The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Im, S.-H.
Right arrow Articles by Fuchs, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Im, S.-H.
Right arrow Articles by Fuchs, S.
The Journal of Immunology, 2000, 165: 3599-3605.
Copyright © 2000 by The American Association of Immunologists

Role of Tolerogen Conformation in Induction of Oral Tolerance in Experimental Autoimmune Myasthenia Gravis1

Sin-Hyeog Im*, Dora Barchan*, Miriam C. Souroujon*,{dagger} and Sara Fuchs2,*

* Department of Immunology, The Weizmann Institute of Science, Rehovot, Israel; and {dagger} The Open University of Israel, Tel-Aviv, Israel


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We recently demonstrated that oral or nasal administration of recombinant fragments of the acetylcholine receptor (AChR) prevents the induction of experimental autoimmune myasthenia gravis (EAMG) and suppresses ongoing EAMG in rats. We have now studied the role of spatial conformation of these recombinant fragments in determining their tolerogenicity. Two fragments corresponding to the extracellular domain of the human AChR {alpha}-subunit and differing in conformation were tested: H{alpha}1–205 expressed with no fusion partner and H{alpha}1–210 fused to thioredoxin (Trx), and designated Trx-H{alpha}1–210. The conformational similarity of the fragments to intact AChR was assessed by their reactivity with {alpha}-bungarotoxin and with anti-AChR mAbs, specific for conformation-dependent epitopes. Oral administration of the more native fragment, Trx-H{alpha}1–210, at the acute phase of disease led to exacerbation of EAMG, accompanied by an elevation of AChR-specific humoral and cellular reactivity, increased levels of Th1-type cytokines (IL-2, IL-12), decreased levels of Th2 (IL-10)- or Th3 (TGF-ß)-type cytokines, and higher expression of costimulatory factors (CD28, CTLA4, B7-1, B7-2, CD40L, and CD40). On the other hand, oral administration of the less native fragments H{alpha}1–205 or denatured Trx-H{alpha}1–210 suppressed ongoing EAMG and led to opposite changes in the immunological parameters. It thus seems that native conformation of AChR-derived fragments renders them immunogenic and immunopathogenic and therefore not suitable for treatment of myasthenia gravis. Conformation of tolerogens should therefore be given careful attention when considering oral tolerance for treatment of autoimmune diseases.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Oral tolerance is the phenomenon of systemic, Ag-specific, immunological hyporesponsiveness that results from oral administration of Ag (1). The potential of oral administration of autoantigens or their derivatives for the amelioration of autoimmune diseases was first demonstrated in a model of collagen-induced arthritis in rats that was suppressed by oral administration of type II collagen (2, 3). Since then, many groups have demonstrated suppression of autoimmune responses in a variety of animal models, which led to a series of clinical trials in humans suffering from multiple sclerosis (4), rheumatoid arthritis (5), uveitis (6), and type I diabetes (7). Three basic mechanisms have been suggested to contribute to mucosal Ag-driven tolerance: clonal deletion, clonal anergy, and active suppression. These mechanisms are not mutually exclusive and may occur simultaneously to maintain stable tolerance.

Several factors are known to determine the mechanism of oral tolerance. The dose of Ag administered is the primary determinant of which mechanism predominates and may determine the outcome of oral administration of the Ag (8, 9, 10). Low doses favor active suppression, while high Ag doses favor clonal deletion and clonal anergy. For instance, oral administration of low doses (20–2500 µg) of type II collagen has a beneficial effect on the clinical state of rheumatoid arthritis patients, as monitored by three sets of composite criteria of improvement in rheumatoid arthritis, whereas larger doses did not induce active suppression of the autoimmune process and did not provide protection (11). Similar results were also obtained in a diabetes model in mice (12).

Even though substantial progress has been made in elucidating the immunological mechanisms associated with Ag-specific oral tolerance, there are still many important aspects to be investigated. These include the delineation of Ag uptake and delivery in the gut, Ag processing and presentation in the gut-associated lymphoid tissue, and costimulation requirements.

One of the open questions concerns the importance of the chemical nature of the fed tolerogen for the induction of systemic tolerance (13). Orally administered particulate Ags often induce an active immune response, in contrast to the tolerance induced by the same Ags in soluble form (14, 15). The degree of nativity of the Ags is also an important issue. For instance, oral administration of type II collagen in its native form leads to the induction of chronic autoimmune arthritis in mice, suggesting that the conformation of an orally introduced Ag could be a key factor in induction of systemic tolerance (16). In the present study, we test the contribution of tolerogen conformation for the induction of oral tolerance in experimental autoimmune myasthenia gravis (EAMG).3

Myasthenia gravis and EAMG are T cell-regulated Ab-mediated autoimmune diseases of the neuromuscular junction in which the nicotinic acetylcholine receptor (AChR) is the major autoantigen. To develop an Ag-specific therapy, we have administered orally or nasally recombinant fragments corresponding to the extracellular domain of the human AChR {alpha}-subunit, and successfully induced protection against EAMG and suppression of an already ongoing disease. These effects on EAMG were shown to be accompanied by reduced AChR-specific cellular and humoral responses (17, 18). This is different from earlier reports in which Torpedo AChR was used for the induction of mucosal tolerance. In the latter studies, protection against EAMG was accompanied by increased anti-AChR Ab levels, probably due to the high immunogenicity of Torpedo AChR (19, 20).

To investigate the role of tolerogen conformation for the induction of oral tolerance in myasthenia, we used recombinant fragments corresponding to the extracellular domain of the human AChR {alpha}-subunit, which differ in their conformation. The different fragments were orally administered to Lewis rats during the acute phase of EAMG, and their effects on disease modulation were followed. We demonstrate that a more native fragment, thioredoxin (Trx)-H{alpha}1–210, failed to induce oral tolerance, whereas a less native fragment, H{alpha}1–205, induced tolerance and was efficient in treating the already ongoing autoimmune process of EAMG. This finding was supported by the observation that these two fragments induced different changes in the cytokine profile and in the expression of costimulatory factors. Thus, the immunogenicity or rather the nonimmunogenicity of a molecule is a key factor in determining its efficacy as a tolerogen for oral application.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals

Female Lewis rats (6–7 wk of age) were purchased from the animal breeding center of the Weizmann Institute of Science (Rehovot, Israel).

Ag preparation

AChR was purified from Torpedo californica electric organ by affinity chromatography, as previously described (21). Recombinant fragments were synthesized by PCR on cDNA prepared from total RNA of the human TE671 cell line. The recombinant fragment H{alpha}1–210 containing the P3A exon (22) were expressed as fusion proteins Trx-H{alpha}1–210 in pThioHis-A (Invitrogen, San Diego, CA) or GST-H{alpha}1–210 (22). H{alpha}1–205 was expressed in pET8-C with no fusion partner. All the recombinant proteins, present in inclusion bodies, were solubilized by 9 M urea, followed by serial dialyses in 50 mM Tris buffer, pH 8. Chemical modification, by reduction and carboxymethylation of recombinant fragments, was performed by reduction with 0.1 M of 2-ME in 6 M guanidine HCl/0.2 M Tris buffer, pH 8.8, followed by blocking of the sulfhydryl groups with iodoactamide, as previously described (23). The denatured forms of Trx-H{alpha}1–210 or H{alpha}1–205 were designated denTrx-H{alpha}1–210 and denH{alpha}1–205, respectively.

Western blot

Electrophoresis and blotting of recombinant proteins and Torpedo AChR were performed essentially as described (22). The proteins were resolved in 12% polyacrylamide gels and transferred to a nitrocellulose membrane. After blocking with 0.5% hemoglobin in PBS, mAb 198 (10 µg/ml) was added and incubated for 2 h at 37°C. The membrane was washed and then incubated for 1 h at 37°C with 125I-labeled goat anti-mouse IgG. After washing, the blots were exposed to an x-ray-sensitive film. Binding to {alpha}-bungarotoxin ({alpha}-BTX) was detected by overlay with 125I-labeled {alpha}-BTX (125I-{alpha}-BTX) (2 x 10-9 M), followed by washing and autoradiography.

Inhibition of mAb 198 binding to AChR

Microtiter plates were coated with Torpedo AChR (1 µg/ml) in PBS and incubated overnight at 4°C. After blocking of the plates, mAb 198 preincubated in the presence of different concentrations of recombinant proteins was added to the wells. Bound mAb 198 was detected by incubation with alkaline phosphatase-conjugated goat anti-rat IgG (1/10,000 dilution), followed by determination of alkaline phosphatase activity.

Induction and clinical evaluation of EAMG

Rats were immunized once in both hind footpads by s.c. injection of Torpedo AChR (45 µg/rat) emulsified in CFA containing additional Mycobacterium tuberculosis (1 mg/rat; Difco, Detroit, MI). Clinical severity of EAMG was graded as follows: grade 0, rats with normal muscle strength; grade 1, mildly decreased activity, weak grip, with fatigability; grade 2, weakness, hunched posture at rest, decreased body weight, tremor; 3, severe generalized weakness, marked decrease in body weight, moribund; 4, dead. Animals were evaluated weekly for 7–10 wk following immunization with Torpedo AChR.

Induction of oral tolerance

Feeding with the recombinant fragments was initiated at the acute phase of EAMG, 7–10 days after immunization with Torpedo AChR and continued twice per week until the end of the experiment. The amount of recombinant fragments, and of Trx and OVA (as control), was 600 µg/dose/rat in 1 ml Tris buffer (50 mM, pH 8).

Anti-AChR Ab assay

Abs to rat muscle AChR were measured by RIA with crude rat muscle extract in which the AChR is specifically labeled by 125I-{alpha}-BTX (24). Results are expressed as nmol Ab/L serum.

Lymphocyte proliferation assay

Draining lymph node cells (LNC) were cultured (5 x 105/well) in RPMI 1640 medium supplemented with HEPES, sodium pyruvate, glutamine, 2-ME, antibiotics, nonessential amino acids, and 0.5% normal rat serum, either alone or in the presence of Torpedo AChR, Trx-H{alpha}1–210, H{alpha}1–205, or Con A. Proliferation was assessed by measuring [3H]thymidine (0.5 µCi/well) incorporation during the last 18 h of a 4-day culture period. Results are expressed as {Delta}cpm after subtraction of background of unstimulated cultures from stimulated LNC.

B cell proliferation assay based on alkaline phosphatase activity

B cell proliferation was assayed as described (25, 26). Draining LNC (1 x 106/ml) were cultured in the medium used for lymphocyte proliferation supplemented by 10% FCS. The cells were stimulated in vitro with Torpedo AChR (0.01 µg/ml), Trx-H{alpha}1–210 (50 µg/ml), Trx (50 µg/ml), H{alpha}1–205 (50 µg/ml), Con A (2 µg/ml), or LPS (5 µg/ml) in 24-well plates. After 4 days in culture, the cells were harvested, washed, and diluted in PBS. For the alkaline phosphatase assay, 100 µl cell suspensions, containing different cell concentrations, were transferred to 96-well plates into which 100 µl/well of substrate solution (p-nitrophenyl phosphate, disodium; 1 mg/ml) was added. The plates were incubated for 2 h at 37°C in 5% CO2. The OD at 405 nm was measured, and the data are expressed as OD at 405 nm per number of cells/well.

Determination of cytokines and costimulatory factors

PCR-ELISA was used to assess the levels of mRNA specific for cytokines (IL-2, IL-10, IL-12, IFN-{gamma}, and TGF-ß) and costimulatory factors (CD40, CD40L, CD28, CTLA4, B7-1, and B7-2). RNA extraction, cDNA synthesis, and RT-PCR in the presence of digoxigenin (DIG)-dNTP were performed as described (27) with some modification suggested by the manufacturer of the PCR-ELISA kit (Roche Molecular Biochemicals, Mannheim, Germany).

The sequences of primer pairs specific for rat IL-2, IL-10, IL-12, TGF-ß, IFN-{gamma}, and ß-actin were the same as previously reported (27). The primer sequences specific for rat costimulatory factors and mouse CD40 are as follows: CD40 sense primer (CGCTATGGGGCTGCTTGTTGACAG); CD40 antisense primer (GACGGTATCAGTGGTCTCAGTGGC); CD40 internal primer (CAGCCCAGTGGAACAGGGAGATTCGC); CD40L sense primer (5'-GATCCTCAAATTGCAGCACA-3'); CD40L antisense primer (5'-AGCCAAAAGATGAGAAGCCA-3'); CD40L internal primer (5'-TGGGAGACAGCTGACGGTTAAAAG-3'); CD28 sense primer (5'-CGGGAATG GGAATTTTACCT-3'); CD28 antisense primer (5'-TCCAGAGCAGTGATGGTGAG-3'); CD28 internal primer (5'-AACATGACACCGCGGAGACTCGGG-3'); CTLA4 sense primer (5'-AGGACTTGGCCTTTTGGAGT-3'); CTLA4 antisense primer (5'-CAGTCCTTGGATGGTGAGGT); CTLA4 internal primer (5'-TGATGAGGTCCGGGTG ACGGTGCT-3'); B7-1 sense primer (5'-GTGAGAGAAAAGGCATTGCTG-3'); B7-1 antisense primer (5'-GGTTCTTGTTTGTTTCTCTGC-3'); B7-1 internal primer (5'-GGTGCTCTCTGTCATCTCCGGGGT-3'); B7-2 sense primer (5'-GAGGCAA GCTTACTTCAATAGCA-3'); B7-2 antisense primer (5'-ATGCCAGTGTTTCTTG TTTCATT-3'); B7-2 internal primer (5'-ACACCCACGGGATCAATTATCCTC-3').

The internal primers were all biotinylated by Biotin-Chem-Link (Roche Molecular Biochemicals), according to the manufacturer’s protocol. The amplified DIG-labeled PCR products were quantified using a PCR-ELISA kit. They were then denatured and hybridized to the suitable cytokine- or costimulatory factor-specific biotinylated internal primers for 3 h at 37°C with constant shaking. The DIG-labeled PCR product/biotinylated probe hybrids were immobilized on streptavidin-coated 96-well ELISA plates. After washing, the bound PCR products were detected with a peroxidase-conjugated anti-DIG Ab. PCR products were viewed with the peroxidase substrate 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), and signals were quantified by absorbance at 405 nm (28).

Statistical analysis

Student’s two-tailed t test was used to determine the significance of differences between group means.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Immunochemical characterization of AChR-derived recombinant fragments

The AChR-derived recombinant fragments of human AChR {alpha}-subunit were cloned and expressed either as fusion proteins Trx-H{alpha}1–210 or GST-H{alpha}1–210, or without a fusion partner (H{alpha}1–205). The extent of their conformational similarity to intact AChR was established by reactivity with {alpha}-BTX and mAb 198, an anti-AChR mAb specific for the main immunogenic region in the {alpha}-subunit, which is known to be a conformation-dependent epitope (Fig. 1Go). As shown in Fig. 1GoB, Trx-H{alpha}1–210 binds {alpha}-BTX to a higher extent than the other two fragments. The weakest {alpha}-BTX binder was fragment H{alpha}1–205. Denaturation of H{alpha}1–205 by chemical modification completely abolished its ability to bind {alpha}-BTX, assessing the importance of conformation for this binding (data not shown). Similar results were obtained when the blot was overlaid with mAb 5.5 (29), which is directed to the acetylcholine binding site (data not shown). The anti-main immunogenic region mAb 198 (30) bound well to Trx-H{alpha}1–210 and, to a lower extent, to the other two fragments (GST-H{alpha}1–210 and H{alpha}1–205) (Fig. 1GoC).



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 1. Immunochemical characterization of AChR-derived recombinant fragments. Torpedo AChR (5 µg; lane 1) and different recombinant fragments of human AChR {alpha}-subunit (20 µg each; GST-H{alpha}1–210, lane 2; Trx-H{alpha}1–210, lane 3; and H{alpha}1–205, lane 4) were resolved on 12% SDS-PAGE and stained by Coomassie blue (A) or blotted to nitrocelluse membranes that were then overlaid with 125I-{alpha}-BTX (B) or with mAb 198, followed by 125I-labeled goat anti-mouse (C). The weak binding of mAb 198 to Torpedo AChR is due to the low amount of AChR loaded onto the gel (1:50 molar ratio with the recombinant fragments). The band at 38 kDa seen in lane 2 of A is probably a degradation product of GST-H{alpha}1–210, since mAb 198 binds to it. We do not know the identity of the band at 40 kDa in the same lane.

 
The binding of the recombinant fragments to mAb 198 in Western blots was correlated with their ability to inhibit the binding of mAb 198 to Torpedo AChR in solution. As shown in Fig. 2Go, Trx-H{alpha}1–210 inhibited this binding with an IC50 value of 3 x 10-7 M. The IC50 values for fragments GST-H{alpha}1–210 and H{alpha}1–205 were 1.3 x 10-6 M and 3.3 x 10-6 M, respectively. In all additional experiments, we focused on two of the three fragments, which represent the extremes with regard to conformational similarity to intact AChR, namely the more native fragment, Trx-H{alpha}1–210, and the less native fragment, H{alpha}1–205.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 2. Inhibition of mAb 198 binding to Torpedo AChR by different fragments of human AChR. mAb 198 was preincubated in the presence of different concentrations of recombinant fragments and added to microtiter plates coated with Torpedo AChR. Bound mAb 198 was detected by determination of alkaline phosphatase activity.

 
Effect of oral treatment with recombinant fragments on EAMG

The role of tolerogen conformation in modulation of EAMG was tested by oral administration of the fragments during the acute phase of disease in rats. The fragments tested were Trx-H{alpha}1–210, H{alpha}1–205, and their respective chemically modified forms, denTrx-H{alpha}1–210 and denH{alpha}1–205. OVA and Trx alone were used as controls. Oral administration of the fragments was initiated at the acute phase, 8 days after the induction of EAMG, and was continued twice per week for 9 wk. Treatment with Trx-H{alpha}1–210 led to aggravation of disease symptoms even as compared with control OVA-treated rats (Fig. 3Go). In the first 5 wk after induction of disease, all rats treated with Trx-H{alpha}1–210 got sick and 6 of 10 died of EAMG. At that time, 3 of 10 OVA-treated rats had died of EAMG, whereas H{alpha}1–205-treated rats showed only mild symptoms of EAMG (Fig. 3Go). Interestingly, oral treatment with the chemically modified, denatured form of Trx-H{alpha}1–210, denTrx-H{alpha}1–210, suppressed EAMG in a similar manner to H{alpha}1–205 (data not shown). Treatment with Trx alone had no effect on EAMG (data not shown), assessing that the fusion partner (Trx) was not responsible for the aggravation of EAMG observed in the Trx-H{alpha}1–210-treated rats. By 10 wk after disease induction, 7 of 10 rats in the Trx-H{alpha}1–210-treated and 6 of 10 in the OVA-treated group were dead (the mean clinical scores were 3.4 for the Trx-H{alpha}1–210-treatd group and 3.2 for the OVA-treated groups). On the other hand, in the H{alpha}1–205-treated group, 3 of 10 rats were completely healthy and none of the rats died (mean clinical score, 1.3; Table IGo).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 3. Effect of oral treatment with recombinant fragments on EAMG. Torpedo AChR was injected to induce EAMG and rats were treated twice per week by oral administration of OVA, Trx, Trx-H{alpha}1–210, denTrx-H{alpha}1–210, H{alpha}1–205, or denH{alpha}1–205, starting 8 days following AChR injection, at the acute phase of EAMG. Treatments were performed as described in Materials and Methods. Representative of three independent experiments. *, p < 0.005.

 

View this table:
[in this window]
[in a new window]
  		Table I. Effect of oral treatment with AChR fragments on EAMG: acute phase treatment

 
The evaluation of clinical symptoms of rats treated with different proteins was corroborated by the analyses of muscle AChR content and body weight changes of the rats (Table IGo). Rats in the Trx-H{alpha}1–210 and control OVA-treated groups lost 69% and 55% of their muscle AChR content, respectively. In contrast, rats treated by H{alpha}1–205 lost only 10% of their muscle AChR (Table IGo). It should be noted that continuous long-term oral administration to naive rats (for at least 3 mo) of all tested recombinant fragments has never led to the development of clinical signs of EAMG. However, feeding with the more native fragment Trx-H{alpha}1–210 led to elicitation of Abs to the fragment itself, whereas feeding with H{alpha}1–205 or OVA did not elicit an Ab response to the fed Ag (data not shown).

Oral administration of the fragments was accompanied by different effects on AChR-specific humoral and cellular immune responses. Rats treated orally with Trx-H{alpha}1–210 exhibited an increase in their anti-self AChR Ab levels (93.5 ± 5.5 nM) when compared with the OVA-treated group (70.5 ± 6.5 nM). On the other hand, treatment with H{alpha}1–205 resulted in a decrease in the anti-self AChR Ab level (31 ± 3.5 nM). In addition, Trx-H{alpha}1–210-treated rats also exhibited a high AChR-specific proliferative T cell response, similar to the response in the OVA-treated rats, whereas H{alpha}1–205-treated rats had a suppressed T cell response (Table IGo).

Effect of tolerogen conformation on the expression of cytokines and costimulatory factors

To analyze the possible mechanisms underlying the effects that the different fragments exert on EAMG, we studied the levels of cytokines and costimulatory factors in the treated rats. Draining LNC of rats fed with H{alpha}1–205, Trx-H{alpha}1–210, or OVA were removed 5–8 wk after EAMG induction and cultured for 48 h in the presence of Torpedo AChR. Total RNA was then prepared from the cells and subjected to PCR-ELISA with cytokine-specific or costimulatory factor-specific primers.

As shown in Fig. 4GoA, oral treatment with Trx-H{alpha}1–210 resulted in down-regulation of IFN-{gamma}, IL-10, and TGF-ß and up-regulation in the level of IL-2 (and a slight increase in IL-12) compared with OVA-treated rats. On the other hand, oral treatment with H{alpha}1–205 resulted in suppression of Th1-type (IL-2, IL-12, and IFN-{gamma}) cytokine mRNA levels and in up-regulation of Th2-type (IL-10) or Th3-type (TGF-ß) cytokine mRNA levels, as already reported by us (18).



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of oral administration of recombinant fragments on cytokines (A) and costimulatory factors (B). LNC from rats treated at the acute phase of EAMG with OVA ({square}), Trx-H{alpha}1–210 (), or H{alpha}1–205 () were cultured for 2 days in the presence of AChR, and mRNA was prepared. The mRNA expression level of cytokines or costimulatory factors (and of ß-actin as control) was determined by PCR-ELISA, and the data are expressed as the relative value compared with the OVA-treated group, which was designated 100%. *, p < 0.005; **, p < 0.01.

 
The observed stimulation of AChR-specific T cell proliferation (Table IGo) and up-regulation of Th1-type cytokine levels (Fig. 4GoA) suggest alterations in the level of costimulation in Trx-H{alpha}1–210-treated rats. The expression levels of costimulatory factors were tested in the AChR-stimulated LNC, which were used for analysis of cytokine levels. As shown in Fig. 4GoB, oral treatment with Trx-H{alpha}1–210 resulted in up-regulation of CD28, CD40, and CD40L compared with OVA-treated rats (p < 0.005). Other costimulatory factors such as CTLA4 and B7-1/B7-2 were similarly expressed in Trx-H{alpha}1–210- and OVA-treated rats. On the other hand, oral treatment with the less native fragment H{alpha}1–205, which has been an effective tolerogen, resulted in reduced expression levels (p < 0.005; as compared with controls) of the costimulatory factors tested, such as CD40L, CD40, CD28, CTLA4, and B7-1/B7-2. This suggests that up-regulated expression of costimulatory factors induced by feeding with Trx-H{alpha}1–210 leads to the increased AChR-specific T cell proliferation. This activation of autoregulatory T cells results in up-regulated Th1-type cytokines and down-regulation of Th2 or Th3 cytokines. On the other hand, the protective effect of oral treatment with H{alpha}1–205 is accompanied by down-regulation of costimulatory factor expression, which in turn induces a suppressed AChR-T cell response.

Effect of tolerogen conformation on T and B cell proliferation

To examine whether the observed up-regulation of Th1-type cytokines and of costimulatory factors induced by Trx-H{alpha}1–210 feeding may also be associated with an increased AChR-specific B cell proliferation, we compared the in vitro response of cells from myasthenic rats to the various fragments. Draining LNC were removed from myasthenic rats (mean clinical score, 2–3) at the chronic stage of disease, 6–8 wk after EAMG induction. Cells were cultured for 4 days in the presence of Torpedo AChR, Trx-H{alpha}1–210, H{alpha}1–205, Trx, Con A, or LPS, and the level of B cell proliferation was determined by alkaline phosphatase activity (which is known to be specific for activated B cells; 25, 26). Trx-H{alpha}1–210 induced the highest B cell proliferative response (Fig. 5GoA), whereas Trx alone had only a minor effect on B cell proliferation. LPS induced a strong response, and Con A did not induce any B cell proliferative response (data not shown), as expected for activated B cells. Interestingly, Torpedo AChR induced a lower B cell proliferation than Trx-H{alpha}1–210, which may be due to its processing in vitro.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. Effects of tolerogen conformation on T and B cell proliferation. Proliferation of B and T cells from myasthenic rats in response to Torpedo AChR, Trx-H{alpha}1–210, H{alpha}1–205, and Trx was determined, as described in Materials and Methods. The level of B cell proliferation was determined by alkaline phosphatase activity (A), and proliferation of T cells was determined by measuring thymidine incorporation (B).

 
T cell proliferation was also assessed in the same LNC. As shown in Fig. 5GoB, T cell proliferation in the presence of Trx-H{alpha}1–210 was higher than in the presence of the other fragments. Trx alone induced only a minor T cell proliferation (data not shown). The different T cell responses induced by the two fragments (Trx-H{alpha}1–210 and H{alpha}1–205) may reflect differences in their Ag processing and presentation in the LNC of myasthenic rats.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Oral tolerance has attracted growing attention as a potential therapy for a variety of systemic inflammatory disorders including autoimmune diseases (1). However, in spite of the promising results of oral administration of autoantigens or their derivatives on the modulation of experimental autoimmune diseases, there are still important questions that remain to be answered before oral tolerance can be successfully applied for the treatment of human patients (31). These questions concern Ag processing and presentation in the gut-associated lymphoid tissue, the cytokine milieu, level of costimulation, optimal dose of Ag (12, 32), and nature of the fed tolerogen (14, 15). Some of these factors may determine the outcome of the treatment, its safety, and whether it will result in improvement or exacerbation of the disease (33, 34, 35, 36, 37, 38).

In this study, we focused on investigating the role of conformation of orally administered AChR fragments in the induction of systemic suppression of EAMG. We have gained insight to the immunological pathways that follow the oral administration of conformationally different AChR fragments, and also suggest clues to predict what is required from a fed protein to serve as a successful tolerogen.

Rats were fed at the acute phase of EAMG with recombinant fragments, all corresponding to the extracellular domain of the human AChR {alpha}-subunit, but differing in their spatial conformation. One of the fragments, H{alpha}1–205, was previously shown by us to suppress EAMG in rats when administered orally either at the acute or at the chronic phase of disease (18). The other recombinant fragment, Trx-H{alpha}1–210, corresponds to the same region in the human AChR {alpha}-subunit, but in contrast to H{alpha}1–205, its three-dimensional structure is more similar to that of the corresponding region in native intact AChR. This was assessed by its reactivity with {alpha}-BTX, mAb 5.5, and mAb 198, all of which are known to recognize conformation-dependent epitopes of AChR. Another recombinant fragment, GST-H{alpha}1-210, consisting of the same sequence joined to GST had intermediate characteristics. We have demonstrated that in contrast to H{alpha}1–205 that suppresses EAMG, the more native fragment, Trx-H{alpha}1–210, fails to do so. Differences other than conformation could contribute to their different ability to induce oral tolerance. However, the fact that denaturation of the Trx-H{alpha}1–210 fragment turned it from an exacerbator of EAMG into an effective tolerogen suggests that conformation itself plays an important role in determining the tolerogenicity of these fragments.

Our next goal was to analyze the immunological events that follow the oral administration of these conformationally different fragments, and that result in one case in suppression and in the other case in exacerbation of an existing disease. We demonstrate that whereas the less native fragment, H{alpha}1–205, leads to a decreased humoral and cellular AChR-specific response accompanied by a decrease in the production of proinflammatory cytokines and costimulatory factors, the oral administration of the more native, Trx-H{alpha}1–210 fragment leads to opposite changes. Namely, feeding with Trx-H{alpha}1–210 leads to an elevated AChR-specific humoral and cellular reactivity and to an up-regulation of the proinflammatory cytokine IL-2 and costimulatory factors accompanied by down-regulation of antiinflammatory cytokines. Although Trx has been shown to act as a potent chemoattractant and inducer of cytokines (39, 40), the latter effects cannot be attributed to Trx since denatured Trx-H{alpha}1–210 and Trx alone did not act like Trx-H{alpha}1–210.

Previous reports have demonstrated the involvement of the proinflammatory cytokines IL-12 and IFN-{gamma} in the induction of EAMG (41, 42, 43, 44) and the protective effects of antiinflammatory cytokines such as IL-10 and TGF-ß in autoimmune diseases including EAMG (45). Therefore, our observations on the different changes in the cytokine profile following the administration of H{alpha}1–205 and Trx-H{alpha}1–210 may explain the different effects of these two fragments on the course of EAMG.

The opposite consequences of oral administration of fragments differing in their conformation may stem from the repertoire of T and B cell epitopes they are bearing. The more native fragment, Trx-H{alpha}1–210, may be recognized by autoreactive B cells already existing in the myasthenic rats, which could serve as APCs required for T cell activation, as has been implied in other autoimmune diseases (46). Such a fragment is more likely to have deleterious effects upon oral ingestion. The less native fragment, H{alpha}1–205, probably bears significantly less, or no pathogenic B cell epitopes at all, and would therefore not stimulate B cell proliferation that would in turn lead to AChR-specific T cell activation. Our B cell proliferation assay indeed demonstrates that Trx-H{alpha}1–210 can stimulate B cells from sensitized rats, whereas H{alpha}1–205, denatured Trx-H{alpha}1–210, and Trx alone do not. Moreover, oral administration of Trx-H{alpha}1–210 leads to increased levels of CD40L, which is expressed on activated T cells and is known to be an important costimulatory factor in B cell activation. This factor has also been shown to be essential for AChR-specific immune responses since CD40L-deficient mice (CD40L-/-) are resistant to EAMG induction (47). The B cell activation following the administration of a native AChR fragment could lead to the elevated AChR-specific T cell proliferation (Table IGo) and to the observed shift in the cytokine profile from a Th2/Th3 response to a Th1-regulated AChR-specific response. Conversely, when a less native AChR fragment, such as H{alpha}1–205, is orally administered, the level of costimulation is too low to stimulate T cell activation, thus leading to a shift in the cytokine profile in favor of the antiinflammatory Th2/Th3 cytokines.

In the present study, we have attempted to induce tolerance when the autoimmune anti-AChR process already takes place and found that native conformation of the tolerogen employed is not beneficial for the induction of oral tolerance. This might be due to some residual pathogenicity that may result in stimulation of already activated B cells, especially in the case of a highly immunogenic autoantigen as AChR. It is therefore important to delineate the requirements for an effective tolerogen. In the case of EAMG, we believe that myasthenogenicity of the tested fragments upon active immunization provides one such clue. We observed that injections of large amounts of Trx-H{alpha}1–210 (500 µg/dose in CFA) resulted in clinical signs of EAMG, while injection of the same dose of H{alpha}1–205 resulted only in a transient disease characterized by very mild symptoms (mean clinical score, 1). Nevertheless, it should be stressed that even long-term oral administration of any of the tested fragments never led to clinical signs of EAMG. Another clue is based on the ability to elicit a humoral response to the fed fragment. Oral feeding with the more native fragment Trx-H{alpha}1–210 led to production of anti-fragment Abs, whereas feeding with denTrx-H{alpha}1–210 or H{alpha}1–205 did not elicit any humoral response. The latter observation also indicates that antigenic competition is not the underlying mechanism of the suppression induced by feed with the recombinant fragments. If that were the mechanism, we would expect the more native fragment, Trx-H{alpha}1–210, to act as a more potent tolerogen, which is not the case.

The molecular features required for immunopathogenicity and tolerogenicity may be distinct from each other, and there is an advantage to be able to control them as desired. This distinction may be particularly important for attempts to induce tolerance in an already existing disease. In the present study, we report on the oral treatment of rats by rAChR fragments, at the acute phase of EAMG. We have clearly demonstrated that while the less native fragment (H{alpha}1–205) suppresses EAMG, the more native fragment (Trx-H{alpha}1–210) has no such effect and even exacerbates the clinical symptoms of disease. Since we have evidence that during the chronic phase of disease myasthenic rats have autoreactive B cells recognizing Trx-H{alpha}1–210 (Fig. 5GoA), we believe that administration of this recombinant fragment at the chronic phase would most likely lead to further activation of these autoreactive cells and to exacerbation of disease.

It should be noted that to date, most of the oral tolerance studies in experimental autoimmune diseases describe prevention experiments in which the tolerogen was introduced before disease induction, when Ag-specific activated B or T cells still do not exist. It may therefore be somewhat misleading to design clinical trials on the basis of such prevention studies. Moreover, this may be one of the reasons that clinical trials on ongoing human autoimmune diseases have not been very successful.

In conclusion, our study suggests that the spatial conformation of an orally administered tolerogen should be given careful attention when considering oral treatment for the induction of systemic tolerance in established Ab-mediated autoimmune diseases such as myasthenia gravis.


   Acknowledgments
 
We thank Carmit Bar-Natan for excellent technical assistance.


   Footnotes
 
1 This research was supported by grants from The Association Française contre les Myopathies, The Muscular Dystrophy Association of America, and The Robert Koch-Minerva Center for Research in Autoimmune Diseases at The Weizmann Institute of Science. Back

2 Address correspondence and reprint requests to Dr. Sara Fuchs, Department of Immunology, The Weizmann Institute of Science, Rehovot 76100, Israel. Back

3 Abbreviations used in this paper: EAMG, experimental autoimmune myasthenia gravis; {alpha}-BTX, {alpha}-bungarotoxin; AChR, acetylcholine receptor; DIG, digoxigenin; 125I-{alpha}-BTX, 125I-labeled {alpha}-BTX; LNC, lymph node cells; Trx, thioredoxin. Back

Received for publication December 10, 1999. Accepted for publication July 10, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Weiner, H. L.. 1997. Oral tolerance for the treatment of autoimmune diseases. Annu. Rev. Med. 48:341.[Medline]
  2. Thompson, H. S., N. A. Staines. 1986. Gastric administration of type II collagen delays the onset and severity of collagen-induced arthritis in rats. Clin. Exp. Immunol. 64:581.[Medline]
  3. Nagler-Anderson, C., L. A. Bober, M. E. Robinson, G. W. Siskind, G. J. Thorbecke. 1986. Suppression of type II collagen-induced arthritis by intragastric administration of soluble type II collagen. Proc. Natl. Acad. Sci. USA 83:7443.[Abstract/Free Full Text]
  4. Weiner, H. L., G. A. Mackin, M. Matsui, E. J. Orav, S. J. Khoury, D. M. Dawson, D. A. Hafler. 1993. Double-blind pilot trial of oral tolerization with myelin antigens in multiple sclerosis. Science 259:1321.[Abstract/Free Full Text]
  5. Trentham, D. E., R. A. Dynesius-Trentham, E. J. Orav, D. Combitchi, C. Lorenzo, K. L. Sewell, D. A. Hafler, H. L. Weiner. 1993. Effects of oral administration of type II collagen on rheumatoid arthritis. Science 261:1727.[Abstract/Free Full Text]
  6. Nussenblatt, R. B., S. M. Whitcup, M. D. de Smet, R. R. Caspi, A. T. Kozhich, H. L. Weiner, B. Vistica, I. Gery. 1996. Intraocular inflammatory disease (uveitis) and the use of oral tolerance: a status report. Ann. NY Acad. Sci. 778:325.[Medline]
  7. Schatz, D. A., D. G. Rogers, B. H. Brouhard. 1996. Prevention of insulin-dependent diabetes mellitus: an overview of three trials. Clev. Clin. J. Med. 63:270.[Medline]
  8. Gregerson, D. S., W. F. Obritsch, L. A. Donoso. 1993. Oral tolerance in experimental autoimmune uveoretinitis: distinct mechanisms of resistance are induced by low dose vs high dose feeding protocols. J. Immunol. 151:5751.[Abstract]
  9. Friedman, A., H. Weiner. 1994. Induction of anergy or active suppression following oral tolerance is determined by antigen dosage. Proc. Natl. Acad. Sci. USA 91:6688.[Abstract/Free Full Text]
  10. Whitacre, C. C., I. E. Gienapp, C. G. Orosz, D. M. Bitar. 1991. Oral tolerance in experimental autoimmune encephalomyelitis. III. Evidence for clonal anergy. J. Immunol. 147:2155.[Abstract]
  11. Barnett, M. L., J. M. Kremer, E. W. St. Clair, D. O. Clegg, D. Furst, M. Weisman, M. J. Fletcher, S. Chasan-Taber, E. Finger, A. Morales, et al 1998. Treatment of rheumatoid arthritis with oral type II collagen: results of a multicenter, double-blind, placebo-controlled trial. [Published erratum appears in 1998 Arthritis Rheum. 41:938.]. Arthritis Rheum. 41:290.[Medline]
  12. Bergerot, I., N. Fabien, A. Mayer, C. Thivolet. 1996. Active suppression of diabetes after oral administration of insulin is determined by antigen dosage. Ann. NY Acad. Sci. 778:362.[Medline]
  13. Fowler, E., H. L. Weiner. 1997. Oral tolerance: elucidation of mechanisms and application to treatment of autoimmune diseases. Biopolymers 43:323.[Medline]
  14. McGhee, J. R., J. Mestecky, M. T. Dertzbaugh, J. H. Eldridge, M. Hirasawa, H. Kiyono. 1992. The mucosal immune system: from fundamental concepts to vaccine development. Vaccine 10:75.[Medline]
  15. Ermak, T. H., H. R. Bhagat, J. Pappo. 1994. Lymphocyte compartments in antigen-sampling regions of rabbit mucosal lymphoid organs. Am. J. Trop. Med. Hyg. 50:14.
  16. Terato, K., X. J. Ye, H. Miyahara, M. A. Cremer, M. M. Griffiths. 1996. Induction by chronic autoimmune arthritis in DBA/1 mice by oral administration of type II collagen and Escherichia coli lipopolysaccharide. Br. J. Rheumatol. 35:828.[Abstract/Free Full Text]
  17. Barchan, D., M. C. Souroujon, S. H. Im, C. Antozzi, S. Fuchs. 1999. Antigen-specific modulation of experimental myasthenia gravis: nasal tolerization with recombinant fragments of the human acetylcholine receptor {alpha}-subunit. Proc. Natl. Acad. Sci. USA 96:8086.[Abstract/Free Full Text]
  18. Im, S. H., D. Barchan, S. Fuchs, M. C. Souroujon. 1999. Suppression of ongoing experimental myasthenia by oral treatment with an acetylcholine receptor recombinant fragment. J. Clin. Invest. 104:1723.[Medline]
  19. Drachman, D. B.. 1996. Immunotherapy in neuromuscular disorders: current and future strategies. Muscle Nerve 19:1239.[Medline]
  20. Shi, F. D., X. F. Bai, H. L. Li, Y. M. Huang, P. H. Van der Meide, H. Link. 1998. Nasal tolerance in experimental autoimmune myasthenia gravis (EAMG): induction of protective tolerance in primed animals. Clin. Exp. Immunol. 111:506.[Medline]
  21. Aharonov, A., R. Tarrab-Hazdai, I. Silman, S. Fuchs. 1977. Immunochemical studies on acetylcholine receptor fraction from Torpedo californica. Immunochemistry 14:129.[Medline]
  22. Barchan, D., O. Asher, S. J. Tzartos, S. Fuchs, M. C. Souroujon. 1998. Modulation of the anti-acetylcholine receptor response and experimental autoimmune myasthenia gravis by recombinant fragments of the acetylcholine receptor. Eur. J. Immunol. 28:616.[Medline]
  23. Bartfeld, D., S. Fuchs. 1978. Specific immunosuppression of experimental autoimmune myasthenia gravis by denatured acetylcholine receptor. Proc. Natl. Acad. Sci. USA 75:4006.[Abstract/Free Full Text]
  24. Souroujon, M. C., D. Mochly-Rosen, A. S. Gordon, S. Fuchs. 1983. Interaction of monoclonal antibodies to Torpedo acetylcholine receptor with the receptor of skeletal muscle. Muscle Nerve 6:303.[Medline]
  25. Hashimoto, N., R. H. Zubler. 1986. Colorimetric B cell proliferation assay based on alkaline phosphatase activity: selective measurement of B cell proliferation in the presence of other cell types. J. Immunol. Methods 90:97.[Medline]
  26. Kasyapa, C. S., M. Ramanadham. 1992. Alkaline phosphatase activity is expressed only in B lymphocytes committed to proliferation. [Published erratum appears in 1992 Immunol. Lett. 33:315.]. Immunol. Lett. 31:111.[Medline]
  27. Zipris, D., D. L. Greiner, S. Malkani, B. Whalen, J. P. Mordes, A. A. Rossini. 1996. Cytokine gene expression in islets and thyroids of BB rats: IFN-{gamma} and IL-12p40 mRNA increase with age in both diabetic and insulin-treated nondiabetic BB rats. J. Immunol. 156:1315.[Abstract]
  28. Tsuruta, H., S. Matsui, K. Oka, T. Namba, M. Shinngu, M. Nakamura. 1995. Quantitation of IL-1ß mRNA by a combined method of RT-PCR and an ELISA based on ion-sensitive field effect transistor. J. Immunol. Methods 180:259.[Medline]
  29. Mochly-Rosen, D., S. Fuchs. 1981. Monoclonal anti-acetylcholine receptor directed against the cholinergic binding site. Biochemistry 20:5920.[Medline]
  30. Tzartos, S. J., D. E. Rand, B. L. Einarson, J. M. Lindstrom. 1981. Mapping of surface structures of Electrophorus acetylcholine receptor using monoclonal antibodies. J. Biol. Chem. 256:8635.[Abstract/Free Full Text]
  31. Tian, J., A. Olcott, L. Hanssen, D. Zekzer, D. L. Kaufman. 1999. Antigen-based immunotherapy for autoimmune disease: from animal models to humans?. Immunol. Today 20:190.[Medline]
  32. Sieper, J., S. Kary, H. Sorensen, R. Alten, U. Eggens, W. Huge, F. Hiepe, A. Kuhne, J. Listing, N. Ulbrich, et al 1996. Oral type II collagen treatment in early rheumatoid arthritis: a double-blind, placebo-controlled, randomized trial. Arthritis Rheum. 39:41.[Medline]
  33. Weiner, H. L.. 1999. Oral tolerance with copolymer 1 for the treatment of multiple sclerosis. Proc. Natl. Acad. Sci. USA 96:3333.[Free Full Text]
  34. Miller, A., O. Lider, O. Abramsky, H. L. Weiner. 1994. Orally administered myelin basic protein in neonates primes for immune responses and enhances experimental autoimmune encephalomyelitis in adult animals. Eur. J. Immunol. 24:1026.[Medline]
  35. Blanas, E., F. R. Carbone, J. Allison, J. F. Miller, W. R. Heath. 1996. Induction of autoimmune diabetes by oral administration of autoantigen. Science 274:1707.[Abstract/Free Full Text]
  36. Bellmann, K., H. Kolb, S. Rastegar, P. Jee, F. W. Scott. 1998. Potential risk of oral insulin with adjuvant for the prevention of type I diabetes: a protocol effective in NOD mice may exacerbate disease in BB rats. Diabetologia 41:844.[Medline]
  37. Meyer, A. L., J. M. Benson, I. E. Gienapp, K. L. Cox, C. C. Whitacre. 1996. Suppression of murine chronic relapsing experimental autoimmune encephalomyelitis by the oral administration of myelin basic protein. J. Immunol. 157:4230.[Abstract]
  38. Bai, X. F., H. L. Li, F. D. Shi, J. Q. Liu, B. G. Xiao, P. H. Van der Meide, H. Link. 1998. Complexities of applying nasal tolerance induction as a therapy for ongoing relapsing experimental autoimmune encephalomyelitis (EAE) in DA rats. Clin. Exp. Immunol. 111:205.[Medline]
  39. Schenk, H., M. Vogt, W. Droge, K. Schulze-Osthoff. 1996. Thioredoxin as a potent costimulus of cytokine expression. J. Immunol. 156:765.[Abstract]
  40. Bertini, R., O. M. Howard, H. F. Dong, J. J. Oppenheim, C. Bizzarri, R. Sergi, G. Caselli, S. Pagliei, B. Romines, J. A. Wilshire, et al 1999. Thioredoxin, a redox enzyme released in infection and inflammation, is a unique chemoattractant for neutrophils, monocytes, and T cells. J. Exp. Med. 189:1783.[Abstract/Free Full Text]
  41. Balasa, B., C. Deng, J. Lee, L. M. Bradley, D. K. Dalton, P. Christadoss, N. Sarvetnick. 1997. Interferon {gamma} (IFN-{gamma}) is necessary for the genesis of acetylcholine receptor-induced clinical experimental autoimmune myasthenia gravis in mice. J. Exp. Med. 186:385.[Abstract/Free Full Text]
  42. Zhang, G. X., B. G. Xiao, X. F. Bai, A. Orn, P. H. van der Meide, H. Link. 1998. IFN-{gamma} is required to induce experimental autoimmune myasthenia gravis. Ann. NY Acad. Sci. 841:576.[Medline]
  43. Li, H. L., F. D. Shi, X. F. Bai, Y. M. Huang, P. H. van der Meide, B. G. Xiao, H. Link. 1998. Nasal tolerance to experimental autoimmune myasthenia gravis: tolerance reversal by nasal administration of minute amounts of interferon-{gamma}. Clin. Immunol. Immunopathol. 87:15.[Medline]
  44. Moiola, L., F. Galbiati, G. Martino, S. Amadio, E. Brambilla, G. Comi, A. Vincent, L. M. Grimaldi, L. Adorini. 1998. IL-12 is involved in the induction of experimental autoimmune myasthenia gravis, an antibody-mediated disease. Eur. J. Immunol. 28:2487.[Medline]
  45. Xiao, B. G., H. Link. 1997. Mucosal tolerance: a two-edged sword to prevent and treat autoimmune diseases. Clin. Immunol. Immunopathol. 85:119.[Medline]
  46. Falcone, M., J. Lee, G. Patstone, B. Yeung, N. Sarvetnick. 1998. B lymphocytes are crucial antigen-presenting cells in the pathogenic autoimmune response to GAD65 antigen in nonobese diabetic mice. J. Immunol. 161:1163.[Abstract/Free Full Text]
  47. Shi, F. D., B. He, H. Li, D. Matusevicius, H. Link, H. G. Ljunggren. 1998. Differential requirements for CD28 and CD40 ligand in the induction of experimental autoimmune myasthenia gravis. Eur. J. Immunol. 28:3587.[Medline]



This article has been cited by other articles:


Home page
 J. Neurosci.Home page
J. Luo, P. Taylor, M. Losen, M. H. de Baets, G. D. Shelton, and J. Lindstrom
Main Immunogenic Region Structure Promotes Binding of Conformation-Dependent Myasthenia Gravis Autoantibodies, Nicotinic Acetylcholine Receptor Conformation Maturation, and Agonist Sensitivity
J. Neurosci., November 4, 2009; 29(44): 13898 - 13908.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Feferman, P. K. Maiti, S. Berrih-Aknin, J. Bismuth, J. Bidault, S. Fuchs, and M. C. Souroujon
Overexpression of IFN-Induced Protein 10 and Its Receptor CXCR3 in Myasthenia Gravis
J. Immunol., May 1, 2005; 174(9): 5324 - 5331.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Tramontano and S. P. Makker
Conformation and Glycosylation of a Megalin Fragment Correlate with Nephritogenicity in Heymann Nephritis
J. Immunol., February 15, 2004; 172(4): 2367 - 2373.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Psaridi-Linardaki, A. Mamalaki, M. Remoundos, and S. J. Tzartos
Expression of Soluble Ligand- and Antibody-binding Extracellular Domain of Human Muscle Acetylcholine Receptor alpha Subunit in Yeast Pichia pastoris. ROLE OF GLYCOSYLATION IN alpha -BUNGAROTOXIN BINDING
J. Biol. Chem., July 19, 2002; 277(30): 26980 - 26986.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
S.-H. IM, D. BARCHAN, P. K. MAITI, L. RAVEH, M. C. SOUROUJON, and S. FUCHS
Suppression of experimental myasthenia gravis, a B cell-mediated autoimmune disease, by blockade of IL-18
FASEB J, October 1, 2001; 15(12): 2140 - 2148.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S.-H. Im, D. Barchan, P. K. Maiti, S. Fuchs, and M. C. Souroujon
Blockade of CD40 Ligand Suppresses Chronic Experimental Myasthenia Gravis by Down-Regulation of Th1 Differentiation and Up-Regulation of CTLA-4
J. Immunol., June 1, 2001; 166(11): 6893 - 6898.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Im, S.-H.
Right arrow Articles by Fuchs, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Im, S.-H.
Right arrow Articles by Fuchs, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS