The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elhofy, A.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elhofy, A.
Right arrow Articles by Bost, K. L.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2000, 165: 3324-3332.
Copyright © 00 by The American Association of Immunologists

Salmonella Infection Does Not Increase Expression and Activity of the High Affinity IL-12 Receptor1

Adam Elhofy, Ian Marriott and Kenneth L. Bost2

Department of Biology, University of North Carolina, Charlotte, NC 28223


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of high affinity IL-12 receptors is required for IL-12-mediated IFN-{gamma} production. Activation of this pathway has been shown to be critical in generating optimal cell-mediated immunity. Therefore, increased IL-12 receptor expression might be expected in the host response after infection by an intracellular bacterial pathogen. In the present study, we have made the surprising discovery that infection with Salmonella results in an early reduction of high affinity IL-12 receptor expression and activation. After oral inoculation with Salmonella, the level of mRNA expression encoding IL-12 receptor ß2 (IL-12Rß2) subunit was diminished 12 h postinfection in the mesenteric lymph nodes and subsequently in the spleen. Furthermore, decreased IL-12Rß2 mRNA expression was observed in CD4+ T lymphocytes isolated from the mesenteric lymph nodes and spleens of infected mice. Attenuated IL-12Rß2 mRNA expression correlated with reduced receptor signaling, as demonstrated by reduced IL-12-induced STAT4 phosphorylation in enriched T lymphocytes isolated from the mesenteric lymph nodes and spleens of Salmonella-infected mice. These in vivo results were substantiated with an in vitro model system. In this model system, T lymphocytes cocultured with Salmonella-infected macrophages expressed less IL-12Rß2 mRNA. The cocultured T cells were also less responsive to IL-12 as assessed by reduced phosphorylation of STAT4 and limited IFN-{gamma} secretion. Together, these studies suggest that Salmonella can limit an optimal host immune response by reducing the expression and activity of high affinity IL-12 receptors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Salmonella spp. efficiently invade the intestinal mucosa and survive as intracellular pathogens of macrophages (1), and possibly dendritic cells (2). It is the ability of this pathogen to invade host cells that limits the effectiveness of Ab- and neutrophil-mediated damage (1, 3), thereby facilitating dissemination of Salmonella from mucosal sites. Because of the intracellular nature of Salmonella infections, cell-mediated immunity is required for an optimal, protective host response against this pathogen (4, 5, 6, 7).

There are several compelling lines of evidence that demonstrate that interactions between high affinity IL-12 receptors and IL-12 are critical for optimal immune responses against Salmonella. Patients who have genetic mutations and cannot express a functional, high affinity IL-12 receptor consistently present with bacterial infections caused by Mycobacterium or Salmonella species (6, 8). Furthermore, patients who have a defect in the ability to secrete IL-12 suffer from recurrent Salmonella infections (9, 10). Findings to complement these clinical observations have also been reported with the use of animal models of salmonellosis (9). Endogenous production of IL-12 in response to Salmonella infection augments the host response (4, 5), and exogenous therapy with recombinant IL-12 (4) also limits progression of salmonellosis. Taken together, these studies and clinical observations demonstrate a requirement for high affinity IL-12 receptor expression for optimal immunity against this intracellular pathogen of macrophages.

The receptor for IL-12 is composed of two subunits, designated ß1 and ß2 (11, 12, 13, 14). Whereas the ß1 component of the IL-12 receptor is constitutively expressed on various cell types, resulting in a low affinity receptor (KDa = 2–6 nM), coexpression of the ß2 (IL-12Rß2)3 chain is required for expression of the high affinity receptor (KDa = 33–65 pM) (15). The high affinity heterodimer is expressed on a limited number of cell types, including Th1 lymphocytes, CD8+ T lymphocytes, NK cells, and possibly B lymphocytes (11, 15, 16, 17, 18, 19, 20). Binding of IL-12 to the high affinity receptor signals the secretion of IFN-{gamma} and is required for optimal development of Th1 lymphocytes (21). Signaling through the high affinity IL-12 receptor requires phosphorylation of JAK2, which then phosphorylates STAT4 (22, 23, 24, 25). In fact, STAT4 phosphorylation and its subsequent translocation to the nucleus have been used to define the ability of mice to mount an optimal Th1 response (15, 17, 26). In this manner, IL-12-mediated IFN-{gamma} secretion can activate macrophages to augment the host response against intracellular bacterial pathogens (27, 28, 29, 30) such as Salmonella (4, 5, 31).

An increase in high affinity IL-12 receptor expression would be anticipated for an optimal host response against Salmonella. Previous studies have demonstrated increased IL-12 and IFN-{gamma} expression at mucosal sites (32, 33) and in cultured leukocytes exposed to this bacteria (34). Therefore, increased IL-12 receptor expression or activation after Salmonella infection would be consistent with an optimal host response that depends on IL-12-induced IFN-{gamma} production. In contrast to our expectations, we report here that infection with Salmonella elicited an early decrease in IL-12Rß2 mRNA expression and reduced IL-12 responsiveness both in vivo and in vitro. These results suggest an unexpected mechanism whereby Salmonella may limit the protective cell-mediated immune response early in infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intragastric intubation of mice with Salmonella

Specific pathogen-free BALB/c or C57BL/6 mice, weighing 20–24 g (Charles River Laboratories, Wilmington, MA), were inoculated with viable Salmonella dublin (strain SL1363) via a gastric tube. Mice received varying inocula of Salmonella from 105 to 107 bacteria per mouse, representing doses of Salmonella above and below the LD50 (i.e., 3 x 106 bacteria) for this strain of mice. At varying times postinfection, mice were euthanized, and lymphoid organs were excised for RNA isolation or for cell isolation.

RNase protection assay (RPA)

Spleens were isolated from mice orally inoculated with Salmonella, and total RNA was prepared with Trizol reagent as previously described (22, 35, 36, 37). Five micrograms of total RNA were then hybridized to RNA probes for L32, IL-12Rß2, and G3PDH. Probes were generated with a RiboQuant custom template set and a RiboQuant in vitro transcription kit according to the manufacturer’s supplied protocol (PharMingen, San Diego, CA). Hybridization was terminated after 16 h by addition of RNases A and T. Protected fragments were denatured and electrophoresed on a polyacrylamide sequencing gel. The gel was dried and then exposed to x-ray film.

Semiquantitative amplification of mRNA expression by RT-PCR

At the indicated times, total RNA was isolated from cultured cells or from mucosal tissues as previously described (22, 35, 36, 37) with Trizol reagent (Life Technologies, Gaithersburg, MD). A total of 2 µg RNA was reverse transcribed with SuperScript II reverse transcriptase (Life Technologies). A portion of the total cDNA was amplified by PCR using 94°C denaturation, 61°C annealing, and 72°C extension temperatures, with the first three cycles having extended times. Positive and negative strand primers and the number of cycles used for amplification of each mRNA species were as follows: IL-12Rß2, 30 cycles, AATCTCCATGGCAAGAAAGTCC and GTTGATGGCAGTAACACGGACT; c-maf, 30 cycles, TGTGTTCACGTTCGAGCTTT and AGGTCGGAATTGTTCATTGC; G3PDH, 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT. Amplified products were visualized under UV illumination after electrophoresis on ethidium bromide-stained agarose gels. Amplification of the appropriate gene fragments was assured by comparison with m.w. markers run on the same gel (i.e., 220 bp for IL-12Rß2; 200 bp for c-maf, and 340 bp for G3PDH). The conditions for amplification of each mRNA species were predetermined to be within the linear range of amplification as previously described (36). In addition, with the use of known amounts of IL-12Rß2 DNA, it was possible to determine that RT-PCR amplification was >1000 times more sensitive than the RPA.

Quantification of CD4+ and CD8+ T lymphocyte populations in mesenteric lymph nodes and spleen after intragastric intubation with Salmonella

To assess whether the absolute numbers of CD4+ or CD8+ T lymphocytes were altered early in the immune response against Salmonella, T lymphocyte populations were enumerated using FACS analyses (FACScalibur, Becton Dickinson, Mountain View, CA). At varying times postinoculation (0 to 48 h), the mesenteric lymph nodes and spleens were removed from euthanized mice, and single cell suspensions were prepared as described below. Cells were washed once in cold RPMI 1640 containing 1% FCS (Atlanta Biologics, Norcross, GA) and 0.05 M sodium azide. Aliquots of each isolated leukocyte population were incubated with the following PE-conjugated Abs (PharMingen); anti-mouse CD4 (clone RM4-5), anti-mouse CD8 (clone 53-6.7), or an isotype-matched control Ab (clone R35-95). After incubation for 30 min at 4°C, cells were washed twice and analyzed for fluorescence (2). The percentage of cells positive for CD4 and CD8 in each leukocyte preparation was determined by scoring 10,000 cells.

Isolation of CD4+ T lymphocytes after intragastric intubation with Salmonella

To investigate the expression of IL-12Rß2 mRNA in CD4+ T lymphocytes after intragastric inoculation with Salmonella, spleen or mesenteric lymph nodes were removed at the indicated times postinfection. Single cell suspensions were made, and CD4+ T lymphocytes were then magnetically separated using a ferritin-conjugated anti-CD4 Ab according to instructions supplied by the manufacturer (Miltenyi Biotech, Auburn, CA) using the VARIO MACS magnetic separator (Miltenyi Biotech). Cells not expressing CD4 were washed through with excess buffer, and cells retained within the column were eluted with buffer after removal of the column from the magnetic field. Cells isolated in this manner were >98% CD4+ as determined by FACS analysis. CD4+ T lymphocytes were then placed in Trizol reagent for isolation of RNA and quantification of IL-12Rß2 mRNA expression as described above.

Cocultures of Salmonella-infected macrophages and CD4+ T cells or enriched T lymphocytes

Elicited peritoneal macrophages were isolated as previously described (37). Briefly, BALB/c mice (Charles River) weighing 20–24 g were injected i.p. with 500 µl IFA (Sigma, St. Louis, MO). Three days later, the peritoneal cavities were lavaged with RPMI 1640 containing 2% FCS to remove the elicited peritoneal macrophages. After two washes, macrophages were purified by adherence to plastic culture flasks (Corning, Cambridge, MA) for 30–45 min in RPMI 1640 containing 2% FCS. Adherent macrophages were then cultured with S. dublin (strain SL1363) at varying ratios of bacteria to macrophages (10:1, 3:1, or 1:1) in RPMI 1640 supplemented with 5% FCS but containing no antibiotics. After 60 min, extracellular bacteria were removed by washing in medium, followed by the addition of RPMI 1640 supplemented with 5% FCS and gentamicin to kill any remaining extracellular bacteria. The viability of infected macrophages was assessed at the end of the experiment using trypan blue exclusion. As previously observed (38), macrophages exposed to this bacterial burden remained >95% viable throughout the culture procedure.

Total T lymphocytes or CD4+ T cells were used in these cocultures. Total T lymphocytes were enriched from splenic leukocytes by passage through a nylon wool column as previously described (39). Briefly, spleens were removed from naive BALB/c mice and disassociated by passage through a 30-gauge wire mesh screen, thereby making single cell suspensions. The dissociated cells were washed, and RBC were lysed using 0.83% ammonium chloride (Sigma). Leukocytes were resuspended in RPMI 1640 containing 5% FCS and passed slowly over a nylon wool column. Nonadherent cells were pelleted and resuspended in RPMI 1640 (Life Technologies) containing 5% FCS to a final concentration of 5 x 106 cells/ml. These cells were determined to be >80% T lymphocytes using flow cytometry (2) to detect the presence of CD3 (clone 145-2C11, PharMingen). CD4+ T cells were isolated as described above.

After exposure of macrophages to Salmonella, nylon wool-enriched T lymphocytes or magnetically purified CD4+ T cells were then added directly to these cultures. At varying times after coculture, T lymphocytes were removed and assayed for the level of mRNA expression or presence of IL-12-induced STAT4 phosphorylation by Western blot analyses as described below. In parallel experiments, cocultured T lymphocytes were also removed and assayed for IL-12-induced IFN-{gamma} production. In these studies, 105 cocultured T lymphocytes were plated in 96-well plates and cultured with varying amounts of IL-12 (0–10 pg/ml). After 48 h of culture, supernatants were taken, and the amount of IFN-{gamma} secreted was quantified by a capture ELISA (PharMingen). The amount of IFN-{gamma} in culture supernatants was determined by extrapolation of optical densities from a standard curve generated by limiting dilutions of recombinant murine IFN-{gamma}.

Transwell cultures of Salmonella-infected macrophages and enriched T lymphocytes

Isolated peritoneal macrophages were adhered to the bottom chamber of a 12-well Transwell (Corning) tissue culture plate and exposed to Salmonella at a 10:1 ratio. After 1 h of infection, extracellular Salmonella were washed off, and macrophages were cultured in RPMI containing 5% FCS and gentamicin. Nylon wool-enriched T lymphocytes isolated from the spleens of uninfected mice (5 x 105/well) were added to the upper Transwell chamber and were separated from the infected macrophages by a 0.45-µm pore membrane. Cells were cocultured for varying times (6, 12, and 24 h), and then T lymphocytes were removed from the upper chamber and incubated with IL-12 (5 pg/ml) for 10 min. T lymphocytes were then lysed and assayed for total STAT4 and STAT4 phosphorylation by Western blot analyses as described below.

Quantification of STAT4 phosphorylation by Western blot analyses

Nylon wool-enriched T lymphocytes were lysed in extraction buffer (20 mM Tris (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40, 0.02% NaN3, 10 mM NaF, 1 mM sodium orthovanadate, 0.25 mM PMSF, 1 µg/ml aprotinin, and 1 µg/ml leupeptin), and the lysate was centrifuged (16,000 x g for 20 min) at 4°C to remove the insoluble material. To reduce nonspecific interactions, the soluble lysates were precleared with protein G-agarose (Life Technologies) by incubation with the beads for 20 min at 4°C. Beads were then removed from the lysate by centrifugation. Lysates were incubated with 1 µg affinity-purified goat anti-STAT4 Ab per sample at 4°C for 1 h as suggested by the manufacturer (R&D Systems, Minneapolis, MN). The complex was then precipitated by the addition of protein G-agarose for 1 h followed by centrifugation and washing of the beads in cold extraction buffer. A 2x sample buffer (2% SDS, 20% glycerol, 125 mM Tris base, 150 mM 2-ME) was then added to each immunoprecipitate, and the beads pelleted by centrifugation. Immunoprecipitated material was loaded onto a 10% SDS-polyacrylamide gel and electrophoresed for 45 min at 140 V (Bio-Rad, Hercules, CA). After electrophoresis, gels were transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA), followed by blocking of the membranes with 5% dry milk. A biotinylated anti-phosphotyrosine Ab (clone RC20, Signal Transductions Laboratories, Lexington, KY) was added for 2 h, and unbound Ab was washed off. Streptavidin conjugated to HRP was added after removal of excess anti-phosphotyrosine Ab. The polyvinylidene difluoride membrane was then thoroughly washed, and enhanced chemiluminescence (Amersham, Arlington Heights, IL) was used for detection of bound Ab. Blots were subjected to autoradiography with KODAK MR film.

After detection of phosphorylated STAT4, the same blots were stripped and reprobed to detect total STAT4 present in each sample. Blots were stripped in a buffer (100 mM 2-ME, 2% SDS, 62.5 mM Tris-HCl (pH 6.7)) for 15 min at 50°C. Goat anti-STAT4 Ab (R&D Systems) was then added to the blots for 1 h, washed, and incubated with HRP-conjugated anti-goat Ab for 45 min. The presence of bound Ab was detected by enhanced chemiluminescence followed by autoradiography.

Densitometric analysis

Densitometric analyses were performed on PCR amplified products and autoradiographs as previously described (40). Briefly, each image was scanned into Photoshop (Adobe Systems, San Jose, CA) and saved as a TIFF image. The images were then imported into NIH image (NIH Images software), and a gel-plotting macro was then used to outline each band. Band intensities were then calculated with the uncalibrated OD setting.

Statistical analysis

Statistical analyses were performed using the Student t test (GraphPad, San Diego, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-12Rß2 mRNA expression does not increase in response to intragastric inoculation with Salmonella as determined by RPA

An optimal response against the intracellular pathogen, Salmonella, requires IL-12 induced IFN-{gamma} production (9). Expression of the high affinity IL-12 receptor is required for such a response, and patients with defects in this receptor are highly susceptible to recurrent Salmonella infection (6, 10). Because infection with other intracellular pathogens reportedly induced IL-12 receptor expression (41, 42), we anticipated that infection with Salmonella would do the same. To address this possibility, mice were orally intubated with Salmonella and sacrificed at 12-h intervals. The spleens were excised, and an RPA was performed to quantify increases in IL-12Rß2 mRNA expression.

Fig. 1Go shows the results of one such analysis. There was no detectable IL-12Rß2 mRNA expression in the spleens of mock infected mice, which is consistent with reports that show limited expression of this message by unstimulated T lymphocytes (17, 43). Surprisingly, however, no detectable increase in IL-12Rß2 mRNA expression was observed in infected mice during the first 48 h after infection (Fig. 1Go). The lack of detection of IL-12Rß2 mRNA in infected mice could not be explained by technical considerations, because IL-12-stimulated T lymphocytes showed substantial increases in 12Rß2 message, and since the presence of housekeeping genes were readily detected (L32 (ribosomal structural protein) and G3PDH).



View larger version (85K):
[in this window]
[in a new window]
 
FIGURE 1. IL-12Rß2 mRNA expression does not increase in response to intragastric inoculation with Salmonella as determined by RPA. Mice were sacrificed at 0, 12, 24, 36, and 48 h after oral inoculation with Salmonella. Spleens were excised, and total RNA was prepared and subjected to RPA to detect expression of IL-12Rß2, G3PDH, or ribosomal structural protein (L32) mRNA species. Results are shown as protected fragments electrophoresed on ethidium bromide-stained agarose gels after autoradiography. As a positive control for IL-12Rß2 mRNA expression, total RNA was isolated from CD4+ T lymphocytes treated in vitro with recombinant IL-12. These results are representative of three separate experiments.

 
IL-12Rß2 mRNA expression does not increase in response to intragastric inoculation with Salmonella as determined by RT-PCR analyses

The lack of any detectable increases in IL-12Rß2 mRNA expression using the RPA was surprising, but not definitive, because message expression was clearly below the level of detection for this technique. To overcome this limitation, a sensitive, semiquantitative RT-PCR analysis was developed and used to detect IL-12Rß2 mRNA expression after Salmonella infection.

After intubation, mice were euthanized, and RNA was isolated from the mesenteric lymph nodes and spleens. RT-PCR was performed, and as shown in Fig. 2Go, this technique could detect the presence of IL-12Rß2 mRNA in uninfected mice. This result is consistent with that previously observed after a similar RT-PCR analysis (20, 44). Consistent with those results obtained using RPA, no increases in IL-12Rß2 mRNA expression were observed in the mesenteric lymph nodes and spleens within the first 48 h after infection with Salmonella (Fig. 2Go). In fact, when densitometric scans were used to quantify the amplified products, there was a profound reduction in IL-12Rß2 mRNA expression, especially in the mesenteric lymph nodes (Fig. 2Go). As early as 12 h postinfection, constitutive levels of IL-12Rß2 mRNA were decreased >10-fold. This result was representative of 10 separate analyses in which the decreases ranged from 8- to 14-fold. By 24 h postinfection, splenic IL-12Rß2 mRNA levels were decreased by >8-fold over constitutive levels. Importantly, the kinetics of decreased IL-12ß2R mRNA correlated with the appearance of significant numbers of viable Salmonella into the spleen by 24 h (38), suggesting a cause and effect relationship. Differences in IL-12Rß2 mRNA expression in this assay could not be attributed to significant differences in input RNA or efficiencies of reverse transcription between samples as indicated by amplification of the housekeeping gene, G3PDH, from the same samples (Fig. 2Go).



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 2. IL-12Rß2 mRNA expression does not increase in response to intragastric inoculation with Salmonella as determined by RT-PCR. At varying times postinfection (0, 12, 24, and 36 h), the mesenteric lymph nodes (MLN) and spleens were removed. Total RNA was extracted from these organs, and semiquantitative RT-PCR was performed for IL-12Rß2, c-maf, and G3PDH mRNA expression. Results are shown as amplified products electrophoresed on ethidium bromide-stained agarose gels under UV illumination. Results are representative of 10 separate experiments, each performed on distinct animal groups.

 
In response to Salmonella infection, the transcription of numerous host genes occurs, including substantial increases in IL-12 mRNA expression at mucosal and systemic sites (36, 40). In analyzing a variety of genes that were up-regulated at mucosal sites immediately after infection, we were again surprised to find that the mRNA encoding the transcriptional factor, c-maf, was increased (Fig. 2Go). This result was especially unexpected in light of the importance of c-maf expression for optimal IL-4 production (45, 46, 47). This transient increase in c-maf was not sufficient to induce detectable IL-4 mRNA expression at mucosal sites (data not shown), which is consistent with previous reports (48).

The results presented in Fig. 2Go were obtained from mice given 3 x 106 Salmonella, which corresponds to the LD50 for BALB/c mice when given intragastrically. Importantly, up to 10-fold decreases in IL-12Rß2 mRNA expression were also observed in mice given lower inocula of Salmonella (i.e., 5 x 105). Furthermore, similar decreases in IL-12Rß2 mRNA expression have also been observed in the mesenteric lymph nodes of C57BL/6 mice (data not shown), demonstrating that the effect observed here cannot be attributed solely to the Th2 nature of BALB/c mice (49, 50, 51).

Enumeration of CD4+ and CD8+ T lymphocytes in the mesenteric lymph nodes and spleens after intragastric inoculation with Salmonella

One possible explanation for decreased IL-12Rß2 mRNA expression soon after intragastric inoculation with Salmonella could be a reduction in the number of cells expressing this receptor in the mesenteric lymph nodes and spleen. Because CD4+ and CD8+ T lymphocytes are the predominant cells expressing the high affinity IL-12 receptor in these lymphoid organs, FACS analysis was performed to quantify the proportions of these cells types present after infection. As shown in Fig. 3Go, no significant differences in the numbers of CD4+ or CD8+ T lymphocytes in the mesenteric lymph nodes and spleens were observed during the first 48 h after infection. Further, the total leukocyte numbers in each of these lymphoid organs did not vary more than 18% during the first 48 h following infection (data not shown). These results strongly suggest that differences in IL-12Rß2 mRNA expression after intragastric inoculation with Salmonella cannot be explained by reductions in the absolute numbers of CD4+ or CD8+ T lymphocytes.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 3. Enumeration of CD4+ and CD8+ T lymphocytes in the mesenteric lymph nodes and spleens after intragastric inoculation with Salmonella. At varying times after intragastric inoculation with Salmonella (6, 12, 24, and 48 h), the mesenteric lymph nodes and spleens were removed, and single cell suspensions were made. Total cells were immunofluorescently stained with PE-conjugated anti-CD4 (A) or anti-CD8+ (B) Abs, respectively. The percentage of cells staining for CD4 or CD8 was determined by flow cytometric analysis of 10,000 cells per sample. This experiment was performed twice with similar results.

 
No increases in IL-12Rß2 mRNA expression in mesenteric lymph node and splenic CD4+ T lymphocytes after intragastric inoculation with Salmonella

NK cells, CD4+ and CD8+ T lymphocytes, and possibly B lymphocytes can express high affinity IL-12 receptors (11, 15, 16, 17, 18, 19, 20). Due to the importance of CD4+ T lymphocytes in the protective immune response against Salmonella (52, 53, 54), we questioned whether down-regulation of IL-12Rß2 mRNA expression occurred in this cell population after infection.

Mice were intragastrically inoculated with Salmonella, and at varying times postinfection, CD4+ T lymphocytes were purified from the mesenteric lymph nodes and spleens by magnetic separation. RNA was then isolated from these cells and subjected to RT-PCR for IL-12Rß2 mRNA expression. As shown in Fig. 4Go, CD4+ T lymphocytes from the mesenteric lymph nodes and spleens showed significant reductions in IL-12Rß2 mRNA expression (20- and 10-fold, respectively) at 24 h after infection. Importantly, the kinetics of IL-12Rß2 mRNA reduction paralleled the kinetics of entry of viable bacteria in these respective lymphoid organs as previously described (38). Again, differences in IL-12Rß2 mRNA expression in this assay could not be attributed to significant differences in input RNA or efficiencies of reverse transcription between samples as indicated by amplification of the housekeeping gene, G3PDH, from the same samples (Fig. 4Go).



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 4. No increases in IL-12Rß2 mRNA expression in mesenteric lymph node and splenic CD4+ T lymphocytes after intragastric inoculation with Salmonella. At varying times after infection (12, 24, and 48 h), mesenteric lymph nodes and spleens were removed, and CD4+ T lymphocytes were isolated by magnetic separation. RNA was extracted from the CD4+ T lymphocytes, and semiquantitative RT-PCR was performed for IL-12Rß2 and G3PDH mRNA expression. Results are shown as amplified products electrophoresed on ethidium bromide-stained agarose gels under UV illumination. Results shown here are representative of two separate experiments, each performed on different groups of mice.

 
Decreased IL-12-induced STAT4 phosphorylation in enriched T lymphocytes from the mesenteric lymph nodes after intragastric inoculation with Salmonella

No Abs currently exist for quantification of murine IL-12Rß2 protein expression; however, phosphorylation of STAT4 in response to IL-12 binding its high affinity receptor has been used as a functional assay to define the presence of this cell surface receptor (15, 17). If decreased IL-12Rß2 mRNA expression translates into limited receptor expression, then a reduction in receptor activity would also be expected. We next questioned whether enriched T lymphocytes from the mesenteric lymph nodes of infected mice were limited in their responsiveness to IL-12.

Mice were intragastrically inoculated with Salmonella, and at varying times postinfection mesenteric lymph nodes were removed. Nylon wool-enriched T lymphocytes from these organs were exposed to recombinant IL-12 for 10 min before cell lysis. Total STAT4 was immunoprecipitated from cell lysates, and Western blot analyses were performed to quantify phosphorylation of this protein induced by exposure of lymphocytes to IL-12. As shown in Fig. 5Go, significant decreases in STAT4 phosphorylation were observed at 12 and 24 h postinfection (6- and 4-fold decreases compared with uninfected, respectively). These differences in phosphorylation could not be explained by altered protein loading on the gels or a reduction in STAT4 protein, as evidenced by no significant differences in the levels of total STAT4 in CD4+ T lymphocytes isolated from control and infected mice (Fig. 5Go). These results demonstrate that Salmonella-induced decreases in IL-12Rß2 mRNA expression (Figs. 2Go and 4Go) correlated with reduced responsiveness of these cells to IL-12 (Fig. 4Go), suggesting decreased expression of the high affinity IL-12 receptor.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 5. Decreased IL-12-induced STAT4 phosphorylation in enriched T lymphocytes from the mesenteric lymph nodes after intragastric inoculation with Salmonella. At varying times after intragastric inoculation with Salmonella (12, 24, 36, and 48 h), the mesenteric lymph nodes and spleens were removed, and T lymphocytes were isolated. Enriched T lymphocytes were exposed to recombinant IL-12 (5 pg/ml) for 10 min, followed by lysis of cells. Total STAT4 was immunoprecipitated from lysates and then electrophoresed on SDS-polyacrylamide gels. Western blots were performed using an anti-phosphotyrosine Ab to detect phosphorylated STAT4. Blots were then stripped and reprobed using an anti-STAT4 Ab to detect total STAT4 in each sample. Detection of immunoreactive protein bands was performed using enhanced chemiluminescence. This experiment was performed four times with similar results.

 
T lymphocytes cocultured with Salmonella-infected macrophages do not increase IL-12Rß2 mRNA expression

An in vitro model was established to provide support for our in vivo observations. Because Salmonella is an intracellular pathogen, macrophages were isolated from normal mice and exposed to Salmonella in vitro. After removal of extracellular Salmonella, enriched T lymphocytes isolated from normal mice were then added to these infected macrophages. Cells were cocultured for varying times and assayed for the expression of IL-12Rß2 mRNA expression by RT-PCR. As shown in Fig. 6Go, IL-12Rß2 mRNA expression by nylon wool-enriched (Fig. 6GoA) or CD4+-purified (Fig. 6GoB) T lymphocytes was significantly reduced when compared with constitutive levels from noninfected cocultures. Differences in IL-12Rß2 mRNA expression in this assay could not be attributed to differences in input RNA or altered efficiencies of reverse transcription between samples as indicated by amplification of the housekeeping gene, G3PDH, from the same samples (Fig. 6Go). Furthermore, it is clear from Fig. 6GoA that the mRNA encoding IFN-{gamma} mirrored IL-12Rß2 mRNA expression in that it did not increase during coculture. Conversely, other mRNAs, including the mRNA encoding c-maf increases significantly, demonstrating that not all T lymphocyte-derived mRNAs are down-regulated after coculture with Salmonella-infected macrophages.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 6. T lymphocytes cocultured with Salmonella-infected macrophages do not increase IL-12Rß2 mRNA expression. Normal peritoneal macrophages were isolated and exposed to Salmonella for 1 h, followed by removal of extracellular bacteria. Nylon wool-enriched T lymphocytes (A) or purified CD4+ T lymphocytes (B) were isolated from normal mouse spleens and cocultured with the infected macrophages for 0, 12, or 24 h. T lymphocytes were then removed from coculture, and RNA was extracted for semiquantitative RT-PCR to detect IL-12Rß2, IFN-{gamma}, c-maf, and G3PDH mRNA expression. Results, shown as amplified products electrophoresed on ethidium bromide-stained agarose gels under UV illumination, are representative of two separate experiments, on different groups of mice.

 
T lymphocytes cocultured with Salmonella-infected macrophages have reduced STAT4 phosphorylation and IFN-{gamma} secretion in response to recombinant IL-12

Results presented in Fig. 6Go suggested that high affinity IL-12 receptor expression might be limited in T lymphocytes cocultured with Salmonella-infected macrophages. If true, then reductions in IL-12-induced phosphorylation of STAT4 would be expected. To address this possibility, T lymphocytes were cocultured with Salmonella-infected macrophages for varying periods of time. T lymphocytes were then removed from coculture and exposed to recombinant IL-12. Immunoblots for phosphorylated STAT4 and total STAT4 were then performed on cellular lysates. As seen in Fig. 7Go, nylon wool enriched T lymphocytes (Fig. 7GoA) had reduced STAT4 phosphorylation after 6, 12, and 24 h of coculture with Salmonella-infected macrophages. These differences in phosphorylation could not be explained by altered protein loading on the gels or reduced total STAT4 in the cell preparations because reprobing the blots for total STAT4 showed no significant differences (Fig. 7GoA).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 7. T lymphocytes cocultured with Salmonella-infected macrophages have reduced STAT4 phosphorylation in response to recombinant IL-12. Normal peritoneal macrophages (m{phi}) were isolated and exposed to Salmonella for 1 h, followed by removal of extracellular bacteria. Nylon wool-enriched T lymphocytes (A and B) or purified CD4+ T lymphocytes (C) were isolated from normal mouse spleens and cocultured with the infected macrophages for 0, 6, 12, or 24 h. T lymphocytes were then removed and exposed to recombinant IL-12, followed by immunoblots to quantify phosphorylated STAT4 and total STAT4. A, Representative immunoblot of phosphorylated STAT4 and total STAT4 from enriched T lymphocytes. Densitometric scans were then made of the immunoblots to calculate the ratios between STAT4 phosphorylation and total STAT4 contents to show the percentage change from time zero. B, Percent decrease in STAT4 phosphorylation using densitometric measurements from the immunoblot shown in A. In addition, C shows the percent decrease in STAT4 STAT4 phosphorylation according to densitometric measurements from a representative immunoblot (not shown) using CD4+ T lymphocytes. An additional control included cocultures of uninfected macrophages and T lymphocytes for 24 h before removal of cells or supernatant for analyses (UI). These experiments were each performed three times. *, Statistically significant differences when compared with uninfected control cocultures (p < 0.01).

 
To quantify the difference in phosphorylation, densitometric scans were performed on the Western blots. The ratio of STAT4 phosphorylation to total STAT4 was calculated for each sample, and Fig. 7Go, B and C, shows decreased IL-12-induced STAT4 phosphorylation from cocultures of nylon wool-enriched or CD4+-purified T lymphocytes and infected macrophages, respectively.

If high affinity IL-12 receptor expression is reduced in T lymphocytes cocultured with Salmonella-infected macrophages, the ability of these T lymphocytes to secrete IFN-{gamma} in response to IL-12 should also be reduced. To address this possibility, CD4+ T lymphocytes were added to cultures of Salmonella-infected macrophages for varying periods of time (0–24 h). T lymphocytes were then removed from coculture, exposed to recombinant IL-12, and assayed for IFN-{gamma} production. As shown in Fig. 8Go, IL-12-induced IFN-{gamma} secretion was significantly reduced in T lymphocytes cocultured with Salmonella-infected macrophages. Increased time in coculture correlated with increased reduction in inducible IFN-{gamma} production. Taken together, these results (Figs. 7Go and 8Go) suggest a reduced ability of T lymphocytes cocultured with Salmonella-infected macrophages to signal through high affinity IL-12 receptors.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 8. CD4+ T lymphocytes cocultured with Salmonella-infected macrophages have reduced IFN-{gamma} secretion in response to recombinant IL-12. Normal peritoneal macrophages were isolated and exposed to Salmonella for 1 h, followed by removal of extracellular bacteria. CD4+ T lymphocytes were isolated from normal mouse spleens and cocultured with the infected macrophages for 0, 6, 12, or 24 h. T lymphocytes were then removed and exposed to recombinant IL-12, followed by quantification of IFN-{gamma} secretion 48 h later. An additional control included cocultures of uninfected macrophages and T lymphocytes for 24 h before removal of cells or supernatant for analyses (UI). These experiments were each performed three times. *, Statistically significant differences when compared with uninfected control cocultures (p < 0.01).

 
T lymphocytes cocultured in Transwell plates with Salmonella-infected macrophages have decreased IL-12-induced phosphorylation of STAT4

To determine whether infected macrophages required direct contact with T lymphocytes to down-regulate high affinity IL-12 receptor activity, a Transwell coculture system was used. Infected macrophages in the bottom chamber were separated from enriched T lymphocytes in the upper chamber by a 0.45-µm pore membrane and cocultured in this manner for 6, 12, or 24 h. T lymphocytes were then removed from the upper chamber and incubated with recombinant IL-12 (5 pg/ml) for 10 min. The T lymphocytes were then lysed and Western blot analyses were performed to quantify phosphorylated STAT4 and total STAT4 present. As shown in Fig. 9Go, IL-12-induced STAT4 phosphorylation was attenuated at 6 and 12 h (4- and 2-fold, respectively) after coculture. These differences in phosphorylation could not be explained by altered protein loading on the gels or by reduced total STAT4 in the cell preparations because reprobing the blots for total STAT4 showed no significant differences (Fig. 9Go). These data demonstrate that the reduction in high affinity IL-12 receptor activity during cocultures of T lymphocytes with infected macrophages was due, at least in part, to a soluble factor.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 9. T lymphocytes cocultured in Transwell plates with Salmonella-infected macrophages have decreased IL-12-induced phosphorylation of STAT4. Normal peritoneal macrophages were isolated and placed in the bottom chamber of Transwell plates. Macrophages were exposed to Salmonella for 1 h, followed by removal of extracellular bacteria. Enriched T lymphocytes from normal mouse spleens were placed in the upper chamber and then cocultured with the infected macrophages for 0, 6, 12, and 24 h. T lymphocytes were then removed from the Transwell upper chamber, exposed to recombinant IL-12, followed by immunoblots to quantify phosphorylated STAT4 and total STAT4. A representative immunoblot of three separate experiments is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-12, interacting with its high affinity receptor to induce IFN-{gamma} secretion, is an important mechanism in the protective host response against Salmonella and other intracellular bacterial pathogens (4, 27, 28, 29, 30, 55, 56). In both humans and mice, genetic or therapeutic alterations in this pathway result in increased susceptibility to Salmonella infections (5, 6, 8, 57). As expected, previous studies have demonstrated a host response which includes increases in IL-12 (4, 36) and IFN-{gamma} (58, 59, 60).

However, it is also clear that Salmonella is an efficient pathogen and that IL-12-induced IFN-{gamma} production is not always sufficient or optimal to protect the host from infection. Despite a host response that includes increased chemokine (61), IL-12 (36, 62) and IFN-{gamma} (32, 33) expression at mucosal surfaces, mice exposed intragastrically to wild-type strains of Salmonella become infected and succumb to salmonellosis if the inoculum is sufficient. The observation that exogenous treatment with recombinant IL-12 enhances protection against Salmonella infections (4, 31) further suggests that endogenously produced IL-12 is insufficient to promote an optimal host response. Interestingly, BALB/c and C57BL/6 mice are often used as models to exploit their skewed Th2 and Th1 responsiveness, respectively (49, 50, 51, 63); however, both strains of mice are similarly susceptible to salmonellosis (64, 65). Taken together, these experimental observations suggest that viable, wild-type strains of Salmonella may be able to limit a protective Th1 response in the host.

Due to the importance of IL-12/IL-12 receptor interactions in the optimal host response to Salmonella, we were surprised to find that IL-12Rß2 expression was not rapidly and significantly up-regulated. In fact, using a sensitive RT-PCR assay, we found a significant reduction in the constitutive levels of mRNA encoding IL-12Rß2 at mucosal sites early in the response. This reduced mRNA expression translated into a diminished functional capacity of the IL-12 receptor on T lymphocytes, as evidenced by decreased responsiveness to exogenously added IL-12. These results could be reproduced in vitro using cocultures of infected macrophages and T lymphocytes, where IL-12-induced STAT4 phosphorylation and IFN-{gamma} secretion was attenuated. These results strongly suggest that Salmonella can limit the initiation of a protective Th1 response via an early and significant decrease in high affinity IL-12 receptor activity.

The ability of Salmonella to limit high affinity IL-12 receptor expression early in the host response was also unexpected in light of previous reports that demonstrate microbial-induced increases in IL-12 receptor expression. Leishmania and Plasmodium infections up-regulated IL-12 receptor expression, and in each case there was a correlation between increased IL-12Rß2 expression in resistant vs susceptible mouse strains (66, 67, 68). It has therefore been suggested that up-regulation of IL-12 receptor expression is an important component of the protective host response. Reovirus infection also up-regulates IL-12Rß2 chain mRNA expression in Peyer’s patches after intragastric infection (69). Increased IL-12 receptor mRNA expression has also been reported during active tuberculosis and sarcoidosis (42), although it is not clear whether this is an early, late, or continuous event during these diseases. Taken together, these previous studies are consistent with a host response that increases IL-12 receptor expression after infection with pathogens that require optimal Th1 responses for host protection. The mechanism for of IL-12 receptor up-regulation after infection with these pathogens has been suggested to be mediated by IL-12 and/or IFN-{gamma} (21, 68, 69, 70). Such a conclusion is consistent with in vitro studies that have clearly established that exogenously added IL-12 or IFN-{gamma} can rapidly and dramatically increase IL-12 receptor expression on T lymphocytes (15, 17, 71). Therefore, these observations indicate that production of IL-12 has important implications for induction of optimal IL-12 receptor expression, either directly, or by increasing secretion of IFN-{gamma}.

There are several points that should be made regarding the kinetics and magnitude of Salmonella-induced reduction in IL-12Rß2 expression and activity. First, the decreases observed occurred early in the course of the infection and correlated with the initial entry of viable Salmonella into the respective lymphoid organs. This observation is consistent with the possibility that early reductions in IL-12Rß2 expression and activity facilitate the initial invasion and spread of this pathogen. Second, it was clear that IL-12Rß2 expression and activity was not significantly increased by 48 h postinfection, although a return to near constitutive levels had occurred. This result was again surprising because early host production of IL-12 (36, 40) and IFN-{gamma} (32, 33, 72) occurs in this time frame, and these cytokines would be assumed to significantly up-regulate IL-12Rß2 expression and activity. Third, the ability of Salmonella infection to down-regulate IL-12Rß2 expression and activity cannot be explained by the inability of the host to respond to this bacterium. There is a vigorous host response against this pathogen that involves early chemokine (61) and cytokine production (36, 62, 73). Furthermore, in the present study, we demonstrated for the first time that the mRNA encoding T lymphocyte-derived c-maf is also significantly increased after infection. Finally, the level of constitutive IL-12Rß2 mRNA expression is below the level of sensitivity for analysis by RPAs (Fig. 1Go), but not for analysis by RT-PCR (Figs. 2Go and 4Go). However, both assays show the same result, that the anticipated increase in IL-12Rß2 mRNA expression did not occur during the early host response to Salmonella infection. Taken together, these observations support the notion that Salmonella infection can limit IL-12Rß2 expression and activity at a critical early stage in the infection process when this bacterium first enters lymphoid organs and begins to establish an infection.

It was of significant interest that c-maf mRNA expression was rapidly and dramatically increased after infection with Salmonella. c-maf is a transcriptional activator that is selectively expressed in IL-4-producing Th2 cells (46, 47, 74). This transcriptional factor can directly activate the IL-4 gene and thereby promote development of the Th2 lineage. Furthermore, increased expression of c-maf can limit development of a Th1 response, using an IL-4-independent mechanism, while facilitating the development of a Th2 response in an IL-4-dependent manner (46). Thus, early in the infection process, Salmonella up-regulates c-maf mRNA while down-regulating IL-12Rß2 mRNA expression. This would seem to be counterproductive to an optimal host response against this intracellular pathogen, which requires a dominant Th1 response for optimal protection.

This early, transient increase in c-maf does not result in significant IL-4 mRNA expression or secretion (our results and Refs. 53, 66, 72, 75). Further, we have been unable to detect significant IL-4 production in the cocultures of infected macrophages and CD4+ T cells. In addition, Transwell experiments show that infected macrophages can secrete a soluble factor that acts on T lymphocytes to down-regulate their IL-12Rß2 mRNA expression. Macrophages are not a recognized source of IL-4. Although future investigations are ongoing to identify soluble factors derived from infected macrophages that limit IL-12Rß2 expression and activity, we can conclude that this effect is not due to early IL-4 production.

There is at least one report describing the ability of viable, wild-type Salmonella to limit T lymphocyte responsiveness. Mouse macrophages infected with live Salmonella typhimurium could abrogate the ability of Ag-specific T lymphocytes to proliferate or to adoptively transfer a delayed-type hypersensitivity response (63). The mechanism for these effects was not altogether clear; however, expression of the costimulatory molecules, ICAM-1 and B7, was down-regulated in cocultures of T lymphocytes and macrophages infected with viable Salmonella (63).

In summary, it has been suggested that IL-12 can function to bridge the gap from innate immunity to Ag-specific adaptive immunity (76, 77). IL-12 acts via several mechanisms, which include the induction of early IFN-{gamma} secretion and the priming of Th1 differentiation (15, 17). Each of these important events depends on the expression of high affinity IL-12 receptor expression. Results presented here demonstrate for the first time that Salmonella-infected macrophages can limit early expression and activity of this receptor. These studies suggest one possible mechanism by which infection with this intracellular pathogen might limit the initiation of an optimal cell-mediated host response.


    Footnotes
 
1 This work was supported in part by National Institutes of Health Grant AI32976. Back

2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, University of North Carolina at Charlotte, 9201 University City Boulevard, Charlotte, NC 28223-0001. Back

3 Abbreviations used in this paper: IL-12Rß2, IL-12 receptor ß2 chain; RPA, RNase protection assay. Back

Received for publication January 21, 2000. Accepted for publication June 29, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Finlay, B. B., S. Falkow. 1989. Salmonella as an intracellular parasite. Mol. Microbiol. 3:1833.[Medline]
  2. Marriott, I., T. G. Hammond, E. K. Thomas, K. L. Bost. 1999. Salmonella efficiently enter and survive within cultured CD11c+ dendritic cells initiating cytokine expression. Eur. J. Immunol. 29:1107.[Medline]
  3. Finlay, B. B., P. Cossart. 1997. Exploitation of mammalian host cell functions by bacterial pathogens [published erratum appears in Science 1997;278(5337):373] [see comments]. Science 276:718.[Abstract/Free Full Text]
  4. Kincy-Cain, T., J. D. Clements, K. L. Bost. 1996. Endogenous and exogenous interleukin-12 augment the protective immune response in mice orally challenged with Salmonella dublin. Infect. Immun. 64:1437.[Abstract]
  5. Mastroeni, P., J. A. Harrison, J. A. Chabalgoity, C. E. Hormaeche. 1996. Effect of interleukin 12 neutralization on host resistance and {gamma} interferon production in mouse typhoid. Infect. Immun. 64:189.[Abstract]
  6. de Jong, R., F. Altare, I. A. Haagen, D. G. Elferink, T. Boer, P. J. van Breda Vriesman, P. J. Kabel, J. M. Draaisma, J. T. van Dissel, F. P. Kroon, et al 1998. Severe mycobacterial and Salmonella infections in interleukin-12 receptor-deficient patients. Science 280:1435.[Abstract/Free Full Text]
  7. Kagaya, K., K. Watanabe, Y. Fukazawa. 1989. Capacity of recombinant {gamma} interferon to activate macrophages for Salmonella-killing activity. Infect. Immun. 57:609.[Abstract/Free Full Text]
  8. Altare, F., A. Durandy, D. Lammas, J. F. Emile, S. Lamhamedi, F. Le Deist, P. Drysdale, E. Jouanguy, R. Doffinger, F. Bernaudin, et al 1998. Impairment of mycobacterial immunity in human interleukin-12 receptor deficiency. Science 280:1432.[Abstract/Free Full Text]
  9. Jouanguy, E., R. Doffinger, S. Dupuis, A. Pallier, F. Altare, J. L. Casanova. 1999. IL-12 and IFN-{gamma} in host defense against mycobacteria and Salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]
  10. Altare, F., D. Lammas, P. Revy, E. Jouanguy, R. Doffinger, S. Lamhamedi, P. Drysdale, D. Scheel-Toellner, J. Girdlestone, P. Darbyshire, et al 1998. Inherited interleukin 12 deficiency in a child with bacille Calmette-Guérin and Salmonella enteritidis disseminated infection. J. Clin. Invest. 102:2035.[Medline]
  11. Wu, C., J. Ferrante, M. K. Gately, J. Magram. 1997. Characterization of IL-12 receptor ß1 chain (IL-12Rß1)-deficient mice: IL-12Rß1 is an essential component of the functional mouse IL-12 receptor. J. Immunol. 159:1658.[Abstract]
  12. Gubler, U., D. H. Presky. 1996. Molecular biology of interleukin-12 receptors. Ann. NY Acad. Sci. 795:36.[Medline]
  13. Chua, A. O., V. L. Wilkinson, D. H. Presky, U. Gubler. 1995. Cloning and characterization of a mouse IL-12 receptor-ß component. J. Immunol. 155:4286.[Abstract]
  14. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  15. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  16. Gollob, J. A., C. P. Schnipper, E. Orsini, E. Murphy, J. F. Daley, S. B. Lazo, D. A. Frank, D. Neuberg, J. Ritz. 1998. Characterization of a novel subset of CD8+ T cells that expands in patients receiving interleukin-12. J. Clin. Invest. 102:561.[Medline]
  17. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  18. Yu, C. R., H. A. Young, J. R. Ortaldo. 1998. Characterization of cytokine differential induction of STAT complexes in primary human T and NK cells. J. Leukocyte Biol. 64:245.[Abstract]
  19. Wu, C. Y., R. R. Warrier, D. M. Carvajal, A. O. Chua, L. J. Minetti, R. Chizzonite, P. K. Mongini, A. S. Stern, U. Gubler, D. H. Presky, et al 1996. Biological function and distribution of human interleukin-12 receptor ß chain. Eur. J. Immunol. 26:345.[Medline]
  20. Thibodeaux, D. K., S. E. Hunter, K. E. Waldburger, J. L. Bliss, W. L. Trepicchio, J. P. Sypek, K. Dunussi-Joannopoulos, S. J. Goldman, J. P. Leonard. 1999. Autocrine regulation of IL-12 receptor expression is independent of secondary IFN-{gamma} secretion and not restricted to T and NK cells. J. Immunol. 163:5257.[Abstract/Free Full Text]
  21. Sinigaglia, F., D. D’Ambrosio, P. Panina-Bordignon, L. Rogge. 1999. Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function. Immunol. Rev. 170:65.[Medline]
  22. Bacon, C. M., E. F. R. Petricoin, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  23. Bacon, C. M., S. S. Cho, J. J. O’Shea. 1996. Signal transduction by interleukin-12 and interleukin-2: a comparison and contrast. Ann. NY Acad. Sci. 795:41.[Medline]
  24. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  25. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, et al 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  26. Rogge, L., D. D’Ambrosio, M. Biffi, G. Penna, L. J. Minetti, D. H. Presky, L. Adorini, F. Sinigaglia. 1998. The role of Stat4 in species-specific regulation of Th cell development by type I IFNs. J. Immunol. 161:6567.[Abstract/Free Full Text]
  27. Cooper, A. M., A. D. Roberts, E. R. Rhoades, J. E. Callahan, D. M. Getzy, I. M. Orme. 1995. The role of interleukin-12 in acquired immunity to Mycobacterium tuberculosis infection. Immunology 84:423.[Medline]
  28. Heinzel, F. P., D. S. Schoenhaut, R. M. Rerko, L. E. Rosser, M. K. Gately. 1993. Recombinant interleukin 12 cures mice infected with Leishmania major. J. Exp. Med. 177:1505.[Abstract/Free Full Text]
  29. Flynn, J. L., M. M. Goldstein, K. J. Triebold, J. Sypek, S. Wolf, B. R. Bloom. 1995. IL-12 increases resistance of BALB/c mice to Mycobacterium tuberculosis infection. J. Immunol. 155:2515.[Abstract]
  30. Murray, H. W., J. Hariprashad. 1995. Interleukin 12 is effective treatment for an established systemic intracellular infection: experimental visceral leishmaniasis. J. Exp. Med. 181:387.[Abstract/Free Full Text]
  31. Mastroeni, P., J. A. Harrison, J. H. Robinson, S. Clare, S. Khan, D. J. Maskell, G. Dougan, C. E. Hormaeche. 1998. Interleukin-12 is required for control of the growth of attenuated aromatic-compound-dependent salmonellae in BALB/c mice: role of {gamma} interferon and macrophage activation. Infect. Immun. 66:4767.[Abstract/Free Full Text]
  32. Ramarathinam, L., R. A. Shaban, D. W. Niesel, G. R. Klimpel. 1991. Interferon {gamma} (IFN-{gamma}) production by gut-associated lymphoid tissue and spleen following oral Salmonella typhimurium challenge. Microb. Pathog. 11:347.[Medline]
  33. George, A.. 1996. Generation of {gamma} interferon responses in murine Peyer’s patches following oral immunization. Infect. Immun. 64:4606.[Abstract]
  34. Ramarathinam, L., D. W. Niesel, G. R. Klimpel. 1993. Salmonella typhimurium induces IFN-{gamma} production in murine splenocytes: role of natural killer cells and macrophages. J. Immunol. 150:3973.[Abstract]
  35. Bost, K. L., S. C. Bieligk, B. M. Jaffe. 1995. Lymphokine mRNA expression by transplantable murine B lymphocytic malignancies: tumor-derived IL-10 as a possible mechanism for modulating the anti-tumor response. J. Immunol. 154:718.[Abstract]
  36. Bost, K. L., J. D. Clements. 1995. In vivo induction of interleukin-12 mRNA expression after oral immunization with Salmonella dublin or the B subunit of Escherichia coli heat-labile enterotoxin. Infect. Immun. 63:1076.[Abstract]
  37. Bost, K. L., M. J. Mason. 1995. Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases of IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages. J. Immunol. 155:285.[Abstract]
  38. Kincy-Cain, T., K. L. Bost. 1996. Increased susceptibility of mice to Salmonella infection following in vivo treatment with the substance P antagonist, spantide II. J. Immunol. 157:255.[Abstract]
  39. Hathcock, K. S.. 1991. T-cell enrichment by nonadherence to nylon. J. E. Coligan, and A. M. Kruisbeck, and D. H. Margulies, and E. M. Shevach, and W. Strober, eds. In Current Protocols In Immunology Vol. 1:3.2.1. John Wiley and Sons, New York.
  40. Elhofy, A., K. Bost. 1999. Limited interleukin-18 response in Salmonella-infected murine macrophages and in Salmonella-infected mice. Infect. Immun. 67:5021.[Abstract/Free Full Text]
  41. Vingerhoets, J., E. Bisalinkumi, G. Penne, R. Colebunders, E. Bosmans, L. Kestens, G. Vanham. 1998. Altered receptor expression and decreased sensitivity of T-cells to the stimulatory cytokines IL-2, IL-7 and IL-12 in HIV infection. Immunol. Lett. 61:53.[Medline]
  42. Taha, R. A., E. M. Minshall, R. Olivenstein, D. Ihaku, B. Wallaert, A. Tsicopoulos, A. B. Tonnel, R. Damia, D. Menzies, Q. A. Hamid. 1999. Increased expression of IL-12 receptor mRNA in active pulmonary tuberculosis and sarcoidosis. Am. J. Respir. Crit. Care Med. 160:1119.[Abstract/Free Full Text]
  43. Himmelrich, H., P. Launois, I. Maillard, T. Biedermann, F. Tacchini-Cottier, R. M. Locksley, M. Rocken, J. A. Louis. 2000. In BALB/c mice, IL-4 production during the initial phase of infection with Leishmania major is necessary and sufficient to instruct Th2 cell development resulting in progressive disease. J. Immunol. 164:4819.[Abstract/Free Full Text]
  44. Klein, T. W., C. A. Newton, N. Nakachi, H. Friedman. 2000. {Delta}9-Tetrahydrocannabinol treatment suppresses immunity and early IFN-{gamma}, IL-12, and IL-12 receptor ß2 responses to Legionella pneumophila infection. J. Immunol. 164:6461.[Abstract/Free Full Text]
  45. Ho, I. C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  46. Ho, I. C., D. Lo, L. H. Glimcher. 1998. c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation by both interleukin 4-dependent and -independent mechanisms. J. Exp. Med. 188:1859.[Abstract/Free Full Text]
  47. Kim, J. I., I. C. Ho, M. J. Grusby, L. H. Glimcher. 1999. The transcription factor c-Maf controls the production of interleukin-4 but not other Th2 cytokines. Immunity 10:745.[Medline]
  48. VanCott, J. L., H. F. Staats, D. W. Pascual, M. Roberts, S. N. Chatfield, M. Yamamoto, M. Coste, P. B. Carter, H. Kiyono, J. R. McGhee. 1996. Regulation of mucosal and systemic antibody responses by T helper cell subsets, macrophages, and derived cytokines following oral immunization with live recombinant Salmonella. J. Immunol. 156:1504.[Abstract]
  49. Brown, D. R., J. M. Green, N. H. Moskowitz, M. Davis, C. B. Thompson, S. L. Reiner. 1996. Limited role of CD28-mediated signals in T helper subset differentiation. J. Exp. Med. 184:803.[Abstract/Free Full Text]
  50. Brown, D. R., K. Swier, N. H. Moskowitz, M. F. Naujokas, R. M. Locksley, S. L. Reiner. 1997. T helper subset differentiation in the absence of invariant chain. J. Exp. Med. 185:31.[Abstract/Free Full Text]
  51. Falcone, M., A. J. Rajan, B. R. Bloom, C. F. Brosnan. 1998. A critical role for IL-4 in regulating disease severity in experimental allergic encephalomyelitis as demonstrated in IL-4-deficient C57BL/6 mice and BALB/c mice. J. Immunol. 160:4822.[Abstract/Free Full Text]
  52. Hess, J., C. Ladel, D. Miko, S. H. Kaufmann. 1996. Salmonella typhimurium aroA- infection in gene-targeted immunodeficient mice: major role of CD4+ TCR-{alpha}ß cells and IFN-{gamma} in bacterial clearance independent of intracellular location. J. Immunol. 156:3321.[Abstract]
  53. Pie, S., P. Truffa-Bachi, M. Pla, C. Nauciel. 1997. Th1 response in Salmonella typhimurium-infected mice with a high or low rate of bacterial clearance. Infect. Immun. 65:4509.[Abstract]
  54. Thygesen, P., H. B. Christensen, H. P. Hougen, J. Rygaard. 1997. Transfer of primed CD4+OX40- T lymphocytes induces increased immunity to experimental Salmonella typhimurium infections in rats. APMIS 105:410.[Medline]
  55. Afonso, L. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, G. Trinchieri, P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235.[Abstract/Free Full Text]
  56. Nauciel, C., F. Espinasse-Maes. 1992. Role of {gamma} interferon and tumor necrosis factor {alpha} in resistance to Salmonella typhimurium infection. Infect. Immun. 60:450.[Abstract/Free Full Text]
  57. Kincy-Cain, T., K. L. Bost. 1997. Substance P-induced IL-12 production by murine macrophages. J. Immunol. 158:2334.[Abstract]
  58. McDyer, J. F., T. J. Goletz, E. Thomas, C. H. June, R. A. Seder. 1998. CD40 ligand/CD40 stimulation regulates the production of IFN-{gamma} from human peripheral blood mononuclear cells in an IL-12- and/or CD28-dependent manner. J. Immunol. 160:1701.[Abstract/Free Full Text]
  59. Scharton-Kersten, T., P. Caspar, A. Sher, E. Y. Denkers. 1996. Toxoplasma gondii: evidence for interleukin-12-dependent and- independent pathways of interferon-{gamma} production induced by an attenuated parasite strain. Exp. Parasitol. 84:102.[Medline]
  60. Tripp, C. S., O. Kanagawa, E. R. Unanue. 1995. Secondary response to Listeria infection requires IFN-{gamma} but is partially independent of IL-12. J. Immunol. 155:3427.[Abstract]
  61. Gewirtz, A. T., A. S. Rao, Jr P. O. Simon, D. Merlin, D. Carnes, J. L. Madara, A. S. Neish. 2000. Salmonella typhimurium induces epithelial IL-8 expression via Ca(2+)-mediated activation of the NF-{kappa}B pathway. J. Clin. Invest. 105:79.[Medline]
  62. Chong, C., K. L. Bost, J. D. Clements. 1996. Differential production of interleukin-12 mRNA by murine macrophages in response to viable or killed Salmonella spp. Infect. Immun. 64:1154.[Abstract]
  63. Shibuya, K., D. Robinson, F. Zonin, S. B. Hartley, S. E. Macatonia, C. Somoza, C. A. Hunter, K. M. Murphy, A. O’Garra. 1998. IL-1{alpha} and TNF-{alpha} are required for IL-12-induced development of Th1 cells producing high levels of IFN-{gamma} in BALB/c but not C57BL/6 mice. J. Immunol. 160:1708.[Abstract/Free Full Text]
  64. O’Brien, A. D., I. Scher, G. H. Campbell, R. P. MacDermott, S. B. Formal. 1979. Susceptibility of CBA/N mice to infection with Salmonella typhimurium: influence of the X-linked gene controlling B lymphocyte function. J. Immunol. 123:720.[Abstract/Free Full Text]
  65. Tagliabue, A., L. Nencioni, L. Villa, D. Boraschi. 1984. Genetic control of in vitro natural cell-mediated activity against Salmonella typhimurium by intestinal and splenic lymphoid cells in mice. Clin. Exp. Immunol. 56:531.[Medline]
  66. Himmelrich, H., C. Parra-Lopez, F. Tacchini-Cottier, J. A. Louis, P. Launois. 1998. The IL-4 rapidly produced in BALB/c mice after infection with Leishmania major down-regulates IL-12 receptor ß2-chain expression on CD4+ T cells resulting in a state of unresponsiveness to IL-12. J. Immunol. 161:6156.[Abstract/Free Full Text]
  67. Jones, D., M. M. Elloso, L. Showe, D. Williams, G. Trinchieri, P. Scott. 1998. Differential regulation of the interleukin-12 receptor during the innate immune response to Leishmania major. Infect. Immun. 66:3818.[Abstract/Free Full Text]
  68. Sam, H., M. M. Stevenson. 1999. In vivo IL-12 production and IL-12 receptors ß1 and ß2 mRNA expression in the spleen are differentially up-regulated in resistant B6 and susceptible A/J mice during early blood-stage Plasmodium chabaudi AS malaria. J. Immunol. 162:1582.[Abstract/Free Full Text]
  69. Fan, J. Y., C. S. Boyce, C. F. Cuff. 1998. T-helper 1 and T-helper 2 cytokine responses in gut-associated lymphoid tissue following enteric reovirus infection. Cell. Immunol. 188:55.[Medline]
  70. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler, D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses. Annu. Rev. Immunol. 16:495.[Medline]
  71. Rogge, L., F. Sinigaglia. 1997. Early events controlling T-helper cell differentiation: the role of the IL-12 receptor. Chem. Immunol. 68:38.[Medline]
  72. Eckmann, L., J. Fierer, M. F. Kagnoff. 1996. Genetically resistant (Ityr) and susceptible (Itys) congenic mouse strains show similar cytokine responses following infection with Salmonella dublin. J. Immunol. 156:2894.[Abstract]
  73. Heinzel, F. P., A. M. Hujer, F. N. Ahmed, R. M. Rerko. 1997. In vivo production and function of IL-12 p40 homodimers. J. Immunol. 158:4381.[Abstract]
  74. Li, B., C. Tournier, R. J. Davis, R. A. Flavell. 1999. Regulation of IL-4 expression by the transcription factor JunB during T helper cell differentiation. EMBO J. 18:420.[Medline]
  75. Klimpel, G. R., M. Asuncion, J. Haithcoat, D. W. Niesel. 1995. Cholera toxin and Salmonella typhimurium induce different cytokine profiles in the gastrointestinal tract. Infect. Immun. 63:1134.[Abstract]
  76. Chehimi, J., G. Trinchieri. 1994. Interleukin-12: a bridge between innate resistance and adaptive immunity with a role in infection and acquired immunodeficiency. J Clin. Immunol. 14:149.[Medline]
  77. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
C. C. Bowman and K. L. Bost
Cyclooxygenase-2-Mediated Prostaglandin E2 Production in Mesenteric Lymph Nodes and in Cultured Macrophages and Dendritic Cells after Infection with Salmonella
J. Immunol., February 15, 2004; 172(4): 2469 - 2475.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. W. Schrum, I. Marriott, B. R. Butler, E. K. Thomas, M. C. Hudson, and K. L. Bost
Functional CD40 Expression Induced following Bacterial Infection of Mouse and Human Osteoblasts
Infect. Immun., March 1, 2003; 71(3): 1209 - 1216.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. W. Pascual, T. Trunkle, and J. Sura
Fimbriated Salmonella enterica Serovar Typhimurium Abates Initial Inflammatory Responses by Macrophages
Infect. Immun., August 1, 2002; 70(8): 4273 - 4281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elhofy, A.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elhofy, A.
Right arrow Articles by Bost, K. L.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS