|
|
||||||||
Department of Biology and the Cancer Center, University of California at San Diego, La Jolla, CA 92093
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
1
(8, 9). Increased calcium concentration couples to a
number of downstream pathways in the cell, notably the
calcium/calmodulin-dependent
(CaM)5 phosphatase
calcineurin (10) and the CaM kinases (11, 12). Calcineurin, or protein phosphatase 2B (P2b), is a ubiquitously expressed serine/threonine phosphatase. It consists of two subunits: the catalytic calcineurin A, a 59-kDa protein, and calcineurin B, a 19-kDa regulatory subunit. A role for calcineurin in T cell activation was discovered when the immunosuppressive compounds cyclosporin A (CsA) and FK-506 were found to inhibit calcium-dependent activation of T cells (13). This effect was traced to specific inhibition of calcineurin by a complex of CsA and an endogenous protein, cyclophilin, a peptidyl prolyl-cis-trans isomerase. FK-506 and its cellular cofactor FK-506 binding protein, which is also an isomerase, appear to inhibit calcineurin in a similar manner. In both cases, exquisite specificity for calcineurin is achieved as a result of an active site formed by the drug/isomerase complex (14). The role of calcineurin has also been substantiated by a constitutively active form of the enzyme that lacks the regulatory domain (15). When such a mutant was expressed in cultured T cells it bypassed the need for calcium elevation in T cell activation and IL-2 transcription. Studies by a number of groups have shown that induction of cytokine transcription depends upon the calcineurin-mediated nuclear transport and activation of the Rel-related family of transcription factors known as NF-AT (5, 16, 17, 18). As such, CsA potently inhibits the transcriptional activation of IL-2, IL-3, IL-4, and CD40 ligand.
As with mature T cell activation, T cell development in the thymus is dependent upon signals through the TCR/CD3 complex (3, 19). Such signals appear to regulate both the expansion of cells at the CD4-CD8- double-negative (DN) stage of development (20, 21), and the more extensively studied selection events at the CD4+CD8+ double-positive (DP) stage itself (22, 23, 24). It is at the DP stage that interaction with peptide Ag/MHC complexes at high affinity leads to negative selection, while interaction with such complexes at low affinity promotes maturation or positive selection (25). Therefore, this step of thymocyte development produces mature T cells that are selected to recognize MHC molecules, but do not recognize self-MHC/peptide complexes so efficiently that they are likely to cause autoimmunity.
A number of groups have investigated the effects of the calcineurin inhibitors CsA and FK-506 on T cell development both in vivo and in vitro. Several studies have shown that CsA administration in vivo leads to partial, although not complete, rescue from deletion of DP thymocytes by the endogenous superantigens (SAgs) present in certain mouse strains (26, 27, 28, 29). It has also been shown that CsA can partially inhibit negative selection of DP thymocytes in H-Y TCR-transgenic male mice (30). One study showed that in vitro deletion of thymocytes bearing a particular alloreactive TCR transgene was unaffected by CsA, while deletion of thymocytes bearing a different alloreactive receptor was enhanced (31). Similarly, we saw that the effect of CsA on deletion in culture depended on the nature of the TCR-Ag/MHC interaction. Deletion by a weak peptide analogue could be significantly inhibited by CsA, whereas deletion mediated by an antigenic peptide from pigeon cytochrome c (PCC) was not (32, 33). This suggests that calcineurin may not play a role in mediating negative selection because deletion of cells recognizing a high-affinity peptide is not affected by CsA, but calcineurin may play a role in positive selection because CsA can inhibit the selection effects of lower affinity peptides. This is consistent with experiments in which CsA or FK-506 were shown to inhibit thymocyte positive selection in vivo (26, 27, 29, 30). However, all of the in vivo studies had noted profound thymic hypertrophy after immunosuppressant treatment consistent with observed changes in the thymic stromal cells and a potential for disruption of Ag presentation (34, 35). With the exception of this caveat, experiments supporting the idea that CsA can inhibit positive selection seem to be consistent; however, the effects of CsA on negative selection remain controversial.
To better address the effects of calcineurin on developmental events in vivo, we generated transgenic mice that express a constitutively active calcineurin in their thymocytes and mature T cells. We found that calcineurin caused a block in early DN development, causing a decrease in the steady-state DP population but not in the mature T cell populations. Furthermore, we found that calcineurin can contribute to the efficiency of positive selection of DP thymocytes and the activation of mature T cells. Despite the increased efficiency of signaling through the TCR, under no conditions examined could we detect a conversion of positive selection to negative selection, nor could we detect an enhancement of negative selection.
| Materials and Methods |
|---|
|
|
|---|
A 1.6-kb Xba/BstXI fragment containing the
murine CD4 silencer was blunt-end cloned into the EcoRV site
of pKS (pKS-sil). The truncated murine calcineurin mutant was removed
from pSR
-296 by an EcoRI digest and cloned into the same
site in pKS-sil. A fragment containing the calcineurin cDNA and the
silencer was isolated with NotI, and
XhoI-linkered. This fragment was then ligated into the
XhoI site in pTex (36). The entire fragment for
injection was isolated by digestion of CsCl-purified plasmid DNA with
NotI.
In preparation for injection, transgene fragments were isolated from agarose gels with Qiaex beads (Qiagen, Chatsworth, CA) according to the manufacturers instructions. Integrity of the DNA was verified on an agarose gel. Finally, DNA was diluted to 1.5 µg/ml in sterile injection buffer (5 mM Tris-HCl (pH 8.0), 0.1 mM EDTA).
Mice
Fragments were injected into CB6 F2 embryos. Founder mice were back-crossed to C57BL/6 mice for further analysis. Founder and F1 mice were also bred to AND TCR-transgenic mice (37, 38). All mice analyzed were between 4- and 8-wk of age, unless otherwise noted.
Southern blots/PCR-typing of transgenes
Founder mice were initially identified by Southern blot analysis
of DNA isolated from tail biopsies. Tail pieces of
0.5 cm in length
were obtained from mice between 2- and 3-wk of age, and incubated for
at least 8 h in buffer containing 50 mM Tris-HCl (pH 7.5), 15 mM
EDTA, 100 mM NaCl, 0.5% SDS, and 0.5 mg/ml proteinase K. After
incubation, the supernatant was extracted once with
phenol/chloroform-isoamyl alcohol, and the DNA was precipitated by the
addition of 1.5 vol of 100% ethanol. The DNA pellet was resuspended in
0.1 ml Tris-EDTA, and allowed to resolublize overnight at
4o. A total of 20 µl of the DNA solution was
digested with SstI and run on a 1% agarose gel. The gel was
vacuum-transferred to a nylon membrane (Amersham, Arlington Heights,
IL), and the DNA was UV crosslinked to the membrane, using a GS Gene
Linker from Bio-Rad (Hercules, CA). Subsequent calcineurin offspring of
founder mice were identified by PCR typing of DNA from tail biopsies.
The forward primer (TACTTAGATGTGTACAATAACAAAGCT) is specific for a
portion of murine calcineurin; the reverse primer
(ATGTTATCAAGTGACAGTACACAC), hybridizes to the murine CD4 silencer.
Therefore, this primer combination will only produce products from the
transgenic construct.
Northern blots
Total RNA from thymocytes was isolated with the Trizol reagent (Life Technologies, Gaithersburg, MD). Total RNA (20 µg) was run on a formaldehyde-agarose gel and transferred by capillary blotting to nylon membrane. RNA was UV crosslinked to the membrane. Membranes were probed with a fragments of truncated calcineurin. After exposure to O-Mat AR film (Eastman Kodak, Rochester, NY), the membrane was stripped by the addition of boiling 0.1% SDS and rocked for 7 min at room temperature. The membrane was reprobed with a fragment of the CD4 silencer and then GAPDH as a control for loading.
Antibodies
Directly conjugated Abs to CD4 (YTS 191.1) and CD8
(YTS
169.4) were obtained from Caltag (San Francisco, CA). Directly
conjugated Abs to V
11 (RR8-1) CD69 (H1.2F3), CD3
(145-2C11), CD5
(53-7.3), Kb (AF6-88.5), I-E (14-4-4S), Vß6
(RR4-7), CD44 (IM7), and CD25 (7D4) were obtained from PharMingen (San
Diego, CA).
Flow cytometry
Lymphocytes were resuspended to 106/0.1 ml in PBS with 1% FCS and 0.1% sodium azide (staining buffer), and stained with 0.5 µg of each Ab, for 20 min at room temperature. Cells were washed with 1.5 ml of staining buffer and finally resuspended in 0.5 ml staining buffer. List mode data was collected on 15,00020,000 events on a Becton Dickinson (Mountain View, CA) FACScan, using CellQuest software. Four-color analysis was performed on a Becton Dickinson FACScalibur, also using CellQuest software.
Ab and complement treatment
Cells were resuspended in appropriate Ab supernatant and Low-Tox rabbit complement (Cedarlane Laboratories, Hornby, Ontario, Canada), and the suspension was incubated at 37°C for 45 min. To eliminate CD8+ cells, 3.168.36 supernatant (anti-CD8) was used. RL172 or GK1.5 supernatant (anti-CD4) was used to eliminate CD4+ cells.
RT-PCR
Single cell suspensions were made from thymi. Enrichment of thymic subpopulations was done by treating with the appropriate Ab supernatant and Low-Tox rabbit complement for 45 min at 37°C. Next, complement-treated cells were stained with Abs to cell surface receptors and then sorted on a FACSorter (Becton Dickinson). A total of 250,000 cells that were CD3-CD44+ and/or CD25+ (DN population), CD3+CD4+CD8+ (DP population), CD3+CD4+CD8- (CD4 single-positives (CD4SP)), or CD3+CD4-CD8+ (CD8 single-positives (CD8SP)) were collected. Total RNA was made by Qiagen Total RNA Prep Kit, according to the manufactures instructions. The RNA was DNase-treated, spun over a Quiagen column to purify the RNA, precipitated, and resuspended in 20 µl RNase-free water containing 5 µg/ml oligo-dT and 1 U/µl placental ribonuclease inhibitor, RNAsin (Promega, Madison, WI). The reaction was then incubated for 10 min at 65°C and chilled on ice. Next, the reaction was split into two tubes and 10 µl of a 2x RT mix was added. The 2x RT mix contained 2.5 U/µl RNAsin, 2x reverse transcriptase buffer, 2 nM dNTPs, and ± 10 U avian myeloblastosis virus reverse transcriptase (Promega). Reactions were incubated for 45 min at 37°C, heat-inactivated 10 min at 85°C, and then quick chilled. The cDNA was titrated for use in the PCR. Primers and reaction conditions were described above and the following ß-actin primers were used as a control: 3'CTCTTTGATGTCACGCACGAT and 5'GTGGGCCGCTCTAGGCACCAA.
Luciferase assays
pNF-AT luciferase (gift of the Weiss Lab, University of California, San Francisco, CA) was cotransfected into T Ag (TAg) Jurkats with plasmids containing the appropriate cDNA and incubated for 36 h at 37°C in 5% CO2. Cells were then collected, and 1 x 105 cells in 90 µl were plated in a 96-well plate with the appropriate stimuli. Cells were incubated at 37°C for 68 h. A total of 10 µl phosphate harvest buffer (200 mM KHPO4 (pH 7.8), 1 mM DTT, 10% Triton X-100) was added to the wells and incubated at room temperature for 5 min. Lysates were transferred to luciferase cuvettes and placed in a luminometer where 100 µl luciferase assay buffer (200 mM KPO4 (pH 7.8), 10 mM ATP, and 20 mM MgCl2) and 100 µl 1 mM luciferin were injected. The luminometer was set as follows: mode, integrate; time, 10 s; and temperature, 25°C.
Proliferation and deletion assays
Single cell suspensions were made from the thymi or spleens of calcineurin mice or nontransgenic littermates. RBC were lysed by osmotic shock. Cells were washed and resuspended in Eagle Hanks amino acid medium plus 10% FCS, and aliquoted at 105/well in a 96-well plate in the absence of exogenous APC. When mice on a normal background were used, CD8+ T cells were first eliminated by treatment with anti-CD8 Ab (3.168.32 culture supernatant) and Low-Tox rabbit complement (Cedarlane Laboratories). In all cases, cells were cultured 48 h, before an overnight pulse with 1 mCi/well [3H]thymidine. In vitro thymocyte deletion cultures were conducted exactly as described previously (32, 33, 39).
Phosphatase assay
Twenty-five million thymocytes were depleted of all RBC by osmotic shock. Cells were washed in PBS, lysed in 50 µl hypotonic lysis buffer containing 50 mM Tris (pH 7.5), 1 mM EDTA, 1 mM CaCl2, 1 mM PMSF, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 1 mM DTT, and subjected to three rounds of freeze and thaw. Protein concentrations were determined by Bradford reagent (Bio-Rad) and then equilibrated. Phosphatase assay was performed as described previously (40, 41).
| Results |
|---|
|
|
|---|
The cDNA encoding a mutant form of the calcineurin catalytic
subunit (15), in which the calmodulin binding domain and
the autoinhibitory domain have been deleted (P2b
; Fig. 1
A), was subcloned into the
pTexSil expression vector. Two founders were obtained and were bred to
C57BL/6 mice to generate offspring for further analysis. Expression of
the calcineurin transgene was determined by Northern blot analysis of
total RNA from unseparated thymocytes of first generation mice. One of
the lines expressed the transgene (Fig. 1
B) and was used for
further analysis. To further characterize expression of the transgene,
thymocyte subsets were sorted by FACS according to surface staining for
CD3, CD4, and CD8. From these sorted cells, RNA was isolated and
subjected to RT-PCR analysis (Fig. 1
C). All four thymic
subsets were found to express the transgene, suggesting that in this
founder line, the CD4 silencer did not function. Therefore, mice were
examined for effects of the P2b
transgene on both early
and late stages of thymic development.
|
transgene by examining its effect on T cell activation.
P2b
-transgenic mice were bred to AND
TCR-transgenic mice and T cells from AND and
AND;P2b
littermates were compared for sensitivity to
activation by pharmacological agents or Ag. Consistent with cell
transfection experiments (15), splenocytes from the
double-transgenic mice were sensitive to stimulation with PMA alone, as
determined by proliferation (Fig. 2
30% of the maximum stimulation achieved with PMA
and ionomycin for either AND or AND;P2b
mice.
Splenocytes from AND;P2b
mice were also somewhat more
sensitive to stimulation by peptide Ag, as shown by a 2- to 3-fold
shift in the dose-response curves and an increase in the maximum
response (Fig. 2
transgene is sufficient to confer calcium-independent
T cell activation and enhance the sensitivity of Ag-mediated
activation.
|
transgene
To quantitate the increase in basal level of phosphatase activity
due to the transgene, an in vitro phosphatase assay, measuring serine
dephosphorylation of the regulatory subunit of PKA, was used (14, 40, 41). As a control for the activity of the P2b
construct and its effects on activation and phosphatase activity, TAg
Jurkat cells were transfected with an IL-2 promoter-luciferase gene
reporter construct alone or cotransfected with a construct encoding the
calcineurin B-chain subunit, the P2b
(A-chain) subunit, or both.
Cells were divided and half were used to measure luciferase activity as
an indicator of NF-AT function, and half were examined for phosphatase
activity. The luciferase assay (Fig. 3
A) confirmed that P2b
can
synergize with PMA to cause IL-2 promoter activation in the absence of
the induced release of calcium. Furthermore, the activation was
suppressed by cyclosporin A. In addition, the luciferase activity was
higher when both the constitutively active A subunit and the B subunit
were cotransfected. This suggests that the endogenous B subunit is
limiting to some extent under these conditions (40, 42, 43, 44).
|
alone, but a much
more significant increase with both the P2b
and calcineurin B
subunits. This added effect of the B subunit was not seen in the
absence of calcium. For comparison, CsA was added as an indication of
the calcineurin-independent background of the assay.
Similar experiments were conducted with transgenic thymocytes to
correlate the functional response to the corresponding change in the
level of phosphatase activity. Thymocytes from transgenic mice and
nontransgenic littermates were divided and subjected to proliferation
and phosphatase assays. Fig. 3
shows the results of a proliferation
assay employing thymocytes from a calcineurin-transgenic mouse or
nontransgenic littermate. Although the effect was not as dramatic as
that found for splenocytes (Fig. 2
), P2b
-transgenic
thymocytes were sensitive to stimulation by PMA alone. The two
populations of cells showed equivalent responses to stimulation with
PMA and ionomycin (Fig. 3
; 45). Furthermore, a 2- to
3-fold increase in proliferative response to PMA alone (Fig. 3
C) is tied to a slight increase in the level of phosphatase
activity (Fig. 3
D). Although the increase was small it was
reproduced in five experiments. Addition of EGTA revealed an increase
in the level of calcium-independent activity of the transgenic cells
over the littermate level, and the addition of CsA once again shows the
calcineurin-independent background of the assay. Therefore, the
constitutively active calcineurin expressed in the transgenic
thymocytes caused a detectable increase in phosphatase activity that
apparently synergizes with PMA to allow cells to proliferate without
the need for an increase in intracellular calcium.
We have confirmed that the transgene is producing a constitutively
active calcineurin phosphatase, it was found to be expressed in all
thymic subsets, and it is sufficient to allow calcium-independent
activation of mature T cells. Importantly, the low level of activity
allows us to investigate the role of calcineurin in development without
a general disruption of cellular physiology. As shown below, higher
expression would be predicted to eliminate the thymus entirely.
Therefore, the P2b
mice were analyzed for changes in
development of DN cells and positive and negative selection of DP
thymocytes.
Thymic development
Thymocytes, splenocytes, and lymph node cells were isolated from
P2b
-transgenic mice and nontransgenic littermates and
stained with Abs to various cell surface markers. As shown in Fig. 4
A, the percentage of mature T
cell populations was increased in the thymus and spleen of
P2b
-transgenic mice. In the thymus, this increase also
coincided with an increase in the percentage of
CD69+ and CD3high cells
(Fig. 4
), indicating an increase in the proportion of cells being
signaled through their TCR (46). When thymocytes were
isolated from P2b
-transgenic mice, it was also noted that
the size of the thymus appeared to be significantly smaller than in
nontransgenic littermates. Total numbers of thymocyte subsets from
individual 4- to 6-wk-old mice were enumerated (Fig. 4
B).
Compared with nontransgenic littermates, total thymocyte numbers are
reduced by about 60% in P2b
hemizygous mice and nearly
90% in homozygous mice (Fig. 4
). Nearly all of the decrease was
accounted for in the DP population (Fig. 4
B). We considered
two possibilities to explain the decrease in cell numbers; there is an
inhibition in cellular expansion and differentiation in early thymocyte
development, or there is an increase in cell death that may be
associated with negative selection at the DP stage. However, several
additional observations are not consistent with an increase in negative
selection. First, the absolute numbers of mature CD4SP and CD8SP
thymocytes were not correspondingly affected (Fig. 4
B)
contrary to what might be predicted in the face of a more stringent
negative selection. Second, attempts to demonstrate increased thymocyte
cell death by the use of in situ TUNEL staining revealed no detectable
increase in apoptotic cells (data not shown). Third, the proportion and
number of T cells in the peripheral lymphoid organs was not
significantly diminished in P2b
-transgenic mice. The
alternative was addressed by analyzing thymic DN cells to determine
whether there was a halt in DN development.
|
CD44+CD25+
(pro-T cell)
CD44-CD25+
(early pre-T
cell)
CD44-CD25- DN
(late pre-T cell). The
CD44-CD25- cells
begin to up-regulate the CD4 and CD8 coreceptors as well as
intermediate levels of the TCR. Flow cytometric analyses of DN
thymocytes revealed an apparent DN cell arrest at the
CD44-CD25+ stage of
development, where 65% of the DN cells were
CD44-CD25+ vs 35% in
nontransgenic littermates (Fig. 4
These observations suggest that the decrease in the size of the DP
thymocyte population does not appear to result from a large increase in
cell death, but rather it is a result of a partial arrest in DN
development. This could be due to the increased signaling through
calcineurin that in some way diminishes expansion, or it could be
indirect due to a feedback of excess positive selection
(47). To examine this issue, we looked at the progression
of development in embryonic thymuses. At embryonic day 18, before the
appearance of CD4SP or CD8SP there was already an apparent decrease in
overall cellularity, an increase in
CD44-CD25+, and a decrease
in CD44-CD25- cells (data
not shown). Because a population of positively selected cells had not
yet appeared, we propose that the P2b
molecule directly affects the
rate of progression through the
CD44-CD25+ stage of
maturation.
The effect of activated calcineurin on negative selection
To examine the effect of the P2b
transgene on
negative selection, we investigated three experimental models; in vivo
negative selection in TCR-transgenic mice, age-dependent progression of
the SAg-mediated Vß6-positive T cell deletion, and the apoptosis of
cultured thymocytes mediated by the presentation of peptide Ags. We
bred P2b
mice to AND TCR-transgenic mice in
which the cells express a receptor specific for PCC in association with
H-2Ek. The TCR expressed by the majority of T
cells consists of Vß3 and V
11 (37). Previous studies
have determined that no selection occurs in H-2d
or H-2q mice, positive selection occurs in
H-2Ab mice, and a dominant, late-stage negative
selection occurs in mice that express H-2As
(32, 38). Mice were bred to express the two transgenes and
different MHC haplotypes to determine the effects of the
P2b
transgene on positive and negative selection.
In the first model we assessed AND;P2b
mice that
expressed H-2b/s. In these mice, we have shown
that CD4+ development is blocked such that there
are less than 10% CD4SP thymocytes and 3%
CD4+V
11high thymocytes
(Fig. 5
), whereas
H-2b or H-2b/q mice have
2040% CD4+ cells (32). The
negative selection in this model occurs at the DP
SP transition
because the DP population is intact. In
AND;P2b
;H-2b/s mice, we not
only saw no diminution of the CD4+ cells bearing
the V
11+ TCR that would reflect enhanced
negative selection, we saw a slight increase in the percentage of those
cells (Fig. 5
). Because there was a loss in total cellularity there was
no increase in the absolute number of cells, but the important point is
there was no decrease in the number or proportion of mature
V
11high cells. These data suggest that P2b
does not enhance late-stage negative selection that is mediated by an
endogenous self-Ag.
|
-transgenic mice were bred with D1.LP mice, which
are MHC H-2b, Mlsa, and
carry the endogenous mouse mammary tumor virus 7. In a normal D1.LP
mouse, deletion of SAg-reactive, Vß6-bearing T cells is incomplete
but progressive with age (48). Even in adult mice, the
Vß6 deletion is not as high as that seen in DBA-2 mice. This is
presumably due to a requirement for H-2E molecules for optimum mouse
mammary tumor virus 7 SAg presentation. In these analyses we did not
see a P2b
-dependent difference in the number of mature
Vß6+CD4+ cells in the
thymus or periphery, suggesting again that the transgene did not
enhance the negative selection of these cells (Fig. 6
|
-transgenic mice were more sensitive to this form
of negative selection, and whether P2b
would confer a differential
sensitivity to the altered peptide vs the antigenic peptide. Depicted
in Fig. 7
as compared with AND controls. There
was a trend toward increased deletion using PCC, though the variability
was such that there was no statistically significant difference.
Certainly, there was no preferential sensitivity of
AND;P2b
mice to peptide K99A over PCC peptide, as we
would have predicted from the effects of CsA deletion on in vitro
negative selection. Finally, it is likely that deletion mediated by
PCC, but not K99A, is mediated in part by the cytokines secreted by the
mature thymocytes (49, 50). Thus, we do not view the
differences between AND and AND;P2b
in the
response to PCC to reflect a meaningful effect on physiological
negative selection. We conclude from an analysis of three experimental
models that an active form of calcineurin does not enhance negative
selection.
|
Using the AND-transgenic mice, we also wanted to
determine the effect of the P2b
transgene on positive
selection. As described above, previous studies have determined that
this transgenic TCR is not selected in the presence of
H-2d or H-2q, whereas there
is a large population of
V
11highVß3highCD4+
thymocytes that develop in the presence of H-2b
(32, 38). Presented in Fig. 8
is a representative comparison of the
steady-state cell thymus populations under two conditions that promote
positive selection. If the percentage of CD4SP thymocytes is used as a
measure of positive selection, one copy of H-2Ab
present in H-2b/q or H-2b/d
mice is suboptimal when compared with the selection in
H-2b mice (Fig. 8
A). As shown in this
experiment, the presence of the P2b
transgene correlates
with a substantial increase in the CD4 SP population, and thus positive
selection in the presence of H-2b/q or
H-2b/d but not H-2b.
|
mice (Fig. 8
11+ T cells in the
lymph nodes (data not shown). These experiments suggest that under
conditions of suboptimal positive selection, the P2b
transgene can enhance the selection and differentiation of MHC class II
positive DP thymocytes. | Discussion |
|---|
|
|
|---|
) phosphatase affects T cell development
and activation, and to resolve the inconsistent data obtained using the
calcineurin inhibitors CsA and FK-506. Although studies on T cell
activation events in mature cells have been conducted using calcineurin
inhibitors (15, 51, 52, 53, 54) as well as calcineurin
overexpression (15, 55, 56), only the former approach had
been used to study the potential roles of calcineurin in T cell
development. Not only were the results from studies using
immunosuppressants to look at calcineurins role in thymic negative
selection inconsistent, the interpretation of the results was clouded
by the effects CsA or FK-506 have on thymic architecture and the
differentiation of CD4SP and CD8SP thymocytes. A genetic approach,
presented in this report, allowed us to determine the effects of
calcineurin activation in a cell-autonomous manner.
Despite the relatively low level of expression of the
P2b
-transgenic mice, for the purposes of these studies it
appears to be optimal. The homozygous transgenic mice have a profound
deficiency in thymic expansion, and thus any further increase in
expression would abrogate thymic development entirely. In the founder
line examined in this report, we could examine selection in the
heterozygotes and homozygotes and thus see a dosage effect of this form
of calcineurin. One unexpected finding was that the CD4 silencer did
not appear to restrict expression in the way we had previously found
for a test transgene with identical control elements (A. Wurster and
L.P. Kane, unpublished observations). Although this early expression of
calcineurin did have the effect of inhibiting progression through the
CD44-CD25+ stage in
otherwise wild-type mice, it did not seem to diminish expansion in
AND-H-2b, H-2b/q, and
H-2b/d TCR-transgenic mice. We were thus able to
examine its effect on positive and negative selection.
We did not find evidence for the participation of calcineurin in negative selection. We were not able to detect any increase in apoptotic thymocytes in thymic sections, although if there was a subtle increase in the rate of apoptosis associated with negative selection it might be difficult to detect by a TUNEL. We have been successful in using TUNEL to detect negative selection in TCR and PCC double-transgenic mice (57), but in this case a large fraction of the cells died due to the recognition of a "self" Ag. Nonetheless, the rate of macrophage engulfment of dying thymocytes is very high (58), so a negative result with TUNEL may not be meaningful. Another prediction is that if there was a considerable increase in negative selection at the DP stage, this should have resulted in a significant decrease in the number of mature, CD4+ and CD8+ thymocytes and T cells. Again, we did not observe a significant decrease in the number of mature thymocytes, nor did we observe a decrease in the proportion of T cells in the peripheral lymphoid organs. In fact, we consistently saw an increase in the proportion of mature thymocytes and T cells in the spleen and lymph nodes.
To further clarify the effects of the active phosphatase on negative
selection, we measured the number of mature CD4SP thymocytes in AND
TCR-transgenic mice that expressed H-2b/s.
Because deletion is not complete in these mice, we should be
able to detect an enhancement of negative selection by a loss of
CD4+V
11 positive cells. In contrast, the
representative experiment presented in Fig. 5
shows an increase in the
percentage of V
11 cells that survive, supporting the idea that
calcineurin does not enhance negative selection and may instead aid in
positive selection and survival. Further evidence against a role for
calcineurin in negative selection was provided by examining a model of
SAg-mediated deletion. We specifically choose a model in which deletion
is suboptimal so that an enhanced negative selection could be detected.
In a comparison of 17 mice equally distributed between
P2b
+/- and
P2b
-/- genotypes, there was no
difference in the age-dependent SAg-mediated thymic deletion. If
calcineurin was involved in this type of negative selection, we would
expect that the number of (Vß6+) SAg-reactive
cells surviving would be diminished compared with the nontransgenic
controls.
In contrast to the lack of evidence for an effect on negative
selection, the analysis indicated that the P2b
transgene
promoted positive selection. Thymocytes expressing high levels of CD5,
CD69, and CD3, putative indicators of positive selection, were always
present in increased proportions. This observation is consistent with
the increased positive selection seen in AND;P2b
double-transgenic mice expressing either H-2b/d
or H-2b/q (Fig. 8
). Although there was
considerable variability in the efficiency of positive selection when
the data from different experiments were pooled, we consistently noted
a higher percentage of CD4+ thymocytes in
AND;P2b
double-transgenic mice, when compared with
AND littermates. We were also able to observe an increase in
the percentage of CD4+ T cells in the peripheral
lymphoid organs. However, we did not observe an increase in steady
state numbers of CD4+ thymocytes when we examined
AND;P2b
mice of MHC haplotype H-2b.
We interpret this result to show that there is not a general increase
in the survival of CD4SP thymocytes, but rather there is an increase in
the efficiency of suboptimal positive selection. Thus, we did not see
evidence for the conversion of a strong positive selection signal in
H-2b mice to negative selection.
The possibility exists that the P2b
transgene affects
negative selection, but the magnitude of the effect is too small to
measure. Because we can easily measure effects of the transgene on
PMA-induced proliferation, Ag-induced proliferation, and positive
selection, at the least we can say that calcineurin is substantially
more important for the signal transduction involved in these responses
as compared with negative selection. Based on these results we argue
that negative selection is not simply an increase in the signaling
associated with positive selection. This interpretation is consistent
with studies conducted using FK-506 (59). In vivo, FK-506
treatment blocked the development of mature SP thymocytes as well as
the induction of CD69 expression, two indicators of positive selection.
However, no apparent effect on negative selection was found when
looking at deletion due to a negative selection in TCR-transgenic mice
or when analyzing deletion mediated by SAgs. This concept that positive
and negative selection use distinct signaling pathways has been
suggested by work on other thymic selection signaling pathways as well.
Loss and gain-of-function genetic studies indicate that the
mitogen-activated protein (MAP) kinase pathway preferentially affects
positive selection (60, 61, 62), whereas the use of MAP kinase
inhibitors seemed to show that both positive and negative selection can
be affected by the MAP kinase pathway (63). Conversely,
dominant-negative forms of nur77 orphan steroid receptor in thymocytes
suppressed negative selection without affecting positive selection
(64). These examples support the idea that positive and
negative selection can emanate from distinct signaling pathways.
With these mice, we were also able to confirm, for the first time with
naive T cells, that a constitutively active calcineurin is sufficient
to synergize with a suboptimal concentration of 2 ng/ml PMA to induce
cellular proliferation. Significantly, we also saw an increased
sensitivity to antigenic stimulation. These experiments show that the
major (if not the only) calcium-dependent enzyme required for T cell
proliferation is calcineurin. This is consistent with the observation
that calcineurin is the predominant calmodulin-binding protein in T
cells (65). In all cases the mature T cells from
calcineurin-transgenic mice appeared phenotypically normal as
determined by FACS analysis of a number of different markers, such as
CD3, CD4, CD8, and CD69. Thus, the increased proliferation of
calcineurin-transgenic T cells in response to PMA or Ag (Fig. 8
) is
most likely attributable to calcineurin itself and is not a by-product
of aberrant selection processes.
| Acknowledgments |
|---|
-transgenic mice.
We are also grateful to Leslie Sharp for performing in situ TUNEL
analysis and Randy Kincaid for the P2b
(CaM-AI) cDNA. | Footnotes |
|---|
2 K.H.-M. and L.P.K. contributed equally to this work. ![]()
3 Current address: Department of Microbiology and Immunology, University of California, 3rd and Parnassus, San Francisco, CA 94143 ![]()
4 Address correspondence and reprint requests to Dr. Stephen M. Hedrick, University of California at San Diego, Department of Biology 0687, 9500 Gilman Drive, La Jolla, CA 92093. ![]()
5 Abbreviations used in this paper: CaM, calcium/calmodulin dependent; P2b, protein phosphatase 2B; CsA, cyclosporin A; DN, CD4-CD8- double-negative thymocytes; DP, CD4+CD8+ double-positive thymocytes; CD4SP, CD4+CD8- single positive thymocytes; CD8SP, CD4-CD8+ single positive thymocytes; PCC, pigeon cytochrome c; SAg, superantigen; NLC, normal littermate control; TAg, T Ag. ![]()
Received for publication April 27, 2000. Accepted for publication July 18, 2000.
| References |
|---|
|
|
|---|
as a signal-transducing element. Exp. Cell Res. 253:15.[Medline]
ß versus 
lineage commitment. Immunol. Rev. 165:111.[Medline]
ß TCR-transgenic mice. J. Immunol. 152:2853.[Abstract]
B/MAD3, an inhibitor of NF-
B. EMBO J. 13:861.[Medline]
gene induction in stimulated T and B cells. J. Exp. Med. 180:763.This article has been cited by other articles:
![]() |