|
|
||||||||
Department of Biology, University of North Carolina, Charlotte, NC 28223
| Abstract |
|---|
|
|
|---|
production. Activation of this pathway has been
shown to be critical in generating optimal cell-mediated immunity.
Therefore, increased IL-12 receptor expression might be expected in the
host response after infection by an intracellular bacterial pathogen.
In the present study, we have made the surprising discovery that
infection with Salmonella results in an early reduction
of high affinity IL-12 receptor expression and activation. After oral
inoculation with Salmonella, the level of mRNA
expression encoding IL-12 receptor ß2 (IL-12Rß2) subunit was
diminished 12 h postinfection in the mesenteric lymph nodes and
subsequently in the spleen. Furthermore, decreased IL-12Rß2 mRNA
expression was observed in CD4+ T lymphocytes isolated from
the mesenteric lymph nodes and spleens of infected mice. Attenuated
IL-12Rß2 mRNA expression correlated with reduced receptor signaling,
as demonstrated by reduced IL-12-induced STAT4 phosphorylation in
enriched T lymphocytes isolated from the mesenteric lymph nodes and
spleens of Salmonella-infected mice. These in vivo
results were substantiated with an in vitro model system. In this model
system, T lymphocytes cocultured with
Salmonella-infected macrophages expressed less
IL-12Rß2 mRNA. The cocultured T cells were also less responsive to
IL-12 as assessed by reduced phosphorylation of STAT4 and limited
IFN-
secretion. Together, these studies suggest that
Salmonella can limit an optimal host immune response by
reducing the expression and activity of high affinity IL-12
receptors. | Introduction |
|---|
|
|
|---|
There are several compelling lines of evidence that demonstrate that interactions between high affinity IL-12 receptors and IL-12 are critical for optimal immune responses against Salmonella. Patients who have genetic mutations and cannot express a functional, high affinity IL-12 receptor consistently present with bacterial infections caused by Mycobacterium or Salmonella species (6, 8). Furthermore, patients who have a defect in the ability to secrete IL-12 suffer from recurrent Salmonella infections (9, 10). Findings to complement these clinical observations have also been reported with the use of animal models of salmonellosis (9). Endogenous production of IL-12 in response to Salmonella infection augments the host response (4, 5), and exogenous therapy with recombinant IL-12 (4) also limits progression of salmonellosis. Taken together, these studies and clinical observations demonstrate a requirement for high affinity IL-12 receptor expression for optimal immunity against this intracellular pathogen of macrophages.
The receptor for IL-12 is composed of two subunits, designated ß1 and
ß2 (11, 12, 13, 14). Whereas the ß1 component of the IL-12
receptor is constitutively expressed on various cell types, resulting
in a low affinity receptor (KDa = 26
nM), coexpression of the ß2
(IL-12Rß2)3 chain is
required for expression of the high affinity receptor
(KDa = 3365 pM) (15). The
high affinity heterodimer is expressed on a limited number of cell
types, including Th1 lymphocytes, CD8+ T
lymphocytes, NK cells, and possibly B lymphocytes (11, 15, 16, 17, 18, 19, 20). Binding of IL-12 to the high affinity receptor signals
the secretion of IFN-
and is required for optimal development of Th1
lymphocytes (21). Signaling through the high affinity
IL-12 receptor requires phosphorylation of JAK2, which then
phosphorylates STAT4 (22, 23, 24, 25). In fact, STAT4
phosphorylation and its subsequent translocation to the nucleus have
been used to define the ability of mice to mount an optimal Th1
response (15, 17, 26). In this manner, IL-12-mediated
IFN-
secretion can activate macrophages to augment the host response
against intracellular bacterial pathogens (27, 28, 29, 30) such as
Salmonella (4, 5, 31).
An increase in high affinity IL-12 receptor expression would be
anticipated for an optimal host response against Salmonella.
Previous studies have demonstrated increased IL-12 and IFN-
expression at mucosal sites (32, 33) and in cultured
leukocytes exposed to this bacteria (34). Therefore,
increased IL-12 receptor expression or activation after
Salmonella infection would be consistent with an optimal
host response that depends on IL-12-induced IFN-
production. In
contrast to our expectations, we report here that infection with
Salmonella elicited an early decrease in IL-12Rß2 mRNA
expression and reduced IL-12 responsiveness both in vivo and in vitro.
These results suggest an unexpected mechanism whereby
Salmonella may limit the protective cell-mediated immune
response early in infection.
| Materials and Methods |
|---|
|
|
|---|
Specific pathogen-free BALB/c or C57BL/6 mice, weighing 2024 g (Charles River Laboratories, Wilmington, MA), were inoculated with viable Salmonella dublin (strain SL1363) via a gastric tube. Mice received varying inocula of Salmonella from 105 to 107 bacteria per mouse, representing doses of Salmonella above and below the LD50 (i.e., 3 x 106 bacteria) for this strain of mice. At varying times postinfection, mice were euthanized, and lymphoid organs were excised for RNA isolation or for cell isolation.
RNase protection assay (RPA)
Spleens were isolated from mice orally inoculated with Salmonella, and total RNA was prepared with Trizol reagent as previously described (22, 35, 36, 37). Five micrograms of total RNA were then hybridized to RNA probes for L32, IL-12Rß2, and G3PDH. Probes were generated with a RiboQuant custom template set and a RiboQuant in vitro transcription kit according to the manufacturers supplied protocol (PharMingen, San Diego, CA). Hybridization was terminated after 16 h by addition of RNases A and T. Protected fragments were denatured and electrophoresed on a polyacrylamide sequencing gel. The gel was dried and then exposed to x-ray film.
Semiquantitative amplification of mRNA expression by RT-PCR
At the indicated times, total RNA was isolated from cultured cells or from mucosal tissues as previously described (22, 35, 36, 37) with Trizol reagent (Life Technologies, Gaithersburg, MD). A total of 2 µg RNA was reverse transcribed with SuperScript II reverse transcriptase (Life Technologies). A portion of the total cDNA was amplified by PCR using 94°C denaturation, 61°C annealing, and 72°C extension temperatures, with the first three cycles having extended times. Positive and negative strand primers and the number of cycles used for amplification of each mRNA species were as follows: IL-12Rß2, 30 cycles, AATCTCCATGGCAAGAAAGTCC and GTTGATGGCAGTAACACGGACT; c-maf, 30 cycles, TGTGTTCACGTTCGAGCTTT and AGGTCGGAATTGTTCATTGC; G3PDH, 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT. Amplified products were visualized under UV illumination after electrophoresis on ethidium bromide-stained agarose gels. Amplification of the appropriate gene fragments was assured by comparison with m.w. markers run on the same gel (i.e., 220 bp for IL-12Rß2; 200 bp for c-maf, and 340 bp for G3PDH). The conditions for amplification of each mRNA species were predetermined to be within the linear range of amplification as previously described (36). In addition, with the use of known amounts of IL-12Rß2 DNA, it was possible to determine that RT-PCR amplification was >1000 times more sensitive than the RPA.
Quantification of CD4+ and CD8+ T lymphocyte populations in mesenteric lymph nodes and spleen after intragastric intubation with Salmonella
To assess whether the absolute numbers of CD4+ or CD8+ T lymphocytes were altered early in the immune response against Salmonella, T lymphocyte populations were enumerated using FACS analyses (FACScalibur, Becton Dickinson, Mountain View, CA). At varying times postinoculation (0 to 48 h), the mesenteric lymph nodes and spleens were removed from euthanized mice, and single cell suspensions were prepared as described below. Cells were washed once in cold RPMI 1640 containing 1% FCS (Atlanta Biologics, Norcross, GA) and 0.05 M sodium azide. Aliquots of each isolated leukocyte population were incubated with the following PE-conjugated Abs (PharMingen); anti-mouse CD4 (clone RM4-5), anti-mouse CD8 (clone 53-6.7), or an isotype-matched control Ab (clone R35-95). After incubation for 30 min at 4°C, cells were washed twice and analyzed for fluorescence (2). The percentage of cells positive for CD4 and CD8 in each leukocyte preparation was determined by scoring 10,000 cells.
Isolation of CD4+ T lymphocytes after intragastric intubation with Salmonella
To investigate the expression of IL-12Rß2 mRNA in CD4+ T lymphocytes after intragastric inoculation with Salmonella, spleen or mesenteric lymph nodes were removed at the indicated times postinfection. Single cell suspensions were made, and CD4+ T lymphocytes were then magnetically separated using a ferritin-conjugated anti-CD4 Ab according to instructions supplied by the manufacturer (Miltenyi Biotech, Auburn, CA) using the VARIO MACS magnetic separator (Miltenyi Biotech). Cells not expressing CD4 were washed through with excess buffer, and cells retained within the column were eluted with buffer after removal of the column from the magnetic field. Cells isolated in this manner were >98% CD4+ as determined by FACS analysis. CD4+ T lymphocytes were then placed in Trizol reagent for isolation of RNA and quantification of IL-12Rß2 mRNA expression as described above.
Cocultures of Salmonella-infected macrophages and CD4+ T cells or enriched T lymphocytes
Elicited peritoneal macrophages were isolated as previously described (37). Briefly, BALB/c mice (Charles River) weighing 2024 g were injected i.p. with 500 µl IFA (Sigma, St. Louis, MO). Three days later, the peritoneal cavities were lavaged with RPMI 1640 containing 2% FCS to remove the elicited peritoneal macrophages. After two washes, macrophages were purified by adherence to plastic culture flasks (Corning, Cambridge, MA) for 3045 min in RPMI 1640 containing 2% FCS. Adherent macrophages were then cultured with S. dublin (strain SL1363) at varying ratios of bacteria to macrophages (10:1, 3:1, or 1:1) in RPMI 1640 supplemented with 5% FCS but containing no antibiotics. After 60 min, extracellular bacteria were removed by washing in medium, followed by the addition of RPMI 1640 supplemented with 5% FCS and gentamicin to kill any remaining extracellular bacteria. The viability of infected macrophages was assessed at the end of the experiment using trypan blue exclusion. As previously observed (38), macrophages exposed to this bacterial burden remained >95% viable throughout the culture procedure.
Total T lymphocytes or CD4+ T cells were used in these cocultures. Total T lymphocytes were enriched from splenic leukocytes by passage through a nylon wool column as previously described (39). Briefly, spleens were removed from naive BALB/c mice and disassociated by passage through a 30-gauge wire mesh screen, thereby making single cell suspensions. The dissociated cells were washed, and RBC were lysed using 0.83% ammonium chloride (Sigma). Leukocytes were resuspended in RPMI 1640 containing 5% FCS and passed slowly over a nylon wool column. Nonadherent cells were pelleted and resuspended in RPMI 1640 (Life Technologies) containing 5% FCS to a final concentration of 5 x 106 cells/ml. These cells were determined to be >80% T lymphocytes using flow cytometry (2) to detect the presence of CD3 (clone 145-2C11, PharMingen). CD4+ T cells were isolated as described above.
After exposure of macrophages to Salmonella, nylon
wool-enriched T lymphocytes or magnetically purified
CD4+ T cells were then added directly to these
cultures. At varying times after coculture, T lymphocytes were removed
and assayed for the level of mRNA expression or presence of
IL-12-induced STAT4 phosphorylation by Western blot analyses as
described below. In parallel experiments, cocultured T lymphocytes were
also removed and assayed for IL-12-induced IFN-
production. In these
studies, 105 cocultured T lymphocytes were plated
in 96-well plates and cultured with varying amounts of IL-12 (010
pg/ml). After 48 h of culture, supernatants were taken, and the
amount of IFN-
secreted was quantified by a capture ELISA
(PharMingen). The amount of IFN-
in culture supernatants was
determined by extrapolation of optical densities from a standard curve
generated by limiting dilutions of recombinant murine IFN-
.
Transwell cultures of Salmonella-infected macrophages and enriched T lymphocytes
Isolated peritoneal macrophages were adhered to the bottom chamber of a 12-well Transwell (Corning) tissue culture plate and exposed to Salmonella at a 10:1 ratio. After 1 h of infection, extracellular Salmonella were washed off, and macrophages were cultured in RPMI containing 5% FCS and gentamicin. Nylon wool-enriched T lymphocytes isolated from the spleens of uninfected mice (5 x 105/well) were added to the upper Transwell chamber and were separated from the infected macrophages by a 0.45-µm pore membrane. Cells were cocultured for varying times (6, 12, and 24 h), and then T lymphocytes were removed from the upper chamber and incubated with IL-12 (5 pg/ml) for 10 min. T lymphocytes were then lysed and assayed for total STAT4 and STAT4 phosphorylation by Western blot analyses as described below.
Quantification of STAT4 phosphorylation by Western blot analyses
Nylon wool-enriched T lymphocytes were lysed in extraction buffer (20 mM Tris (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40, 0.02% NaN3, 10 mM NaF, 1 mM sodium orthovanadate, 0.25 mM PMSF, 1 µg/ml aprotinin, and 1 µg/ml leupeptin), and the lysate was centrifuged (16,000 x g for 20 min) at 4°C to remove the insoluble material. To reduce nonspecific interactions, the soluble lysates were precleared with protein G-agarose (Life Technologies) by incubation with the beads for 20 min at 4°C. Beads were then removed from the lysate by centrifugation. Lysates were incubated with 1 µg affinity-purified goat anti-STAT4 Ab per sample at 4°C for 1 h as suggested by the manufacturer (R&D Systems, Minneapolis, MN). The complex was then precipitated by the addition of protein G-agarose for 1 h followed by centrifugation and washing of the beads in cold extraction buffer. A 2x sample buffer (2% SDS, 20% glycerol, 125 mM Tris base, 150 mM 2-ME) was then added to each immunoprecipitate, and the beads pelleted by centrifugation. Immunoprecipitated material was loaded onto a 10% SDS-polyacrylamide gel and electrophoresed for 45 min at 140 V (Bio-Rad, Hercules, CA). After electrophoresis, gels were transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA), followed by blocking of the membranes with 5% dry milk. A biotinylated anti-phosphotyrosine Ab (clone RC20, Signal Transductions Laboratories, Lexington, KY) was added for 2 h, and unbound Ab was washed off. Streptavidin conjugated to HRP was added after removal of excess anti-phosphotyrosine Ab. The polyvinylidene difluoride membrane was then thoroughly washed, and enhanced chemiluminescence (Amersham, Arlington Heights, IL) was used for detection of bound Ab. Blots were subjected to autoradiography with KODAK MR film.
After detection of phosphorylated STAT4, the same blots were stripped and reprobed to detect total STAT4 present in each sample. Blots were stripped in a buffer (100 mM 2-ME, 2% SDS, 62.5 mM Tris-HCl (pH 6.7)) for 15 min at 50°C. Goat anti-STAT4 Ab (R&D Systems) was then added to the blots for 1 h, washed, and incubated with HRP-conjugated anti-goat Ab for 45 min. The presence of bound Ab was detected by enhanced chemiluminescence followed by autoradiography.
Densitometric analysis
Densitometric analyses were performed on PCR amplified products and autoradiographs as previously described (40). Briefly, each image was scanned into Photoshop (Adobe Systems, San Jose, CA) and saved as a TIFF image. The images were then imported into NIH image (NIH Images software), and a gel-plotting macro was then used to outline each band. Band intensities were then calculated with the uncalibrated OD setting.
Statistical analysis
Statistical analyses were performed using the Student t test (GraphPad, San Diego, CA).
| Results |
|---|
|
|
|---|
An optimal response against the intracellular pathogen,
Salmonella, requires IL-12 induced IFN-
production
(9). Expression of the high affinity IL-12 receptor is
required for such a response, and patients with defects in this
receptor are highly susceptible to recurrent Salmonella
infection (6, 10). Because infection with other
intracellular pathogens reportedly induced IL-12 receptor expression
(41, 42), we anticipated that infection with
Salmonella would do the same. To address this possibility,
mice were orally intubated with Salmonella and sacrificed at
12-h intervals. The spleens were excised, and an RPA was performed to
quantify increases in IL-12Rß2 mRNA expression.
Fig. 1
shows the results of one such
analysis. There was no detectable IL-12Rß2 mRNA expression in the
spleens of mock infected mice, which is consistent with reports that
show limited expression of this message by unstimulated T lymphocytes
(17, 43). Surprisingly, however, no detectable increase in
IL-12Rß2 mRNA expression was observed in infected mice during the
first 48 h after infection (Fig. 1
). The lack of detection of
IL-12Rß2 mRNA in infected mice could not be explained by technical
considerations, because IL-12-stimulated T lymphocytes showed
substantial increases in 12Rß2 message, and since the presence of
housekeeping genes were readily detected (L32 (ribosomal structural
protein) and G3PDH).
|
The lack of any detectable increases in IL-12Rß2 mRNA expression using the RPA was surprising, but not definitive, because message expression was clearly below the level of detection for this technique. To overcome this limitation, a sensitive, semiquantitative RT-PCR analysis was developed and used to detect IL-12Rß2 mRNA expression after Salmonella infection.
After intubation, mice were euthanized, and RNA was isolated from the
mesenteric lymph nodes and spleens. RT-PCR was performed, and as shown
in Fig. 2
, this technique could detect
the presence of IL-12Rß2 mRNA in uninfected mice. This result is
consistent with that previously observed after a similar RT-PCR
analysis (20, 44). Consistent with those results obtained
using RPA, no increases in IL-12Rß2 mRNA expression were observed in
the mesenteric lymph nodes and spleens within the first 48 h after
infection with Salmonella (Fig. 2
). In fact, when
densitometric scans were used to quantify the amplified products, there
was a profound reduction in IL-12Rß2 mRNA expression, especially in
the mesenteric lymph nodes (Fig. 2
). As early as 12 h
postinfection, constitutive levels of IL-12Rß2 mRNA were decreased
>10-fold. This result was representative of 10 separate analyses in
which the decreases ranged from 8- to 14-fold. By 24 h
postinfection, splenic IL-12Rß2 mRNA levels were decreased by
>8-fold over constitutive levels. Importantly, the kinetics of
decreased IL-12ß2R mRNA correlated with the appearance of significant
numbers of viable Salmonella into the spleen by 24 h
(38), suggesting a cause and effect relationship.
Differences in IL-12Rß2 mRNA expression in this assay could not be
attributed to significant differences in input RNA or efficiencies of
reverse transcription between samples as indicated by amplification of
the housekeeping gene, G3PDH, from the same samples
(Fig. 2
).
|
The results presented in Fig. 2
were obtained from mice given 3 x
106 Salmonella, which corresponds to
the LD50 for BALB/c mice when given
intragastrically. Importantly, up to 10-fold decreases in IL-12Rß2
mRNA expression were also observed in mice given lower inocula of
Salmonella (i.e., 5 x 105).
Furthermore, similar decreases in IL-12Rß2 mRNA expression have also
been observed in the mesenteric lymph nodes of C57BL/6 mice (data not
shown), demonstrating that the effect observed here cannot be
attributed solely to the Th2 nature of BALB/c mice
(49, 50, 51).
Enumeration of CD4+ and CD8+ T lymphocytes in the mesenteric lymph nodes and spleens after intragastric inoculation with Salmonella
One possible explanation for decreased IL-12Rß2 mRNA expression
soon after intragastric inoculation with Salmonella could be
a reduction in the number of cells expressing this receptor in the
mesenteric lymph nodes and spleen. Because CD4+
and CD8+ T lymphocytes are the predominant cells
expressing the high affinity IL-12 receptor in these lymphoid organs,
FACS analysis was performed to quantify the proportions of these cells
types present after infection. As shown in Fig. 3
, no significant differences in the
numbers of CD4+ or CD8+ T
lymphocytes in the mesenteric lymph nodes and spleens were observed
during the first 48 h after infection. Further, the total
leukocyte numbers in each of these lymphoid organs did not vary more
than 18% during the first 48 h following infection (data not
shown). These results strongly suggest that differences in IL-12Rß2
mRNA expression after intragastric inoculation with
Salmonella cannot be explained by reductions in the absolute
numbers of CD4+ or CD8+ T
lymphocytes.
|
NK cells, CD4+ and CD8+ T lymphocytes, and possibly B lymphocytes can express high affinity IL-12 receptors (11, 15, 16, 17, 18, 19, 20). Due to the importance of CD4+ T lymphocytes in the protective immune response against Salmonella (52, 53, 54), we questioned whether down-regulation of IL-12Rß2 mRNA expression occurred in this cell population after infection.
Mice were intragastrically inoculated with Salmonella, and
at varying times postinfection, CD4+ T
lymphocytes were purified from the mesenteric lymph nodes and spleens
by magnetic separation. RNA was then isolated from these cells and
subjected to RT-PCR for IL-12Rß2 mRNA expression. As shown in Fig. 4
, CD4+ T
lymphocytes from the mesenteric lymph nodes and spleens showed
significant reductions in IL-12Rß2 mRNA expression (20- and 10-fold,
respectively) at 24 h after infection. Importantly, the kinetics
of IL-12Rß2 mRNA reduction paralleled the kinetics of entry of viable
bacteria in these respective lymphoid organs as previously described
(38). Again, differences in IL-12Rß2 mRNA expression in
this assay could not be attributed to significant differences in input
RNA or efficiencies of reverse transcription between samples as
indicated by amplification of the housekeeping gene, G3PDH,
from the same samples (Fig. 4
).
|
No Abs currently exist for quantification of murine IL-12Rß2 protein expression; however, phosphorylation of STAT4 in response to IL-12 binding its high affinity receptor has been used as a functional assay to define the presence of this cell surface receptor (15, 17). If decreased IL-12Rß2 mRNA expression translates into limited receptor expression, then a reduction in receptor activity would also be expected. We next questioned whether enriched T lymphocytes from the mesenteric lymph nodes of infected mice were limited in their responsiveness to IL-12.
Mice were intragastrically inoculated with Salmonella, and
at varying times postinfection mesenteric lymph nodes were removed.
Nylon wool-enriched T lymphocytes from these organs were exposed to
recombinant IL-12 for 10 min before cell lysis. Total STAT4 was
immunoprecipitated from cell lysates, and Western blot analyses were
performed to quantify phosphorylation of this protein induced by
exposure of lymphocytes to IL-12. As shown in Fig. 5
, significant decreases in STAT4
phosphorylation were observed at 12 and 24 h postinfection (6- and
4-fold decreases compared with uninfected, respectively). These
differences in phosphorylation could not be explained by altered
protein loading on the gels or a reduction in STAT4 protein, as
evidenced by no significant differences in the levels of total STAT4 in
CD4+ T lymphocytes isolated from control and
infected mice (Fig. 5
). These results demonstrate that
Salmonella-induced decreases in IL-12Rß2 mRNA expression
(Figs. 2
and 4
) correlated with reduced responsiveness of these cells
to IL-12 (Fig. 4
), suggesting decreased expression of the high affinity
IL-12 receptor.
|
An in vitro model was established to provide support for our in
vivo observations. Because Salmonella is an intracellular
pathogen, macrophages were isolated from normal mice and exposed to
Salmonella in vitro. After removal of extracellular
Salmonella, enriched T lymphocytes isolated from normal mice
were then added to these infected macrophages. Cells were cocultured
for varying times and assayed for the expression of IL-12Rß2 mRNA
expression by RT-PCR. As shown in Fig. 6
, IL-12Rß2 mRNA expression by nylon wool-enriched (Fig. 6
A)
or CD4+-purified (Fig. 6
B) T
lymphocytes was significantly reduced when compared with constitutive
levels from noninfected cocultures. Differences in IL-12Rß2 mRNA
expression in this assay could not be attributed to differences in
input RNA or altered efficiencies of reverse transcription between
samples as indicated by amplification of the housekeeping gene,
G3PDH, from the same samples (Fig. 6
). Furthermore, it is
clear from Fig. 6
A that the mRNA encoding IFN-
mirrored
IL-12Rß2 mRNA expression in that it did not increase during
coculture. Conversely, other mRNAs, including the mRNA encoding c-maf
increases significantly, demonstrating that not all T
lymphocyte-derived mRNAs are down-regulated after coculture with
Salmonella-infected macrophages.
|
secretion in
response to recombinant IL-12
Results presented in Fig. 6
suggested that high affinity IL-12
receptor expression might be limited in T lymphocytes cocultured with
Salmonella-infected macrophages. If true, then reductions in
IL-12-induced phosphorylation of STAT4 would be expected. To address
this possibility, T lymphocytes were cocultured with
Salmonella-infected macrophages for varying
periods of time. T lymphocytes were then removed from coculture and
exposed to recombinant IL-12. Immunoblots for phosphorylated STAT4 and
total STAT4 were then performed on cellular lysates. As seen in Fig. 7
, nylon wool enriched T lymphocytes
(Fig. 7
A) had reduced STAT4 phosphorylation after 6, 12, and
24 h of coculture with Salmonella-infected macrophages.
These differences in phosphorylation could not be explained by altered
protein loading on the gels or reduced total STAT4 in the cell
preparations because reprobing the blots for total STAT4 showed no
significant differences (Fig. 7
A).
|
If high affinity IL-12 receptor expression is reduced in T lymphocytes
cocultured with Salmonella-infected macrophages, the ability
of these T lymphocytes to secrete IFN-
in response to IL-12 should
also be reduced. To address this possibility,
CD4+ T lymphocytes were added to cultures of
Salmonella-infected macrophages for varying periods of time
(024 h). T lymphocytes were then removed from coculture, exposed to
recombinant IL-12, and assayed for IFN-
production. As shown in Fig. 8
, IL-12-induced IFN-
secretion was
significantly reduced in T lymphocytes cocultured with
Salmonella-infected macrophages. Increased time in coculture
correlated with increased reduction in inducible IFN-
production.
Taken together, these results (Figs. 7
and 8
) suggest a reduced ability
of T lymphocytes cocultured with
Salmonella-infected macrophages to signal through
high affinity IL-12 receptors.
|
To determine whether infected macrophages required direct contact
with T lymphocytes to down-regulate high affinity IL-12 receptor
activity, a Transwell coculture system was used. Infected macrophages
in the bottom chamber were separated from enriched T lymphocytes in the
upper chamber by a 0.45-µm pore membrane and cocultured in this
manner for 6, 12, or 24 h. T lymphocytes were then removed from
the upper chamber and incubated with recombinant IL-12 (5 pg/ml) for 10
min. The T lymphocytes were then lysed and Western blot analyses were
performed to quantify phosphorylated STAT4 and total STAT4 present. As
shown in Fig. 9
, IL-12-induced STAT4
phosphorylation was attenuated at 6 and 12 h (4- and 2-fold,
respectively) after coculture. These differences in phosphorylation
could not be explained by altered protein loading on the gels or by
reduced total STAT4 in the cell preparations because reprobing the
blots for total STAT4 showed no significant differences (Fig. 9
). These
data demonstrate that the reduction in high affinity IL-12 receptor
activity during cocultures of T lymphocytes with infected macrophages
was due, at least in part, to a soluble factor.
|
| Discussion |
|---|
|
|
|---|
secretion, is an important mechanism in the protective host
response against Salmonella and other intracellular
bacterial pathogens (4, 27, 28, 29, 30, 55, 56). In both humans
and mice, genetic or therapeutic alterations in this pathway result in
increased susceptibility to Salmonella infections (5, 6, 8, 57). As expected, previous studies have demonstrated a
host response which includes increases in IL-12 (4, 36)
and IFN-
(58, 59, 60).
However, it is also clear that Salmonella is an efficient
pathogen and that IL-12-induced IFN-
production is not always
sufficient or optimal to protect the host from infection. Despite a
host response that includes increased chemokine (61),
IL-12 (36, 62) and IFN-
(32, 33)
expression at mucosal surfaces, mice exposed intragastrically to
wild-type strains of Salmonella become infected and succumb
to salmonellosis if the inoculum is sufficient. The observation that
exogenous treatment with recombinant IL-12 enhances protection against
Salmonella infections (4, 31) further suggests
that endogenously produced IL-12 is insufficient to promote an optimal
host response. Interestingly, BALB/c and C57BL/6 mice are often used as
models to exploit their skewed Th2 and Th1 responsiveness, respectively
(49, 50, 51, 63); however, both strains of mice are similarly
susceptible to salmonellosis (64, 65). Taken together,
these experimental observations suggest that viable, wild-type strains
of Salmonella may be able to limit a protective Th1 response
in the host.
Due to the importance of IL-12/IL-12 receptor interactions in the
optimal host response to Salmonella, we were surprised to
find that IL-12Rß2 expression was not rapidly and significantly
up-regulated. In fact, using a sensitive RT-PCR assay, we found a
significant reduction in the constitutive levels of mRNA encoding
IL-12Rß2 at mucosal sites early in the response. This reduced mRNA
expression translated into a diminished functional capacity of the
IL-12 receptor on T lymphocytes, as evidenced by decreased
responsiveness to exogenously added IL-12. These results could be
reproduced in vitro using cocultures of infected macrophages and T
lymphocytes, where IL-12-induced STAT4 phosphorylation and IFN-
secretion was attenuated. These results strongly suggest that
Salmonella can limit the initiation of a protective Th1
response via an early and significant decrease in high affinity IL-12
receptor activity.
The ability of Salmonella to limit high affinity IL-12
receptor expression early in the host response was also unexpected in
light of previous reports that demonstrate microbial-induced increases
in IL-12 receptor expression. Leishmania and
Plasmodium infections up-regulated IL-12 receptor
expression, and in each case there was a correlation between increased
IL-12Rß2 expression in resistant vs susceptible mouse strains
(66, 67, 68). It has therefore been suggested that
up-regulation of IL-12 receptor expression is an important component of
the protective host response. Reovirus infection also up-regulates
IL-12Rß2 chain mRNA expression in Peyers patches after intragastric
infection (69). Increased IL-12 receptor mRNA expression
has also been reported during active tuberculosis and sarcoidosis
(42), although it is not clear whether this is an early,
late, or continuous event during these diseases. Taken together, these
previous studies are consistent with a host response that increases
IL-12 receptor expression after infection with pathogens that require
optimal Th1 responses for host protection. The mechanism for of IL-12
receptor up-regulation after infection with these pathogens has been
suggested to be mediated by IL-12 and/or IFN-
(21, 68, 69, 70). Such a conclusion is consistent with in vitro studies
that have clearly established that exogenously added IL-12 or IFN-
can rapidly and dramatically increase IL-12 receptor expression on T
lymphocytes (15, 17, 71). Therefore, these observations
indicate that production of IL-12 has important implications for
induction of optimal IL-12 receptor expression, either directly, or by
increasing secretion of IFN-
.
There are several points that should be made regarding the kinetics and
magnitude of Salmonella-induced reduction in IL-12Rß2
expression and activity. First, the decreases observed occurred early
in the course of the infection and correlated with the initial entry of
viable Salmonella into the respective lymphoid organs. This
observation is consistent with the possibility that early reductions in
IL-12Rß2 expression and activity facilitate the initial invasion and
spread of this pathogen. Second, it was clear that IL-12Rß2
expression and activity was not significantly increased by 48 h
postinfection, although a return to near constitutive levels had
occurred. This result was again surprising because early host
production of IL-12 (36, 40) and IFN-
(32, 33, 72) occurs in this time frame, and these cytokines would be
assumed to significantly up-regulate IL-12Rß2 expression and
activity. Third, the ability of Salmonella infection to
down-regulate IL-12Rß2 expression and activity cannot be explained by
the inability of the host to respond to this bacterium. There is a
vigorous host response against this pathogen that involves early
chemokine (61) and cytokine production (36, 62, 73). Furthermore, in the present study, we demonstrated for the
first time that the mRNA encoding T lymphocyte-derived c-maf is also
significantly increased after infection. Finally, the level of
constitutive IL-12Rß2 mRNA expression is below the level of
sensitivity for analysis by RPAs (Fig. 1
), but not for analysis by
RT-PCR (Figs. 2
and 4
). However, both assays show the same result, that
the anticipated increase in IL-12Rß2 mRNA expression did not occur
during the early host response to Salmonella infection.
Taken together, these observations support the notion that
Salmonella infection can limit IL-12Rß2 expression and
activity at a critical early stage in the infection process when this
bacterium first enters lymphoid organs and begins to establish an
infection.
It was of significant interest that c-maf mRNA expression was rapidly and dramatically increased after infection with Salmonella. c-maf is a transcriptional activator that is selectively expressed in IL-4-producing Th2 cells (46, 47, 74). This transcriptional factor can directly activate the IL-4 gene and thereby promote development of the Th2 lineage. Furthermore, increased expression of c-maf can limit development of a Th1 response, using an IL-4-independent mechanism, while facilitating the development of a Th2 response in an IL-4-dependent manner (46). Thus, early in the infection process, Salmonella up-regulates c-maf mRNA while down-regulating IL-12Rß2 mRNA expression. This would seem to be counterproductive to an optimal host response against this intracellular pathogen, which requires a dominant Th1 response for optimal protection.
This early, transient increase in c-maf does not result in significant IL-4 mRNA expression or secretion (our results and Refs. 53, 66, 72, 75). Further, we have been unable to detect significant IL-4 production in the cocultures of infected macrophages and CD4+ T cells. In addition, Transwell experiments show that infected macrophages can secrete a soluble factor that acts on T lymphocytes to down-regulate their IL-12Rß2 mRNA expression. Macrophages are not a recognized source of IL-4. Although future investigations are ongoing to identify soluble factors derived from infected macrophages that limit IL-12Rß2 expression and activity, we can conclude that this effect is not due to early IL-4 production.
There is at least one report describing the ability of viable, wild-type Salmonella to limit T lymphocyte responsiveness. Mouse macrophages infected with live Salmonella typhimurium could abrogate the ability of Ag-specific T lymphocytes to proliferate or to adoptively transfer a delayed-type hypersensitivity response (63). The mechanism for these effects was not altogether clear; however, expression of the costimulatory molecules, ICAM-1 and B7, was down-regulated in cocultures of T lymphocytes and macrophages infected with viable Salmonella (63).
In summary, it has been suggested that IL-12 can function to bridge the
gap from innate immunity to Ag-specific adaptive immunity (76, 77). IL-12 acts via several mechanisms, which include the
induction of early IFN-
secretion and the priming of Th1
differentiation (15, 17). Each of these important events
depends on the expression of high affinity IL-12 receptor expression.
Results presented here demonstrate for the first time that
Salmonella-infected macrophages can limit early expression
and activity of this receptor. These studies suggest one possible
mechanism by which infection with this intracellular pathogen might
limit the initiation of an optimal cell-mediated host response.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, University of North Carolina at Charlotte, 9201 University City Boulevard, Charlotte, NC 28223-0001. ![]()
3 Abbreviations used in this paper: IL-12Rß2, IL-12 receptor ß2 chain; RPA, RNase protection assay. ![]()
Received for publication January 21, 2000. Accepted for publication June 29, 2000.
| References |
|---|
|
|
|---|
interferon production in mouse typhoid. Infect. Immun. 64:189.[Abstract]
interferon to activate macrophages for Salmonella-killing activity. Infect. Immun. 57:609.
in host defense against mycobacteria and Salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]
secretion and not restricted to T and NK cells. J. Immunol. 163:5257.
interferon and macrophage activation. Infect. Immun. 66:4767.
(IFN-
) production by gut-associated lymphoid tissue and spleen following oral Salmonella typhimurium challenge. Microb. Pathog. 11:347.[Medline]
interferon responses in murine Peyers patches following oral immunization. Infect. Immun. 64:4606.[Abstract]
production in murine splenocytes: role of natural killer cells and macrophages. J. Immunol. 150:3973.[Abstract]
9-Tetrahydrocannabinol treatment suppresses immunity and early IFN-
, IL-12, and IL-12 receptor ß2 responses to Legionella pneumophila infection. J. Immunol. 164:6461.
ß cells and IFN-
in bacterial clearance independent of intracellular location. J. Immunol. 156:3321.[Abstract]
interferon and tumor necrosis factor
in resistance to Salmonella typhimurium infection. Infect. Immun. 60:450.
from human peripheral blood mononuclear cells in an IL-12- and/or CD28-dependent manner. J. Immunol. 160:1701.
production induced by an attenuated parasite strain. Exp. Parasitol. 84:102.[Medline]
but is partially independent of IL-12. J. Immunol. 155:3427.[Abstract]
B pathway. J. Clin. Invest. 105:79.[Medline]
and TNF-
are required for IL-12-induced development of Th1 cells producing high levels of IFN-
in BALB/c but not C57BL/6 mice. J. Immunol. 160:1708.This article has been cited by other articles:
![]() |
C. C. Bowman and K. L. Bost Cyclooxygenase-2-Mediated Prostaglandin E2 Production in Mesenteric Lymph Nodes and in Cultured Macrophages and Dendritic Cells after Infection with Salmonella J. Immunol., February 15, 2004; 172(4): 2469 - 2475. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. W. Schrum, I. Marriott, B. R. Butler, E. K. Thomas, M. C. Hudson, and K. L. Bost Functional CD40 Expression Induced following Bacterial Infection of Mouse and Human Osteoblasts Infect. Immun., March 1, 2003; 71(3): 1209 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Pascual, T. Trunkle, and J. Sura Fimbriated Salmonella enterica Serovar Typhimurium Abates Initial Inflammatory Responses by Macrophages Infect. Immun., August 1, 2002; 70(8): 4273 - 4281. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |