partially active mutant cells whereas equine scid, SX9, and XR-C1 correspond to null mutants of DNA-PKcs (14, 15, 17).

Analyses of V(D)J recombination in DNA-PKcs knockout cells are considered to be the most effective way to verify the above hypothesis. Indeed, several recent reports have described analyses of sjf in DNA-PKcs null mice (20, 21, 22). However, contrary to the hypothesis, no decrease in the frequency or fidelity of sjf in these animals was reported (20, 22), although a moderately decreased fidelity of sjf was observed in another study (21).

To help clarify this conundrum, we used two cell lines established from lung fibroblast cells of DNA-PKcs knockout mice in which exon 3 of the gene was disrupted (23). Sjf was analyzed in both cells using extrachromosomal assay vectors and was found to be impaired. In the case of the DNA PKcs knockout cell PK33N, the frequency of sjf was not remarkably impaired but the fidelity was clearly impaired, while in PK33S the frequency and the fidelity were remarkably impaired. Interestingly, the reduction of sjf frequency in each cell line was different but the reduction of sjf fidelity was quite similar. These findings suggest the existence of different levels of end-joining activity in each cell line, activity which does not usually participate in the V(D)J recombination process but can ligate imprecisely the blunt-end DNA molecules made by RAG digestion. This might be a reason for the difference between PK33N and PK33S cells. To date, the responsibility of DNA-PKcs for sjf has been discussed through the analysis of the various kinds of DNA-PKcs mutant cells including knockout cells. If the assay detects end-joining activities other than that in V(D)J recombination, it is difficult to obtain conclusive results through only measurement of the frequency of sjf occurring in DNA-PKcs-deficient cells.

Why then, does the frequency of sjf not decrease in a knockout cell line as much as the fidelity of sjf? Why do the other knockout mouse strains (20, 21, 22) show different effects in sjf from our knockout cell lines? For understanding the enigmatic phenomena, we propose the following hypothesis: The assay using extrachromosomal vector detects the recombination activity which usually participates in non-V(D)J as well as in V(D)J recombination. This means that the double-strand break ends generated by the RAG products can be ligated by a repair machinery that might be different in each cell type and that might be induced by several kinds of stimulation. This hypothesis is supported by the following observations: 1) V(D)J recombination of TCR genes in murine scid T cells can be restored by exposure to ionizing radiation (29, 30); and 2) the frequency and fidelity of sjf in the scid mouse-derived cells vary depending on the cell lineage (18). In addition, our observation that two independent DNA-PKcs knockout cells, PK33N and PK33S, exhibit a different frequency of sjf, but a similar fidelity also supports the hypothesis. Systematic analyses of sjf generated in various other cell lineages of knockout mice will provide further clarification.

Until now, analyses of sjf activity using DNA-PKcs-deficient cells, even knockout cells, have not concluded the responsibility of DNA-PKcs for sjf in V(D)J recombination. This fact indicated the limitations of analyses using only deficient cells. In contrast, it has been suggested that an approach using full-length cDNA, that is, to test whether the defect of sjf in the mutant cells can be complemented by the introduction of full-length cDNA, will provide a method to determine directly the relationship between DNA-PKcs and sjf activity.

What we want to know most is whether the DNA-PKcs controls the sjf or not. Use of full-length cDNA allows us to directly assess the role of DNA-PKcs in sjf, even if the tested cells have any end-joining activities other than that participating in V(D)J recombination.

Therefore, we attempted to introduce the full-length cDNA of DNA-PKcs into the knockout cells. Consequently, the fidelity of sjf was restored to ~80% of that in parent cells by the introduction of a full-length wild-type DNA-PKcs cDNA construct. This observation clearly indicated that DNA-PKcs controls sjf as well as cjf. Moreover, to confirm the requirement of DNA-PKcs for sjf, we also prepared mutated DNA-PKcs gene corresponding to the naturally occurring mutants irs-20, V3, murine scid, and SX9 and assessed their ability for sjf. Because end-joining activity other than that for V(D)J recombination might vary among different cell lines, we used an identical DNA-PKcs knockout cell line in the experiment as the recipient cell for transfection of each mutant construct. In other words, to perform the V(D)J recombination assay with an identical cell line as the recipient cell for each mutant construct is essential to exclude the difference of activities other than those participating in V(D)J recombination from the assay. By using various mutant constructs and performing the assay in the same cell line, we succeeded in determining a fine difference among each DNA-PKcs mutant product. As a result, the irs-20, V3, and murine scid products exhibited residual activity while the SX9 products were completely defective. Both the frequency and efficiency of sjf were assessed (Fig. 3GoC).

The amount of product expressed by mutant constructs is critical to a discussion of the activity of each mutant product. Therefore, the expression of the constructs introduced into the recipient cells was confirmed using Western blot analysis. The wild-type and the irs-20 mutant constructs expressed roughly two times more than the other constructs. This observation is consistent with the findings of certain other investigations that some mutant products are unstable compared with intact DNA-PKcs product.

Next, it should be noted that V3 product was expressed equally to the other mutant products in our system. Nevertheless, endogenous product expressed from mutant allele of V3 was not detected in the V3 cells (31), suggesting the presence of an additional mutation(s) that influence the transcription or stability of DNA-PKcs in the V3 cells.

Because of the high level of expression of the irs-20 construct, we could not exclude the possibility that elevated sjf activity elicited by the irs-20 construct was due simply to its high expression. In other words, there is a possibility that the activity of irs-20 product per molecule might be lower than that indicated by our assay. However, either way, the irs-20 product must be partially inactivated, because although the amount of the irs-20 product is more than that of intact product in the recipient cells, the activity of the former is less than that of the latter.

Next, it has been suggested that murine scid cells exhibit partial activity (14, 19, 20, 21), but our experiments did not lead to a conclusion on this point, because the difference between transfectants with the scid construct and the vector alone was too small to obtain a statistically reliable answer.

In this study we demonstrated the specific activity of mutant products under the same cell condition. It must be noted that the activity for sjf and stability of each mutant product shown in this study are characteristic in the specific cells, PK33S. To understand the known mutants phenotype, end-joining activities and the amount of mutant DNA-PKcs product in each mutant cell should be observed. Indeed, the amount of DNA-PKcs product expressed by irs-20 and V3 mutant constructs in our assay does not represent the amount of endogenous products observed in the irs-20 and V3 mutant cells. The amount of mutant products may be controlled by additional factors in each cell.

Our observations showed that sjf is impaired in our knockout cells and that the defect of sjf was restored by a full-length cDNA and partially restored by mutant DNA-PKcs constructs. Therefore, we conclude that DNA-PKcs has a crucial role in sjf of V(D)J recombination.

Lastly, to determine whether the role of DNA-PKcs molecules in sjf is related to its kinase activity, we introduced point mutations into the kinase domain of DNA-PKcs and, as a result, demonstrated the essential role of kinase activity for sjf (Table IIGo).

Although we introduced two amino acid substitutions into the kinase motif of DNA-PKcs according to previous studies on ATM (25), the activity of sjf did not decrease completely. Two possibilities are considered. One is that the mutant product encoded by pME-mt-PI3K has residual kinase activity and the other is that other activities other than kinase are required for complete inactivation of sjf.

We note that the kinase activity of the product encoded by SX9 construct was measured and found to be negative (31), but activity of the product encoded by pME-mt-PI3K construct was not measured by in vitro assay system. However, it was reported that the substituted amino acid residues are required for catalysis (32) and that the mutation of corresponding amino acid residues in ATM, which belongs to PI3-kinase family, made the product kinase negative as measured by in vitro assay (25).

We attempted to measure the kinase activity of the product encoded by each construct by the in vitro kinase assay system using p53 synthetic oligo peptide as a substrate (33, 34, 35), but in the case of mice, it was not possible to measure the activity with good reproducibility. This may be due to the small amount of the products in the mice cells.

Briefly stated, until now the role of DNA-PKcs has been studied mainly using scid mice. Scid mice exhibit defective development of T and B lymphocytes owing to the defect of recombination of Ig and TCR genes (36, 37, 38). DNA-PKcs gene was found to be the responsible gene of scid and, as mentioned above, scid mice exhibit normal sjf but abnormal cjf (18, 39). Subsequent studies revealed that the embryonic fibroblast cells derived from the DNA-PKcs knockout mice exhibit scid phenotype (22).

Our observations indicate that DNA-PKcs controls sjf in V(D)J recombination and that its kinase activity is required for it. These findings support an in vitro study reported previously (40). In the present and previous studies, reverse genetic studies using a full-length DNA-PKcs cDNA clearly showed the requirement of DNA-PKcs for sjf as well as for cjf (14, 32).

Reverse genetic studies with the DNA-PKcs cDNA will shed further light on the role of DNA-PKcs for V(D)J recombination.


    Acknowledgments
 
We thank K. Yokoro for encouragement, E. Hendrickson for critical reading and helpful discussion, F. Alt for helpful information before publication, P. Jeggo and H. Takahashi for helpful discussion, and Y. Hoki, K. Shingu, and E. Kinoshita for technical assistance. We are grateful to M. Gellert for the gift of pJH200, Y. Shinkai for BCMGSNeo-TAG1 and BCMGSNeo-TAG2, K. Maruyama for pME18S, and B. F. Burke-Gaffney for editing the English manuscript.


    Footnotes
 
1 R.F. was supported by Japan Society for the Promotion of Science Research Fellowships for Young Scientists. Back

2 Current address: Department of Radiation Genetics, Faculty of Medicine, Kyoto University, Yoshida, Sakyo-ku, 606-8501, Kyoto, Japan. Back

3 Address correspondence and reprint requests to Dr. Masumi Abe, Division of Biology and Oncology, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba-shi, Chiba 263-8555, Japan. Back

4 Abbreviations used in this paper: RAG, recombination activating gene; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; XRCC, x-ray cross complementation; cjf, coding joint formation; sjf, signal joint formation; PI3K, phosphatidylinositol 3-kinase Back

Accepted for publication July 12, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tonegawa, S.. 1983. Somatic generation of antibody diversity. Nature 302:575.[Medline]
  2. Schatz, D. G., M. A. Oettinger, D. Baltimore. 1989. The V(D)J recombination activating gene, RAG-1. Cell 59:1035.[Medline]
  3. Gu, Y., K. J. Seidl, G. A. Rathbun, C. Zhu, J. P. Manis, N. van der Stoep, L. Davidson, H. L. Cheng, J. M. Sekiguchi, K. Frank, et al 1997. Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity 7:653.[Medline]
  4. Ouyang, H., A. Nussenzweig, A. Kurimasa, V. C. Soares, X. Li, C. Cordon-Cardo, W. Li, N. Cheong, M. Nussenzweig, G. Iliakis, et al 1997. Ku70 is required for DNA repair but not for T cell antigen receptor gene recombination in vivo. J. Exp. Med. 186:921.[Abstract/Free Full Text]
  5. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson, P. A. Jeggo. 1994. Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination. Science 265:1442.[Abstract/Free Full Text]
  6. Hartley, K. O., D. Gell, G. C. Smith, H. Zhang, N. Divecha, M. A. Connelly, A. Admon, S. P. Lees-Miller, C. W. Anderson, S. P. Jackson. 1995. DNA-dependent protein kinase catalytic subunit: a relative of phosphatidylinositol 3-kinase and the ataxia telangiectasia gene product. Cell 82:849.[Medline]
  7. Li, Z., T. Otevrel, Y. Gao, H. L. Cheng, B. Seed, T. D. Stamato, G. E. Taccioli, F. W. Alt. 1995. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83:1079.[Medline]
  8. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammlian cells. Nature 388:492.[Medline]
  9. Araki, R., A. Fujimori, K. Hamatani, K. Mita, T. Saito, M. Mori, R. Fukumura, M. Morimyo, M. Muto, M. Itoh, et al 1997. Nonsense mutation at Tyr-4046 in the DNA-dependent protein kinase catalytic subunit of severe combined immune deficiency mice. Proc. Natl. Acad. Sci. USA 94:2438.[Abstract/Free Full Text]
  10. Blunt, T., D. Gell, M. Fox, G. E. Taccioli, A. R. Lehmann, S. P. Jackson, P. A. Jeggo. 1996. Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse. Proc. Natl. Acad. Sci. USA 93:10285.[Abstract/Free Full Text]
  11. Danska, J. S., D. P. Holland, S. Mariathasan, K. M. Williams, C. J. Guidos. 1996. Biochemical and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes. Mol. Cell Biol. 16:5507.[Abstract]
  12. Priestley, A., H. J. Beamish, D. Gell, A. G. Amatucci, M. C. Muhlmann-Diaz, B. K. Singleton, G. C. Smith, T. Blunt, L. C. Schalkwyk, J. S. Bedford, et al 1998. Molecular and biochemical characterisation of DNA-dependent protein kinase-defective rodent mutant irs-20. Nucleic Acids Res. 26:1965.[Abstract/Free Full Text]
  13. Shin, E. K., L. E. Perryman, K. Meek. 1997. A kinase-negative mutation of DNA-PK(CS) in equine SCID results in defective coding and signal joint formation. J. Immunol. 158:3565.[Abstract]
  14. Fukumura, R., R. Araki, A. Fujimori, M. Mori, T. Saito, F. Watanabe, M. Sarashi, H. Itsukaichi, K. Eguchi-Kasai, K. Sato, et al 1998. Murine cell line SX9 bearing a mutation in the dna-pkcs gene exhibits aberrant V(D)J recombination not only in the coding joint but also in the signal joint. J. Biol. Chem. 273:13058.[Abstract/Free Full Text]
  15. Errami, A., D. M. He, A. A. Friedl, W. J. I. Overkamp, B. Morolli, E. A. Hendrickson, F. Eckardt-Schupp, M. Oshimura, P. H. M. Lohman, S. P. Jackson, M. Z. Zdzienicka. 1998. XR-C1, a new CHO cell mutant which is defective in DNA-PKcs, is impaired in both V(D)J coding and signal joint formation. Nucleic Acids Res. 26:3146.[Abstract/Free Full Text]
  16. Jin, S., S. Inoue, D. T. Weaver. 1997. Functions of the DNA dependent protein kinase. Cancer Surv. 29:221.[Medline]
  17. Wiler, R., R. Leber, B. B. Moore, L. F. VanDyk, L. E. Perryman, K. Meek. 1995. Equine severe combined immunodeficiency: a defect in V(D)J recombination and DNA-dependent protein kinase activity. Proc. Natl. Acad. Sci. USA 92:11485.[Abstract/Free Full Text]
  18. Lieber, M. R., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, K. Mizuuchi, M. J. Bosma, M. Gellert. 1988. The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell 55:7.[Medline]
  19. Jhappan, C., 3rd H. C. Morse, R. D. Fleischmann, M. M. Gottesman, G. Merlino. 1997. DNA-PKcs: a T-cell tumour suppressor encoded at the mouse scid locus. Nat. Genet. 17:483.[Medline]
  20. Taccioli, G. E., A. G. Amatucci, H. J. Beamish, D. Gell, X. H. Xiang, M. I. Torres Arzayus, A. Priestley, S. P. Jackson, A. Marshak Rothstein, P. A. Jeggo, V. L. Herrera. 1998. Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity. Immunity 9:355.[Medline]
  21. Bogue, M. A., C. Jhappan, D. B. Roth. 1998. Analysis of variable (diversity) joining recombination in DNA-dependent protein kinase (DNA-PK)-deficient mice reveals DNA-PK-independent pathways for both signal and coding joint formation. Proc. Natl. Acad. Sci. USA 95:15559.[Abstract/Free Full Text]
  22. Gao, Y., J. Chaudhuri, C. Zhu, L. Davidson, D. T. Weaver, F. W. Alt. 1998. A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination. Immunity 9:367.[Medline]
  23. Kurimasa, A., H. Ouyang, L. Dong, S. Wang, X. Li, C. Cordon-Cardo, D. J. Chen, G. C. Li. 1999. Catalytic subunit of DNA-dependent protein kinase: impact on lymphocyte development and tumorigenesis. Proc. Natl. Acad. Sci. USA 96:1403.[Abstract/Free Full Text]
  24. Hesse, J. E., M. R. Lieber, M. Gellert, K. Mizuuchi. 1987. Extrachromosomal DNA substrates in pre-B cells undergo inversion or deletion at immunoglobulin V-(D)-J joining signals. Cell 49:775.[Medline]
  25. Canman, C. E., D. S. Lim, K. A. Cimprich, Y. Taya, K. Tamai, K. Sakaguchi, E. Appella, M. B. Kastan, J. D. Siliciano. 1998. Activation of the ATM kinase by ionizing radiation and phosphorylation of p53. Science 281:1677.[Abstract/Free Full Text]
  26. Lin, J. Y., M. C. Muhlmann-Diaz, M. A. Stackhouse, J. F. Robinson, G. E. Taccioli, D. J. Chen, J. S. Bedford. 1997. An ionizing radiation-sensitive CHO mutant cell line: irs-20. IV. Genetic complementation, V(D)J recombination and the scid phenotype. Radiat. Res. 147:166.[Medline]
  27. Taccioli, G. E., H. L. Cheng, A. J. Varghese, G. Whitmore, F. W. Alt. 1994. A DNA repair defect in Chinese hamster ovary cells affects V(D)J recombination similarly to the murine scid mutation. J. Biol. Chem. 269:7439.[Abstract/Free Full Text]
  28. Kulesza, P., M. R. Lieber. 1998. DNA-PK is essential only for coding joint formation in V(D)J recombination. Nucleic Acids Res. 26:3944.[Abstract/Free Full Text]
  29. Bogue, M. A., C. Zhu, E. Aguilar-Cordova, L. A. Donehower, D. B. Roth. 1996. p53 is required for both radiation-induced differentiation and rescue of V(D)J rearrangement in scid mouse thymocytes. Genes Dev. 10:553.[Abstract/Free Full Text]
  30. Livak, F., S. C. Welsh, C. J. Guidos, I. N. Crispe, J. S. Danska, D. G. Schatz. 1996. Transient restoration of gene rearrangement at multiple T cell receptor loci in gamma-irradiated scid mice. J. Exp. Med. 184:419.[Abstract/Free Full Text]
  31. Peterson, S. R., M. Stackhouse, M. J. Waltman, F. Chen, K. Sato, D. J. Chen. 1997. Characterization of two DNA double-stranded break repair-deficient cell lines that express inactive DNA-dependent protein kinase catalytic subunits. J. Biol. Chem. 272:10227.[Abstract/Free Full Text]
  32. Kurimasa, A., S. Kumano, N. V. Boubnov, M. D. Story, C. S. Tung, S. R. Peterson, D. J. Chen. 1999. Requirement for the kinase activity of human DNA-dependent protein kinase catalytic subunit in DNA strand break rejoining. Mol. Cell Biol. 19:3877.[Abstract/Free Full Text]
  33. Lees-Miller, S. P., Y. R. Chen, C. W. Anderson. 1990. Human cells contain a DNA-activated protein kinase that phosphorylates simian virus 40 T antigen, mouse p53, and the human Ku autoantigen. Mol. Cell Biol. 10:6472.[Abstract/Free Full Text]
  34. Finnie, N. J., T. M. Gottlieb, T. Blunt, P. A. Jeggo, S. P. Jackson. 1995. DNA-dependent protein kinase activity is absent in xrs-6 cells: implications for site-specific recombination and DNA double-strand break repair. Proc. Natl. Acad. Sci. USA 92:320.[Abstract/Free Full Text]
  35. Lees-Miller, S. P., R. Godbout, D. W. Chan, M. Weinfeld, R. S. R. Day, G. M. Barron, J. Allalunis-Turner. 1995. Absence of p350 subunit of DNA-activated protein kinase from a radiosensitive human cell line. Science 267:1183.[Abstract/Free Full Text]
  36. Schuler, W., I. J. Weiler, A. Schuler, R. A. Phillips, N. Rosenberg, T. W. Mak, J. F. Kearney, R. P. Perry, M. J. Bosma. 1986. Rearrangement of antigen receptor genes is defective in mice with severe combined immune deficiency. Cell 46:963.[Medline]
  37. Malynn, B. A., T. K. Blackwell, G. M. Fulop, G. A. Rathbun, A. J. Furley, P. Ferrier, L. B. Heinke, R. A. Phillips, G. D. Yancopoulos, F. W. Alt. 1988. The scid defect affects the final step of the immunoglobulin VDJ recombinase mechanism. Cell 54:453.[Medline]
  38. Okazaki, K., S. Nishikawa, H. Sakano. 1988. Aberrant immunoglobulin gene rearrangement in scid mouse bone marrow cells. J. Immunol. 141:1348.[Abstract]
  39. Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo, F. W. Alt. 1993. Impairment of V(D)J recombination in double-strand break repair mutants. Science 260:207.[Abstract/Free Full Text]
  40. Gottlieb, T. M., S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cell 72:131.[Medline]



This article has been cited by other articles:


Home page
J. Exp. Med.Home page
J. D. Curry, D. Schulz, C. J. Guidos, J. S. Danska, L. Nutter, A. Nussenzweig, and M. S. Schlissel
Chromosomal reinsertion of broken RSS ends during T cell development
J. Exp. Med., October 1, 2007; 204(10): 2293 - 2303.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Rooney, F. W. Alt, J. Sekiguchi, and J. P. Manis
Artemis-independent functions of DNA-dependent protein kinase in Ig heavy chain class switch recombination and development
PNAS, February 15, 2005; 102(7): 2471 - 2475.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. J. L. Cook, L. Oganesian, P. Harumal, A. Basten, R. Brink, and C. J. Jolly
Reduced Switching in SCID B Cells Is Associated with Altered Somatic Mutation of Recombined S Regions
J. Immunol., December 15, 2003; 171(12): 6556 - 6564.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E. J. Perkins, A. Nair, D. O. Cowley, T. Van Dyke, Y. Chang, and D. A. Ramsden
Sensing of intermediates in V(D)J recombination by ATM
Genes & Dev., January 15, 2002; 16(2): 159 - 164.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukumura, R.
Right arrow Articles by Abe, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukumura, R.
Right arrow Articles by Abe, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS