|
|
||||||||

*
Department of Immunology, The Weizmann Institute of Science, Rehovot, Israel; and
The Open University of Israel, Tel-Aviv, Israel
| Abstract |
|---|
|
|
|---|
-subunit and differing in conformation were
tested: H
1205 expressed with no fusion partner and H
1210
fused to thioredoxin (Trx), and designated Trx-H
1210. The
conformational similarity of the fragments to intact AChR was assessed
by their reactivity with
-bungarotoxin and with anti-AChR mAbs,
specific for conformation-dependent epitopes. Oral administration of
the more native fragment, Trx-H
1210, at the acute phase of disease
led to exacerbation of EAMG, accompanied by an elevation of
AChR-specific humoral and cellular reactivity, increased levels of
Th1-type cytokines (IL-2, IL-12), decreased levels of Th2 (IL-10)- or
Th3 (TGF-ß)-type cytokines, and higher expression of costimulatory
factors (CD28, CTLA4, B7-1, B7-2, CD40L, and CD40). On the other hand,
oral administration of the less native fragments H
1205 or
denatured Trx-H
1210 suppressed ongoing EAMG and led to opposite
changes in the immunological parameters. It thus seems that native
conformation of AChR-derived fragments renders them immunogenic and
immunopathogenic and therefore not suitable for treatment of myasthenia
gravis. Conformation of tolerogens should therefore be given careful
attention when considering oral tolerance for treatment of autoimmune
diseases. | Introduction |
|---|
|
|
|---|
Several factors are known to determine the mechanism of oral tolerance. The dose of Ag administered is the primary determinant of which mechanism predominates and may determine the outcome of oral administration of the Ag (8, 9, 10). Low doses favor active suppression, while high Ag doses favor clonal deletion and clonal anergy. For instance, oral administration of low doses (202500 µg) of type II collagen has a beneficial effect on the clinical state of rheumatoid arthritis patients, as monitored by three sets of composite criteria of improvement in rheumatoid arthritis, whereas larger doses did not induce active suppression of the autoimmune process and did not provide protection (11). Similar results were also obtained in a diabetes model in mice (12).
Even though substantial progress has been made in elucidating the immunological mechanisms associated with Ag-specific oral tolerance, there are still many important aspects to be investigated. These include the delineation of Ag uptake and delivery in the gut, Ag processing and presentation in the gut-associated lymphoid tissue, and costimulation requirements.
One of the open questions concerns the importance of the chemical nature of the fed tolerogen for the induction of systemic tolerance (13). Orally administered particulate Ags often induce an active immune response, in contrast to the tolerance induced by the same Ags in soluble form (14, 15). The degree of nativity of the Ags is also an important issue. For instance, oral administration of type II collagen in its native form leads to the induction of chronic autoimmune arthritis in mice, suggesting that the conformation of an orally introduced Ag could be a key factor in induction of systemic tolerance (16). In the present study, we test the contribution of tolerogen conformation for the induction of oral tolerance in experimental autoimmune myasthenia gravis (EAMG).3
Myasthenia gravis and EAMG are T cell-regulated Ab-mediated autoimmune
diseases of the neuromuscular junction in which the nicotinic
acetylcholine receptor (AChR) is the major autoantigen. To develop an
Ag-specific therapy, we have administered orally or nasally recombinant
fragments corresponding to the extracellular domain of the human AChR
-subunit, and successfully induced protection against EAMG and
suppression of an already ongoing disease. These effects on EAMG were
shown to be accompanied by reduced AChR-specific cellular and humoral
responses (17, 18). This is different from earlier reports
in which Torpedo AChR was used for the induction of mucosal
tolerance. In the latter studies, protection against EAMG was
accompanied by increased anti-AChR Ab levels, probably due to the
high immunogenicity of Torpedo AChR (19, 20).
To investigate the role of tolerogen conformation for the induction of
oral tolerance in myasthenia, we used recombinant fragments
corresponding to the extracellular domain of the human AChR
-subunit, which differ in their conformation. The different
fragments were orally administered to Lewis rats during the acute phase
of EAMG, and their effects on disease modulation were followed. We
demonstrate that a more native fragment, thioredoxin (Trx)-H
1210,
failed to induce oral tolerance, whereas a less native fragment,
H
1205, induced tolerance and was efficient in treating the already
ongoing autoimmune process of EAMG. This finding was supported by the
observation that these two fragments induced different changes in the
cytokine profile and in the expression of costimulatory factors. Thus,
the immunogenicity or rather the nonimmunogenicity of a molecule is a
key factor in determining its efficacy as a tolerogen for oral
application.
| Materials and Methods |
|---|
|
|
|---|
Female Lewis rats (67 wk of age) were purchased from the animal breeding center of the Weizmann Institute of Science (Rehovot, Israel).
Ag preparation
AChR was purified from Torpedo californica electric
organ by affinity chromatography, as previously described
(21). Recombinant fragments were synthesized by PCR on
cDNA prepared from total RNA of the human TE671 cell line. The
recombinant fragment H
1210 containing the P3A exon
(22) were expressed as fusion proteins Trx-H
1210 in
pThioHis-A (Invitrogen, San Diego, CA) or GST-H
1210
(22). H
1205 was expressed in pET8-C with no fusion
partner. All the recombinant proteins, present in inclusion bodies,
were solubilized by 9 M urea, followed by serial dialyses in 50 mM Tris
buffer, pH 8. Chemical modification, by reduction and
carboxymethylation of recombinant fragments, was performed by reduction
with 0.1 M of 2-ME in 6 M guanidine HCl/0.2 M Tris buffer, pH 8.8,
followed by blocking of the sulfhydryl groups with iodoactamide, as
previously described (23). The denatured forms of
Trx-H
1210 or H
1205 were designated denTrx-H
1210 and
denH
1205, respectively.
Western blot
Electrophoresis and blotting of recombinant proteins and
Torpedo AChR were performed essentially as described
(22). The proteins were resolved in 12% polyacrylamide
gels and transferred to a nitrocellulose membrane. After blocking with
0.5% hemoglobin in PBS, mAb 198 (10 µg/ml) was added and incubated
for 2 h at 37°C. The membrane was washed and then incubated for
1 h at 37°C with 125I-labeled goat
anti-mouse IgG. After washing, the blots were exposed to an
x-ray-sensitive film. Binding to
-bungarotoxin (
-BTX) was
detected by overlay with 125I-labeled
-BTX
(125I-
-BTX) (2 x
10-9 M), followed by washing and
autoradiography.
Inhibition of mAb 198 binding to AChR
Microtiter plates were coated with Torpedo AChR (1 µg/ml) in PBS and incubated overnight at 4°C. After blocking of the plates, mAb 198 preincubated in the presence of different concentrations of recombinant proteins was added to the wells. Bound mAb 198 was detected by incubation with alkaline phosphatase-conjugated goat anti-rat IgG (1/10,000 dilution), followed by determination of alkaline phosphatase activity.
Induction and clinical evaluation of EAMG
Rats were immunized once in both hind footpads by s.c. injection of Torpedo AChR (45 µg/rat) emulsified in CFA containing additional Mycobacterium tuberculosis (1 mg/rat; Difco, Detroit, MI). Clinical severity of EAMG was graded as follows: grade 0, rats with normal muscle strength; grade 1, mildly decreased activity, weak grip, with fatigability; grade 2, weakness, hunched posture at rest, decreased body weight, tremor; 3, severe generalized weakness, marked decrease in body weight, moribund; 4, dead. Animals were evaluated weekly for 710 wk following immunization with Torpedo AChR.
Induction of oral tolerance
Feeding with the recombinant fragments was initiated at the acute phase of EAMG, 710 days after immunization with Torpedo AChR and continued twice per week until the end of the experiment. The amount of recombinant fragments, and of Trx and OVA (as control), was 600 µg/dose/rat in 1 ml Tris buffer (50 mM, pH 8).
Anti-AChR Ab assay
Abs to rat muscle AChR were measured by RIA with crude rat
muscle extract in which the AChR is specifically labeled by
125I-
-BTX (24). Results are
expressed as nmol Ab/L serum.
Lymphocyte proliferation assay
Draining lymph node cells (LNC) were cultured (5 x
105/well) in RPMI 1640 medium supplemented with
HEPES, sodium pyruvate, glutamine, 2-ME, antibiotics, nonessential
amino acids, and 0.5% normal rat serum, either alone or in the
presence of Torpedo AChR, Trx-H
1210, H
1205, or Con
A. Proliferation was assessed by measuring
[3H]thymidine (0.5 µCi/well) incorporation
during the last 18 h of a 4-day culture period. Results are
expressed as
cpm after subtraction of background of unstimulated
cultures from stimulated LNC.
B cell proliferation assay based on alkaline phosphatase activity
B cell proliferation was assayed as described (25, 26). Draining LNC (1 x 106/ml) were
cultured in the medium used for lymphocyte proliferation supplemented
by 10% FCS. The cells were stimulated in vitro with Torpedo
AChR (0.01 µg/ml), Trx-H
1210 (50 µg/ml), Trx (50 µg/ml),
H
1205 (50 µg/ml), Con A (2 µg/ml), or LPS (5 µg/ml) in
24-well plates. After 4 days in culture, the cells were harvested,
washed, and diluted in PBS. For the alkaline phosphatase assay, 100
µl cell suspensions, containing different cell concentrations, were
transferred to 96-well plates into which 100 µl/well of substrate
solution (p-nitrophenyl phosphate, disodium; 1
mg/ml) was added. The plates were incubated for 2 h at 37°C in
5% CO2. The OD at 405 nm was measured, and the
data are expressed as OD at 405 nm per number of cells/well.
Determination of cytokines and costimulatory factors
PCR-ELISA was used to assess the levels of mRNA specific for
cytokines (IL-2, IL-10, IL-12, IFN-
, and TGF-ß) and costimulatory
factors (CD40, CD40L, CD28, CTLA4, B7-1, and B7-2). RNA extraction,
cDNA synthesis, and RT-PCR in the presence of digoxigenin (DIG)-dNTP
were performed as described (27) with some modification
suggested by the manufacturer of the PCR-ELISA kit (Roche Molecular
Biochemicals, Mannheim, Germany).
The sequences of primer pairs specific for rat IL-2, IL-10, IL-12,
TGF-ß, IFN-
, and ß-actin were the same as previously reported
(27). The primer sequences specific for rat costimulatory
factors and mouse CD40 are as follows: CD40 sense primer
(CGCTATGGGGCTGCTTGTTGACAG); CD40 antisense primer
(GACGGTATCAGTGGTCTCAGTGGC); CD40 internal primer
(CAGCCCAGTGGAACAGGGAGATTCGC); CD40L sense primer
(5'-GATCCTCAAATTGCAGCACA-3'); CD40L antisense primer
(5'-AGCCAAAAGATGAGAAGCCA-3'); CD40L internal primer
(5'-TGGGAGACAGCTGACGGTTAAAAG-3'); CD28 sense primer (5'-CGGGAATG
GGAATTTTACCT-3'); CD28 antisense primer (5'-TCCAGAGCAGTGATGGTGAG-3');
CD28 internal primer (5'-AACATGACACCGCGGAGACTCGGG-3'); CTLA4 sense
primer (5'-AGGACTTGGCCTTTTGGAGT-3'); CTLA4 antisense primer
(5'-CAGTCCTTGGATGGTGAGGT); CTLA4 internal primer
(5'-TGATGAGGTCCGGGTG ACGGTGCT-3'); B7-1 sense primer
(5'-GTGAGAGAAAAGGCATTGCTG-3'); B7-1 antisense primer
(5'-GGTTCTTGTTTGTTTCTCTGC-3'); B7-1 internal primer
(5'-GGTGCTCTCTGTCATCTCCGGGGT-3'); B7-2 sense primer (5'-GAGGCAA
GCTTACTTCAATAGCA-3'); B7-2 antisense primer (5'-ATGCCAGTGTTTCTTG
TTTCATT-3'); B7-2 internal primer (5'-ACACCCACGGGATCAATTATCCTC-3').
The internal primers were all biotinylated by Biotin-Chem-Link (Roche Molecular Biochemicals), according to the manufacturers protocol. The amplified DIG-labeled PCR products were quantified using a PCR-ELISA kit. They were then denatured and hybridized to the suitable cytokine- or costimulatory factor-specific biotinylated internal primers for 3 h at 37°C with constant shaking. The DIG-labeled PCR product/biotinylated probe hybrids were immobilized on streptavidin-coated 96-well ELISA plates. After washing, the bound PCR products were detected with a peroxidase-conjugated anti-DIG Ab. PCR products were viewed with the peroxidase substrate 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), and signals were quantified by absorbance at 405 nm (28).
Statistical analysis
Students two-tailed t test was used to determine the significance of differences between group means.
| Results |
|---|
|
|
|---|
The AChR-derived recombinant fragments of human AChR
-subunit
were cloned and expressed either as fusion proteins Trx-H
1210 or
GST-H
1210, or without a fusion partner (H
1205). The extent of
their conformational similarity to intact AChR was established by
reactivity with
-BTX and mAb 198, an anti-AChR mAb specific for
the main immunogenic region in the
-subunit, which is known to be a
conformation-dependent epitope (Fig. 1
).
As shown in Fig. 1
B, Trx-H
1210 binds
-BTX to a
higher extent than the other two fragments. The weakest
-BTX binder
was fragment H
1205. Denaturation of H
1205 by chemical
modification completely abolished its ability to bind
-BTX,
assessing the importance of conformation for this binding (data not
shown). Similar results were obtained when the blot was overlaid with
mAb 5.5 (29), which is directed to the acetylcholine
binding site (data not shown). The anti-main immunogenic region
mAb 198 (30) bound well to Trx-H
1210 and, to a
lower extent, to the other two fragments (GST-H
1210 and
H
1205) (Fig. 1
C).
|
1210 inhibited this binding
with an IC50 value of 3 x
10-7 M. The IC50 values
for fragments GST-H
1210 and H
1205 were 1.3 x
10-6 M and 3.3 x
10-6 M, respectively. In all additional
experiments, we focused on two of the three fragments, which represent
the extremes with regard to conformational similarity to intact AChR,
namely the more native fragment, Trx-H
1210, and the less native
fragment, H
1205.
|
The role of tolerogen conformation in modulation of EAMG was
tested by oral administration of the fragments during the acute phase
of disease in rats. The fragments tested were Trx-H
1210,
H
1205, and their respective chemically modified forms,
denTrx-H
1210 and denH
1205. OVA and Trx alone were used as
controls. Oral administration of the fragments was initiated at the
acute phase, 8 days after the induction of EAMG, and was continued
twice per week for 9 wk. Treatment with Trx-H
1210 led to
aggravation of disease symptoms even as compared with control
OVA-treated rats (Fig. 3
). In the first 5
wk after induction of disease, all rats treated with Trx-H
1210 got
sick and 6 of 10 died of EAMG. At that time, 3 of 10 OVA-treated rats
had died of EAMG, whereas H
1205-treated rats showed only mild
symptoms of EAMG (Fig. 3
). Interestingly, oral treatment with the
chemically modified, denatured form of Trx-H
1210,
denTrx-H
1210, suppressed EAMG in a similar manner to H
1205
(data not shown). Treatment with Trx alone had no effect on EAMG (data
not shown), assessing that the fusion partner (Trx) was not responsible
for the aggravation of EAMG observed in the Trx-H
1210-treated
rats. By 10 wk after disease induction, 7 of 10 rats in the
Trx-H
1210-treated and 6 of 10 in the OVA-treated group were dead
(the mean clinical scores were 3.4 for the Trx-H
1210-treatd group
and 3.2 for the OVA-treated groups). On the other hand, in the
H
1205-treated group, 3 of 10 rats were completely healthy and none
of the rats died (mean clinical score, 1.3; Table I
).
|
|
1210
and control OVA-treated groups lost 69% and 55% of their muscle AChR
content, respectively. In contrast, rats treated by H
1205 lost
only 10% of their muscle AChR (Table I
1210 led to elicitation of Abs to the
fragment itself, whereas feeding with H
1205 or OVA did not elicit
an Ab response to the fed Ag (data not shown).
Oral administration of the fragments was accompanied by different
effects on AChR-specific humoral and cellular immune responses. Rats
treated orally with Trx-H
1210 exhibited an increase in their
anti-self AChR Ab levels (93.5 ± 5.5 nM) when compared with
the OVA-treated group (70.5 ± 6.5 nM). On the other hand,
treatment with H
1205 resulted in a decrease in the anti-self
AChR Ab level (31 ± 3.5 nM). In addition, Trx-H
1210-treated
rats also exhibited a high AChR-specific proliferative T cell response,
similar to the response in the OVA-treated rats, whereas
H
1205-treated rats had a suppressed T cell response (Table I
).
Effect of tolerogen conformation on the expression of cytokines and costimulatory factors
To analyze the possible mechanisms underlying the effects that the
different fragments exert on EAMG, we studied the levels of cytokines
and costimulatory factors in the treated rats. Draining LNC of rats fed
with H
1205, Trx-H
1210, or OVA were removed 58 wk after EAMG
induction and cultured for 48 h in the presence of
Torpedo AChR. Total RNA was then prepared from the cells and
subjected to PCR-ELISA with cytokine-specific or costimulatory
factor-specific primers.
As shown in Fig. 4
A, oral
treatment with Trx-H
1210 resulted in down-regulation of IFN-
,
IL-10, and TGF-ß and up-regulation in the level of IL-2 (and a slight
increase in IL-12) compared with OVA-treated rats. On the other hand,
oral treatment with H
1205 resulted in suppression of Th1-type
(IL-2, IL-12, and IFN-
) cytokine mRNA levels and in up-regulation of
Th2-type (IL-10) or Th3-type (TGF-ß) cytokine mRNA levels, as already
reported by us (18).
|
1210-treated rats. The expression levels of costimulatory
factors were tested in the AChR-stimulated LNC, which were used for
analysis of cytokine levels. As shown in Fig. 4
1210 resulted in up-regulation of CD28, CD40,
and CD40L compared with OVA-treated rats (p <
0.005). Other costimulatory factors such as CTLA4 and B7-1/B7-2 were
similarly expressed in Trx-H
1210- and OVA-treated rats. On the
other hand, oral treatment with the less native fragment H
1205,
which has been an effective tolerogen, resulted in reduced expression
levels (p < 0.005; as compared with controls)
of the costimulatory factors tested, such as CD40L, CD40, CD28, CTLA4,
and B7-1/B7-2. This suggests that up-regulated expression of
costimulatory factors induced by feeding with Trx-H
1210 leads to
the increased AChR-specific T cell proliferation. This activation of
autoregulatory T cells results in up-regulated Th1-type cytokines and
down-regulation of Th2 or Th3 cytokines. On the other hand, the
protective effect of oral treatment with H
1205 is accompanied by
down-regulation of costimulatory factor expression, which in turn
induces a suppressed AChR-T cell response. Effect of tolerogen conformation on T and B cell proliferation
To examine whether the observed up-regulation of Th1-type
cytokines and of costimulatory factors induced by Trx-H
1210
feeding may also be associated with an increased AChR-specific B cell
proliferation, we compared the in vitro response of cells from
myasthenic rats to the various fragments. Draining LNC were removed
from myasthenic rats (mean clinical score, 23) at the chronic stage
of disease, 68 wk after EAMG induction. Cells were cultured for 4
days in the presence of Torpedo AChR, Trx-H
1210,
H
1205, Trx, Con A, or LPS, and the level of B cell proliferation
was determined by alkaline phosphatase activity (which is known to be
specific for activated B cells; 25, 26). Trx-H
1210
induced the highest B cell proliferative response (Fig. 5
A), whereas Trx alone had
only a minor effect on B cell proliferation. LPS induced a strong
response, and Con A did not induce any B cell proliferative response
(data not shown), as expected for activated B cells. Interestingly,
Torpedo AChR induced a lower B cell proliferation than
Trx-H
1210, which may be due to its processing in vitro.
|
1210 was higher than in the presence of the other fragments.
Trx alone induced only a minor T cell proliferation (data not shown).
The different T cell responses induced by the two fragments
(Trx-H
1210 and H
1205) may reflect differences in their Ag
processing and presentation in the LNC of myasthenic rats. | Discussion |
|---|
|
|
|---|
In this study, we focused on investigating the role of conformation of orally administered AChR fragments in the induction of systemic suppression of EAMG. We have gained insight to the immunological pathways that follow the oral administration of conformationally different AChR fragments, and also suggest clues to predict what is required from a fed protein to serve as a successful tolerogen.
Rats were fed at the acute phase of EAMG with recombinant fragments,
all corresponding to the extracellular domain of the human AChR
-subunit, but differing in their spatial conformation. One of the
fragments, H
1205, was previously shown by us to suppress EAMG in
rats when administered orally either at the acute or at the chronic
phase of disease (18). The other recombinant fragment,
Trx-H
1210, corresponds to the same region in the human AChR
-subunit, but in contrast to H
1205, its three-dimensional
structure is more similar to that of the corresponding region in native
intact AChR. This was assessed by its reactivity with
-BTX, mAb 5.5,
and mAb 198, all of which are known to recognize conformation-dependent
epitopes of AChR. Another recombinant fragment, GST-H
1-210,
consisting of the same sequence joined to GST had intermediate
characteristics. We have demonstrated that in contrast to H
1205
that suppresses EAMG, the more native fragment, Trx-H
1210, fails
to do so. Differences other than conformation could contribute to their
different ability to induce oral tolerance. However, the fact that
denaturation of the Trx-H
1210 fragment turned it from an
exacerbator of EAMG into an effective tolerogen suggests that
conformation itself plays an important role in determining the
tolerogenicity of these fragments.
Our next goal was to analyze the immunological events that follow the
oral administration of these conformationally different fragments, and
that result in one case in suppression and in the other case in
exacerbation of an existing disease. We demonstrate that whereas the
less native fragment, H
1205, leads to a decreased humoral and
cellular AChR-specific response accompanied by a decrease in the
production of proinflammatory cytokines and costimulatory factors, the
oral administration of the more native, Trx-H
1210 fragment leads
to opposite changes. Namely, feeding with Trx-H
1210 leads to an
elevated AChR-specific humoral and cellular reactivity and to an
up-regulation of the proinflammatory cytokine IL-2 and costimulatory
factors accompanied by down-regulation of antiinflammatory cytokines.
Although Trx has been shown to act as a potent chemoattractant and
inducer of cytokines (39, 40), the latter effects cannot
be attributed to Trx since denatured Trx-H
1210 and Trx alone did
not act like Trx-H
1210.
Previous reports have demonstrated the involvement of the
proinflammatory cytokines IL-12 and IFN-
in the induction of EAMG
(41, 42, 43, 44) and the protective effects of antiinflammatory
cytokines such as IL-10 and TGF-ß in autoimmune diseases including
EAMG (45). Therefore, our observations on the different
changes in the cytokine profile following the administration of
H
1205 and Trx-H
1210 may explain the different effects of
these two fragments on the course of EAMG.
The opposite consequences of oral administration of fragments differing
in their conformation may stem from the repertoire of T and B cell
epitopes they are bearing. The more native fragment, Trx-H
1210,
may be recognized by autoreactive B cells already existing in the
myasthenic rats, which could serve as APCs required for T
cell activation, as has been implied in other autoimmune diseases
(46). Such a fragment is more likely to have deleterious
effects upon oral ingestion. The less native fragment, H
1205,
probably bears significantly less, or no pathogenic B cell epitopes at
all, and would therefore not stimulate B cell proliferation
that would in turn lead to AChR-specific T cell activation. Our B cell
proliferation assay indeed demonstrates that Trx-H
1210 can
stimulate B cells from sensitized rats, whereas H
1205, denatured
Trx-H
1210, and Trx alone do not. Moreover, oral administration of
Trx-H
1210 leads to increased levels of CD40L, which is expressed
on activated T cells and is known to be an important costimulatory
factor in B cell activation. This factor has also been shown to be
essential for AChR-specific immune responses since CD40L-deficient mice
(CD40L-/-) are resistant to EAMG induction
(47). The B cell activation following the administration
of a native AChR fragment could lead to the elevated AChR-specific T
cell proliferation (Table I
) and to the observed shift in the cytokine
profile from a Th2/Th3 response to a Th1-regulated AChR-specific
response. Conversely, when a less native AChR fragment, such as
H
1205, is orally administered, the level of costimulation is too
low to stimulate T cell activation, thus leading to a shift in the
cytokine profile in favor of the antiinflammatory Th2/Th3
cytokines.
In the present study, we have attempted to induce tolerance when the
autoimmune anti-AChR process already takes place and found that
native conformation of the tolerogen employed is not beneficial for the
induction of oral tolerance. This might be due to some residual
pathogenicity that may result in stimulation of already activated B
cells, especially in the case of a highly immunogenic autoantigen as
AChR. It is therefore important to delineate the requirements for an
effective tolerogen. In the case of EAMG, we believe that
myasthenogenicity of the tested fragments upon active immunization
provides one such clue. We observed that injections of large amounts of
Trx-H
1210 (500 µg/dose in CFA) resulted in clinical signs of
EAMG, while injection of the same dose of H
1205 resulted only in a
transient disease characterized by very mild symptoms (mean clinical
score, 1). Nevertheless, it should be stressed that even long-term oral
administration of any of the tested fragments never led to clinical
signs of EAMG. Another clue is based on the ability to elicit a humoral
response to the fed fragment. Oral feeding with the more native
fragment Trx-H
1210 led to production of anti-fragment Abs,
whereas feeding with denTrx-H
1210 or H
1205 did not elicit any
humoral response. The latter observation also indicates that antigenic
competition is not the underlying mechanism of the suppression induced
by feed with the recombinant fragments. If that were the mechanism, we
would expect the more native fragment, Trx-H
1210, to act as a more
potent tolerogen, which is not the case.
The molecular features required for immunopathogenicity and
tolerogenicity may be distinct from each other, and there is an
advantage to be able to control them as desired. This distinction may
be particularly important for attempts to induce tolerance in an
already existing disease. In the present study, we report on the oral
treatment of rats by rAChR fragments, at the acute phase of EAMG. We
have clearly demonstrated that while the less native fragment
(H
1205) suppresses EAMG, the more native fragment (Trx-H
1210)
has no such effect and even exacerbates the clinical symptoms of
disease. Since we have evidence that during the chronic phase of
disease myasthenic rats have autoreactive B cells recognizing
Trx-H
1210 (Fig. 5
A), we believe that administration of
this recombinant fragment at the chronic phase would most likely lead
to further activation of these autoreactive cells and to exacerbation
of disease.
It should be noted that to date, most of the oral tolerance studies in experimental autoimmune diseases describe prevention experiments in which the tolerogen was introduced before disease induction, when Ag-specific activated B or T cells still do not exist. It may therefore be somewhat misleading to design clinical trials on the basis of such prevention studies. Moreover, this may be one of the reasons that clinical trials on ongoing human autoimmune diseases have not been very successful.
In conclusion, our study suggests that the spatial conformation of an orally administered tolerogen should be given careful attention when considering oral treatment for the induction of systemic tolerance in established Ab-mediated autoimmune diseases such as myasthenia gravis.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sara Fuchs, Department of Immunology, The Weizmann Institute of Science, Rehovot 76100, Israel. ![]()
3 Abbreviations used in this paper: EAMG, experimental autoimmune myasthenia gravis;
-BTX,
-bungarotoxin; AChR, acetylcholine receptor; DIG, digoxigenin; 125I-
-BTX, 125I-labeled
-BTX; LNC, lymph node cells; Trx, thioredoxin. ![]()
Received for publication December 10, 1999. Accepted for publication July 10, 2000.
| References |
|---|
|
|
|---|
-subunit. Proc. Natl. Acad. Sci. USA 96:8086.
and IL-12p40 mRNA increase with age in both diabetic and insulin-treated nondiabetic BB rats. J. Immunol. 156:1315.[Abstract]
(IFN-
) is necessary for the genesis of acetylcholine receptor-induced clinical experimental autoimmune myasthenia gravis in mice. J. Exp. Med. 186:385.
is required to induce experimental autoimmune myasthenia gravis. Ann. NY Acad. Sci. 841:576.
. Clin. Immunol. Immunopathol. 87:15.[Medline]
This article has been cited by other articles:
![]() |
J. LINDSTROM, J. LUO, and A. KURYATOV Myasthenia Gravis and the Tops and Bottoms of AChRs: Antigenic Structure of the MIR and Specific Immunosuppression of EAMG Using AChR Cytoplasmic Domains Ann. N.Y. Acad. Sci., June 1, 2008; 1132(1): 29 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Feferman, P. K. Maiti, S. Berrih-Aknin, J. Bismuth, J. Bidault, S. Fuchs, and M. C. Souroujon Overexpression of IFN-Induced Protein 10 and Its Receptor CXCR3 in Myasthenia Gravis J. Immunol., May 1, 2005; 174(9): 5324 - 5331. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tramontano and S. P. Makker Conformation and Glycosylation of a Megalin Fragment Correlate with Nephritogenicity in Heymann Nephritis J. Immunol., February 15, 2004; 172(4): 2367 - 2373. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. MILANI, N. OSTLIE, W. WANG, and B. M. CONTI-FINE T Cells and Cytokines in the Pathogenesis of Acquired Myasthenia Gravis Ann. N.Y. Acad. Sci., September 1, 2003; 998(1): 284 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. SOUROUJON, P. K. MAITI, T. FEFERMAN, S.-H. IM, L. RAVEH, and S. FUCHS Suppression of Myasthenia Gravis by Antigen-Specific Mucosal Tolerance and Modulation of Cytokines and Costimulatory Factors Ann. N.Y. Acad. Sci., September 1, 2003; 998(1): 533 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Psaridi-Linardaki, A. Mamalaki, M. Remoundos, and S. J. Tzartos Expression of Soluble Ligand- and Antibody-binding Extracellular Domain of Human Muscle Acetylcholine Receptor alpha Subunit in Yeast Pichia pastoris. ROLE OF GLYCOSYLATION IN alpha -BUNGAROTOXIN BINDING J. Biol. Chem., July 19, 2002; 277(30): 26980 - 26986. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. IM, D. BARCHAN, P. K. MAITI, L. RAVEH, M. C. SOUROUJON, and S. FUCHS Suppression of experimental myasthenia gravis, a B cell-mediated autoimmune disease, by blockade of IL-18 FASEB J, October 1, 2001; 15(12): 2140 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Im, D. Barchan, P. K. Maiti, S. Fuchs, and M. C. Souroujon Blockade of CD40 Ligand Suppresses Chronic Experimental Myasthenia Gravis by Down-Regulation of Th1 Differentiation and Up-Regulation of CTLA-4 J. Immunol., June 1, 2001; 166(11): 6893 - 6898. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||