The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S. W.
Right arrow Articles by Sung, Y. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S. W.
Right arrow Articles by Sung, Y. C.
The Journal of Immunology, 2000, 165: 3631-3639.
Copyright © 2000 by The American Association of Immunologists

Effects of a Hexameric Deoxyriboguanosine Run Conjugation into CpG Oligodeoxynucleotides on Their Immunostimulatory Potentials1

Seung Woo Lee2,*, Man Ki Song2,*, Kwan Hyuck Baek*, Yunji Park*, Jong Kyung Kim*, Chu Hee Lee*, Hae-Kap Cheong{dagger}, Chaejoon Cheong{dagger} and Young Chul Sung3,*

* Department of Life Science, Center for Biofunctional Molecules, Pohang University of Science and Technology, Pohang, Korea; and {dagger} Magnetic Resonance Team, Korea Basic Science Institute, Taejon, Korea


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG oligodeoxynucleotides (ODNs) are promising immunomodulatory agents for treating human diseases and vaccine development. Phosphodiester CpG ODNs were demonstrated to have poor immunostimulatory potentials for cytokine production. However, the conjugation of consecutive deoxyriboguanosine residues, called a dG run, at the 3' terminus of phosphodiester CpG ODNs significantly enhanced TNF-{alpha} and IL-12 production from mouse splenic dendritic cells (DCs). The optimal induction of cytokine production was achieved by the addition of a hexameric dG (dG6) run. In contrast, the existence of a dG6 run either at the 5' terminus of phosphodiester CpG ODNs or at the 3' terminus of phosphorothioate CpG ODNs diminished CpG-mediated cytokine induction, suggesting that the effects of a dG run depend on its location and the chemical property of the ODN backbone, respectively. In addition, we provided the evidence that the conjugation of a dG6 run caused the structural transformation of CpG ODNs, which facilitates their targeting into mouse APCs such as splenic DCs, B cells, and peritoneal macrophages with a scavenger receptor type A ligand specificity. Among primary APCs, DCs were the most potent for CpG ODN-mediated IL-12 production. Furthermore, we demonstrated that the conjugation of a dG6 run into the 3' terminus of phosphodiester CpG ODNs was crucial for their ability to generate Th1 immunity in vivo. Thus, the conjugation of a dG6 run into phosphodiester CpG ODNs would be an alternative way to optimize their immunostimulatory potentials in vitro and in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG oligodeoxynucleotides (ODNs)4 have been extensively studied as a potent immunostimulatory agent capable of activating both innate and adaptive immunity (1, 2, 3, 4, 5, 6). In vitro studies have shown that CpG ODNs stimulate APCs such as B cells, macrophages, and dendritic cells (DCs), to induce cytokine production and expression of costimulatory molecules for immune activation (7, 8, 9, 10). The entry of CpG ODNs into endosomes followed by endosomal maturation appears to be critical for immunostimulatory functions (11, 12). Although DNA is able to bind to the membrane of mammalian cells (13, 14), the specific receptor(s) for the entry of CpG ODNs has not been found in APCs. Alternatively, the nonspecific adsorptive endocytosis has been suggested to be a major mechanism for cellular internalization of CpG ODNs (14, 15). Thus, the modification of CpG ODNs that facilitates their binding to specific receptors on APCs may improve the functions of CpG ODNs.

In this regard the tagging of consecutive dG residues, called a dG run (16), to CpG ODNs may modulate their immunostimulatory potential, since the dG run is known to bind to the scavenger receptor (SR) (17, 18), which is mainly expressed in the cells of monocytic lineage (19). Kimura et al. demonstrated that IFN production and NK activity from mouse splenocytes were increased by the addition of dG12 runs next to the CpG motif (AACGTT) (17). Also, the existence of poly(dG) at both ends of CpG ODN, which is partially phosphorothioate modified, could enhance NK cell activation in human PBMC, although this activity was significantly decreased when the ODN was entirely phosphorothioate modified (20). These results imply that the dG run may increase the uptake of CpG ODNs into target cells through SR and influence CpG-mediated cellular signaling. However, it is unclear which types of cells are direct targets of dG run-containing CpG ODNs. Moreover, it remains to be determined whether the dG run conjugation can modulate in vivo functions of CpG ODNs.

Here, we demonstrated that the conjugation of a dG6 run into the 3' terminus of phosphodiester CpG ODNs significantly augmented their immunostimulatory potentials in terms of IL-12 production from mouse primary APCs and the ability to generate Th1 immunity in mice. Of note, the effects of a dG6 run were dependent upon its location and the chemical property of the ODN backbone, and the conjugation of a dG6 run induced structural transformation of CpG ODNs, which facilitated their binding to DCs in an SR-A-dependent manner.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ODNs, reagents, and mice

All CpG ODNs with phosphodiester and phosphorothioate backbone were purchased from GenoTech (Taejon, Korea). Several ODNs are modified by tagging the fluorescein into the 3' or 5' terminus (f-ODNs). Endotoxin contamination measured by the Limulus assay (Sigma, St. Louis, MO) was negligible in all ODN preparations. Dextran sulfate, chondroitin sulfate, fucoidan, oleic acid, fibrinogen, and low density lipoprotein were purchased from Sigma, and anti-CD18 mAb was purchased from PharMingen (San Diego, CA). Specific pathogen-free conditioned 6-wk-old female C57BL/6 and BALB/c mice were purchased from Dae-Han Laboratory Animal Center (Eumsung, Korea) and Japan SLC (Shizuoka, Japan).

Isolation of primary APCs

Splenic DCs were isolated from female C57BL/6 mice as previously shown with minor modifications (21, 22). Briefly, splenocytes were adhered to a tissue culture plate for 90 min, and then nonadherent cells were discarded. Adherent cells were cultured overnight in the presence of 10 ng/ml of recombinant murine GM-CSF (R&D Systems, Minneapolis, MN). The weakly adherent cells were loaded on a Percoll density gradient, and low density cells from the interface were used as splenic DC-enriched populations. For the direct purification of splenic DCs, splenocytes were incubated with anti-CD11c microbeads and then passed through a column of midiMACS system (Miltenyi Biotec, Auburn, CA), and the remaining CD11c+ cells were used. Resting peritoneal macrophages were harvested as previously described (23) by washing the peritoneal cavity of C57BL/6 mice with the culture medium and were seeded in a tissue culture dish. After incubation for 9 h, nonadherent cells were removed by washing three times with medium, and remaining adherent cells were used in the following experiments. Splenic B cells were isolated from the nonadherent population of splenocytes. Total splenocytes were seeded into a tissue culture plate for 90 min, and anti-CD19 microbeads were coincubated with a nonadherent population of splenocytes. By passing through columns of the miniMACS system, CD19+ B cells were finally purified.

Delivery of ODNs

ODNs (1.5–3 µM) were incubated with various APCs for either 10 h (TNF-{alpha}) or 30 h (IL-12) with RPMI complete medium (Life Technologies/BRL, Gaithersburg, MD), which were supplemented with 10% FBS, 2-ME (50 µM), and L-glutamine (1.5 mM). Also, ODNs (0.3 µM) were codelivered with 3 µg of cationic lipid complex, Lipogen (BodYtech, Chuncheon, Korea), to DCs and were incubated for 4 h in serum-free RPMI medium. After washing the liposome-ODN complexes, cells were further incubated for 24 h with RPMI complete medium.

Cytokine detection

Various APCs were stimulated by ODNs or LPS, and the culture supernatants were quantitated by commercial ELISA kits (Genzyme, Cambridge, MA) for detection of both IL-12 and TNF-{alpha} or by specific mAb pairs for detection of both IFN-{gamma} and IL-4. For sandwich ELISAs, purified anti-mouse IL-4/IFN-{gamma} mAbs (PharMingen) were adsorbed to capture cytokines on polystyrene base microtiter immunoassay plates (Dynex Technologies, Chantilly, VA). The culture supernatants diluted appropriately were incubated following biotinylated anti-mouse IL-4/IFN-{gamma} mAbs. Streptavidin-peroxidase (Southern Biotechnology Associates, Birmingham, AL) was used for detection followed by H2O2 and tetramethylbenzidine substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD) solutions. Recombinant IL-4/IFN-{gamma} (PharMingen) were used as standards for calculating cytokine concentrations in the culture supernatants tested.

Binding and internalization assay with fluoresceinated ODNs

CD11c+ DCs (105), CD19+ B cells, and peritoneal macrophages were preincubated at 4°C for 15 min to suppress endocytosis and then incubated with various f-ODNs (5 µM) for 30 min at 4°C. After complete washing the cells with PBS, the mean fluorescent intensity (MFI) was measured from f-ODNs bound to the cells by FACScan (Becton Dickinson, Mountain View, CA). For detecting the internalization of ODNs, f-ODNs (1 or 5 µM) were treated for 30 min at 4°C and then further incubated for 1.5 or 6 h at 37°C. After treatment of phosphorothioate-modified poly(dC)20 to deprive cell-bound f-ODNs, the MFI from internalized f-ODNs was measured by FACScan. The MFI was measured from the live cells, extracting the dead population of cells with propidium iodide staining.

Nuclear magnetic resonance (NMR) analysis for ODN structure

ODNs were chemically synthesized on an Applied Biosystems 392 (Foster City, CA) and were purified by PAGE and size exclusion chromatography. The purified samples were dialyzed against PBS buffer. After lyophilization, the samples were dissolved in 400 µl of PBS. NMR experiments were performed on a Bruker DMX 600 spectrometer (Billerica, MA). Jump-and-return pulse was used to suppress water peak. The delay between the two 90°C pulses was set to optimize the imino proton peaks. The spectral width was 12,000 Hz (20 ppm), and 256 scans were averaged for each sample. The recycle delay was 1.8 s. The FIDs were apodized with 1 Hz exponential functions. The polynomial baseline correction was applied to the imino proton regions.

Immunizations

Six- to 8-wk-old female BALB/c mice were immunized with various Ags with or without ODNs. Briefly, 5 µg of heat-inactivated HIV type 1 (HIV-1) particles that had been formulated with aluminum hydroxide (Sigma) were s.c. immunized together with 50 µg of phosphodiester ODNs. We also used gDE2t protein (24), which is a fusion protein of herpes simplex virus type 1 glycoprotein D (gD) and C-terminal truncated hepatitis C virus (HCV) envelope protein 2 (E2t) for the immunization. Two micrograms of phosphodiester (1826D, M21) or phosphorothioate (1826T) ODNs were i.m. administered with 5 µg of gDE2t protein. Four weeks after the first immunization, mice were given booster immunizations with same immunization regimens. Humoral and cellular immune responses were monitored 2 wk after booster immunization. HIV- or HCV E2t-specific IgG responses were determined by ELISA. For the detection of cytokine expression from CD4+ T cells from immunized mice, CD4+ T cells were finally purified from nonadherent population of splenocytes using anti-CD4 microbeads and the miniMACS system. CD4+ T cells (2 x 105) were stimulated with E2t proteins purified from Chinese hamster ovary (CHO) cells for 5 days in the presence of 105 syngeneic APCs. APCs were isolated from the adherent population of splenocytes from naive BALB/c mice and then treated with mitomycin C (Sigma).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The existence of a dG run at the 3' terminus, not at the 5' terminus, of phosphodiester CpG ODNs is critical for cytokine induction from splenic DCs

To investigate the effects of a dG run on the cytokine induction by phosphodiester CpG ODNs, we sought the bacterial DNA sequence containing a dG run as well as a CpG hexamer nucleotide motif. The 20-mer ODN derived from ampR gene within the pUC19 sequences (nucleotides 2293–2312) (25), designated p19, was tested for its ability to induce IL-12 and TNF-{alpha} from splenic DCs (Table IGo). The putative dG run (GGGGCG)-containing phosphodiester CpG ODN p19 elicited higher levels of cytokine production, comparable to those induced by LPS. However, deletion of the putative dG run from p19 (p19d) completely abrogated cytokine production. As expected, the induction of cytokine production by p19 was entirely dependent upon the presence of a CpG sequence (M1). In addition, changes in nucleotides within the putative dG run from dG to dC (M7, M13, M14, and M15) resulted in dramatic reduction of IL-12 and TNF-{alpha} production, but substitution of a dC with a dG (M16) caused a marked increase in the production of cytokines, implying that the dG run is critical for cytokine induction by p19. However, the introduction into the 5' terminus of a dG run of various lengths (M19, M26, and M27) did not enhance cytokine induction. To explore the optimal length of a 3'-dG run, we tagged various numbers of dG residues to the 3' terminus of p19d (Fig. 1Go). It is likely that the 3'-dG run should have at least four consecutive dG residues for cytokine induction. The maximum induction of IL-12 and TNF-{alpha} production was achieved by the addition of a dG6 run (p19d-dG6; M16). In addition, the ability to induce cytokines was retained, but slightly decreased, when the longer dG runs (dG8, dG10, and dG12) were added. The conversion of CpG dinucleotide to GpC (p19d-dG12/GC) completely abrogated cytokine production, and poly(dG)20 did not induce cytokine production, indicating that the dG run alone could not induce cytokine production in the absence of a CpG motif.


View this table:
[in this window]
[in a new window]
 
Table I. Effects of dG run on cytokine induction from splenic dendritic cells1

 


View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. The optimal length of a 3'-dG run for cytokine induction. Splenic DCs (105) were stimulated by ODNs (1.5 µM) for either 10 h (TNF-{alpha}) or 30 h (IL-12). Mouse cytokines were determined from cell-free culture supernatants by ELISA kits (Genzyme). Data are expressed as the relative percentage of cytokine induction, and each bar represents the mean and SEM of triplicate determinations. The experiments were reproduced with similar results.

 
Enhancement of cytokine induction by dG6 run depends upon its location and the chemical property of the ODN backbone

To further address the effect of a dG6 run on different sequence contexts of phosphodiester CpG ODNs, we added a dG6 run to the 5' or the 3' terminus of two different CpG ODNs, such as 1826D and M12, respectively (Table IIGo). There was a significant increase in the activity of cytokine production when a dG6 run was fused to the 3' terminus (1826D vs M21, and M12 vs M22), but not to the 5' terminus (1826D vs M20, and M12 vs M23), suggesting that the effect of a dG6 run depends on its location within the phosphodiester CpG ODNs. To further determine the specificity of a dG run, we replaced a dG6 run with other nucleotide runs (dA6, dT6, and dC6) and tested for cytokine induction (Table IIGo). M16A, M16T, and M16C were completely deprived of the ability to induce cytokines, indicating the specificity of a dG run for this function. To assess the effect of the dG run on other mouse APCs, CpG ODNs conjugated with a dG6 run were treated with either peritoneal macrophages (pMac) or splenic B cells. Although pMac and B cells produced much lower amount of IL-12 than did splenic DCs, the addition of a dG6 run to the 3' of CpG ODNs (M21 and M16), but not into the 5' (M20 and M26), also enhanced IL-12 production (Fig. 2Go). As expected, the replacement of a dG6 run with a dC6 run totally abolished the induction of IL-12. These results suggest that the dG run is effective in a broad range of cells in a position-dependent manner.


View this table:
[in this window]
[in a new window]
 
Table II. Effects of a dG run on cytokine induction depend on its location1

 


View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 2. The effect of a dG6 run in peritoneal macrophages and B cells. ODNs (3 µM) were incubated for 30 h with 105 peritoneal macrophages and 2 x 105 CD19+ splenic B cells. The nucleotide sequence of M21C is TCCATGACGTTCCTGACGTTC CCCCC. Each bar represents the mean and SEM of triplicate determinations. The experiments were repeated three times with similar results. UD, undetected.

 
A similar approach was taken to test whether the conjugation of a dG6 run at the 3' terminus is also effective in a phosphorothioate-modified CpG ODN. The phosphorothioate CpG ODN 1826T greatly augmented cytokine induction relative to the phosphodiester CpG ODN 1826D. Interestingly, the existence of a dG6 run at the 3' terminus of a phosphorothioate CpG ODN (M21T) decreased both TNF-{alpha} and IL-12 production compared with1826T (Fig. 3Go), suggesting that the conjugation of a dG6 run at the 3' terminus inhibits immunostimulatory potentials of phosphorothioate-modified CpG ODNs. In particular, M21T produced lesser amounts of IL-12 but higher amounts of TNF-{alpha} than did M21, a dG6 run-containing phosphodiester CpG ODN. These results imply that the dG run differently affects CpG-mediated cytokine induction depending upon the chemical property of backbone structure of CpG ODNs.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. The effect of 3'-dG6 run conjugation into phosphorothioate CpG ODN on cytokine induction. Splenic DCs (105) were stimulated by ODNs for either 10 h (TNF-{alpha}) or 30 h (IL-12). Mouse cytokines were determined from cell-free culture supernatants by ELISA. 1826D and M21 are phosphodiester CpG ODNs, and 1826T, M21T, and control ODN are phosphorothioate-modified ODNs. The nucleotide sequence of control ODN is TCCATGAGCTTCCTGAGCTT. The experiments were repeated three times with similar results.

 
The conjugation of a dG6 run influences both the uptake and the cellular signaling of CpG ODNs

To determine the effect of a dG run conjugation on the cellular binding and the internalization of CpG ODNs in CD11c+ splenic DCs, we performed FACS analysis using fluoresceinated phosphodiester CpG ODNs. Fluoresceinated p19 (f-p19), but not f-p19d, was shown to efficiently bind to DCs (Fig. 4GoA). f-M16 and f-M26 that contain a 3' and a 5'-dG6 run, respectively, bound more efficiently than did f-p19. The cellular binding of ODNs was also enhanced by the tagging of a dG6 run to the 3' and 5' termini of f-1826D (f-M21 and f-M20, respectively). Interestingly, CpG ODNs with a dG6 run at their 5' termini bound to DCs less efficiently than those with a dG6 run at their 3' termini. However, the substitution of a dG6 run on f-M21 with a dC6 run (f-M21C) completely abolished its binding activity, suggesting that the cellular binding of ODN is dG run specific. Moreover, the capacity for internalization of ODNs was correlated with the binding activity (Fig. 4GoB), implying that the binding of the dG6 run resulted in an increase in the intracellular concentration of CpG ODNs. It is worth noting that the apparent ODN uptake shown in Fig. 4GoB may be less than the actual uptake due to the rapid degradation of phosphodiester ODN (26). Similar results were observed in B cells and pMac (data not shown). In addition, pMac had approximately 4 times higher binding affinity for ODNs than B cells and DCs. Nevertheless, the level of IL-12 production from pMac and B cells by CpG ODNs conjugated with a dG6 run was much lower than that from DCs (Fig. 2Go and Table IIGo). Therefore, these data suggest that among primary APCs, DCs are the most potent cells for CpG ODN-mediated IL-12 induction.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. Conjugation of a dG6 run enhanced the binding and the internalization of CpG ODNs in DCs. CD11c+ splenic DCs (105) were incubated with various ODNs tagged by fluorescein. The MFI was measured from quadruplicate DC cultures. Data are expressed as the relative index, defined as the fold increase in MFI in the presence of f-ODNs over MFI in the presence of medium alone. The f-ODNs (5 µM) were incubated for 30 min at 4°C. The MFI from f-ODNs bound to cell membrane was measured (A). f-ODNs (1 µM) were treated for 30 min at 4°C and then further incubated for either 1.5 or 6 h at 37°C. MFI from internalized f-ODNs was measured by removing membrane-bound f-ODNs (B).

 
We next addressed why the 5' conjugation of a dG6 run has little effect on cytokine production, although it increases the binding and the internalization of CpG ODNs. We hypothesized that the 5'-dG6 run may inhibit CpG motif-mediated cellular signaling for cytokine induction. To test this hypothesis, we delivered various ODNs together with liposomes into DCs to normalize the intracellular concentration of ODNs (Table IIGo), and it was shown that all ODNs, except M16GC, greatly increased IL-12 production. Interestingly, CpG ODNs conjugated with a dA6, a dT6, or a dC6 run at their 3' termini (M16A, M16T, and M16C) also induced high levels of IL-12 production comparable to M16, suggesting that the 3'-dG6 run is only necessary for the binding and the subsequent internalization of ODNs. In contrast, there was a significant reduction in IL-12 production by the 5' addition of a dG6 run to CpG ODN (M20 and M23) compared with 1826D and M12 that lack a dG6 run, indicating that the dG6 run at the 5' terminus may inhibit the cytokine induction mediated by CpG ODNs, even if it could increase their cellular binding and internalization activities.

The dG run-containing CpG ODNs bind to the receptor with a SR-A ligand specificity on splenic DCs

It was previously suggested that ODNs containing a dG12 run at their 5' and 3' termini could bind to SR on macrophages (17). In fact, the expression of the SR family in subsets of DCs has not been clearly identified. Singh et al. showed that maleyl-BSA which is the ligand of many SR families (SR-A I/II, SR-BI, CD36) could bind to murine splenic DCs (21). In addition, human DCs could express CD36 (27) and Cla-1 (28), the human homologue of the murine SR-BI. Thus, we performed the competitive binding assays using f-M21 for SR families in DCs. The binding of f-M21 to DCs was significantly impaired by treatment with the competitive ligands for SR-A, such as dextran sulfate, fucoidan, and poly(dG)20 (19) (Fig. 5Go). In contrast, chondroitin sulfate and poly(dC)20 did not compete with f-M21 for binding to DCs, indicating the specificity of competition. In addition, pretreatment with low density lipoprotein and oleic acid, which are ligands for SR-BI and CD36, respectively, did not diminish the binding of f-M21 even at a high concentration (0.5 mg/ml), suggesting that the receptor with a SR-A ligand specificity may confer the binding activity to dG run-containing ODNs. It was previously reported that phosphodiester or phosphorothioate ODNs could bind to Mac-1 proteins (CD11b/CD18) in human polymorphonuclear leukocytes and that fibrinogen and anti-CD18 mAb efficiently compete with the binding of ODNs to Mac-1 (29). However, pretreatment of fibrinogen and anti-CD18 mAb could not decrease the binding of f-M21 to DCs and to pMac, suggesting that Mac-1 was not a target receptor for the binding of dG6 run-containing phosphodiester ODNs, at least in the murine APCs.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 5. The dG6 run-containing CpG ODNs bind to a receptor with an SR-A ligand specificity in splenic DCs. CD11c+ splenic DCs (105) were incubated with f-M21 (1 µM) in the presence of various ligands (0.25 mg/ml; 10 µM poly(dG)20 and poly(dC)20), and MFI from bound f-M21 was measured. Data are expressed as the relative percentage of binding when the MFI from f-M21 alone was regarded as 100%. All experiments were repeated five times with similar results.

 
The conjugation of a dG run induces the structural transformation of CpG ODNs

It was previously reported that short oligo-dGs could be assembled into a four-stranded helix, called a tetraplex, that was stabilized by G quartets and inhibited SR activity (18). To investigate whether specific structural determinants of CpG ODNs are required for binding to SR, we determined the tetraplex formation of various CpG ODNs with or without a dG run by the presence of unusual imino proton NMR resonances in 10–12 ppm (30, 31). The population of tetraplex structures relative to that of Watson-Crick base-paired hairpin or duplex structures was estimated for various ODNs (Fig. 6Go). All ODNs with four or longer consecutive dG residues formed tetraplex structures regardless of their location. Longer dG runs increased the tetraplex population. ODNs containing a 3'-dG6 run (M16 and M21) formed more clear tetraplex structures than did those containing a 5'-dG6 run (M16' and M20), which may explain why CpG ODNs with a 3'-dG6 run were more efficient in the cellular binding. For the 3'-dG run-containing CpG ODNs, the ability to induce IL-12 appeared to correlate with the population of the tetraplex structure, suggesting that the structural transformation into a tetraplex was critical for cytokine induction by CpG ODNs with a 3'-dG run.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. Imino proton NMR spectra and the population ratios of tetraplex structure for various ODNs. The population ratios of tetraplex structure to hairpin or duplex structure were estimated by calculating the peak integral ratios of G quartet imino proton resonances and Watson-Crick base-paired imino proton resonances at 10–12 and 12–14.5 ppm, respectively. The relative percentages of IL-12 induction from splenic DCs were also reported by setting the IL-12 induction by p19 as 100%. The nucleotide sequence of M16' is GGGGGGAAAACGTTCGTC.

 
The conjugation of a dG6 run into phosphodiester CpG ODNs is crucial for the generation of Th1 immunity in vivo

To determine whether the conjugation of a dG run also affected the immunostimulatory potentials of phosphodiester CpG ODNs in vivo, alum-absorbed, heat-inactivated HIV-1 particles with or without ODNs were s.c. immunized into mice. Without the coadministration of ODNs, mice raised moderate levels of IgG, which were mainly composed of IgG1 isotype (Fig. 7GoA). The coadministration of a dG6 run-containing CpG ODN, M16, increased total IgG production (p < 0.05), especially the IgG2a isotype (p < 0.03), which is one of the representatives of Th1 immune responses (32). In contrast, the coadministration of either M16C or M16GC did not significantly increase the levels of total IgG and IgG2a. These results suggest that the presence of both a CpG motif and a dG run are critical for the adjuvanticity of phosphodiester CpG ODN, whereby either a dG run or a CpG motif alone did not confer an immunostimulatory effect in vivo. Since only phosphorothioate-modified CpG ODNs have been used as adjuvants to date (33, 34, 35), we next compared the adjuvanticity of dG6 run-tagged phosphodiester CpG ODN (M21) with phosphorothioate CpG ODN (1826T) for the generation of Th1 immunity. We also used the phosphodiester CpG ODN (1826D) as a control CpG ODN for these experiments. To clearly observe the adjuvanticity, we immunized gDE2t fusion proteins (24) in the absence of alum together with relatively low dose of ODNs (2 µg) into mice. The coimmunization of gDE2t proteins with 1826D elicited a low level of HCV E2-specific IgG2a production (Fig. 7GoB). In contrast, coadministration of M21 elicited IgG2a production approximately 50-fold higher than did 1826D, but 2-fold lower than that induced by 1826T, indicating that the tagging of a dG6 run into 1826D enhances its adjuvanticity to elicit IgG2a production. In concordance with IgG subtype responses, CD4+ T cells from mice that received either M21 or 1826T had a higher ratio of IFN-{gamma} to IL-4 secretion than did mice that received 1826D by the stimulation with recombinant HCV E2t proteins (Fig. 7GoC). Overall, our results suggest that the conjugation of a dG run is critical for induction of Th1 immunity to protein Ags when phosphodiester CpG ODNs are used as adjuvants.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 7. The conjugation of a 3'-dG6 run into phosphodiester CpG ODNs is essential for inducing Th1 immunity in vivo. Ags were immunized into BALB/c mice with or without ODNs, and mice were given a booster immunization 4 wk after the first immunization. A, HIV-1-specific IgG responses. Heat-inactivated HIV-1 particles (5 µg/mouse) that had been formulated with alum were s.c. administered together with 50 µg of phosphodiester ODNs. Each bar represents the group mean (n = 6) of OD (OD450) values, and vertical lines represent the SEM. End-point titers were also determined by ELISA with a serial 3-fold dilution of pooled sera. The OD cut-off value was established as the mean OD + 3 SD of serum samples obtained from control mice that were immunized alum only. Statistics were determined using Student’s t test. B, Mean ELISA titers of anti-E2t IgG2a from each group of mice (n = 6). gDE2t protein (5 µg/mouse) was i.m. immunized without alum. Two micrograms of phosphodiester (1826, M21) or phosphorothioate (1826T) ODNs was coadministered. End-point titers were determined with individual serum sample. C, Cytokine expression from CD4+ T cells from immunized mice (n = 3). CD4+ T cells (2 x 105) were stimulated with E2t protein for 5 days. Each bar represents the mean and SEM in quadruplicate. All experiments were reproduced with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report we clearly demonstrated that the conjugation of a dG6 run into phosphodiester CpG ODNs augmented cytokine induction from various mouse APCs, especially splenic DCs, only when a dG6 run was located at the 3' terminus. Tagging of a dG6 run to phosphodiester CpG ODNs enabled them to efficiently target various APCs, including DCs, through SR-mediated endocytosis. It is of interest to note that DCs stimulated by CpG ODNs with a dG6 run produced approximately 50-fold more IL-12 than did pMac, even though DCs bind to ODNs 4 times less efficiently than do pMac. Our competition analysis suggests that the potential receptor for the binding of dG6 run-containing CpG ODNs is SR-A in CD11c+ splenic DCs, since only ligands for SR-A could inhibit the binding of CpG ODNs. However, we do not exclude the possibility that another receptor(s) sharing ligand specificity with SR-A confers the binding of dG6 run-containing CpG ODNs. Receptor signaling by SR ligation has been reported to affect cytokine induction. The ligation of SR by maleyl-BSA could initiate transcription of the TNF-{alpha} gene on murine macrophages (36). In contrast, it is known that SR ligation by maley-BSA selectively suppresses LPS-induced IL-12 production in bone marrow-derived macrophages (37). However, it is unlikely that SR ligation through G quartets by itself affects intracellular signaling for cytokine induction in DCs, since neither TNF-{alpha} nor IL-12 is induced by either dG6 run-containing ODNs that lacked a CpG motif or poly(dG)20.

Formation of a tetraplex structure stabilized by G quartets dramatically affected both the efficiency of binding and subsequent internalization of dG run-containing CpG ODNs into APCs. It is unclear why a dG6 run conjugated at the 5' terminus is less efficient at inducing a tetraplex structure than a dG6 run conjugated at the 3' terminus. Nevertheless, the location of a dG6 run within CpG ODNs appeared to be important for their functions, since a 5'-dG6 run inhibited cytokine induction elicited by CpG motifs when CpG ODNs were delivered with liposomes. Our results are partially consistent with a recent report by Krieg et al. (38) that demonstrated that some ODNs containing self-complementary and/or G-rich sequences (CpG-N) neutralized the ability of CpG motif-mediated cytokine induction in cis or trans. They also suggested that the higher ordered structure of CpG-N might exert neutralizing effects on cytokine induction. However, our structural data showed that a G quartet structure failed to induce IL-12 production only when it was located at the 5' terminus of phosphodiester CpG ODNs (Fig. 6Go). The detailed mechanisms by which a 5'-dG6 run inhibits CpG-mediated cytokine induction should be explored.

Previous reports suggested that the sequence contexts flanking the CpG motif were important for the activity of CpG ODNs (10, 38, 39), but it was unclear how and why the flanking sequences influenced their functions. Even though 1826D induced a relatively low level of cytokine production from DCs, other phosphodiester CpG ODNs tested in this study had no activity in the absence of a dG run. However, these CpG ODNs elicited cytokine production similar to that by 1826D when they were delivered with liposomes (Table IIGo), suggesting that the specificity of ODN sequences may be related to their internalization efficiency. In addition, it is likely that the length of the CpG ODN affects the efficiency of intracellular signaling for cytokine induction and/or the stability of the ODN, since 11-mer CpG ODN (M12) induced IL-12 much less efficiently than did longer CpG ODNs when delivered with liposomes (Table IIGo). Taken together, our results suggest that both the sequence context and the length of phosphodiester CpG ODNs are important to modulate their immunostimulatory potentials. The chemical property of the backbone structure of CpG ODNs also affected their ability to induce cytokine. Of note, the conjugation of a dG6 run at the 3' terminus of a phosphorothioate CpG ODN decreased its ability for both TNF-{alpha} and IL-12 induction from splenic DCs. Ballas et al. also demonstrated that the poly(dG) ends completely abrogated the enhancement of NK activity by CpG motifs when the entire backbone was phosphorothioate modified (20). Although additional experiments are required to clarify whether the backbone structure influences CpG-mediated cytokine induction, the phosphorothioate modification is suggested to reduce the binding affinity of the CpG ODN to a putative cellular target protein(s) (40).

The intrinsic immunostimulatory potential of the phosphorothioate backbone can generate Janus-faced consequences, since it strongly boosts cytokine induction elicited by CpG motifs and induces detrimental immune activation and toxicity (1, 41, 42, 43). In fact, we observed that a single s.c. administration of phosphorothioate, but not phosphodiester, CpG ODNs (30–50 µg) with 5 µg of gDE2t protein absorbed in alum elicited granuloma formation at the injection sites in mice (data not shown). In contrast to phosphorothioate CpG ODNs, phosphodiester CpG ODNs without a dG run were poorly immunostimulatory by themselves in vitro and in vivo, possibly due to the low efficiency of nonspecific endocytosis and vulnerability to nucleases. However, the conjugation of a dG run may surmount the defects of phosphodiester CpG ODNs due to the following reasons. First, since the tetraplex structure was reported to confer serum nuclease resistance (44), it is possible that the conjugation of a dG run may extend a half-life of phosphodiester CpG ODNs. Second, the dG run efficiently targets CpG ODNs into various APCs via the SR. Our data demonstrated that the conjugation of a dG6 run into phosphodiester CpG ODNs can generate Th1 immunity in vivo. In addition, we observed that the binding and internalization of phosphodiester ODNs into HepG2 cells that express SRs were significantly increased in the presence of a dG run (unpublished observations), suggesting that the conjugation of a dG run has a great potential for delivery of ODNs into cells expressing SRs, such as hepatocytes (45, 46). In conclusion, it is likely that the conjugation of a dG6 run into phosphodiester CpG ODNs would be a promising modification for therapeutic purposes of CpG ODNs.


    Acknowledgments
 
We thank Dr. J. R. Kim for immunocytochemistry of splenic DCs. We also thank Dr. C. W. Lee for review of manuscript, and S. C. Lee for animal care.


    Footnotes
 
1 This work was supported by the grant from Genexine and a National Research Laboratory grant from Korea Institute of Science and Technology Evaluation and Planning. Back

2 S.W.L. and M.K.S. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Young Chul Sung, Department of Life Science, Pohang University of Science and Technology, Pohang 790-784, Korea. Back

4 Abbreviations used in this paper: ODN, oligodeoxynucleotide; DC, dendritic cell; SR, scavenger receptor; f-ODN, ODN modified by tagging the fluorescein into the 3' or 5' terminus; MFI, mean fluorescent intensity; NMR, nuclear magnetic resonance; gD, glycoprotein D; HCV, hepatitis C virus; pMac, peritoneal macrophages. Back

Received for publication April 26, 2000. Accepted for publication July 13, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Klinman, D. M., D. Verthelyi, F. Takeshita, K. J. Ishii. 1999. Immune recognition of foreign DNA: a cure for bioterrorism?. Immunity 11:123.[Medline]
  2. Carpentier, A. F., L. Chen, F. Maltonti, J. Y. Delattre. 1999. Oligodeoxynucleotides containing CpG motifs can induce rejection of a neuroblastoma in mice. Cancer Res. 59:5429.[Abstract/Free Full Text]
  3. Klinman, D. M., J. Conover, C. Coban. 1999. Repeated administration of synthetic oligodeoxynucleotides expressing CpG motifs provides long-term protection against bacterial infection. Infect. Immun. 67:5658.[Abstract/Free Full Text]
  4. Walker, P. S., T. Scharton-Kersten, A. M. Krieg, L. Love-Homan, E. D. Rowton, M. C. Udey, J. C. Vogel. 1999. Immunostimulatory oligodeoxynucleotides promote protective immunity and provide systemic therapy for leishmaniasis via IL-12- and IFN-{gamma}-dependent mechanisms. Proc. Natl. Acad. Sci. USA 96:6970.[Abstract/Free Full Text]
  5. Kovarik, J., P. Bozzotti, L. Love-Homan, M. Pihlgren, H. L. Davis, P. H. Lambert, A. M. Krieg, C. A. Siegrist. 1999. CpG oligodeoxynucleotides can circumvent the Th2 polarization of neonatal responses to vaccines but may fail to fully redirect Th2 responses established by neonatal priming. J. Immunol. 162:1611.[Abstract/Free Full Text]
  6. Kline, J. N., T. J. Waldschmidt, T. R. Businga, J. E. Lemish, J. V. Weinstock, P. S. Thorne, A. M. Krieg. 1998. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J. Immunol. 160:2555.[Abstract/Free Full Text]
  7. Klinman, D. M., A. K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon {gamma}. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  8. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  9. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, J. C. Vogel. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042.[Abstract/Free Full Text]
  10. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
  11. Yi, A. K., R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.[Abstract/Free Full Text]
  12. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230.[Medline]
  13. Bennett, R. M., G. T. Gabor, M. M. Merritt. 1985. DNA binding to human leukocytes: evidence for a receptor-mediated association, internalization, and degradation of DNA. J. Clin. Invest. 76:2182.
  14. Yakubov, L. A., E. A. Deeva, V. F. Zarytova, E. M. Ivanova, A. S. Ryte, L. V. Yurchenko, V. V. Vlassov. 1989. Mechanism of oligonucleotide uptake by cells: involvement of specific receptors?. Proc. Natl. Acad. Sci. USA 86:6454.[Abstract/Free Full Text]
  15. Oxenius, A., M. M. Martinic, H. Hengartner, P. Klenerman. 1999. CpG-containing oligonucleotides are efficient adjuvants for induction of protective antiviral immune responses with T-cell peptide vaccines. J. Virol. 73:4120.[Abstract/Free Full Text]
  16. Pisetsky, D. S.. 1996. Immune activation by bacterial DNA: a new genetic code. Immunity 5:303.[Medline]
  17. Kimura, Y., K. Sonehara, E. Kuramoto, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, T. Tokunaga. 1994. Binding of oligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN. J. Biochem. 116:991.[Abstract/Free Full Text]
  18. Pearson, A. M., A. Rich, M. Krieger. 1993. Polynucleotide binding to macrophage scavenger receptors depends on the formation of base-quartet-stabilized four-stranded helices. J. Biol. Chem. 268:3546.[Abstract/Free Full Text]
  19. Pearson, A. M.. 1996. Scavenger receptors in innate immunity. Curr. Opin. Immunol. 8:20.[Medline]
  20. Ballas, Z. K., W. L. Rasmussen, A. M. Krieg. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
  21. Singh, N., S. Bhatia, R. Abraham, S. K. Basu, A. George, V. Bal, S. Rath. 1998. Modulation of T cell cytokine profiles and peptide-MHC complex availability in vivo by delivery to scavenger receptors via antigen maleylation. J. Immunol. 160:4869.[Abstract/Free Full Text]
  22. Ridge, J. P., E. J. Fuchs, P. Matzinger. 1996. , Neonatal tolerance revisited: turning on newborn T cells with dendritic cells. Science 271:1723.[Abstract]
  23. Ha, S. J., C. H. Lee, S. B. Lee, C. M. Kim, K. L. Jang, H. S. Shin, Y. C. Sung. 1999. A novel function of IL-12p40 as a chemotactic molecule for macrophages. J. Immunol. 163:2902.[Abstract/Free Full Text]
  24. Song, M. K, S. W. Lee, Y. S. Suh, K. J. Lee, Y. C. Sung. 2000. Enhancement of IgG2a and cytotoxic T-lymphocyte responses by a booster immunization with recombinant hepatitis C virus E2 protein in E2 DNA-primed mice. J. Virol. 74:2920.[Abstract/Free Full Text]
  25. Sato, Y., M. Roman, H. Tighe, D. Lee, M. Corr, M. D. Nguyen, G. J. Silverman, M. Lotz, D. A. Carson, E. Raz. 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352.[Abstract]
  26. Zhao, Q., S. Matson, C. J. Herrera, E. Fisher, H. Yu, A. M. Krieg. 1993. Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate, and mixed phosphorothioate and methylphosphonate oligonucleotides. Antisense Res. Dev. 3:53.[Medline]
  27. Albert, M. L., S. F. Pearce, L. M. Francisco, B. Sauter, P. Roy, R. L. Silverstein, N. Bhardwaj. 1998. Immature dendritic cells phagocytose apoptotic cells via {alpha}vß5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359.[Abstract/Free Full Text]
  28. Buechler, C., M. Ritter, C. D. Quoc, A. Agildere, G. Schmitz. 1999. Lipopolysaccharide inhibits the expression of the scavenger receptor Cla-1 in human monocytes and macrophages. Biochem. Biophys. Res. Commun. 262:251.[Medline]
  29. Benimetskaya, L., J. D. Loike, Z. Khaled, G. Loike, S. C. Silverstein, L. Cao, J. el Khoury, T. Q. Cai, C. A. Stein. 1997. Mac-1 (CD11b/CD18) is an oligodeoxynucleotide-binding protein. Nat. Med. 3:414.[Medline]
  30. Aboul-ela, F., A. I. Murchie, D. G. Norman, D. M Lilley. 1994. Solution structure of a parallel-stranded tetraplex formed by d(TG4T) in the presence of sodium ions by nuclear magnetic resonance spectroscopy. J. Mol. Biol. 243:458.[Medline]
  31. Cheong, C., P.B. Moore. 1992. Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures. Biochemistry 31:8406.[Medline]
  32. Snapper, C. M., W. E. Paul. 1987. Interferon-{gamma} and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236:944.[Abstract/Free Full Text]
  33. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  34. Davis, H. L., R. Weeratna, T. J. Waldschmidt, L. Tygrett, J. Schorr, A. M. Krieg. 1998. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160:870.[Abstract/Free Full Text]
  35. Zimmermann, S., O. Egeter, S. Hausmann, G. B. Lipford, M. Rocken, H. Wagner, K. Heeg. 1998. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J. Immunol. 160:3627.[Abstract/Free Full Text]
  36. Misra, U. K., R. E. Shackelford, K. Florine-Casteel, S. F. Thai, P. B. Alford, S. V. Pizzo, D. O. Adams. 1996. Maleylated-BSA induces hydrolysis of PIP2, fluxes of Ca2+, NF-{kappa}B binding, and transcription of the TNF-{alpha} gene in murine macrophages. J. Leukocyte Biol. 60:784.[Abstract]
  37. Sutterwala, F. S., G. J. Noel, R. Clynes, D. M. Mosser. 1997. Selective suppression of interleukin-12 induction after macrophage receptor ligation. J. Exp. Med. 185:1977.[Abstract/Free Full Text]
  38. Krieg, A. M., T. Wu, R. Weeratna, S. M. Efler, L. Love-Homan, L. Yang, A. K. Yi, D. Short, H. L. Davis. 1998. Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs. Proc. Natl. Acad. Sci. USA 95:12631.[Abstract/Free Full Text]
  39. Lipford, G. B., T. Sparwasser, M. Bauer, S. Zimmermann, E. S. Koch, K. Heeg, H. Wagner. 1997. Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur. J. Immunol. 12:3420.
  40. Hartmann, G., R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al 2000. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 164:1617.[Abstract/Free Full Text]
  41. Stein, C. A., Y. C. Cheng. 1993. Antisense oligonucleotides as therapeutic agents–is the bullet really magical?. Science 261:1004.[Abstract/Free Full Text]
  42. Monteith, D. K., M. J. Horner, N. A. Gillett, M. Butler, R. Geary, T. Burckin, T. Ushiro-Watanabe, A. A. Levin. 1999. Evaluation of the renal effects of an antisense phosphorothioate oligodeoxynucleotide in monkeys. Toxicol. Pathol. 27:307.[Abstract/Free Full Text]
  43. Wagner, H.. 1999. Bacterial CpG DNA activates immune cells to signal infectious danger. Adv. Immunol. 73:329.[Medline]
  44. Bishop, J. S., J. K. Guy-Caffey, J. O. Ojwang, S. R. Smith, M. E. Hogan, P. A. Cossum, R. F. Rando, N. Chaudhary. 1996. Intramolecular G-quartet motifs confer nuclease resistance to a potent anti-HIV oligonucleotide. J. Biol. Chem. 271:5698.[Abstract/Free Full Text]
  45. Kleinherenbrink-Stins, M. F., J. H. van de Boom, D. Schouten, P. J. Roholl, M. Niels van der Heyde, A. Brouwer, T. J. van Berkel, D. L. Knook. 1991. Visualization of the interaction of native and modified lipoproteins with parenchymal, endothelial and Kupffer cells from human liver. Hepatology 14:79.[Medline]
  46. Rhainds, D., L. Falstrault, C. Tremblay, L. Brissette. 1999. Uptake and fate of class B scavenger receptor ligands in HepG2 cells. Eur. J. Biochem. 261:227.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
S. Ivanov, A.-M. Dragoi, X. Wang, C. Dallacosta, J. Louten, G. Musco, G. Sitia, G. S. Yap, Y. Wan, C. A. Biron, et al.
A novel role for HMGB1 in TLR9-mediated inflammatory responses to CpG-DNA
Blood, September 15, 2007; 110(6): 1970 - 1981.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Jozefowski, T. H. Sulahian, M. Arredouani, and L. Kobzik
Role of scavenger receptor MARCO in macrophage responses to CpG oligodeoxynucleotides
J. Leukoc. Biol., October 1, 2006; 80(4): 870 - 879.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Osawa, S. Iho, R. Takauji, H. Takatsuka, S. Yamamoto, T. Takahashi, S. Horiguchi, Y. Urasaki, T. Matsuki, and S. Fujieda
Collaborative Action of NF-{kappa}B and p38 MAPK Is Involved in CpG DNA-Induced IFN-{alpha} and Chemokine Production in Human Plasmacytoid Dendritic Cells
J. Immunol., October 1, 2006; 177(7): 4841 - 4852.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gursel, I. Gursel, H. S. Mostowski, and D. M. Klinman
CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation
J. Immunol., August 1, 2006; 177(3): 1575 - 1580.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Kerkmann, L. T. Costa, C. Richter, S. Rothenfusser, J. Battiany, V. Hornung, J. Johnson, S. Englert, T. Ketterer, W. Heckl, et al.
Spontaneous Formation of Nucleic Acid-based Nanoparticles Is Responsible for High Interferon-{alpha} Induction by CpG-A in Plasmacytoid Dendritic Cells
J. Biol. Chem., March 4, 2005; 280(9): 8086 - 8093.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. N. Wu, J. Lee, E. Raz, M. Corr, and D. A. Carson
Necessity of Oligonucleotide Aggregation for Toll-like Receptor 9 Activation
J. Biol. Chem., August 6, 2004; 279(32): 33071 - 33078.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Lundberg, P. Welander, X. Han, and E. Cantin
Herpes Simplex Virus Type 1 DNA Is Immunostimulatory In Vitro and In Vivo
J. Virol., October 15, 2003; 77(20): 11158 - 11169.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. D. Marshall, E. M. Hessel, J. Gregorio, C. Abbate, P. Yee, M. Chu, G. V. Nest, R. L. Coffman, and K. L. Fearon
Novel chimeric immunomodulatory compounds containing short CpG oligodeoxyribonucleotides have differential activities in human cells
Nucleic Acids Res., September 1, 2003; 31(17): 5122 - 5133.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. D. Marshall, K. Fearon, C. Abbate, S. Subramanian, P. Yee, J. Gregorio, R. L. Coffman, and G. Van Nest
Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions
J. Leukoc. Biol., June 1, 2003; 73(6): 781 - 792.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Hemmi, T. Kaisho, K. Takeda, and S. Akira
The Roles of Toll-Like Receptor 9, MyD88, and DNA-Dependent Protein Kinase Catalytic Subunit in the Effects of Two Distinct CpG DNAs on Dendritic Cell Subsets
J. Immunol., March 15, 2003; 170(6): 3059 - 3064.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Gursel, D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman
Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide
J. Leukoc. Biol., May 1, 2002; 71(5): 813 - 820.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Park, S. W. Lee, and Y. C. Sung
Cutting Edge: CpG DNA Inhibits Dendritic Cell Apoptosis by Up-Regulating Cellular Inhibitor of Apoptosis Proteins Through the Phosphatidylinositide-3'-OH Kinase Pathway
J. Immunol., January 1, 2002; 168(1): 5 - 8.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. Mui, S. G. Raney, S. C. Semple, and M. J. Hope
Immune Stimulation by a CpG-Containing Oligodeoxynucleotide Is Enhanced When Encapsulated and Delivered in Lipid Particles
J. Pharmacol. Exp. Ther., September 1, 2001; 298(3): 1185 - 1192.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. H. Baek, S. J. Ha, and Y. C. Sung
A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages
J. Immunol., September 1, 2001; 167(5): 2847 - 2854.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S. W.
Right arrow Articles by Sung, Y. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S. W.
Right arrow Articles by Sung, Y. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS