The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, J.
Right arrow Articles by Proud, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J.
Right arrow Articles by Proud, D.
The Journal of Immunology, 2000, 165: 3384-3392.
Copyright © 00 by The American Association of Immunologists

Role of NF-{kappa}B in Cytokine Production Induced from Human Airway Epithelial Cells by Rhinovirus Infection1

Jean Kim*,{ddagger}, Scherer P. Sanders{dagger}, Edward S. Siekierski*, Vincenzo Casolaro* and David Proud2,*

Divisions of * Clinical Immunology and {dagger} Pulmonary and Critical Care Medicine, Department of Medicine, and {ddagger} Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins University School of Medicine, Baltimore, MD 21224


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Infection of human epithelial cells with human rhinovirus (HRV)-16 induces rapid production of several proinflammatory cytokines, including IL-8, IL-6, and GM-CSF. We evaluated the role of NF-{kappa}B in HRV-16-induced IL-8 and IL-6 production by EMSA using oligonucleotides corresponding to the binding sites for NF-{kappa}B in the IL-6 and IL-8 gene promoters. Consistent with the rapid induction of mRNA for IL-8 and IL-6, maximal NF-{kappa}B binding to both oligonucleotides was detected at 30 min after infection. NF-{kappa}B complexes contained p65 and p50, but not c-Rel. The IL-8 oligonucleotide bound recombinant p50 with only about one-tenth the efficiency of the IL-6 oligonucleotide, even though epithelial cells produced more IL-8 protein than IL-6. Neither the potent glucocorticoid, budesonide (10-7 M), nor a NO donor inhibited NF-{kappa}B binding to either cytokine promoter or induction of mRNA for either IL-8 or IL-6. Sulfasalazine and calpain inhibitor I, inhibitors of NF-{kappa}B activation, blocked HRV-16-induced formation of NF-{kappa}B complexes with oligonucleotides from both cytokines, but did not inhibit mRNA induction for either cytokine. By contrast, sulfasalazine clearly inhibited HRV-16 induction of mRNA for GM-CSF in the same cells. Thus, HRV-16 induces epithelial expression of IL-8 and IL-6 by an NF-{kappa}B-independent pathway, whereas induction of GM-CSF is at least partially dependent upon NF-{kappa}B activation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rhinovirus infections are the single most prevalent cause of the common cold (1) and also have been implicated as playing a role in the exacerbation of other diseases, including asthma (2, 3) and sinusitis (4, 5). However, despite the high prevalence of rhinovirus infections, the biochemical mechanisms leading to the manifestation of symptoms remain unclear.

The airway epithelial cell is the primary site of rhinovirus infection (6, 7), and there is growing evidence that virally induced alterations of epithelial cell biochemistry may be an initiating event in the pathogenesis of rhinovirus infections. Studies with several epithelial cell lines, as well as with cultured primary epithelial cells, have shown that in vitro infection with rhinovirus induces secretion of several cytokines and chemokines, including IL-8, IL-6, GM-CSF, IL-11, IL-1, and RANTES (8, 9, 10, 11, 12, 13). Moreover, several of these cytokines have also been detected in nasal secretions during experimental in vivo rhinovirus infections (9, 10, 14, 15). Given that several of these cytokines can serve as chemoattractants for, and/or activators of, inflammatory cells, it is attractive to suggest that cytokine production by infected epithelial cells may serve to orchestrate the local inflammatory response to rhinovirus infection in a manner that leads to symptom induction.

Activation of the transcription factor, NF-{kappa}B, has been shown to play an important role in the enhanced expression of several cytokine genes, including IL-8, IL-6, and GM-CSF, that is observed in various cell types upon stimulation with agonists such as IL-1 and TNF-{alpha} (16). In some cases, maximal gene expression requires that NF-{kappa}B acts in concert with other transcription factors (16, 17). Recent studies have suggested that activation of NF-{kappa}B may also play a role in rhinovirus-induced epithelial expression of IL-6 and IL-8 (9, 18, 19). These studies were undertaken to further explore the potential role of NF-{kappa}B in rhinovirus-induced cytokine production from epithelial cells. Because of our previous data demonstrating that the BEAS-2B bronchial epithelial cell line responds to rhinovirus infection in a manner similar to primary epithelial cells with a rapid and robust generation of IL-8, IL-6, and GM-CSF (8, 11), we chose to conduct our studies using this cell line. We used oligonucleotides corresponding to the NF-{kappa}B binding sites in the promoters of the IL-6 and IL-8 genes, as well as the consensus sequence originally described from the Ig{kappa} gene (20), to examine the time course of NF-{kappa}B activation in cells infected with partially purified human rhinovirus (HRV)3-16, relative to the time course of cytokine mRNA induction. The relative affinity of the various oligonucleotides for NF-{kappa}B was also examined. Finally, we also evaluated the effects of pharmacologic interventions purported to selectively inhibit NF-{kappa}B activation on the binding of NF-{kappa}B to cytokine promoter oligonucleotides, as well as on cytokine mRNA and protein levels. Our data clearly confirm that rhinovirus infection of epithelial cells activates NF-{kappa}B but suggest that this transcription factor is not required for HRV-16 induction of mRNA for IL-6 or IL-8. By contrast, the increased epithelial expression of mRNA for GM-CSF observed upon HRV-16 infection is reduced when NF-{kappa}B activation is inhibited.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

The following reagents were purchased from the indicated suppliers: HRV-16 and WI-38 cells (American Type Culture Collection, Manassas, VA); DMEM, Eagle’s minimal essential medium (EMEM), Ham’s F-12 medium, HBSS, L-glutamine, penicillin-streptomycin-amphotericin B (Fungizone), trace elements, growth factor, and endothelial cell growth supplement (Collaborative Research, Bedford, MA); FBS (Gemini Biological Products, Calabasas, CA); transferrin, insulin, N,N,N',N'-tetramethylethylenediamine (TEMED), acrylamide, N,N'-methylene-bis-acrylamide, and ammonium persulfate (Life Technologies, Grand Island, NY); 3-(2-hydroxy-2-nitroso-1-propylhydrazino)-1-propanamine (NONOate; Cayman Chemical, Ann Arbor, MI); RNAzol B (Tel-Test, Friendswood, TX); agarose (FMC Bioproducts, Rockland, ME); MOPS, DNA Polymerase I (Klenow fragment), PMSF (Boehringer Mannheim, Indianapolis, IN); [{alpha}-32P]dCTP, poly(dI-dC), oligolabeling kit (Amersham-Pharmacia Biotech, Arlington Heights, IL); anti-p65 Ab, anti-p50 Ab, and anti-c-Rel Ab (Santa Cruz Biotechnologies, Santa Cruz, CA); recombinant p50 protein (Promega, Madison, WI); Calpain inhibitor I (Calbiochem, San Diego, CA). All other chemicals were purchased from Sigma (St. Louis, MO). Budesonide was provided by Per Andersson and Ralph Brattsand (Astra Pharmaceuticals, Lund, Sweden).

Epithelial cell culture and viral infection

The BEAS-2B cell line (21) was provided by Dr. Curtis Harris (National Cancer Institute, Bethesda, MD). Cells were grown in culture medium consisting of Ham’s F-12 nutrient medium with penicillin (100 U/ml), streptomycin (100 U/ml), Fungizone (250 ng/ml), L-glutamine (2 mM), phosphoethanolamine/ethanolamine (0.5 mM), transferrin (10 µg/ml), endothelial cell growth supplement (3.75 µg/ml), epidermal growth factor (12.5 ng/ml), insulin (5 µg/ml), hydrocortisone (10-7 M), cholera toxin (10 ng/ml), 3,3',5-triodothyronine (3 x 10-9 M), retinoic acid (0.1 ng/ml), and trace elements. This medium is hereafter referred to as F12/10X. The cells were incubated at 37°C in 95% air and 5% CO2 and were used between passages 35 and 50.

HRV-16 was propagated in WI-38 cells as previously described (8). The HRV-16 stock generated in this manner was purified to remove ribosomes and soluble factors of WI-38 origin by centrifugation through sucrose, according to published methods (22). For infection, monolayers of BEAS-2B cells (80–90% confluent) were washed three times with HBSS. HRV-16 was added to the cells at concentrations of 104–105 TCID50 U/ml HBSS. The cells were incubated with the virus at 34°C for 1 h, washed three times with F12/10X, and then fresh F12/10X medium was added to the cells. This was referred to as time zero for the experiments described. Nuclear proteins or cellular RNA were then harvested at appropriate times, and the level of cytokine protein was assayed in supernatants collected from the above cells. This protocol was modified slightly for studies of GM-CSF. We have previously reported that production of GM-CSF by primary epithelial cells is extremely sensitive to inhibition by glucocorticoids (23). Because preliminary studies confirmed that HRV-16-induced production of GM-CSF from BEAS-2B cells was also sensitive to glucocorticoids, cell monolayers were placed for 24 h in medium from which hydrocortisone was omitted (F12/9X) before being used in experiments. Moreover, after infection, incubations were also performed in F12/9X.

To further confirm that cytokine induction from BEAS-2B cells by purified virus preparations was due to viral infection, and not to any residual soluble factors from WI-38 cells, two approaches were used. First, viral preparations were subjected to ultrafiltration by centrifugation through Centricon membranes with a 30-kDa molecular mass cutoff (Amicon, Beverly, MA). Both the filtrate, which should contain the same concentration of most known cytokines as the original preparation, and the concentrated retentate were then compared with the original preparation for their ability to generate cytokines. Second, BEAS-2B cell cultures were preincubated with 20 µg/ml of mouse-blocking mAb to human ICAM-1 (84H10; Coulter-Immunotech, Miami, FL), or with a class-matched control Ab, as previously described (8). Cells were then exposed to varying doses of HRV-16, and cytokine production was assessed. Medium was recovered 4 h after infection and assayed for IL-8.

Extraction of nuclear proteins

For each treatment condition, two 75-cm2 tissue culture flasks, each containing monolayers of ~1 x 107 BEAS-2B cells, were treated with ice-cold PBS and scraped. The cell suspension was centrifuged at 1200 x g at 4°C for 8 min. The cell pellets were combined and lysed by resuspension in 100 µl of lysis buffer (10 mM HEPES, pH 7.9, 60 mM KCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5% Nonidet P-40). A 10-µl aliquot was removed and mixed with an equal volume of trypan blue and examined under x40 microscopy to confirm the presence of round, intact nuclei. The remainder of the suspension was centrifuged again. The nuclear pellet was washed with lysis buffer without Nonidet P-40 and centrifuged at 1200 x g at 4°C for 5 min. The pellet was resuspended in 100 µl of nuclear resuspension buffer (25 mM Tris-HCl, pH 8.0, 400 mM KCl, 1 mM DTT, 1 mM PMSF, and 20% w/v glycerol), rapidly frozen and thawed three times, and centrifuged at 4000 x g at 4°C for 12 min. The supernatant containing nuclear proteins was removed, and an aliquot was used for protein determination using the Bio-Rad protein assay kit (Richmond, CA) adapted for microtiter plates. The remainder of the nuclear protein extract was frozen at -80°C until used.

EMSA

Oligonucleotide DNA sequences (100 ng) were synthesized by Genosys Biotechnologies (The Woodlands, TX) and were radiolabeled by random priming (24) using 6 U of DNA Polymerase I (Klenow fragment), [{alpha}-32P]dCTP (50 µCi), and 10 µl of Pharmacia reaction mix (containing dATP, dTTP, dGTP, and random hexadeoxyribonucleotides) in a 50-µl final volume of 10 mM Tris-EDTA pH 8.0 at 37°C for 60 min. The radiolabeled probes were isolated from Sephadex G-50 minicolumns (Pharmacia) by centrifugation at 800 x g for 2 min.

The oligonucleotide sequences used were are follows: AGTTGAGGGGACTTTCCCAGGC, containing the NF-{kappa}B binding site in the promoter of the Ig{kappa} gene; AAATGTGGGATTTTCCCATGAG, containing the NF-{kappa}B binding sequence from the IL-6 gene promoter; AATCGTGGAATTTCCTCTGACA, containing the NF-{kappa}B binding sequence from the IL-8 gene promoter; and GCCATCAGTTGCAAATCGTGGAATTTCCTCTGACA, the sequence from the IL-8 gene promoter that contains both the NF-{kappa}B and the adjacent NF-IL-6 binding sites.

Extracts of nuclear proteins (200 ng) were incubated with 2 ng of the appropriate {alpha}-32P-labeled oligonucleotide (50,000–100,000 cpm/µl) and 1 µg of poly(dI-dC) in 10 µl of binding buffer (10 mM Tris-HCl, pH 7.4, 10% w/v glycerol, and 65 mM KCl) for 30 min at 25°C. For experiments using recombinant p50 protein instead of nuclear extracts, the reaction mixture also contained 0.1 µg of BSA. For supershift experiments, antisera were added and the reaction mixture was incubated for an additional 10 min at 25°C. Electrophoresis was conducted in 5% polyacrylamide gels using 0.045 M Tris-borate/0.001 M EDTA, pH 8.0 buffer. The gel was fixed in 10% acetic acid/10% ethanol for 10 min and dried before exposure to x-ray film (Biomax; Kodak, Rochester, NY).

RNA extraction and Northern analysis

Total cellular RNA was extracted from BEAS-2B cells as previously described (11) using RNAzol B (1 ml/10 cm2) in a modification of the method of Chomczynski and Sacchi (25). The integrity of each RNA sample was assessed by electrophoresis of an aliquot (0.5 µg) on a 1% agarose gel with 0.5 µg ethidium bromide/ml buffer. RNA was stored at -80°C.

Full-length cDNAs for IL-6 and GM-CSF were provided by Steven Gillis (Immunex, Seattle, WA). The full-length cDNA for IL-8 was obtained by RT-PCR as previously described (11). Full-length cDNA for GAPDH was purchased from Clontech (Palo Alto, CA). Probes were labeled to a high specific activity by the random primer method (24). Unincorporated nucleotides were separated using Sephadex G-50 minicolumns (Pharmacia) by centrifugation at 800 x g for 2 min.

Northern analysis was performed as previously described (11). Films were routinely developed for varying times to ensure that band intensities assessed by densitometry were within the linear range for the film. Densitometry was performed using a scanning densitometer (UVP gel documentation system; Ultraviolet Products, San Gabriel, CA), and densitometric analysis was performed using NIH Image software.

Quantification of cytokines

Levels of cytokines in cell supernatants were determined using specific ELISAs. Measurements of IL-8 were performed using a previously described ELISA sensitive to 30 pg/ml of cytokine (8). Levels of IL-6 were assayed using a commercial kit sensitive to 15 pg of IL-6/ml (Biosource International, Camarillo, CA), whereas GM-CSF was quantified using a commercial ELISA sensitive to 7.8 pg of GM-CSF/ml (R&D Systems, Minneapolis, MN). Neither the culture medium nor any of the drugs (or vehicles) used in our experiments caused any nonspecific interference effects in any of the assays.

Effects of drugs on NF-{kappa}B activation and cytokine induction

Budesonide was prepared as a 10-2 M stock solution in DMSO. Because the BEAS-2B cells are usually maintained in growth medium containing low levels of hydrocortisone, the cells for these experiments were placed in medium without hydrocortisone for 24 h before treatment with the glucocorticoid. Cells were then treated with 10-7 M budesonide or appropriately diluted vehicle control for 24 h before viral infection. Budesonide was again included in the medium after viral infection. The concentration of budesonide used was selected because previously it has been shown to maximally inhibit TNF{alpha}-induced RANTES production from BEAS-2B cells (26).

NONOate was prepared in alkaline solution (0.01 M NaOH) as a 100-mM stock solution, which was kept at 4°C until use. New stock solutions of NONOate were prepared for each experiment and used within 1 h of preparation. The defined half-life of NO release from NONOate is 76 min at pH 7.4 and 22°C (Cayman Chemical). Under alkaline conditions, the NONOate does not release NO. NONOate was added at a final concentration of 500 µM both to the HBSS solution during virus exposure and to the medium following the virus exposure.

Sulfasalazine (2 mM), calpain inhibitor I (10 µM), or appropriate vehicle controls were added to cell culture medium for 2 h before viral exposure. The drugs were also added to the HBSS during viral exposure and to the medium added to the cells after infection.

For all drug interventions, doses were tested to ensure that there was no effect on cell viability. Nuclear protein extracts and cellular RNA were prepared, and cell supernatants were removed, at times after viral infection that were optimal for each parameter. That is, 30 min postinfection for nuclear extracts, 1 h postinfection for RNA isolation, and 4 h postinfection for protein analysis.

Statistical analysis

Data are expressed as the mean ± SEM. The effects of drugs on RNA expression and protein secretion were compared using the Student’s t test for paired samples. Differences were considered significant for values of p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Viral induction of cytokines

As we have previously reported, infection of BEAS-2B cells with a purified preparation of HRV-16 results in induction of IL-8 and IL-6 release. Maximal induction of mRNA for both IL-6 and IL-8 occurs within 1 h postinfection of BEAS-2B cells with HRV-16, with maximal protein release occurring within 4–6 h postinfection (11). Although cells always release more IL-8 than IL-6, absolute levels of cytokines produced vary markedly with passage number. Specifically, levels of cytokines decrease with increasing passage number in culture (11). To further confirm that cytokine induction was indeed due to viral infection, and not to some soluble product of WI-38 cells that could have copurified with the virus, two approaches were used. First, a 2-ml volume of each of two different viral preparations was subjected to ultrafiltration by centrifugation through Centricon membranes with a 30-kDa molecular mass cutoff. When ~1 ml of each sample had passed through the filter, both the ~2-fold concentrated retentate and the filtrate were used to "infect" BEAS-2B cells, and the responses were compared with those of the original viral preparations. The first viral preparation released 320 pg/ml of IL-8, whereas the concentrated retentate released 620 pg/ml. Similar data were seen for the second viral preparation (150 pg/ml) and retentate (280 pg/ml). However, in both cases, the filtrate released absolutely no IL-8. These data were consistent with the specific role of virus but could not exclude a role for soluble factors of >30 kDa molecular mass. Therefore, we also examined the effect of preincubation of BEAS-2B cells with a blocking mAb to ICAM-1, the cell surface receptor for HRV-16. At an infectious dose of 104 TCID50 of HRV-16, complete inhibition of IL-8 production was seen (155 pg/ml produced with control Ab vs 0 pg/ml using anti-ICAM-1). At a higher infectious dose (3 x 104 TCID50), partial inhibition was observed (470–230 pg/ml). These data are consistent with our earlier observation that very little virus is necessary to begin a productive infection (8). Given that viral binding to ICAM-1 is essential for cytokine induction, we sought to establish whether binding to ICAM-1 was an adequate stimulus for cytokine induction. Epithelial cells were incubated with varying numbers of paraformaldehyde-fixed neutrophils expressing LFA-1, a counterligand for ICAM-1. In none of three experiments did incubation with neutrophils (at ratios up to 10:1) induce any production of IL-8 or IL-6 (not shown), implying that viral induction of cytokines occurs at a stage after viral binding to ICAM-1.

Time course of NF-{kappa}B activation

As noted above, maximal induction of mRNA for both IL-6 and IL-8 occurs within 1 h postinfection of BEAS-2B cells with HRV-16 (11). Thus, for NF-{kappa}B to play a role in rhinovirus-induced expression of these genes, this transcription factor must be activated within this time frame. When the time course of NF-{kappa}B activation following HRV infection was examined by EMSA, formation of specific NF-{kappa}B complexes was observed using each of the radiolabeled oligonucleotides from the Ig{kappa}, IL-6, and IL-8 gene promoter sequences. In each case, maximal activation of NF-{kappa}B occurred at 30 min after infection, consistent with a potential role of NF-{kappa}B in transcriptional regulation of IL-6 and IL-8 (Fig. 1Go). No activation of NF-{kappa}B was seen in the absence of infectious virus. Interestingly, the signal intensity of the NF-{kappa}B band observed using the oligonucleotide from the IL-8 promoter sequence was consistently significantly weaker than that seen with the oligonucleotide sequences from the Ig{kappa} and IL-6 genes. To determine whether binding of NF-{kappa}B to the IL-8 promoter sequence may be enhanced if the adjacent NF-IL-6 recognition sequence was also present, gel shift assays were performed with the oligonucleotide sequence from the IL-8 gene promoter that contained both sites. Studies with this oligonucleotide showed a similar pattern of NF-{kappa}B complex formation, and no further increase in signal intensity above that seen with the oligonucleotide containing the NF-{kappa}B recognition sequence alone (data not shown).



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 1. Time course of NF-{kappa}B activation in BEAS-2B epithelial cells infected with HRV-16. Left, center, and right, autoradiographs from EMSA using 32P-radiolabeled oligonucleotides corresponding to the NF-{kappa}B binding sites from the promoters of the Ig{kappa}, IL-6, and IL-8 genes, respectively. Nuclear extracts prepared 30 min, 1 h, and 3 h after HRV-16 infection, as well as 30 min after sham infection, were assessed for the formation of NF-{kappa}B complexes. The position of the specific NF-{kappa}B complex is shown by the arrows. The figure is representative of n = 3 experiments.

 
Composition of NF-{kappa}B complexes binding to IL-6 and IL-8 promoter sequences

To confirm that bands observed by EMSA were indeed NF-{kappa}B, we demonstrated that binding could be inhibited by competition with excess appropriate unlabeled oligonucleotides, but not by oligonucleotides that would not be expected to bind NF-{kappa}B (e.g., oligonucleotides that recognize the transcription factor AP-1) (data not shown). To determine the subunit composition of NF-{kappa}B complexes forming on cytokine promoter sequences in HRV-16-infected BEAS-2B cells, nuclear extracts were obtained 30 min postinfection, at maximal NF-{kappa}B activation, and were incubated with Abs to specific Rel proteins. Addition of anti-p65 or anti-p50 Abs to nuclear extracts after interaction with the oligonucleotide sequence from the IL-6 gene reduced the intensity of the NF-{kappa}B complex and led to the formation of supershift bands of higher molecular masses (Fig. 2Go). By contrast, addition of Abs to c-Rel had no effect on the NF-{kappa}B complex and did not induce supershifts. When a preimmune antiserum was used as a control, it also did not affect the intensity of the NF-{kappa}B complex (not shown). Studies using the oligonucleotide from the IL-8 promoter sequence again resulted in a weaker band for the specific NF-{kappa}B complex. Addition of anti-p65 or anti-p50, but not anti-c-Rel, Abs almost eliminated the formation of the complex. Although a faint supershift was visible using anti-p65, it was difficult to demonstrate a supershift using anti-p50 because of the weak signal.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 2. Identification of HRV-16-induced moieties binding to the promoter regions of the IL-6 (left) and IL-8 (right) genes by EMSA. Nuclear protein extracts were prepared from uninfected and HRV-16-infected cells, and EMSAs were performed in the presence and absence of specific Abs (1 µg) to p65, p50, and c-Rel, members of the Rel protein family. The figure is representative of n = 3 experiments.

 
Given the consistent observation of weaker NF-{kappa}B complex formation with the oligonucleotide from the IL-8 promoter sequence, the ability of this oligonucleotide to bind to purified recombinant p50 protein was compared with those of oligonucleotides from the Ig{kappa} and IL-6 genes. As shown in Fig. 3Go, strong bands were observed when oligonucleotide sequences from the Ig{kappa} or IL-6 gene promoters were incubated with 1 and 3 ng of purified p50 protein. By contrast, bands of comparable intensities were only noted for the oligonucleotide from the IL-8 promoter when 10–30 ng of purified p50 protein was used, suggesting that the NF-{kappa}B recognition site from the IL-8 promoter is at least 10-fold less effective in binding p50 than the related sequences from the Ig{kappa} or IL-6 gene promoters.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 3. Relative affinity of recombinant p50 protein for NF-{kappa}B recognition sequences from the Ig{kappa} (left), IL-6 (center), and IL-8 genes (right), respectively. Recombinant p50 protein was incubated with each 32P-radiolabeled oligonucleotide sequence for 30 min, and EMSA was then performed. The figure is representative of n = 3 experiments.

 
Effect of a NO donor and budesonide on NF-{kappa}B induction in HRV-16-infected BEAS-2B cells

NO has been reported to inhibit TNF-{alpha}-induced NF-{kappa}B activation in endothelial cells via induction and stabilization of I{kappa}B{alpha} (27). Similarly, glucocorticoids have been reported to inhibit NF-{kappa}B activation in several cell types either by induction of I{kappa}B{alpha} (28, 29) or by direct inhibition of NF-{kappa}B binding to its cognate cis-element (30). Prior studies from our laboratory have shown that although both NO and the potent glucocorticoid, budesonide, inhibit HRV-16-induced production of IL-8 and IL-6 protein from BEAS-2B cells, they do not alter the ability of HRV-16 to induce mRNA for these cytokines (11). To determine whether this resulted from inherent resistance of HRV-16-induced NF-{kappa}B activation pathways to these agents, we studied the effects of budesonide, and of the NO donor, NONOate, on NF-{kappa}B complex formation in infected cells. Neither the NO donor nor budesonide inhibited HRV-16-induced activation of NF-{kappa}B in BEAS-2B cells, as assessed by binding to the oligonucleotide from the IL-6 gene promoter (Fig. 4Go). Similar results were obtained when the oligonucleotide from the IL-8 promoter sequence was used (data not shown).



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of the NO donor, NONOate (500 µM), and the glucocorticoid, budesonide (10-7 M), on NF-{kappa}B activation in BEAS-2B epithelial cells infected with HRV-16. Nuclear protein extracts were obtained from BEAS-2B cells 30 min after rhinovirus infection, or sham infection, and EMSA was performed using the 32P-radiolabeled oligonucleotide sequence from the IL-6 gene promoter. The figure is representative of n = 3 experiments.

 
Effect of sulfasalazine and calpain inhibitor I on HRV-16 induction of NF-{kappa}B, cytokine mRNA, and cytokine protein levels

To further define the relationship between HRV-16-induced NF-{kappa}B activation and production of IL-6 and IL-8 from BEAS-2B cells, we studied the effect of putative inhibitors of the NF-{kappa}B activation pathway on NF-{kappa}B activation, cytokine mRNA levels, and cytokine protein production. Sulfasalazine has been reported to inhibit NF-{kappa}B activation by interfering with phosphorylation of I{kappa}B{alpha} (31). In HRV-16-infected epithelial cells, sulfasalazine (2 mM) prevented activation of NF-{kappa}B, as assessed by binding to the oligonucleotides from both the IL-6 and IL-8 gene promoters (Fig. 5Go). Sulfasalazine also significantly inhibited HRV-16-induced IL-6 and IL-8 protein production. However, surprisingly, sulfasalazine had no effect on HRV-16-induced steady-state mRNA expression for IL-6 or IL-8 (Fig. 5Go).



View larger version (78K):
[in this window]
[in a new window]
 
FIGURE 5. Effects of sulfasalazine (2 mM) on activation of NF-{kappa}B and cytokine induction in BEAS-2B epithelial cells infected with HRV-16. Upper panels, Representative EMSA performed using nuclear protein extracts prepared from cells 30 min postinfection and 32P-radiolabeled oligonucleotide probes from the IL-6 (left) or IL-8 (right) gene promoters. Center panels, Representative Northern blots using cDNA probes for IL-6 (left), IL-8 (right), and GAPDH with mRNA prepared from cells 1 h postinfection. Data for upper and center panels are representative of n = 4 experiments. Lower panels, Mean + SEM (n = 4) of protein levels for IL-6 (left) and IL-8 (right) measured by ELISA at 4 h postinfection. Asterisks indicate significant inhibition compared with virus alone (p < 0.05).

 
Activation of NF-{kappa}B can also be blocked by inhibitors of proteosomal proteases, such as calpain inhibitor I (32). In three experiments, incubation of BEAS-2B cells with calpain inhibitor I (10 µM) also resulted in significant inhibition of NF-{kappa}B complex formation in HRV-16-infected cells (not shown), again without an effect on steady-state mRNA levels for IL-6 and IL-8. However, unlike sulfasalazine, calpain inhibitor I failed to inhibit HRV-16-induced IL-6 and IL-8 protein production (Fig. 6Go).



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 6. Effects of calpain inhibitor I (10 µM) on activation of NF-{kappa}B and cytokine induction in BEAS-2B epithelial cells infected with HRV-16. Upper panels, Northern blots for IL-6 (left), IL-8 (right), and GAPDH with mRNA prepared from cells 1 h postinfection. Lower panels, Protein levels for IL-6 (left) and IL-8 (right) measured by ELISA at 4 h postinfection. The figure is representative of n = 3 experiments.

 
Effect of sulfasalazine on HRV-16 induction of GM-CSF

The above data imply that, although NF-{kappa}B activation occurs as a consequence of HRV-16 infection of BEAS-2B cells, this transcription factor is not required for HRV-16-induced IL-6 or IL-8 gene expression in these cells. To substantiate this finding, we sought a positive control for a role of NF-{kappa}B in HRV-16-infected cells. We have previously reported that epithelial cells also produce GM-CSF in response to rhinovirus infection (8). In several cell types, GM-CSF transcription has also been reported to be at least partially dependent upon NF-{kappa}B activation (33, 34). In time course experiments, we established that expression of GM-CSF mRNA is also rapidly induced after HRV-16 infection, with maximal expression seen 1 h postinfection. However, in contrast to IL-8 and IL-6, mRNA expression and protein production for GM-CSF is sustained for a longer time period (Fig. 7Go). Given the rapid activation of NF-{kappa}B noted above, we examined the effects of sulfasalazine on mRNA expression of GM-CSF at 1 h postinfection and assayed protein levels at 4 h postinfection. In contrast to the results obtained above for IL-8 and IL-6, sulfasalazine clearly inhibited both HRV-induced mRNA and protein levels for GM-CSF (Fig. 8Go). Densitometric analysis showed that, on average, mRNA expression was reduced to 50% of that observed in the absence of sulfasalazine. Finally, as a control for interexperiment variation, a similar inhibition of GM-CSF gene expression was seen when the same blots used to demonstrate a lack of effect of sulfasalazine on IL-8 and IL-6 mRNA levels were subsequently stripped and probed for GM-CSF mRNA.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 7. Time course of GM-CSF induction from HRV-16-infected BEAS-2B cells. Upper panel, Northern blots for GM-CSF and for the housekeeping gene, GAPDH. Center panel, Densitometric ratio of the two signals; lower panel, Protein levels produced at each of the time points noted. The figure is representative of n = 4 experiments.

 


View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 8. Effects of sulfasalazine (2 mM) on GM-CSF production from HRV-16-infected BEAS-2B cells. Upper panel, Representative Northern blots for GM-CSF and GAPDH with mRNA prepared from cells 1 h postinfection. Lower panel, Mean + SEM (n = 4) of GM-CSF protein levels measured by ELISA at 4 h postinfection. Asterisks indicate significant inhibition compared with virus alone (p < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although the pathogenesis of rhinovirus infections is incompletely understood, several studies have shown that viral cytotoxicity of infected cells is unlikely to contribute significantly to the symptomatic response (8, 35, 36, 37). Rather, there is a growing belief that the inflammatory consequences of the host response to viral infection may play an important role in disease pathogenesis. Increased numbers of neutrophils and lymphocytes have been observed in nasal tissue and secretions of nonatopic subjects, whereas increased eosinophilia has been observed in the lower airways of asthmatic subjects during rhinovirus infections (36, 38, 39, 40). The ability of rhinovirus infection to induce the production of IL-8, IL-6, and GM-CSF from infected epithelial cells could contribute to these inflammatory cell responses. IL-8 is chemotactic for neutrophils and some subsets of lymphocytes and is a direct activator of neutrophils (41, 42), whereas IL-6 stimulates the proliferation and activation of T lymphocytes, and epithelial overexpression of IL-6 in transgenic mice leads to a marked lymphocytic infiltration of the airway (43, 44). GM-CSF has been shown to enhance the survival and activation of both eosinophils and neutrophils (45, 46, 47).

In our current studies, we have further confirmed that cytokine induction is a specific effect of viral infection. Filtrates of viral preparations containing proteins of <30 kDa molecular mass (most cytokines) did not induce IL-8 production. Moreover, as we have previously shown for HRV-14 (8), cytokine induction could be prevented by blockade of ICAM-1, the cell surface receptor for members of the major group of rhinoviruses. Inhibition by anti-ICAM-1 could be over-ridden when higher infectious doses of virus were used, consistent with our earlier observation that very little virus needs to enter a cell monolayer to trigger a productive infection (8). Given that incubation of epithelial cells with fixed neutrophils expressing LFA-1 did not induce cytokine production, it seems reasonable to assume that simple binding of virus to ICAM-1 is not adequate for cytokine induction and that additional steps in the viral infection process are necessary.

Induction of epithelial expression of IL-6 and IL-8 by HRV has been shown to be mediated primarily at the level of increased gene transcription (9, 18). Transcription of IL-6 and IL-8 induced in several cell types by other stimuli has been shown to be dependent upon activation of NF-{kappa}B, with maximal gene expression often requiring that NF-{kappa}B act in concert with other transcription factors, particularly NF-IL-6 or AP-1 (48, 49, 50). Although indirect evidence has been presented supporting a role of NF-{kappa}B in rhinovirus-induced transcription of IL-6 and IL-8 in epithelial cells, our current studies are the first to clearly demonstrate that induction of mRNA for these cytokines by HRV-16 occurs independent of NF-{kappa}B activation.

Our data confirm that HRV-16 infection of BEAS-2B cells does lead to a rapid activation of NF-{kappa}B, as assessed by EMSA using oligonucleotide probes representing the consensus NF-{kappa}B binding site from the Ig{kappa} gene, as well as the NF-{kappa}B binding sites from the IL-6 and IL-8 gene promoters. Activation was transient, with maximal NF-{kappa}B detected within 30 min postinfection, while levels returned to baseline within 3 h. This time course is similar to that reported for induction of NF-{kappa}B by HRV-14 in the A549 type II alveolar cell line (9). We have previously shown that HRV-16 infection of epithelial cells results in a rapid and transient increase in mRNA for IL-6 and IL-8, with maximal levels seen at 1 h postinfection. Thus, the time course of NF-{kappa}B activation supports the plausibility of transcriptional regulation of these cytokine genes by NF-{kappa}B during viral infection.

In examining NF-{kappa}B activation in our cells, we considered it important to use oligonucleotides containing the putative binding regions for this transcription factor from the promoter regions of the IL-6 and IL-8 genes. Although the IL-6 recognition sequence differs from the consensus sequence from the Ig{kappa} gene by only a single base pair substitution, the recognition sequence from the IL-8 gene promoter is somewhat atypical, containing both substitutions and a "frame shift" in the sequence, and may be expected to show some unique properties. NF-{kappa}B is actually the name given to a group of transcription factors that are comprised of dimers of members of the Rel family of proteins. The composition of NF-{kappa}B complexes binding to a specific gene promoter has been shown to depend primarily on the specific recognition sequence present in the promoter in question (51). It has been reported that the IL-8 promoter sequence in vitro binds optimally to p65-cRel heterodimers and does not bind p65-p50 heterodimers (52, 53). Our current data, using subunit specific Abs, clearly disagree with this premise and show that, in HRV-16-infected epithelial cells, p65 and p50 subunits, but not c-Rel, form the NF-{kappa}B activation complex that binds to both the IL-6 and IL-8 recognition sequences. However, our findings are in agreement with studies of NF-{kappa}B binding to IL-8 and IL-6 promoter sequences using nuclear extracts from the A549 alveolar epithelial cell line, where complexes also predominantly comprised p65 and p50 subunits (9, 18).

Interestingly, we noted that NF-{kappa}B complex formation using nuclear extracts from infected cells was consistently weaker with the oligonucleotide sequence from the IL-8 gene promoter than with oligonucleotides from the IL-6 or Ig{kappa} genes when compared under identical conditions. Given that the recognition sequence for another transcription factor, NF-IL-6, is located immediately adjacent to the NF-{kappa}B site in the IL-8 promoter and that these transcription factors have been reported to function in concert for optimal gene activation (48, 49), we tested the hypothesis that an oligonucleotide containing both sequences may bind NF-{kappa}B more efficiently. However, studies with this elongated oligonucleotide demonstrated no change in the intensity or pattern of NF-{kappa}B band complex formation on EMSA. When studies were performed to quantify the relative ability of recognition sequences from the different genes to bind to a recombinant p50 subunit of NF-{kappa}B, 10- to 30-fold more recombinant protein was required to form bands of comparable intensity with the oligonucleotide from the IL-8 gene promoter than was required with the oligonucleotides from the IL-6 or Ig{kappa} genes. This weaker binding presumably reflects the atypical sequence of the IL-8 gene binding motif, but was of interest given that epithelial cells generate higher levels of IL-8 in response to HRV-16 than of any other cytokine examined to date. Although there could be many other regulatory steps between transcription and protein release, this observation raised the first queries about the central role of NF-{kappa}B in the induction of IL-8 and IL-6 by HRV-16.

The major evidence supporting a role of NF-{kappa}B in the induction of epithelial expression of IL-8 and IL-6 by HRV has been derived from studies using transient transfection of cells with promoter-luciferase constructs (9, 18). Because studies using transient transfection with promoter constructs of limited length may not always accurately reflect endogenous gene responses in infected cells, we determined whether activation of NF-{kappa}B could be uncoupled from cytokine mRNA expression in HRV-16-infected epithelial cells by using pharmacologic interventions that may be expected to modulate NF-{kappa}B activation under our normal infection conditions. We have previously shown that NO is capable of inhibiting both the replication of HRV-16 in epithelial cells and the virally induced production of IL-6 and IL-8 protein. However, surprisingly, NO did not inhibit the induction of mRNA for these cytokines. Because NO has been reported to inhibit activation of NF-{kappa}B in endothelial cells by induction and stabilization of I{kappa}B{alpha} (27), we examined the effects of the NO donor, NONOate, on NF-{kappa}B in response to HRV-16 infection. In contrast to the data reported for endothelial cells, NO did not inhibit activation of NF-{kappa}B in HRV-16-infected cells, implying that the effects of NO on NF-{kappa}B activation are cell and/or stimulus specific. However, the failure of NO to inhibit either NF-{kappa}B activation or mRNA expression for IL-8 and IL-6 did not invalidate the potential role of NF-{kappa}B in gene transcription.

Glucocorticoids also have been shown to inhibit NF-{kappa}B activation in several cell types either by induction of I{kappa}B{alpha} (28, 29) or by direct inhibition of NF-{kappa}B binding to its cognate cis-element (30). In contrast to these reports, the potent glucocorticoid, budesonide, did not inhibit activation of NF-{kappa}B in HRV-16-infected epithelial cells. Interestingly, glucocorticoids have also been shown to have no effect on the activation of NF-{kappa}B in epithelial cells stimulated with IL-1ß (54). This lack of effect is not due to an impaired ability of these cells to respond to glucocorticoids, because this same dose of budesonide has been previously shown to optimally inhibit cytokine-induced production of RANTES from BEAS-2B cells (26). Moreover, we have shown that budesonide does partially inhibit the production of IL-8 and IL-6 from these cells at the protein level, but did not inhibit mRNA induction in response to HRV-16 infection (11). Therefore, these data again failed to uncouple activation of NF-{kappa}B from increased mRNA expression for IL-6 and IL-8.

However, dissociation of the activation of NF-{kappa}B and mRNA expression for IL-8 and IL-6 in HRV-16-infected epithelial cells was observed with sulfasalazine and calpain inhibitor I, drugs that are purported to be selective inhibitors of the NF-{kappa}B activation pathway. Sulfasalazine has been reported to inhibit NF-{kappa}B activation by interfering with phosphorylation of I{kappa}B{alpha} (31), whereas calpain inhibitor I inhibits proteosomal degradation of I{kappa}B (32). Both agents inhibited HRV-16-induced activation of NF-{kappa}B, preventing the formation of complexes with the oligonucleotides derived from both the IL-6 and IL-8 gene promoter sequences. By contrast, neither inhibitor had any effect on HRV-16-induced expression of mRNA for IL-6 or IL-8. The ability of sulfasalazine to decrease HRV-16-induced cytokine protein levels, an effect not observed with calpain inhibitor I, suggests that sulfasalazine may also have additional posttranscriptional actions and demonstrates the importance of examining both mRNA and protein levels before attributing transcriptional effects to NF-{kappa}B. There is precedent for sulfasalazine to have anti-inflammatory actions on cell function that are mediated at the posttranscriptional level and are independent of effects on NF-{kappa}B (55, 56). These data clearly show that activation of NF-{kappa}B is not absolutely essential for HRV-16-induced induction of IL-8 and IL-6 gene expression. Although these data appear to contradict published reports, this may relate primarily to differences in experimental techniques. Zhu and coworkers concluded that HRV-14-induced activation of NF-{kappa}B is essential for IL-6 and IL-8 induction in the A549 cell line (9, 18). These authors showed time courses for NF-{kappa}B activation and cytokine mRNA expression that were in good agreement to those reported in our current studies. However, the causative link between NF-{kappa}B activation and gene transcription was implied solely on the basis of transient transfection of cells with promoter constructs, which may not accurately reflect endogenous gene responses. By contrast, Bagioli and colleagues relied on evidence that incubation of BEAS-2B cells with a high concentration (20 mM) of N-acetyl cysteine inhibited both HRV-39-induced activation of NF-{kappa}B and production of IL-8 protein to imply a causative link, but mRNA levels were not examined (19). As noted from our own data with sulfasalazine, this could be a misleading conclusion if N-acetyl cysteine has any posttranscriptional effects in the cell.

Given the potentially controversial nature of our results, we sought to establish that sulfasalazine could inhibit both mRNA induction and protein levels in a gene for which activation is NF-{kappa}B dependent. We have already demonstrated that rhinovirus infection of epithelial cells leads to the production of GM-CSF, a cytokine whose promoter is known to be responsive to NF-{kappa}B (33, 34). In contrast to IL-8 and IL-6, which are rapidly and transiently induced by HRV-16 infection, expression of GM-CSF is rapid but more sustained. Given the transient induction of NF-{kappa}B, we focused on the early phase of GM-CSF production to determine whether a role of this transcription factor in HRV-16-induced expression of mRNA and protein could be established. EMSA using the NF-{kappa}B binding motif from the GM-CSF gene promoter were not performed given that we had already established that sulfasalazine inhibits binding of NF-{kappa}B to multiple other promoter sequences. Sulfasalazine not only inhibited the production of GM-CSF at the protein level, but also inhibited HRV-16-induced mRNA levels for this cytokine by ~50%. Given the known interaction of multiple transcription factors in transcription of the GM-CSF gene (34), it is not surprising that greater inhibition of mRNA levels were not seen.

In summary, our data confirm that rapid and transient activation of NF-{kappa}B occurs in epithelial cells infected with HRV-16. We demonstrate that this transcription factor plays a role in the early induction of GM-CSF that is observed in HRV-16-infected epithelial cells. By contrast, the rapid generation of IL-6 and IL-8 that is seen in HRV-16-infected epithelial cells is not dependent upon activation of NF-{kappa}B. Additional studies will be required to determine which factors are involved in rhinovirus-induced production of IL-6 and IL-8 from infected epithelial cells.


    Footnotes
 
1 This work was supported by Grants AI37163, HL61011, and AI41463 from the National Institutes of Health and by a grant from the Center for Indoor Air Research. Back

2 Address correspondence and reprint requests to Dr. David Proud, Johns Hopkins Asthma and Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224-6801. Back

3 Abbreviations used in this paper: HRV, human rhinovirus; NONOate, 3-(2-hydroxy-2-nitroso-1-propylhydrazino)-1-propanamine. Back

Received for publication July 22, 1999. Accepted for publication June 29, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gwaltney, J. M., J. O. Hendley, G. Simon, W. S. Jordan. 1966. Rhinovirus infections in an industrial population. I. The occurrence of illness. N. Engl. J. Med. 275:1261.
  2. Johnston, S. L., P. K. Pattemore, G. Sanderson, S. Smith, F. Lampe, L. Josephs, P. Sympington, S. O’Toole, S. H. Myint, D. A. Tyrrell, S. T. Holgate. 1995. Community study of role of viral infections in exacerbations of asthma in 9–11 year old children. Br. Med. J. 310:1225.[Abstract/Free Full Text]
  3. Nicholson, K. G., J. Kent, D. C. Ireland. 1993. Respiratory viruses and exacerbations of asthma in adults. Br. Med. J. 307:982.
  4. Jr Gwaltney, J. M., C. D. Philips, R. D. Miller, D. K. Riker. 1994. Computed tomographic study of the common cold. N. Engl. J. Med. 330:25.[Abstract/Free Full Text]
  5. Turner, B. W., W. S. Cail, J. O. Hendley, F. G. Hayden, W. J. Doyle, J. V. Sorrentino, Jr J. M. Gwaltney. 1992. Physiologic abnormalities of the paranasal sinuses during experimental rhinovirus colds. J. Allergy Clin. Immunol. 90:474.[Medline]
  6. Bardin, P. G., S. L. Johnston, G. Sanderson, S. Robinson, M. A. Pickett, D. J. Fraenkel, S. T. Holgate. 1994. Detection of rhinovirus infection of the nasal mucosa by oligonucleotide in situ hybridization. Am. J. Respir. Cell Mol. Biol. 10:207.[Abstract]
  7. Arruda, E., T. R. Boyle, B. Winther, D. C. Pevear, Jr J. M. Gwaltney, F. G. Hayden. 1995. Localization of human rhinovirus replication in the upper respiratory tract by in situ hybridization. J. Infect. Dis. 171:1329.[Medline]
  8. Subauste, M. C., D. B. Jacoby, S. M. Richards, D. Proud. 1995. Infection of a human respiratory epithelial cell line with rhinovirus: induction of cytokine release and modulation of susceptibility to infection by cytokine exposure. J. Clin. Invest. 96:549.
  9. Zhu, Z., W. Tang, A. Ray, Y. Wu, O. Einarsson, M. L. Landry, Jr J. M. Gwaltney, J. A. Elias. 1996. Rhinovirus stimulation of interleukin-6 in vivo and in vitro: evidence for nuclear factor {kappa}B-dependent transcriptional activation. J. Clin. Invest. 97:421.[Medline]
  10. Einarsson, O., G. P. Geba, Z. Zhu, M. Landry, J. A. Elias. 1996. Interleukin-11: stimulation in vivo and in vitro by respiratory viruses and induction airways hyperresponsiveness. J. Clin. Invest. 97:915.[Medline]
  11. Sanders, S. P., E. S. Siekierski, J. D. Porter, S. M. Richards, D. Proud. 1998. Nitric oxide inhibits rhinovirus-induced cytokine production and viral replication in a human respiratory epithelial cell line. J. Virol. 72:934.[Abstract/Free Full Text]
  12. Schroth, M. K., E. Grimm, P. Frindt, D. M. Galagan, S.-I. Konno, R. Love, J. E. Gern. 1999. Rhinovirus replication causes RANTES production in primary bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 20:1220.[Abstract/Free Full Text]
  13. Terajima, M., M. Yamaya, K. Sekizawa, S. Okinaga, T. Suzuki, N. Yamada, K. Nakayama, T. Ohrui, T. Oshima, Y. Numazaki, H. Sasaki. 1997. Rhinovirus infection of primary cultures of human tracheal epithelium: role of ICAM-1 and IL-1ß. Am. J. Physiol. 273:L749.[Abstract/Free Full Text]
  14. Proud, D., Jr J. M. Gwaltney, J. O. Hendley, C. A. Dinarello, S. Gillis, R. P. Schleimer. 1994. Increased levels of interleukin-1 are detected in nasal secretions of volunteers during experimental rhinovirus colds. J. Infect. Dis. 169:1007.[Medline]
  15. Grünberg, K., M. C. Timmers, H. H. Smits, E. P. A. de Klerk, E. C. Dick, W. J. M. Spaan, P. S. Hiemstra, P. J. Sterk. 1997. Effects of experimental rhinovirus 16 colds on airway hyperresponsiveness to histamine and interleukin-8 in nasal lavage in asthmatic subjects in vivo. Clin. Exp. Allergy 27:36.[Medline]
  16. Blackwell, T. S., J. W. Christman. 1997. The role of nuclear factor-{kappa}B in cytokine gene regulation. Am. J. Respir. Cell Mol. Biol. 17:3.[Abstract/Free Full Text]
  17. Jr Baldwin, A. S.. 1996. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
  18. Zhu, Z., W. Tang, Jr J. M. Gwaltney, Y. , Y. Wu, J. A. Elias. 1997. Rhinovirus stimulation of interleukin-8 in vivo and in vitro: role of NF-{kappa}B. Am. J. Physiol. 273:L814.
  19. Biagioli, M. C., P. Kaul, I. Singh, R. B. Turner. 1999. The role of oxidative stress in rhinovirus induced elaboration of IL-8 by respiratory epithelial cells. Free Radical Biol. Med. 26:454.[Medline]
  20. Sen, R., D. Baltimore. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705.[Medline]
  21. Reddel, R. R., Y. Ke, B. I. Gerwin, M. G. McMenamin, J. F. Lechner, R. T. Su, D. E. Brash, J.-B. Park, J. S. Rhim, C. C. Harris. 1988. Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes. Cancer Res. 48:1904.[Abstract/Free Full Text]
  22. Gern, J. E., R. Vrtis, E. A. B. Kelly, E. C. Dick, W. W. Busse. 1996. Rhinovirus produces nonspecific activation of lymphocytes through a monocyte-dependent mechanism. J. Immunol. 157:1605.[Abstract]
  23. Churchill, L., B. Friedman, R. P. Schleimer, D. Proud. 1992. Production of granulocyte-macrophage colony-stimulating factor by cultured human tracheal epithelial cells. Immunology 75:189.[Medline]
  24. Feinberg, A. P., B. Vogelstein. 1983. A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6.[Medline]
  25. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  26. Stellato, C., L. A. Beck, G. A. Gorgone, D. Proud, T. J. Schall, S. J. Ono, L. M. Lichtenstein, R. P. Schleimer. 1995. Expression of the chemokine RANTES by a human bronchial epithelial cell line: modulation by cytokines and glucocorticoids. J. Immunol. 155:410.[Abstract]
  27. Peng, H.-B., P. Libby, J. K. Liao. 1995. Induction and stabilization of I{kappa}B{alpha} by nitric oxide mediates inhibition of NF-{kappa}B. J. Biol. Chem. 270:14214.[Abstract/Free Full Text]
  28. Scheinman, R. I., P. C. Cogswell, A. K. Lofquist, Jr A. S. Baldwin. 1995. Role of transcriptional activation of I{kappa}B{alpha} in mediation of immunosuppression by glucocorticoids. Science 270:283.[Abstract/Free Full Text]
  29. Auphan, N., J. A. DiDonato, C. Rosette, A. Helmberg, M. Karin. 1995. Immunosuppression by glucocorticoids: inhibition of NF-{kappa}B activity through induction of I{kappa}B synthesis. Science 270:286.[Abstract/Free Full Text]
  30. Mukaida, N., M. Morita, Y. Ishikawa, N. Rice, S. Okamoto, T. Kasahara, K. Matsushima. 1994. Novel mechanism of glucocorticoid-mediated gene repression: nuclear factor-{kappa}B is target for glucocorticoid-mediated interleukin-8 gene repression. J. Biol. Chem. 269:13289.[Abstract/Free Full Text]
  31. Wahl, C., S. Liptay, G. Adler, R. M. Schmid. 1998. Sulfasalazine: a potent and specific inhibitor of nuclear factor {kappa}B. J. Clin. Invest. 101:1163.[Medline]
  32. Griscavage, J. M., S. Wilk, L. J. Ignarro. 1996. Inhibitors of the proteosome pathway interfere with induction of nitric oxide synthase in macrophages by blocking activation of transcription factor NF-{kappa}B. Proc. Natl. Acad. Sci. USA 93:3308.[Abstract/Free Full Text]
  33. Musso, M., P. Ghiorzo, P. Fiorentini, R. Giuffrida, P. Ciotti, C. Garre, R. Ravazzolo, G. Bianchi-Scarra. 1996. An upstream positive regulatory element in human GM-CSF promoter is recognized by NF-{kappa}B/Rel family members. Biochem. Biophys. Res. Commun. 223:64.[Medline]
  34. Thomas, R. S., M. J. Tymms, L. H. McKinlay, M. F. Shannon, A. Seth, I. Kola. 1997. ETS1, NF{kappa}B and AP1 synergistically transactivate the human GM-CSF promoter. Oncogene 14:2845.[Medline]
  35. Winther, B., S. Brofeldt, B. Christensen, N. Mygind. 1984. Light and scanning electron microscopy of nasal biopsy material from patients with naturally acquired common colds. Acta. Otolaryngol. 97:309.[Medline]
  36. Winther, B., B. Farr, R. B. Turner, J. O. Hendley, Jr J. M. Gwaltney, N. Mygind. 1984. Histopathologic examination and enumeration of polymorphonuclear leukocytes in the nasal mucosa during experimental rhinovirus colds. Acta. Otolaryngol. Suppl. 413:19.[Medline]
  37. Winther, B., J. M. Gwaltney, J. O. Hendley. 1990. Respiratory virus infection of monolayer cultures of human nasal epithelial cells. Am. Rev. Respir. Dis. 141:839.[Medline]
  38. Levandowski, R. A., C. W. Weaver, G. G. Jackson. 1988. Nasal secretion leukocyte populations determined by flow cytometry during acute rhinovirus infection. J. Med. Virol. 25:423.[Medline]
  39. Naclerio, R. M., D. Proud, L. M. Lichtenstein, A. Kagey-Sobotka, J. O. Hendley, J. Sorrentino, J. M. Gwaltney. 1988. Kinins are generated during experimental rhinovirus colds. J. Infect. Dis. 157:133.[Medline]
  40. Fraenkel, D. J., P. G. Bardin, G. Sanderson, F. Lampe, S. L. Johnston, S. T. Holgate. 1995. Lower airways inflammation during rhinovirus colds in normal and asthmatic subjects. Am. J. Respir. Crit. Care Med. 151:879.[Abstract]
  41. Leonard, E. J., T. Yoshimura. 1990. Neutrophil attractant/activation protein-1 (NAP-1 [interleukin-8]). Am. J. Respir. Cell Mol. Biol. 2:479.
  42. Larsen, C. G., A. O. Anderson, E. Appella, J. J. Oppenheim, K. Matsushima. 1989. The neutrophil activating protein (NAP-1) is also chemotactic for T lymphocytes. Science 243:1464.[Abstract/Free Full Text]
  43. Haussiau, F. A., P. G. Caulie, J. Van Snick. 1989. Distinct roles of IL-1 and IL-6 in human T cell activation. J. Immunol. 143:2520.[Abstract]
  44. DiCosmo, B. F., G. P. Geba, D. Picarella, J. A. Elias, J. A. Rankin, B. R. Stripp, J. A. Whitsett, R. A. Flavell. 1994. Airway epithelial cell expression of interleukin-6 in transgenic mice: uncoupling of airway inflammation and bronchial hyperreactivity. J. Clin. Invest. 94:2028.
  45. Jr Owen, W. F., M. E. , D. S. Rothenberg, J. C. Silberstein, R. L. Gasson, R. L. Stevens, K. F. Austen. 1987. Regulation of human eosinophil viability, density, and function by granulocyte/macrophage colony-stimulating factor in the presence of 3T3 fibroblasts. J. Exp. Med. 166:129.[Abstract/Free Full Text]
  46. Cox, G., J. Gauldie, M. Jordana. 1992. Bronchial epithelial cell-derived cytokines (G-CSF and GM-CSF) promote the survival of peripheral blood neutrophils in vitro. Am. J. Respir. Cell. Mol. Biol. 7:507.
  47. Lopez, A. F., D. J. Williamson, J. R. Gamble, C. G. Begley, J. M. Harlan, S. J. Klebanoff, A. Waltersdorph, G. Wong, S. C. Clark, M. A. Vadas. 1986. Recombinant human granulocyte-macrophage colony-stimulating factor stimulates in vitro mature human neutrophil and eosinophil function, surface receptor expression, and survival. J. Clin. Invest. 78:1220.
  48. Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto, S. Akira. 1993. Transcription factors NF-IL6 and NF-{kappa}B synergistically activate transcription of the inflammatory cytokines, interleukin-6 and interleukin-8. Proc. Natl. Acad. Sci. USA 90:10193.[Abstract/Free Full Text]
  49. Kunsch, C., R. K. Lang, C. A. Rosen, M. F. Shannon. 1994. Synergistic transcriptional activation of the IL-8 gene by NF-{kappa}B p65 (RelA) and NF-IL-6. J. Immunol. 153:153.[Abstract]
  50. Yasumoto, K., S.-I. Okamoto, N. Mukaida, S. Murakami, M. Mai, K. Matsushima. 1992. Tumor necrosis factor {alpha} and interferon {gamma} synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-{kappa}B-like binding sites of the interleukin 8 gene. J. Biol. Chem. 267:22506.[Abstract/Free Full Text]
  51. Kunsch, C., S. M. Ruben, C. R. Rosen. 1992. Selection of optimal {kappa}B/Rel DNA-binding motifs: interaction of both subunits of NF-{kappa}B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412.[Abstract/Free Full Text]
  52. Kunsch, C., C. A. Rosen. 1993. NF-{kappa}B subunit-specific regulation of the IL-8 promoter. Mol. Cell. Biol. 13:6137.[Abstract/Free Full Text]
  53. Parry, G. C. N., N. Mackman. 1994. A set of inducible genes expressed by activated human monocytic and endothelial cells contain {kappa}B-like sites that specifically bind c-Rel-p65 heterodimers. J. Biol. Chem. 269:20823.[Abstract/Free Full Text]
  54. Newton, R., L. A. Hart, D. A. Stevens, M. Bergmann, L. E. Donnelly, I. M. Adcock, P. J. Barnes. 1998. Effect of dexamethasone on interleukin-1ß (IL-1ß)-induced nuclear factor-{kappa}B (NF-{kappa}B) and {kappa}B-dependent transcription in epithelial cells. Eur. J. Biochem. 251:81.[Medline]
  55. Pruzanski, W., E. Stefanski, P. Vadas, N. S. Ramamurthy. 1997. Inhibition of extracellular release of proinflammatory secretory phospholipase A2 (sPLA2) by sulfasalazine: a novel mechanism of anti-inflammatory activity. Biochem. Pharmacol. 53:1901.[Medline]
  56. Cronstein, B. N., M. C. Montesinos, G. Weissmann. 1999. Salicylates and sulfasalazine, but not glucocorticoids, inhibit leukocyte accumulation by an adenosine-dependent mechanisms that is independent of inhibition of prostaglandin synthesis and p105 of NF{kappa}B. Proc. Natl. Acad. Sci. USA 96:6377.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. S. Zaheer, R. Koetzler, N. S. Holden, S. Wiehler, and D. Proud
Selective Transcriptional Down-Regulation of Human Rhinovirus-Induced Production of CXCL10 from Airway Epithelial Cells via the MEK1 Pathway
J. Immunol., April 15, 2009; 182(8): 4854 - 4864.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Edwards, J. Haas, R. A. Panettieri Jr., M. Johnson, and S. L. Johnston
Corticosteroids and beta2 Agonists Differentially Regulate Rhinovirus-induced Interleukin-6 via Distinct Cis-acting Elements
J. Biol. Chem., May 25, 2007; 282(21): 15366 - 15375.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
U. S. Sajjan, Y. Jia, D. C. Newcomb, J. K. Bentley, N. W. Lukacs, J. J. LiPuma, and M. B. Hershenson
H. influenzae potentiates airway epithelial cell responses to rhinovirus by increasing ICAM-1 and TLR3 expression
FASEB J, October 1, 2006; 20(12): 2121 - 2123.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
V. Laza-Stanca, L. A. Stanciu, S. D. Message, M. R. Edwards, J. E. Gern, and S. L. Johnston
Rhinovirus Replication in Human Macrophages Induces NF-{kappa}B-Dependent Tumor Necrosis Factor Alpha Production.
J. Virol., August 1, 2006; 80(16): 8248 - 8258.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Peng, S. Kotla, R. E. Bumgarner, and K. E. Gustin
Human rhinovirus attenuates the type I interferon response by disrupting activation of interferon regulatory factor 3.
J. Virol., May 1, 2006; 80(10): 5021 - 5031.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. R. Edwards, M. W. Johnson, and S. L. Johnston
Combination Therapy: Synergistic Suppression of Virus-Induced Chemokines in Airway Epithelial Cells
Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 616 - 624.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Chen, E. Hamati, P.-K. Lee, W.-M. Lee, S. Wachi, D. Schnurr, S. Yagi, G. Dolganov, H. Boushey, P. Avila, et al.
Rhinovirus Induces Airway Epithelial Gene Expression through Double-Stranded RNA and IFN-Dependent Pathways
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 192 - 203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. C. Newcomb, U. Sajjan, S. Nanua, Y. Jia, A. M. Goldsmith, J. K. Bentley, and M. B. Hershenson
Phosphatidylinositol 3-Kinase Is Required for Rhinovirus-induced Airway Epithelial Cell Interleukin-8 Expression
J. Biol. Chem., November 4, 2005; 280(44): 36952 - 36961.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. A. Hewson, A. Jardine, M. R. Edwards, V. Laza-Stanca, and S. L. Johnston
Toll-Like Receptor 3 Is Induced by and Mediates Antiviral Activity against Rhinovirus Infection of Human Bronchial Epithelial Cells
J. Virol., October 1, 2005; 79(19): 12273 - 12279.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
S. L. Johnston
Overview of Virus-induced Airway Disease
Proceedings of the ATS, August 1, 2005; 2(2): 150 - 156.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. C. L. Spurrell, S. Wiehler, R. S. Zaheer, S. P. Sanders, and D. Proud
Human airway epithelial cells produce IP-10 (CXCL10) in vitro and in vivo upon rhinovirus infection
Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L85 - L95.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. J. Hall, M. E. Bates, L. Guar, M. Cronan, N. Korpi, and P. J. Bertics
The Role of p38 MAPK in Rhinovirus-Induced Monocyte Chemoattractant Protein-1 Production by Monocytic-Lineage Cells
J. Immunol., June 15, 2005; 174(12): 8056 - 8063.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. G. Cosio, B. Mann, K. Ito, E. Jazrawi, P. J. Barnes, K. F. Chung, and I. M. Adcock
Histone Acetylase and Deacetylase Activity in Alveolar Macrophages and Blood Mononocytes in Asthma
Am. J. Respir. Crit. Care Med., July 15, 2004; 170(2): 141 - 147.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Proud, S. P. Sanders, and S. Wiehler
Human Rhinovirus Infection Induces Airway Epithelial Cell Production of Human {beta}-Defensin 2 Both In Vitro and In Vivo
J. Immunol., April 1, 2004; 172(7): 4637 - 4645.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
I S Patel
Viral regulation of inflammatory cytokines in epithelial cells: an alternative signalling pathway
Thorax, December 1, 2003; 58(12): 1019 - 1019.
[Full Text]


Home page
J. Immunol.Home page
T. R. Meusel and F. Imani
Viral Induction of Inflammatory Cytokines in Human Epithelial Cells Follows a p38 Mitogen-Activated Protein Kinase-Dependent but NF-{kappa}B-Independent Pathway
J. Immunol., October 1, 2003; 171(7): 3768 - 3774.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. Zhou, A. Tan, S. Iasvovskaia, J. Li, A. Lin, and M. B. Hershenson
Ras and Mitogen-Activated Protein Kinase Kinase Kinase-1 Coregulate Activator Protein-1- and Nuclear Factor-{kappa}B-Mediated Gene Expression in Airway Epithelial Cells
Am. J. Respir. Cell Mol. Biol., June 1, 2003; 28(6): 762 - 769.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
P.G. Gibson, P.A.B. Wark, J.L. Simpson, C. Meldrum, S. Meldrum, N. Saltos, and M. Boyle
Induced sputum IL-8 gene expression, neutrophil influx and MMP-9 in allergic bronchopulmonary aspergillosis
Eur. Respir. J., April 1, 2003; 21(4): 582 - 588.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes
Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. K. Sarady, S. L. Otterbein, F. Liu, L. E. Otterbein, and A. M. K. Choi
Carbon Monoxide Modulates Endotoxin-Induced Production of Granulocyte Macrophage Colony-Stimulating Factor in Macrophages
Am. J. Respir. Cell Mol. Biol., December 1, 2002; 27(6): 739 - 745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. P. Sanders, J. Kim, K. Ryan Connolly, J. D. Porter, E. S. Siekierski, and D. Proud
Nitric Oxide Inhibits Rhinovirus-Induced Granulocyte Macrophage Colony-Stimulating Factor Production in Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol., March 1, 2001; 24(3): 317 - 325.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, J.
Right arrow Articles by Proud, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J.
Right arrow Articles by Proud, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS