|
|
||||||||



*
National Institute of Radiological Sciences, Chiba, Japan;
Graduate School of Science and Technology, Chiba University, Chiba, Japan;
Lawrence Berkeley National Laboratory, Berkeley, CA 94720; and
§
Memorial Sloan-Kettering Cancer Center, New York, NY 10021
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The process of V(D)J recombination is roughly divided into four steps: recognition of the signal sequences, digestion, removal and/or addition of a few nucleotides, and ligation. The molecules participating in V(D)J recombination have been elucidated. These reactions are catalyzed by recombination activating gene (RAG)4-1, RAG-2, Ku70, Ku86, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), the x-ray cross complementation group (XRCC)4 gene product, and ligase IV (2, 3, 4, 5, 6, 7, 8). However, the precise role of these gene products in each of the steps is still unclear. Regarding DNA-PKcs, it has been demonstrated that DNA-PKcs contributes to the ligation step of the break sites. In this study, we attempted to clarify the role of DNA-PKcs in the recombination followed by the RAG digestion.
The mutants of DNA-PKcs are categorized to XRCC7 group and include murine scid, V3, irs-20, equine scid, SX9, and XR-C1 cells (9, 10, 11, 12, 13, 14, 15). There is a discrepancy among reports on the effect of the mutations in the DNA-PKcs gene on signal joint formation (sjf). Studies using murine scid, V3, and irs-20 cells have shown that only the coding joint formation (cjf) is impaired significantly (16), while other studies indicated that sjf was also impaired in equine scid, SX9, and XR-C1 cells in addition to cjf (14, 15, 17). Moderate impairment of sjf in murine scid cells has also been observed (18).
One of the hypotheses attempting to accommodate these conflicting observations proposes that murine scid, V3, and irs-20 cells have residual DNA-PKcs activity while the other mutant cells, equine scid, SX9, and XR-C1 cells, do not have any activity. Indeed, reports supporting this hypothesis have appeared recently (14, 19, 20, 21). An effective way to clarify this issue is to conduct an analysis using the DNA-PKcs knockout cells, because the knockout cells should be defective in both joint formations. Although some investigations of V(D)J recombination with DNA-PKcs knockout mice and cell lines have been conducted, it was reported, contrary to our expectation, that cjf was defective but sjf was relatively normal (20, 21, 22). Thus, the null phenotype of DNA-PKcs cells reflects impaired cjf but not impaired sjf.
To help solve this puzzle, we report our observations of sjf in two independent cell lines established from DNA-PKcs knockout mice. Furthermore, we used the full-length cDNA of DNA-PKcs to confirm the responsibility of DNA-PKcs for sjf.
| Materials and Methods |
|---|
|
|
|---|
The cell lines PK33N and PK33S were established from the lung
fibroblast cells of DNA-PKcs knockout mice. The exon 3 of the
DNA-PKcs gene was knocked out in the mice (23).
Meanwhile, the control cell lines PK34N and PK34S were derived from the
lung fibroblast cells of a 129SV mouse bearing wild-type alleles of the
DNA-PKcs gene. The PK33N and PK34N cell lines were
established spontaneously whereas PK33S and PK34S were established with
SV40 virus. These cells were cultured in
-MEM (Life Technologies,
Rockville, MD) supplemented with 10% FCS, 1%
L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml
streptomycin and were grown at 37° in 5%
CO2.
V(D)J recombination assay
V(D)J recombination assay has been described (14, 24). Briefly, the eukaryotic expression vector BCMGSNeo which
contains the CMV promoter bearing RAG-1 or RAG-2 (17.8 µg
BCMGSNeo-TAG1 and 22.2 µg BCMGSNeo-TAG2); pME-PK7, 17.5 µg of which
contains the SR
promoter bearing the murine DNA-PKcs
gene; and the assay vector pJH200 (2 µg) were cotransfected into
5 x 106 cells using lipofect Amine plus
reagent (Life Technologies). A pME18S vector (3.8 µg), which is
identical with pME-PK7 except for the DNA-PKcs gene, was
cotransfected as a control experiment. Furthermore, to test the role of
the kinase activity in sjf, a DNA-PKcs cDNA (17.5 µg
pME-mt-phosphatidylinositol 3-kinase (PI3K)) in which two point
mutations were introduced in the kinase domain region, was used for the
assay. After 48 h, the transfectants were harvested and the assay
vectors were recovered by the rapid isolation method. The recovered DNA
was digested with the restriction enzyme DpnI to eliminate
unreplicated assay vectors, RAG, and DNA-PKcs expression vectors.
Digested DNA was then transfected into Escherichia coli,
DH10B strain (Life Technologies). The accuracy of sjf was assessed by
digestion of the recovered plasmids from the E. coli using
restriction enzyme ApaLI or DNA sequencing.
Preparation of mutant DNA-PKcs constructs
Two amino acids existing in the highly conserved PI3K motif (DXXXXN) were substituted (Asp3921 to Ala and Asn3926 to Lys) for preparing the kinase-defective construct, pME-mt-PI3K, using a QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Substitutions of Glu4125 to Lys, Gly4025 to ter, Tyr4046 to ter, and Leu3191 to Pro, which correspond to the mutations in the irs-20, V3, murine scid, and SX9 cell lines, respectively, were introduced. The methods used to prepare these constructs are listed below.
pME-PK7 (50 ng) was added as template DNA into 50 µl 1x mutagenesis buffer containing 125 ng of the following mutagenesis primers: CCTCGGGATTGGAGCCAGACACCTGAACAAATTCATGGTG and CACCATGAATTTGTTCAGGTGTCTGGCTCCAATCCCGAGG for the kinase-defective construct, pME-mt-PI3K; GGCAGGACTTGGGAAGGATGGAAGCCCTGGATGTAAAGTC and GACTTTACATCCAGGGCTTCCATCCTTCCCAAGTCCTGCC for the irs-20-type construct, pME-PK-irs20; GAGCAGACAATGCTGAGAAAAGGATGATCATGGATTCAAG and CTTGAATCCATGATCATCCTTTTCTCAGCATTGTCTGCTC for the V3-type construct, pME-PK-V3; CCACAACATAAAATACGCTAAGCTAAGAGAAAGTTAGCAG and CTGCTAACTTTCTCTTAGCTTAGCGTATTTTATGTTGTGG for the murine scid-type construct, pME-PK-scid; CAAATCGCTGCTTCTTTCCCAGTAAAATAGAAGAGAGACTG and CAGTCTCTCTTCTATTTTACTGGGAAAGAAGCAGCGATTTG for the SX9-type construct, pME-PK-SX9; and 2.5 units of Pfu DNA polymerase. The template was amplified for 12 cycles with a 9700 PCR thermocycler (Perkin-Elmer, Norwalk, CT; denaturation at 95°C for 30 s, annealing at 55°C for 1 min, and extension at 68°C for 40 min for each cycle). The amplified DNA was treated with the restriction enzyme DpnI to eliminate the template pME-PK7 DNA and then transfected into E. coli, strain SURE 2 (Stratagene). The introduction of the mutations in the isolated clones was confirmed by DNA sequencing.
Western blot analysis
Western blot analysis was conducted as described previously. Briefly, proteins in total cell lysates were separated by 5% SDS-polyacrylamide gel electrophoresis and electroblotted onto polyvinylidene diflouride membranes. Monoclonal 18-2 Ab (Kamiya Biomedical, Seattle, WA) was used. Immunoreactive bands were visualized with Lumi-Lightplus Western blotting substrate (Roche Diagnostics, Mannheim, Germany) and recorded on x-ray film followed by quantitation with an image analyzer (Light Capture; ATTO, Tokyo, Japan).
| Results |
|---|
|
|
|---|
We established a DNA-PKcs knockout mouse strain in which exon 3 of the DNA-PKcs gene was disrupted. Disruption of the DNA-PKcs gene via homologous recombination gene and the absence of its products were confirmed (23). Two cell lines were independently established from the lung fibroblasts of the knockout mice. One (PK33N) was spontaneously established, and the other (PK33S) was established with SV40 virus.
To analyze the V(D)J recombination, RAG-1, RAG-2 expression vectors,
and the pJH200 assay vector for sjf were simultaneously transfected
into these knockout cells (24). Consequently, the
recombination frequency of sjf decreased 2- to 4.5-fold in the
DNA-PKcs-null cells. Next, the fidelity of sjf was clarified by
digestion with the restriction enzyme ApaLI, because the
recognition site for this enzyme must be created when sjf occurs
precisely. Signal joint products recovered from PK33N and PK33S cells
(13.8 and 19.3%) could be digested with ApaLI (Table I
), a finding that showed the defect of
sjf in the knockout cells. Next, we analyzed ApaLI-negative
products. Forty ApaLI-resistant clones recovered from PK33N
cells were sequenced (Fig. 1
). All of
these clones contained various lengths of deletions. Furthermore,
interestingly, most of deletions in the ApaLI-negative
clones occurred relatively symmetric from the break site created by the
RAG proteins (Fig. 1
B). The same observation was made in at
least four additional experiments (data not shown).
|
|
|
To verify whether the defect of sjf in null cells was due
specifically to the absence of DNA-PKcs, a full-length
DNA-PKcs cDNA was introduced into the knockout cell lines,
PK33N and PK33S. As a result, the fidelity of sjf in both knockout cell
lines was dramatically restored (Table I
and Fig. 2
). Although the
restoration of the recombination frequency in the two cell lines was
different (0.92 for PK33N and 0.48 for PK33S), the recombination
fidelity was similar (
70%). This observation, which was confirmed
by more than four experiments, clearly verifies that the defect of sjf
is due to a defect of DNA-PKcs in both knockout cells.
Sjf in knockout cells transfected by irs-20-, V3-, murine scid-, or SX9-type mutant cDNA constructs
To obtain further evidence for the contribution of DNA-PKcs to
sjf, we also attempted to observe the sjf activity of known mutant
DNA-PKcs molecules. We prepared mutant constructs corresponding to the
published mutant sequences for irs-20, V3, murine scid, and
SX9, in addition to the wild-type construct for analysis (Fig. 3
A). The transfection of these
DNA-PKcs constructs revealed that the irs-20 and V3 cells have partial
activity while the SX9 cells do not have any activity (Table II
and Fig. 3
C). The murine
scid cells seemed to have partial activity, but more
extensive experiments are required to obtain a conclusion (Fig. 3
C).
|
|
Expression of each construct
The expression of constructs was measured by Western blot analysis. The expression of each transfected construct within the DNA-PKcs knockout cells was significant. No substantial difference was observed among V3, murine scid, SX9, and pME-mt PI3K, but the expression of the wild-type and irs-20 constructs was higher than that of the other constructs.
The amount of products expressed from the wild-type and irs-20 DNA-PKcs
constructs in the knockout cells was approximately equal to that from
endogenous DNA-PKcs gene in the parental cells (Fig. 3
B).
Sjf requires the kinase activity of DNA-PK
Lastly, to clarify the relationship between sjf activity and
kinase activity of DNA-PK, we attempted to determine whether the kinase
activity of DNA-PKcs was required for complementation of the aberrant
sjf in knockout cells by employing DNA-PKcs constructs
encoding kinase-defective DNA-PKcs products. Two kinds of
kinase-defective constructs, one considered to be a putative kinase
negative and the other a kinase-negative construct, were prepared and
used for the assay. In one construct, two amino acid residues in the
PI3K motif were replaced (i.e., Asp3921 to Ala
and Asn3926 to Lys), and in the other construct a
leucine to proline substitution at nucleotide number 3191 was
introduced. The former was designed according to mutations in ATM,
which is another member of the PI3K family, while the latter is
responsible mutation for SX9 (14, 25). Each construct was
transfected together with RAG-1, RAG-2, and pJH200 into the DNA-PKcs
null mutant cells. As a result, the defect of sjf in the null cells
could not be complemented with SX9 construct and could be only
moderately complemented with the another construct, pME-mt-PI3K (Table II
and Fig. 3
C).
On the basis of these observations we conclude that the kinase activity of DNA-PKcs contributes to the sjf.
| Discussion |
|---|
|
|
|---|
A hypothesis attempting to resolve these contradictory observations proposed that murine scid, V3, and irs-20 are DNA-PKcs partially active mutant cells whereas equine scid, SX9, and XR-C1 correspond to null mutants of DNA-PKcs (14, 15, 17).
Analyses of V(D)J recombination in DNA-PKcs knockout cells are considered to be the most effective way to verify the above hypothesis. Indeed, several recent reports have described analyses of sjf in DNA-PKcs null mice (20, 21, 22). However, contrary to the hypothesis, no decrease in the frequency or fidelity of sjf in these animals was reported (20, 22), although a moderately decreased fidelity of sjf was observed in another study (21).
To help clarify this conundrum, we used two cell lines established from lung fibroblast cells of DNA-PKcs knockout mice in which exon 3 of the gene was disrupted (23). Sjf was analyzed in both cells using extrachromosomal assay vectors and was found to be impaired. In the case of the DNA PKcs knockout cell PK33N, the frequency of sjf was not remarkably impaired but the fidelity was clearly impaired, while in PK33S the frequency and the fidelity were remarkably impaired. Interestingly, the reduction of sjf frequency in each cell line was different but the reduction of sjf fidelity was quite similar. These findings suggest the existence of different levels of end-joining activity in each cell line, activity which does not usually participate in the V(D)J recombination process but can ligate imprecisely the blunt-end DNA molecules made by RAG digestion. This might be a reason for the difference between PK33N and PK33S cells. To date, the responsibility of DNA-PKcs for sjf has been discussed through the analysis of the various kinds of DNA-PKcs mutant cells including knockout cells. If the assay detects end-joining activities other than that in V(D)J recombination, it is difficult to obtain conclusive results through only measurement of the frequency of sjf occurring in DNA-PKcs-deficient cells.
Why then, does the frequency of sjf not decrease in a knockout cell line as much as the fidelity of sjf? Why do the other knockout mouse strains (20, 21, 22) show different effects in sjf from our knockout cell lines? For understanding the enigmatic phenomena, we propose the following hypothesis: The assay using extrachromosomal vector detects the recombination activity which usually participates in non-V(D)J as well as in V(D)J recombination. This means that the double-strand break ends generated by the RAG products can be ligated by a repair machinery that might be different in each cell type and that might be induced by several kinds of stimulation. This hypothesis is supported by the following observations: 1) V(D)J recombination of TCR genes in murine scid T cells can be restored by exposure to ionizing radiation (29, 30); and 2) the frequency and fidelity of sjf in the scid mouse-derived cells vary depending on the cell lineage (18). In addition, our observation that two independent DNA-PKcs knockout cells, PK33N and PK33S, exhibit a different frequency of sjf, but a similar fidelity also supports the hypothesis. Systematic analyses of sjf generated in various other cell lineages of knockout mice will provide further clarification.
Until now, analyses of sjf activity using DNA-PKcs-deficient cells, even knockout cells, have not concluded the responsibility of DNA-PKcs for sjf in V(D)J recombination. This fact indicated the limitations of analyses using only deficient cells. In contrast, it has been suggested that an approach using full-length cDNA, that is, to test whether the defect of sjf in the mutant cells can be complemented by the introduction of full-length cDNA, will provide a method to determine directly the relationship between DNA-PKcs and sjf activity.
What we want to know most is whether the DNA-PKcs controls the sjf or not. Use of full-length cDNA allows us to directly assess the role of DNA-PKcs in sjf, even if the tested cells have any end-joining activities other than that participating in V(D)J recombination.
Therefore, we attempted to introduce the full-length cDNA of DNA-PKcs
into the knockout cells. Consequently, the fidelity of sjf was restored
to
80% of that in parent cells by the introduction of a full-length
wild-type DNA-PKcs cDNA construct. This observation clearly indicated
that DNA-PKcs controls sjf as well as cjf. Moreover, to confirm the
requirement of DNA-PKcs for sjf, we also prepared mutated
DNA-PKcs gene corresponding to the naturally occurring
mutants irs-20, V3, murine scid, and SX9 and assessed their
ability for sjf. Because end-joining activity other than that for V(D)J
recombination might vary among different cell lines, we used an
identical DNA-PKcs knockout cell line in the experiment as the
recipient cell for transfection of each mutant construct. In other
words, to perform the V(D)J recombination assay with an identical cell
line as the recipient cell for each mutant construct is essential to
exclude the difference of activities other than those participating in
V(D)J recombination from the assay. By using various mutant constructs
and performing the assay in the same cell line, we succeeded in
determining a fine difference among each DNA-PKcs mutant product. As a
result, the irs-20, V3, and murine scid products exhibited
residual activity while the SX9 products were completely defective.
Both the frequency and efficiency of sjf were assessed (Fig. 3
C).
The amount of product expressed by mutant constructs is critical to a discussion of the activity of each mutant product. Therefore, the expression of the constructs introduced into the recipient cells was confirmed using Western blot analysis. The wild-type and the irs-20 mutant constructs expressed roughly two times more than the other constructs. This observation is consistent with the findings of certain other investigations that some mutant products are unstable compared with intact DNA-PKcs product.
Next, it should be noted that V3 product was expressed equally to the other mutant products in our system. Nevertheless, endogenous product expressed from mutant allele of V3 was not detected in the V3 cells (31), suggesting the presence of an additional mutation(s) that influence the transcription or stability of DNA-PKcs in the V3 cells.
Because of the high level of expression of the irs-20 construct, we could not exclude the possibility that elevated sjf activity elicited by the irs-20 construct was due simply to its high expression. In other words, there is a possibility that the activity of irs-20 product per molecule might be lower than that indicated by our assay. However, either way, the irs-20 product must be partially inactivated, because although the amount of the irs-20 product is more than that of intact product in the recipient cells, the activity of the former is less than that of the latter.
Next, it has been suggested that murine scid cells exhibit partial activity (14, 19, 20, 21), but our experiments did not lead to a conclusion on this point, because the difference between transfectants with the scid construct and the vector alone was too small to obtain a statistically reliable answer.
In this study we demonstrated the specific activity of mutant products under the same cell condition. It must be noted that the activity for sjf and stability of each mutant product shown in this study are characteristic in the specific cells, PK33S. To understand the known mutants phenotype, end-joining activities and the amount of mutant DNA-PKcs product in each mutant cell should be observed. Indeed, the amount of DNA-PKcs product expressed by irs-20 and V3 mutant constructs in our assay does not represent the amount of endogenous products observed in the irs-20 and V3 mutant cells. The amount of mutant products may be controlled by additional factors in each cell.
Our observations showed that sjf is impaired in our knockout cells and that the defect of sjf was restored by a full-length cDNA and partially restored by mutant DNA-PKcs constructs. Therefore, we conclude that DNA-PKcs has a crucial role in sjf of V(D)J recombination.
Lastly, to determine whether the role of DNA-PKcs molecules in sjf is
related to its kinase activity, we introduced point mutations into the
kinase domain of DNA-PKcs and, as a result, demonstrated the essential
role of kinase activity for sjf (Table II
).
Although we introduced two amino acid substitutions into the kinase motif of DNA-PKcs according to previous studies on ATM (25), the activity of sjf did not decrease completely. Two possibilities are considered. One is that the mutant product encoded by pME-mt-PI3K has residual kinase activity and the other is that other activities other than kinase are required for complete inactivation of sjf.
We note that the kinase activity of the product encoded by SX9 construct was measured and found to be negative (31), but activity of the product encoded by pME-mt-PI3K construct was not measured by in vitro assay system. However, it was reported that the substituted amino acid residues are required for catalysis (32) and that the mutation of corresponding amino acid residues in ATM, which belongs to PI3-kinase family, made the product kinase negative as measured by in vitro assay (25).
We attempted to measure the kinase activity of the product encoded by each construct by the in vitro kinase assay system using p53 synthetic oligo peptide as a substrate (33, 34, 35), but in the case of mice, it was not possible to measure the activity with good reproducibility. This may be due to the small amount of the products in the mice cells.
Briefly stated, until now the role of DNA-PKcs has been studied mainly using scid mice. Scid mice exhibit defective development of T and B lymphocytes owing to the defect of recombination of Ig and TCR genes (36, 37, 38). DNA-PKcs gene was found to be the responsible gene of scid and, as mentioned above, scid mice exhibit normal sjf but abnormal cjf (18, 39). Subsequent studies revealed that the embryonic fibroblast cells derived from the DNA-PKcs knockout mice exhibit scid phenotype (22).
Our observations indicate that DNA-PKcs controls sjf in V(D)J recombination and that its kinase activity is required for it. These findings support an in vitro study reported previously (40). In the present and previous studies, reverse genetic studies using a full-length DNA-PKcs cDNA clearly showed the requirement of DNA-PKcs for sjf as well as for cjf (14, 32).
Reverse genetic studies with the DNA-PKcs cDNA will shed further light on the role of DNA-PKcs for V(D)J recombination.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Radiation Genetics, Faculty of Medicine, Kyoto University, Yoshida, Sakyo-ku, 606-8501, Kyoto, Japan. ![]()
3 Address correspondence and reprint requests to Dr. Masumi Abe, Division of Biology and Oncology, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba-shi, Chiba 263-8555, Japan. ![]()
4 Abbreviations used in this paper: RAG, recombination activating gene; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; XRCC, x-ray cross complementation; cjf, coding joint formation; sjf, signal joint formation; PI3K, phosphatidylinositol 3-kinase ![]()
Accepted for publication July 12, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. F. Weil Too many ends: aberrant transposition Genes & Dev., May 1, 2009; 23(9): 1032 - 1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Curry, D. Schulz, C. J. Guidos, J. S. Danska, L. Nutter, A. Nussenzweig, and M. S. Schlissel Chromosomal reinsertion of broken RSS ends during T cell development J. Exp. Med., October 1, 2007; 204(10): 2293 - 2303. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rooney, F. W. Alt, J. Sekiguchi, and J. P. Manis Artemis-independent functions of DNA-dependent protein kinase in Ig heavy chain class switch recombination and development PNAS, February 15, 2005; 102(7): 2471 - 2475. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. L. Cook, L. Oganesian, P. Harumal, A. Basten, R. Brink, and C. J. Jolly Reduced Switching in SCID B Cells Is Associated with Altered Somatic Mutation of Recombined S Regions J. Immunol., December 15, 2003; 171(12): 6556 - 6564. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Perkins, A. Nair, D. O. Cowley, T. Van Dyke, Y. Chang, and D. A. Ramsden Sensing of intermediates in V(D)J recombination by ATM Genes & Dev., January 15, 2002; 16(2): 159 - 164. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |