| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B in Cytokine Production Induced from Human Airway Epithelial Cells by Rhinovirus Infection1
Divisions of
*
Clinical Immunology and
Pulmonary and Critical Care Medicine, Department of Medicine, and
Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins University School of Medicine, Baltimore, MD 21224
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B in
HRV-16-induced IL-8 and IL-6 production by EMSA using oligonucleotides
corresponding to the binding sites for NF-B in the IL-6 and IL-8
gene promoters. Consistent with the rapid induction of mRNA for IL-8
and IL-6, maximal NF-B binding to both oligonucleotides was detected
at 30 min after infection. NF-B complexes contained p65 and p50, but
not c-Rel. The IL-8 oligonucleotide bound recombinant p50 with only
about one-tenth the efficiency of the IL-6 oligonucleotide, even though
epithelial cells produced more IL-8 protein than IL-6. Neither the
potent glucocorticoid, budesonide (10-7 M), nor a NO donor
inhibited NF-B binding to either cytokine promoter or induction of
mRNA for either IL-8 or IL-6. Sulfasalazine and calpain inhibitor I,
inhibitors of NF-B activation, blocked HRV-16-induced formation of
NF-B complexes with oligonucleotides from both cytokines, but did
not inhibit mRNA induction for either cytokine. By contrast,
sulfasalazine clearly inhibited HRV-16 induction of mRNA for GM-CSF in
the same cells. Thus, HRV-16 induces epithelial expression of IL-8 and
IL-6 by an NF-B-independent pathway, whereas induction of GM-CSF is
at least partially dependent upon NF-B
activation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The airway epithelial cell is the primary site of rhinovirus infection (6, 7), and there is growing evidence that virally induced alterations of epithelial cell biochemistry may be an initiating event in the pathogenesis of rhinovirus infections. Studies with several epithelial cell lines, as well as with cultured primary epithelial cells, have shown that in vitro infection with rhinovirus induces secretion of several cytokines and chemokines, including IL-8, IL-6, GM-CSF, IL-11, IL-1, and RANTES (8, 9, 10, 11, 12, 13). Moreover, several of these cytokines have also been detected in nasal secretions during experimental in vivo rhinovirus infections (9, 10, 14, 15). Given that several of these cytokines can serve as chemoattractants for, and/or activators of, inflammatory cells, it is attractive to suggest that cytokine production by infected epithelial cells may serve to orchestrate the local inflammatory response to rhinovirus infection in a manner that leads to symptom induction.
Activation of the transcription factor, NF-B, has been shown to play
an important role in the enhanced expression of several cytokine genes,
including IL-8, IL-6, and GM-CSF, that is observed in various cell
types upon stimulation with agonists such as IL-1 and TNF-
(16). In some cases, maximal gene expression requires that
NF-B acts in concert with other transcription factors (16, 17). Recent studies have suggested that activation of NF-B
may also play a role in rhinovirus-induced epithelial expression of
IL-6 and IL-8 (9, 18, 19). These studies were undertaken
to further explore the potential role of NF-B in rhinovirus-induced
cytokine production from epithelial cells. Because of our previous data
demonstrating that the BEAS-2B bronchial epithelial cell line responds
to rhinovirus infection in a manner similar to primary epithelial cells
with a rapid and robust generation of IL-8, IL-6, and GM-CSF (8, 11), we chose to conduct our studies using this cell line. We
used oligonucleotides corresponding to the NF-B binding sites in the
promoters of the IL-6 and IL-8 genes, as well as the consensus sequence
originally described from the Ig gene (20), to examine
the time course of NF-B activation in cells infected with partially
purified human rhinovirus
(HRV)3-16, relative to
the time course of cytokine mRNA induction. The relative affinity of
the various oligonucleotides for NF-B was also examined. Finally, we
also evaluated the effects of pharmacologic interventions purported to
selectively inhibit NF-B activation on the binding of NF-B to
cytokine promoter oligonucleotides, as well as on cytokine mRNA and
protein levels. Our data clearly confirm that rhinovirus infection of
epithelial cells activates NF-B but suggest that this transcription
factor is not required for HRV-16 induction of mRNA for IL-6 or IL-8.
By contrast, the increased epithelial expression of mRNA for GM-CSF
observed upon HRV-16 infection is reduced when NF-B activation is
inhibited.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The following reagents were purchased from the indicated
suppliers: HRV-16 and WI-38 cells (American Type Culture Collection,
Manassas, VA); DMEM, Eagle’s minimal essential medium (EMEM), Ham’s
F-12 medium, HBSS, L-glutamine,
penicillin-streptomycin-amphotericin B (Fungizone), trace elements,
growth factor, and endothelial cell growth supplement (Collaborative
Research, Bedford, MA); FBS (Gemini Biological Products, Calabasas,
CA); transferrin, insulin,
N,N,N',N'-tetramethylethylenediamine
(TEMED), acrylamide,
N,N'-methylene-bis-acrylamide, and ammonium
persulfate (Life Technologies, Grand Island, NY);
3-(2-hydroxy-2-nitroso-1-propylhydrazino)-1-propanamine (NONOate;
Cayman Chemical, Ann Arbor, MI); RNAzol B (Tel-Test, Friendswood, TX);
agarose (FMC Bioproducts, Rockland, ME); MOPS, DNA Polymerase I (Klenow
fragment), PMSF (Boehringer Mannheim, Indianapolis, IN);
[-32P]dCTP, poly(dI-dC), oligolabeling kit
(Amersham-Pharmacia Biotech, Arlington Heights, IL); anti-p65 Ab,
anti-p50 Ab, and anti-c-Rel Ab (Santa Cruz Biotechnologies,
Santa Cruz, CA); recombinant p50 protein (Promega, Madison, WI);
Calpain inhibitor I (Calbiochem, San Diego, CA). All other chemicals
were purchased from Sigma (St. Louis, MO). Budesonide was provided by
Per Andersson and Ralph Brattsand (Astra Pharmaceuticals, Lund,
Sweden).
Epithelial cell culture and viral infection
The BEAS-2B cell line (21) was provided by Dr. Curtis Harris (National Cancer Institute, Bethesda, MD). Cells were grown in culture medium consisting of Ham’s F-12 nutrient medium with penicillin (100 U/ml), streptomycin (100 U/ml), Fungizone (250 ng/ml), L-glutamine (2 mM), phosphoethanolamine/ethanolamine (0.5 mM), transferrin (10 µg/ml), endothelial cell growth supplement (3.75 µg/ml), epidermal growth factor (12.5 ng/ml), insulin (5 µg/ml), hydrocortisone (10-7 M), cholera toxin (10 ng/ml), 3,3',5-triodothyronine (3 x 10-9 M), retinoic acid (0.1 ng/ml), and trace elements. This medium is hereafter referred to as F12/10X. The cells were incubated at 37°C in 95% air and 5% CO2 and were used between passages 35 and 50.
HRV-16 was propagated in WI-38 cells as previously described (8). The HRV-16 stock generated in this manner was purified to remove ribosomes and soluble factors of WI-38 origin by centrifugation through sucrose, according to published methods (22). For infection, monolayers of BEAS-2B cells (80–90% confluent) were washed three times with HBSS. HRV-16 was added to the cells at concentrations of 104–105 TCID50 U/ml HBSS. The cells were incubated with the virus at 34°C for 1 h, washed three times with F12/10X, and then fresh F12/10X medium was added to the cells. This was referred to as time zero for the experiments described. Nuclear proteins or cellular RNA were then harvested at appropriate times, and the level of cytokine protein was assayed in supernatants collected from the above cells. This protocol was modified slightly for studies of GM-CSF. We have previously reported that production of GM-CSF by primary epithelial cells is extremely sensitive to inhibition by glucocorticoids (23). Because preliminary studies confirmed that HRV-16-induced production of GM-CSF from BEAS-2B cells was also sensitive to glucocorticoids, cell monolayers were placed for 24 h in medium from which hydrocortisone was omitted (F12/9X) before being used in experiments. Moreover, after infection, incubations were also performed in F12/9X.
To further confirm that cytokine induction from BEAS-2B cells by purified virus preparations was due to viral infection, and not to any residual soluble factors from WI-38 cells, two approaches were used. First, viral preparations were subjected to ultrafiltration by centrifugation through Centricon membranes with a 30-kDa molecular mass cutoff (Amicon, Beverly, MA). Both the filtrate, which should contain the same concentration of most known cytokines as the original preparation, and the concentrated retentate were then compared with the original preparation for their ability to generate cytokines. Second, BEAS-2B cell cultures were preincubated with 20 µg/ml of mouse-blocking mAb to human ICAM-1 (84H10; Coulter-Immunotech, Miami, FL), or with a class-matched control Ab, as previously described (8). Cells were then exposed to varying doses of HRV-16, and cytokine production was assessed. Medium was recovered 4 h after infection and assayed for IL-8.
Extraction of nuclear proteins
For each treatment condition, two 75-cm2
tissue culture flasks, each containing monolayers of 
1 x
107 BEAS-2B cells, were treated with ice-cold PBS
and scraped. The cell suspension was centrifuged at 1200 x
g at 4°C for 8 min. The cell pellets were combined and
lysed by resuspension in 100 µl of lysis buffer (10 mM HEPES, pH 7.9,
60 mM KCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5% Nonidet P-40). A
10-µl aliquot was removed and mixed with an equal volume of trypan
blue and examined under x40 microscopy to confirm the presence of
round, intact nuclei. The remainder of the suspension was centrifuged
again. The nuclear pellet was washed with lysis buffer without Nonidet
P-40 and centrifuged at 1200 x g at 4°C for 5 min.
The pellet was resuspended in 100 µl of nuclear resuspension buffer
(25 mM Tris-HCl, pH 8.0, 400 mM KCl, 1 mM DTT, 1 mM PMSF, and 20% w/v
glycerol), rapidly frozen and thawed three times, and centrifuged at
4000 x g at 4°C for 12 min. The supernatant
containing nuclear proteins was removed, and an aliquot was used for
protein determination using the Bio-Rad protein assay kit (Richmond,
CA) adapted for microtiter plates. The remainder of the nuclear protein
extract was frozen at -80°C until used.
EMSA
Oligonucleotide DNA sequences (100 ng) were synthesized by
Genosys Biotechnologies (The Woodlands, TX) and were radiolabeled by
random priming (24) using 6 U of DNA Polymerase I (Klenow
fragment), [-32P]dCTP (50 µCi), and 10
µl of Pharmacia reaction mix (containing dATP, dTTP, dGTP, and random
hexadeoxyribonucleotides) in a 50-µl final volume of 10 mM Tris-EDTA
pH 8.0 at 37°C for 60 min. The radiolabeled probes were isolated from
Sephadex G-50 minicolumns (Pharmacia) by centrifugation at 800 x
g for 2 min.
The oligonucleotide sequences used were are follows:
AGTTGAGGGGACTTTCCCAGGC, containing the NF-B binding site in the
promoter of the Ig gene; AAATGTGGGATTTTCCCATGAG, containing the
NF-B binding sequence from the IL-6 gene promoter;
AATCGTGGAATTTCCTCTGACA, containing the NF-B binding sequence from
the IL-8 gene promoter; and GCCATCAGTTGCAAATCGTGGAATTTCCTCTGACA,
the sequence from the IL-8 gene promoter that contains both the NF-B
and the adjacent NF-IL-6 binding sites.
Extracts of nuclear proteins (200 ng) were incubated with 2 ng of the
appropriate -32P-labeled oligonucleotide
(50,000–100,000 cpm/µl) and 1 µg of poly(dI-dC) in 10 µl of
binding buffer (10 mM Tris-HCl, pH 7.4, 10% w/v glycerol, and 65 mM
KCl) for 30 min at 25°C. For experiments using recombinant p50
protein instead of nuclear extracts, the reaction mixture also
contained 0.1 µg of BSA. For supershift experiments, antisera were
added and the reaction mixture was incubated for an additional 10 min
at 25°C. Electrophoresis was conducted in 5% polyacrylamide gels
using 0.045 M Tris-borate/0.001 M EDTA, pH 8.0 buffer. The gel was
fixed in 10% acetic acid/10% ethanol for 10 min and dried before
exposure to x-ray film (Biomax; Kodak, Rochester, NY).
RNA extraction and Northern analysis
Total cellular RNA was extracted from BEAS-2B cells as previously described (11) using RNAzol B (1 ml/10 cm2) in a modification of the method of Chomczynski and Sacchi (25). The integrity of each RNA sample was assessed by electrophoresis of an aliquot (0.5 µg) on a 1% agarose gel with 0.5 µg ethidium bromide/ml buffer. RNA was stored at -80°C.
Full-length cDNAs for IL-6 and GM-CSF were provided by Steven Gillis (Immunex, Seattle, WA). The full-length cDNA for IL-8 was obtained by RT-PCR as previously described (11). Full-length cDNA for GAPDH was purchased from Clontech (Palo Alto, CA). Probes were labeled to a high specific activity by the random primer method (24). Unincorporated nucleotides were separated using Sephadex G-50 minicolumns (Pharmacia) by centrifugation at 800 x g for 2 min.
Northern analysis was performed as previously described (11). Films were routinely developed for varying times to ensure that band intensities assessed by densitometry were within the linear range for the film. Densitometry was performed using a scanning densitometer (UVP gel documentation system; Ultraviolet Products, San Gabriel, CA), and densitometric analysis was performed using NIH Image software.
Quantification of cytokines
Levels of cytokines in cell supernatants were determined using specific ELISAs. Measurements of IL-8 were performed using a previously described ELISA sensitive to 30 pg/ml of cytokine (8). Levels of IL-6 were assayed using a commercial kit sensitive to 15 pg of IL-6/ml (Biosource International, Camarillo, CA), whereas GM-CSF was quantified using a commercial ELISA sensitive to 7.8 pg of GM-CSF/ml (R&D Systems, Minneapolis, MN). Neither the culture medium nor any of the drugs (or vehicles) used in our experiments caused any nonspecific interference effects in any of the assays.
Effects of drugs on NF-B activation and cytokine induction
Budesonide was prepared as a 10-2 M stock
solution in DMSO. Because the BEAS-2B cells are usually maintained in
growth medium containing low levels of hydrocortisone, the cells for
these experiments were placed in medium without hydrocortisone for
24 h before treatment with the glucocorticoid. Cells were then
treated with 10-7 M budesonide or appropriately
diluted vehicle control for 24 h before viral infection.
Budesonide was again included in the medium after viral infection. The
concentration of budesonide used was selected because previously it has
been shown to maximally inhibit TNF-induced RANTES production from
BEAS-2B cells (26).
NONOate was prepared in alkaline solution (0.01 M NaOH) as a 100-mM stock solution, which was kept at 4°C until use. New stock solutions of NONOate were prepared for each experiment and used within 1 h of preparation. The defined half-life of NO release from NONOate is 76 min at pH 7.4 and 22°C (Cayman Chemical). Under alkaline conditions, the NONOate does not release NO. NONOate was added at a final concentration of 500 µM both to the HBSS solution during virus exposure and to the medium following the virus exposure.
Sulfasalazine (2 mM), calpain inhibitor I (10 µM), or appropriate vehicle controls were added to cell culture medium for 2 h before viral exposure. The drugs were also added to the HBSS during viral exposure and to the medium added to the cells after infection.
For all drug interventions, doses were tested to ensure that there was no effect on cell viability. Nuclear protein extracts and cellular RNA were prepared, and cell supernatants were removed, at times after viral infection that were optimal for each parameter. That is, 30 min postinfection for nuclear extracts, 1 h postinfection for RNA isolation, and 4 h postinfection for protein analysis.
Statistical analysis
Data are expressed as the mean ± SEM. The effects of drugs on RNA expression and protein secretion were compared using the Student’s t test for paired samples. Differences were considered significant for values of p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As we have previously reported, infection of BEAS-2B cells with a
purified preparation of HRV-16 results in induction of IL-8 and IL-6
release. Maximal induction of mRNA for both IL-6 and IL-8 occurs within
1 h postinfection of BEAS-2B cells with HRV-16, with maximal
protein release occurring within 4–6 h postinfection
(11). Although cells always release more IL-8 than IL-6,
absolute levels of cytokines produced vary markedly with passage
number. Specifically, levels of cytokines decrease with increasing
passage number in culture (11). To further confirm that
cytokine induction was indeed due to viral infection, and not to some
soluble product of WI-38 cells that could have copurified with the
virus, two approaches were used. First, a 2-ml volume of each of two
different viral preparations was subjected to ultrafiltration by
centrifugation through Centricon membranes with a 30-kDa molecular mass
cutoff. When 1 ml of each sample had passed through the filter, both
the 2-fold concentrated retentate and the filtrate were used to
"infect" BEAS-2B cells, and the responses were compared with those
of the original viral preparations. The first viral preparation
released 320 pg/ml of IL-8, whereas the concentrated retentate released
620 pg/ml. Similar data were seen for the second viral preparation (150
pg/ml) and retentate (280 pg/ml). However, in both cases, the filtrate
released absolutely no IL-8. These data were consistent with the
specific role of virus but could not exclude a role for soluble factors
of >30 kDa molecular mass. Therefore, we also examined the effect of
preincubation of BEAS-2B cells with a blocking mAb to ICAM-1, the cell
surface receptor for HRV-16. At an infectious dose of
104 TCID50 of HRV-16,
complete inhibition of IL-8 production was seen (155 pg/ml produced
with control Ab vs 0 pg/ml using anti-ICAM-1). At a higher
infectious dose (3 x 104
TCID50), partial inhibition was observed
(470–230 pg/ml). These data are consistent with our earlier
observation that very little virus is necessary to begin a productive
infection (8). Given that viral binding to ICAM-1 is
essential for cytokine induction, we sought to establish whether
binding to ICAM-1 was an adequate stimulus for cytokine induction.
Epithelial cells were incubated with varying numbers of
paraformaldehyde-fixed neutrophils expressing LFA-1, a counterligand
for ICAM-1. In none of three experiments did incubation with
neutrophils (at ratios up to 10:1) induce any production of IL-8 or
IL-6 (not shown), implying that viral induction of cytokines occurs at
a stage after viral binding to ICAM-1.
Time course of NF-B activation
As noted above, maximal induction of mRNA for both IL-6 and IL-8
occurs within 1 h postinfection of BEAS-2B cells with HRV-16
(11). Thus, for NF-B to play a role in
rhinovirus-induced expression of these genes, this transcription factor
must be activated within this time frame. When the time course of
NF-B activation following HRV infection was examined by EMSA,
formation of specific NF-B complexes was observed using each of the
radiolabeled oligonucleotides from the Ig, IL-6, and IL-8 gene
promoter sequences. In each case, maximal activation of NF-B
occurred at 30 min after infection, consistent with a potential role of
NF-B in transcriptional regulation of IL-6 and IL-8 (Fig. 1
). No activation of NF-B was seen in
the absence of infectious virus. Interestingly, the signal intensity of
the NF-B band observed using the oligonucleotide from the IL-8
promoter sequence was consistently significantly weaker than that seen
with the oligonucleotide sequences from the Ig and IL-6 genes. To
determine whether binding of NF-B to the IL-8 promoter sequence may
be enhanced if the adjacent NF-IL-6 recognition sequence was also
present, gel shift assays were performed with the oligonucleotide
sequence from the IL-8 gene promoter that contained both sites. Studies
with this oligonucleotide showed a similar pattern of NF-B complex
formation, and no further increase in signal intensity above that seen
with the oligonucleotide containing the NF-B recognition sequence
alone (data not shown).
|
B complexes binding to IL-6 and IL-8 promoter
sequences
To confirm that bands observed by EMSA were indeed NF-B, we
demonstrated that binding could be inhibited by competition with excess
appropriate unlabeled oligonucleotides, but not by oligonucleotides
that would not be expected to bind NF-B (e.g., oligonucleotides that
recognize the transcription factor AP-1) (data not shown). To determine
the subunit composition of NF-B complexes forming on cytokine
promoter sequences in HRV-16-infected BEAS-2B cells, nuclear extracts
were obtained 30 min postinfection, at maximal NF-B activation, and
were incubated with Abs to specific Rel proteins. Addition of
anti-p65 or anti-p50 Abs to nuclear extracts after interaction
with the oligonucleotide sequence from the IL-6 gene reduced the
intensity of the NF-B complex and led to the formation of supershift
bands of higher molecular masses (Fig. 2). By contrast, addition of Abs to c-Rel
had no effect on the NF-B complex and did not induce supershifts.
When a preimmune antiserum was used as a control, it also did not
affect the intensity of the NF-B complex (not shown). Studies using
the oligonucleotide from the IL-8 promoter sequence again resulted in a
weaker band for the specific NF-B complex. Addition of anti-p65
or anti-p50, but not anti-c-Rel, Abs almost eliminated the
formation of the complex. Although a faint supershift was visible using
anti-p65, it was difficult to demonstrate a supershift using
anti-p50 because of the weak signal.
|
B complex formation
with the oligonucleotide from the IL-8 promoter sequence, the ability
of this oligonucleotide to bind to purified recombinant p50 protein was
compared with those of oligonucleotides from the Ig and IL-6 genes.
As shown in Fig. 3, strong bands were
observed when oligonucleotide sequences from the Ig or IL-6 gene
promoters were incubated with 1 and 3 ng of purified p50 protein. By
contrast, bands of comparable intensities were only noted for the
oligonucleotide from the IL-8 promoter when 10–30 ng of purified p50
protein was used, suggesting that the NF-B recognition site from the
IL-8 promoter is at least 10-fold less effective in binding p50 than
the related sequences from the Ig or IL-6 gene promoters.
|
B induction in
HRV-16-infected BEAS-2B cells
NO has been reported to inhibit TNF--induced NF-B activation
in endothelial cells via induction and stabilization of IB
(27). Similarly, glucocorticoids have been reported to
inhibit NF-B activation in several cell types either by induction of
IB (28, 29) or by direct inhibition of NF-B
binding to its cognate cis-element (30). Prior
studies from our laboratory have shown that although both NO and the
potent glucocorticoid, budesonide, inhibit HRV-16-induced production of
IL-8 and IL-6 protein from BEAS-2B cells, they do not alter the ability
of HRV-16 to induce mRNA for these cytokines (11). To
determine whether this resulted from inherent resistance of
HRV-16-induced NF-B activation pathways to these agents, we studied
the effects of budesonide, and of the NO donor, NONOate, on NF-B
complex formation in infected cells. Neither the NO donor nor
budesonide inhibited HRV-16-induced activation of NF-B in BEAS-2B
cells, as assessed by binding to the oligonucleotide from the IL-6 gene
promoter (Fig. 4). Similar results were
obtained when the oligonucleotide from the IL-8 promoter sequence was
used (data not shown).
|
B, cytokine mRNA, and cytokine protein levels
To further define the relationship between HRV-16-induced NF-B
activation and production of IL-6 and IL-8 from BEAS-2B cells, we
studied the effect of putative inhibitors of the NF-B activation
pathway on NF-B activation, cytokine mRNA levels, and cytokine
protein production. Sulfasalazine has been reported to inhibit NF-B
activation by interfering with phosphorylation of IB
(31). In HRV-16-infected epithelial cells, sulfasalazine
(2 mM) prevented activation of NF-B, as assessed by binding to
the oligonucleotides from both the IL-6 and IL-8 gene promoters (Fig. 5). Sulfasalazine also significantly
inhibited HRV-16-induced IL-6 and IL-8 protein production. However,
surprisingly, sulfasalazine had no effect on HRV-16-induced
steady-state mRNA expression for IL-6 or IL-8 (Fig. 5).
|
B can also be blocked by inhibitors of proteosomal
proteases, such as calpain inhibitor I (32). In three
experiments, incubation of BEAS-2B cells with calpain inhibitor I (10
µM) also resulted in significant inhibition of NF-B complex
formation in HRV-16-infected cells (not shown), again without an effect
on steady-state mRNA levels for IL-6 and IL-8. However, unlike
sulfasalazine, calpain inhibitor I failed to inhibit HRV-16-induced
IL-6 and IL-8 protein production (Fig. 6).
|
The above data imply that, although NF-B activation occurs as a
consequence of HRV-16 infection of BEAS-2B cells, this transcription
factor is not required for HRV-16-induced IL-6 or IL-8 gene expression
in these cells. To substantiate this finding, we sought a positive
control for a role of NF-B in HRV-16-infected cells. We have
previously reported that epithelial cells also produce GM-CSF in
response to rhinovirus infection (8). In several cell
types, GM-CSF transcription has also been reported to be at least
partially dependent upon NF-B activation (33, 34). In
time course experiments, we established that expression of GM-CSF mRNA
is also rapidly induced after HRV-16 infection, with maximal expression
seen 1 h postinfection. However, in contrast to IL-8 and IL-6,
mRNA expression and protein production for GM-CSF is sustained for a
longer time period (Fig. 7). Given the
rapid activation of NF-B noted above, we examined the effects of
sulfasalazine on mRNA expression of GM-CSF at 1 h postinfection
and assayed protein levels at 4 h postinfection. In contrast to
the results obtained above for IL-8 and IL-6, sulfasalazine clearly
inhibited both HRV-induced mRNA and protein levels for GM-CSF (Fig. 8). Densitometric analysis showed that,
on average, mRNA expression was reduced to 50% of that observed in the
absence of sulfasalazine. Finally, as a control for interexperiment
variation, a similar inhibition of GM-CSF gene expression was seen when
the same blots used to demonstrate a lack of effect of sulfasalazine on
IL-8 and IL-6 mRNA levels were subsequently stripped and probed for
GM-CSF mRNA.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In our current studies, we have further confirmed that cytokine induction is a specific effect of viral infection. Filtrates of viral preparations containing proteins of <30 kDa molecular mass (most cytokines) did not induce IL-8 production. Moreover, as we have previously shown for HRV-14 (8), cytokine induction could be prevented by blockade of ICAM-1, the cell surface receptor for members of the major group of rhinoviruses. Inhibition by anti-ICAM-1 could be over-ridden when higher infectious doses of virus were used, consistent with our earlier observation that very little virus needs to enter a cell monolayer to trigger a productive infection (8). Given that incubation of epithelial cells with fixed neutrophils expressing LFA-1 did not induce cytokine production, it seems reasonable to assume that simple binding of virus to ICAM-1 is not adequate for cytokine induction and that additional steps in the viral infection process are necessary.
Induction of epithelial expression of IL-6 and IL-8 by HRV has been
shown to be mediated primarily at the level of increased gene
transcription (9, 18). Transcription of IL-6 and IL-8
induced in several cell types by other stimuli has been shown to be
dependent upon activation of NF-B, with maximal gene expression
often requiring that NF-B act in concert with other transcription
factors, particularly NF-IL-6 or AP-1 (48, 49, 50). Although
indirect evidence has been presented supporting a role of NF-B in
rhinovirus-induced transcription of IL-6 and IL-8 in epithelial cells,
our current studies are the first to clearly demonstrate that induction
of mRNA for these cytokines by HRV-16 occurs independent of NF-B
activation.
Our data confirm that HRV-16 infection of BEAS-2B cells does lead to a
rapid activation of NF-B, as assessed by EMSA using oligonucleotide
probes representing the consensus NF-B binding site from the Ig
gene, as well as the NF-B binding sites from the IL-6 and IL-8 gene
promoters. Activation was transient, with maximal NF-B detected
within 30 min postinfection, while levels returned to baseline within
3 h. This time course is similar to that reported for induction of
NF-B by HRV-14 in the A549 type II alveolar cell line
(9). We have previously shown that HRV-16 infection of
epithelial cells results in a rapid and transient increase in mRNA for
IL-6 and IL-8, with maximal levels seen at 1 h postinfection.
Thus, the time course of NF-B activation supports the plausibility
of transcriptional regulation of these cytokine genes by NF-B during
viral infection.
In examining NF-B activation in our cells, we considered it
important to use oligonucleotides containing the putative binding
regions for this transcription factor from the promoter regions of the
IL-6 and IL-8 genes. Although the IL-6 recognition sequence differs
from the consensus sequence from the Ig gene by only a single base
pair substitution, the recognition sequence from the IL-8 gene promoter
is somewhat atypical, containing both substitutions and a "frame
shift" in the sequence, and may be expected to show some unique
properties. NF-B is actually the name given to a group of
transcription factors that are comprised of dimers of members of the
Rel family of proteins. The composition of NF-B complexes binding to
a specific gene promoter has been shown to depend primarily on the
specific recognition sequence present in the promoter in question
(51). It has been reported that the IL-8 promoter sequence
in vitro binds optimally to p65-cRel heterodimers and does not bind
p65-p50 heterodimers (52, 53). Our current data, using
subunit specific Abs, clearly disagree with this premise and show that,
in HRV-16-infected epithelial cells, p65 and p50 subunits, but not
c-Rel, form the NF-B activation complex that binds to both the IL-6
and IL-8 recognition sequences. However, our findings are in agreement
with studies of NF-B binding to IL-8 and IL-6 promoter sequences
using nuclear extracts from the A549 alveolar epithelial cell line,
where complexes also predominantly comprised p65 and p50 subunits
(9, 18).
Interestingly, we noted that NF-B complex formation using nuclear
extracts from infected cells was consistently weaker with the
oligonucleotide sequence from the IL-8 gene promoter than with
oligonucleotides from the IL-6 or Ig genes when compared under
identical conditions. Given that the recognition sequence for another
transcription factor, NF-IL-6, is located immediately adjacent to the
NF-B site in the IL-8 promoter and that these transcription factors
have been reported to function in concert for optimal gene activation
(48, 49), we tested the hypothesis that an oligonucleotide
containing both sequences may bind NF-B more efficiently. However,
studies with this elongated oligonucleotide demonstrated no change in
the intensity or pattern of NF-B band complex formation on EMSA.
When studies were performed to quantify the relative ability of
recognition sequences from the different genes to bind to a recombinant
p50 subunit of NF-B, 10- to 30-fold more recombinant protein was
required to form bands of comparable intensity with the oligonucleotide
from the IL-8 gene promoter than was required with the oligonucleotides
from the IL-6 or Ig genes. This weaker binding presumably reflects
the atypical sequence of the IL-8 gene binding motif, but was of
interest given that epithelial cells generate higher levels of IL-8 in
response to HRV-16 than of any other cytokine examined to date.
Although there could be many other regulatory steps between
transcription and protein release, this observation raised the first
queries about the central role of NF-B in the induction of IL-8 and
IL-6 by HRV-16.
The major evidence supporting a role of NF-B in the induction of
epithelial expression of IL-8 and IL-6 by HRV has been derived from
studies using transient transfection of cells with promoter-luciferase
constructs (9, 18). Because studies using transient
transfection with promoter constructs of limited length may not always
accurately reflect endogenous gene responses in infected cells, we
determined whether activation of NF-B could be uncoupled from
cytokine mRNA expression in HRV-16-infected epithelial cells by using
pharmacologic interventions that may be expected to modulate NF-B
activation under our normal infection conditions. We have previously
shown that NO is capable of inhibiting both the replication of HRV-16
in epithelial cells and the virally induced production of IL-6 and IL-8
protein. However, surprisingly, NO did not inhibit the induction of
mRNA for these cytokines. Because NO has been reported to inhibit
activation of NF-B in endothelial cells by induction and
stabilization of IB (27), we examined the effects of
the NO donor, NONOate, on NF-B in response to HRV-16 infection. In
contrast to the data reported for endothelial cells, NO did not inhibit
activation of NF-B in HRV-16-infected cells, implying that the
effects of NO on NF-B activation are cell and/or stimulus specific.
However, the failure of NO to inhibit either NF-B activation or mRNA
expression for IL-8 and IL-6 did not invalidate the potential role of
NF-B in gene transcription.
Glucocorticoids also have been shown to inhibit NF-B activation in
several cell types either by induction of IB (28, 29) or by direct inhibition of NF-B binding to its cognate
cis-element (30). In contrast to these reports,
the potent glucocorticoid, budesonide, did not inhibit activation of
NF-B in HRV-16-infected epithelial cells. Interestingly,
glucocorticoids have also been shown to have no effect on the
activation of NF-B in epithelial cells stimulated with IL-1ß
(54). This lack of effect is not due to an impaired
ability of these cells to respond to glucocorticoids, because this same
dose of budesonide has been previously shown to optimally inhibit
cytokine-induced production of RANTES from BEAS-2B cells
(26). Moreover, we have shown that budesonide does
partially inhibit the production of IL-8 and IL-6 from these cells at
the protein level, but did not inhibit mRNA induction in response to
HRV-16 infection (11). Therefore, these data again failed
to uncouple activation of NF-B from increased mRNA expression for
IL-6 and IL-8.
However, dissociation of the activation of NF-B and mRNA expression
for IL-8 and IL-6 in HRV-16-infected epithelial cells was observed with
sulfasalazine and calpain inhibitor I, drugs that are purported to be
selective inhibitors of the NF-B activation pathway. Sulfasalazine
has been reported to inhibit NF-B activation by interfering with
phosphorylation of IB (31), whereas calpain
inhibitor I inhibits proteosomal degradation of IB
(32). Both agents inhibited HRV-16-induced activation of
NF-B, preventing the formation of complexes with the
oligonucleotides derived from both the IL-6 and IL-8 gene promoter
sequences. By contrast, neither inhibitor had any effect on
HRV-16-induced expression of mRNA for IL-6 or IL-8. The ability of
sulfasalazine to decrease HRV-16-induced cytokine protein levels, an
effect not observed with calpain inhibitor I, suggests that
sulfasalazine may also have additional posttranscriptional actions and
demonstrates the importance of examining both mRNA and protein levels
before attributing transcriptional effects to NF-B. There is
precedent for sulfasalazine to have anti-inflammatory actions on
cell function that are mediated at the posttranscriptional level and
are independent of effects on NF-B (55, 56). These data
clearly show that activation of NF-B is not absolutely essential for
HRV-16-induced induction of IL-8 and IL-6 gene expression. Although
these data appear to contradict published reports, this may relate
primarily to differences in experimental techniques. Zhu and coworkers
concluded that HRV-14-induced activation of NF-B is essential for
IL-6 and IL-8 induction in the A549 cell line (9, 18).
These authors showed time courses for NF-B activation and cytokine
mRNA expression that were in good agreement to those reported in our
current studies. However, the causative link between NF-B activation
and gene transcription was implied solely on the basis of transient
transfection of cells with promoter constructs, which may not
accurately reflect endogenous gene responses. By contrast, Bagioli and
colleagues relied on evidence that incubation of BEAS-2B cells with a
high concentration (20 mM) of N-acetyl cysteine inhibited
both HRV-39-induced activation of NF-B and production of IL-8
protein to imply a causative link, but mRNA levels were not examined
(19). As noted from our own data with sulfasalazine, this
could be a misleading conclusion if N-acetyl cysteine has
any posttranscriptional effects in the cell.
Given the potentially controversial nature of our results, we sought to
establish that sulfasalazine could inhibit both mRNA induction and
protein levels in a gene for which activation is NF-B dependent. We
have already demonstrated that rhinovirus infection of epithelial cells
leads to the production of GM-CSF, a cytokine whose promoter is known
to be responsive to NF-B (33, 34). In contrast to IL-8
and IL-6, which are rapidly and transiently induced by HRV-16
infection, expression of GM-CSF is rapid but more sustained. Given the
transient induction of NF-B, we focused on the early phase of GM-CSF
production to determine whether a role of this transcription factor in
HRV-16-induced expression of mRNA and protein could be established.
EMSA using the NF-B binding motif from the GM-CSF gene promoter were
not performed given that we had already established that sulfasalazine
inhibits binding of NF-B to multiple other promoter sequences.
Sulfasalazine not only inhibited the production of GM-CSF at the
protein level, but also inhibited HRV-16-induced mRNA levels for this
cytokine by 50%. Given the known interaction of multiple
transcription factors in transcription of the GM-CSF gene
(34), it is not surprising that greater inhibition of mRNA
levels were not seen.
In summary, our data confirm that rapid and transient activation of
NF-B occurs in epithelial cells infected with HRV-16. We demonstrate
that this transcription factor plays a role in the early induction of
GM-CSF that is observed in HRV-16-infected epithelial cells. By
contrast, the rapid generation of IL-6 and IL-8 that is seen in
HRV-16-infected epithelial cells is not dependent upon activation of
NF-B. Additional studies will be required to determine which factors
are involved in rhinovirus-induced production of IL-6 and IL-8 from
infected epithelial cells.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David Proud, Johns Hopkins Asthma and Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224-6801.
3 Abbreviations used in this paper: HRV, human rhinovirus; NONOate, 3-(2-hydroxy-2-nitroso-1-propylhydrazino)-1-propanamine.
Received for publication July 22, 1999. Accepted for publication June 29, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B-dependent transcriptional activation. J. Clin. Invest. 97:421.[Medline]
B in cytokine gene regulation. Am. J. Respir. Cell Mol. Biol. 17:3.B and IB proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
B. Am. J. Physiol. 273:L814.
B by nitric oxide mediates inhibition of NF-B. J. Biol. Chem. 270:14214.B in mediation of immunosuppression by glucocorticoids. Science 270:283.B activity through induction of IB synthesis. Science 270:286.B is target for glucocorticoid-mediated interleukin-8 gene repression. J. Biol. Chem. 269:13289.B. J. Clin. Invest. 101:1163.[Medline]
B. Proc. Natl. Acad. Sci. USA 93:3308.B/Rel family members. Biochem. Biophys. Res. Commun. 223:64.[Medline]
B and AP1 synergistically transactivate the human GM-CSF promoter. Oncogene 14:2845.[Medline]
B synergistically activate transcription of the inflammatory cytokines, interleukin-6 and interleukin-8. Proc. Natl. Acad. Sci. USA 90:10193.B p65 (RelA) and NF-IL-6. J. Immunol. 153:153.[Abstract]
and interferon 
synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-B-like binding sites of the interleukin 8 gene. J. Biol. Chem. 267:22506.B/Rel DNA-binding motifs: interaction of both subunits of NF-B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412.B subunit-specific regulation of the IL-8 promoter. Mol. Cell. Biol. 13:6137.B-like sites that specifically bind c-Rel-p65 heterodimers. J. Biol. Chem. 269:20823.B (NF-B) and B-dependent transcription in epithelial cells. Eur. J. Biochem. 251:81.[Medline]
B. Proc. Natl. Acad. Sci. USA 96:6377.This article has been cited by other articles:
|
|
 |
|
  R. S. Zaheer, R. Koetzler, N. S. Holden, S. Wiehler, and D. Proud Selective Transcriptional Down-Regulation of Human Rhinovirus-Induced Production of CXCL10 from Airway Epithelial Cells via the MEK1 Pathway J. Immunol., April 15, 2009; 182(8): 4854 - 4864. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Edwards, J. Haas, R. A. Panettieri Jr., M. Johnson, and S. L. Johnston Corticosteroids and beta2 Agonists Differentially Regulate Rhinovirus-induced Interleukin-6 via Distinct Cis-acting Elements J. Biol. Chem., May 25, 2007; 282(21): 15366 - 15375. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. S. Sajjan, Y. Jia, D. C. Newcomb, J. K. Bentley, N. W. Lukacs, J. J. LiPuma, and M. B. Hershenson H. influenzae potentiates airway epithelial cell responses to rhinovirus by increasing ICAM-1 and TLR3 expression FASEB J, October 1, 2006; 20(12): 2121 - 2123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Laza-Stanca, L. A. Stanciu, S. D. Message, M. R. Edwards, J. E. Gern, and S. L. Johnston Rhinovirus Replication in Human Macrophages Induces NF-{kappa}B-Dependent Tumor Necrosis Factor Alpha Production. J. Virol., August 1, 2006; 80(16): 8248 - 8258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Peng, S. Kotla, R. E. Bumgarner, and K. E. Gustin Human rhinovirus attenuates the type I interferon response by disrupting activation of interferon regulatory factor 3. J. Virol., May 1, 2006; 80(10): 5021 - 5031. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Edwards, M. W. Johnson, and S. L. Johnston Combination Therapy: Synergistic Suppression of Virus-Induced Chemokines in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 616 - 624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Chen, E. Hamati, P.-K. Lee, W.-M. Lee, S. Wachi, D. Schnurr, S. Yagi, G. Dolganov, H. Boushey, P. Avila, et al. Rhinovirus Induces Airway Epithelial Gene Expression through Double-Stranded RNA and IFN-Dependent Pathways Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 192 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Newcomb, U. Sajjan, S. Nanua, Y. Jia, A. M. Goldsmith, J. K. Bentley, and M. B. Hershenson Phosphatidylinositol 3-Kinase Is Required for Rhinovirus-induced Airway Epithelial Cell Interleukin-8 Expression J. Biol. Chem., November 4, 2005; 280(44): 36952 - 36961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Hewson, A. Jardine, M. R. Edwards, V. Laza-Stanca, and S. L. Johnston Toll-Like Receptor 3 Is Induced by and Mediates Antiviral Activity against Rhinovirus Infection of Human Bronchial Epithelial Cells J. Virol., October 1, 2005; 79(19): 12273 - 12279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Johnston Overview of Virus-induced Airway Disease Proceedings of the ATS, August 1, 2005; 2(2): 150 - 156. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. L. Spurrell, S. Wiehler, R. S. Zaheer, S. P. Sanders, and D. Proud Human airway epithelial cells produce IP-10 (CXCL10) in vitro and in vivo upon rhinovirus infection Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L85 - L95. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Hall, M. E. Bates, L. Guar, M. Cronan, N. Korpi, and P. J. Bertics The Role of p38 MAPK in Rhinovirus-Induced Monocyte Chemoattractant Protein-1 Production by Monocytic-Lineage Cells J. Immunol., June 15, 2005; 174(12): 8056 - 8063. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. G. Cosio, B. Mann, K. Ito, E. Jazrawi, P. J. Barnes, K. F. Chung, and I. M. Adcock Histone Acetylase and Deacetylase Activity in Alveolar Macrophages and Blood Mononocytes in Asthma Am. J. Respir. Crit. Care Med., July 15, 2004; 170(2): 141 - 147. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Proud, S. P. Sanders, and S. Wiehler Human Rhinovirus Infection Induces Airway Epithelial Cell Production of Human {beta}-Defensin 2 Both In Vitro and In Vivo J. Immunol., April 1, 2004; 172(7): 4637 - 4645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I S Patel Viral regulation of inflammatory cytokines in epithelial cells: an alternative signalling pathway Thorax, December 1, 2003; 58(12): 1019 - 1019. [Full Text]
|
|
|
|
|
|
T. R. Meusel and F. Imani Viral Induction of Inflammatory Cytokines in Human Epithelial Cells Follows a p38 Mitogen-Activated Protein Kinase-Dependent but NF-{kappa}B-Independent Pathway J. Immunol., October 1, 2003; 171(7): 3768 - 3774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Zhou, A. Tan, S. Iasvovskaia, J. Li, A. Lin, and M. B. Hershenson Ras and Mitogen-Activated Protein Kinase Kinase Kinase-1 Coregulate Activator Protein-1- and Nuclear Factor-{kappa}B-Mediated Gene Expression in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., June 1, 2003; 28(6): 762 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.G. Gibson, P.A.B. Wark, J.L. Simpson, C. Meldrum, S. Meldrum, N. Saltos, and M. Boyle Induced sputum IL-8 gene expression, neutrophil influx and MMP-9 in allergic bronchopulmonary aspergillosis Eur. Respir. J., April 1, 2003; 21(4): 582 - 588. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Sarady, S. L. Otterbein, F. Liu, L. E. Otterbein, and A. M. K. Choi Carbon Monoxide Modulates Endotoxin-Induced Production of Granulocyte Macrophage Colony-Stimulating Factor in Macrophages Am. J. Respir. Cell Mol. Biol., December 1, 2002; 27(6): 739 - 745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Sanders, J. Kim, K. Ryan Connolly, J. D. Porter, E. S. Siekierski, and D. Proud Nitric Oxide Inhibits Rhinovirus-Induced Granulocyte Macrophage Colony-Stimulating Factor Production in Bronchial Epithelial Cells Am. J. Respir. Cell Mol. Biol., March 1, 2001; 24(3): 317 - 325. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
