The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van der Heyde, H. C.
Right arrow Articles by Grisham, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van der Heyde, H. C.
Right arrow Articles by Grisham, M. B.
The Journal of Immunology, 2000, 165: 3317-3323.
Copyright © 00 by The American Association of Immunologists

Nitric Oxide Is Neither Necessary Nor Sufficient for Resolution of Plasmodium chabaudi Malaria in Mice1

Henri C. van der Heyde2,*,{ddagger}, Yang Gu*, Qiang Zhang*, Guang Sun* and Matthew B. Grisham{dagger},{ddagger}

* Departments of Microbiology and Immunology and {dagger} Molecular and Cellular Physiology, {ddagger} Inflammation and Immunology Research Group, Louisiana State University Health Sciences Center, Shreveport, LA 71130


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Malaria is a life-threatening re-emerging disease, yet it is still not clear how bloodstage malarial parasites are killed. Nitric oxide (NO), which has potent anti-microbial activity, may represent an important killing mechanism. The production of NO during descending Plasmodium chabaudi parasitemia, a period when parasites are killed by the immune response, supports this concept. However, NOS20/0 and NOS30/0 mice as well as mice treated with NO synthase 2 (NOS2) inhibitors do not develop exacerbated malaria, indicating that NO production is not necessary for the suppression of P. chabaudi parasitemia. It is possible due to the plasticity in the immune response during malaria that Ab-mediated immunity is enhanced in the absence of NO, thereby explaining the lack of exacerbated malaria in NOS-deficient mice even though NO may function in protection. However, NOS2- and B cell-deficient mice, which cannot use Ab-mediated immunity, suppress their parasitemia with a similar time course as B cell-deficient controls. C57BL/6 mice treated with Propionibacterium acnes to elicit high levels of macrophage-derived NO have a similar time course of P. chabaudi parasitemia as P. acnes-treated NOS20/0 mice, which do not produce NO; this indicates that NO is not sufficient for parasite killing. Collectively, these results indicate that NO is not necessary or sufficient to resolve P. chabaudi malaria.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Malaria is the second leading cause of morbidity and mortality due to a single infectious agent. It is a re-emerging disease due to increasing drug resistance by the malarial parasite and insecticide resistance by the mosquito vector. The bloodstage of malaria, which is the focus of our study, causes the signs and symptoms of malaria as well as the pathology. Most individuals (~99%) control bloodstage malaria, suggesting that components of the immune system kill replicating parasites in the blood. However, the precise mechanisms by which bloodstage parasites are killed remain to be determined. We therefore tested whether NO represents an important defense mechanism against bloodstage malaria.

NO has potent biological activity, including maintaining vascular physiology, modulating inflammatory responses, and functioning in host defense against micro-organisms (1, 2, 3). This free radical has a biological half-life of seconds under normal physiologic oxygen tension. NO diffuses freely across membranes to mediate its effects. NO plays a vital role in the suppression of the acute parasitemia in experimental Leishmania major infections (4) as well in the prevention of reactivation of chronic low grade infection (5).

There are three different isoforms of the NO synthase (NOS)3 enzyme that produces NO from the terminal guanidino nitrogen of arginine (1). Neuronal NOS (NOS1) is expressed primarily in the brain (6). Inflammatory NOS (NOS2) is expressed by cells of the immune systems, primarily macrophages and neutrophils, and this isoform plays a major role in anti-microbial defense (7). T cells reportedly also produce NO (8). Endothelial NOS (NOS3) is expressed by vascular endothelial cells (9). There are two isoforms of NOS that may contribute to NO production during bloodstage malaria, namely inflammatory NOS and endothelial NOS. Bloodstage malaria in mice and humans results in marked activation of endothelial cells, which, in turn, could contribute to NO production. Thus, endothelial and inflammatory NOS may contribute significantly to NO production during malaria.

The different NOS isoforms have different means of causing the enzyme to produce NO. Neuronal and endothelial NOS are expressed constitutively. Calcium binding to calmodulin within the neuronal or endothelial NOS enzyme complex results in activation of the complex and the production of NO. Inflammatory NOS is normally expressed at low basal levels (10, 11). In contrast to neuronal and endothelial NOS, this enzyme is not regulated by calcium-calmodulin binding and is always active. The levels of expression of inflammatory NOS determine the production of NO by immune cells. Treatment of mice with Propionibacterium acnes (formerly called Corynebacterium parvum) leads to high levels of NO in the serum of treated rodents, but the animals do not die (12, 13). Serum NO levels peak at about 50-fold and remain at least 10-fold greater than those in untreated controls for >1 wk (12, 13). The ability of P. acnes to activate macrophages to produce high levels of NO production allows in vivo testing to determine whether NO can kill replicating malarial parasites.

Unlike the clear role for NO in the resolution of Leishmania major and liverstage malaria, the role of NO in the clearance of bloodstage malaria is less defined. Several groups report a relation between protection against bloodstage malaria and NO levels in serum. Favre and colleagues (14) found that IFN-{gamma}R0/0 mice are more susceptible to P. chabaudi infections, and this susceptibility relates to significantly lower serum NOx (NO2- plus NO3-) levels in IFN-{gamma}R0/0 mice compared with controls. Stevenson and colleagues (15, 16, 17) reported that TNF-{alpha}, IFN-{gamma}, and IL-12 are required in vivo to activate serum NO production during P. chabaudi malaria and that enhanced NO production relates to protection. The intact spleen is required to resolve bloodstage malaria (18), and splenocytes in C57BL/6 mice up-regulate NOS2 mRNA during P. chabaudi malaria. Macrophages from P. chabaudi-infected mice produce increased amounts of NO in vitro, suggesting that this cell type is also the source of NO in vivo (19). Collectively, these findings indicate that NO production is induced during bloodstage malaria in splenic macrophages by a pathway that includes IL-12, TNF-{alpha}, and IFN-{gamma}. These findings also suggest that NO plays a role in protection against malaria.

Taylor-Robinson and colleagues (20) first reported a definite role for NO in the resolution of P. chabaudi malaria. They observed that CD4+ T cell clones of the Th1 type transferred protection to CD4+ T cell-depleted and thymectomized recipient mice, but that treatment of the recipients with NOS2 inhibitors abrogated this protection (20). They concluded that Th1 cells produce NO or activate macrophages to secrete NO that, in turn, kills bloodstage malarial parasites.

In contrast to these results, treatment with the NOS2 inhibitor aminoguanidine (AG) does not alter the time course of P. chabaudi parasitemia (16, 21). In experiments performed by Jacobs et al. (16), AG treatment results in some death during ascending P. chabaudi parasitemia; Favre et al. (21), however, do not observe this mortality. NOS2-deficient mice resolve P. chabaudi (21) and Plasmodium berghei XAT (22) parasitemia with a similar time course as C57BL/6 controls, indicating that NO is not required to kill bloodstage parasites.

Results obtained from treatment of CD4-reconstituted SCID mice with a NOS2 inhibitor are in stark contrast with results obtained in NOS2 knockout mice. Differences between contrasting results observed in knockout mice vs treated mice are often explained by the concept of redundancy. Knockout mice with their lifelong deficiency have harnessed other components of the immune system to compensate for the deficiency, whereas treated mice do not have the time to compensate. Compensate means that the depleted protein is replaced by another protein with a similar function. For example, IL-13 may compensate for IL-4 deficiency. Compensation implies that a negative result in knockout mice should not necessarily be interpreted to mean that the missing component has no role. To test whether compensation is an explanation for the contrasting results, we elicited by P. acnes treatment 50-fold higher levels of NO than those in uninfected mice during ascending P. chabaudi parasitemia and assessed its effect on the infection.

Our results in bloodstage malaria indicate that during an immune response there is cross-talk between different effector arms of the immune response, with each limiting the other’s response (23). Thus, if Ab-mediated immunity (AMI) is deficient, then B cells no longer signal to limit cell-mediated immunity (CMI; specifically {gamma}{delta} T cells), and consequently, CMI is enhanced in bloodstage malaria (23). Conversely, if components of CMI (for example, {gamma}{delta} T cells) are missing, then {gamma}{delta} T cells no longer signal to limit the B cell response, and AMI is enhanced (24). We have termed plasticity of the immune response this ability to enhance effector arms of the immune response in the absence of another immune component (24). It is therefore possible that AMI is augmented in the absence of macrophage-derived NO, another component of CMI. If augmentation by AMI for NO occurs, then the parasitemia time course will be similar in NOS-deficient mice and controls even though NO may function in killing malarial parasites. To eliminate this possibility, we examined the role of NO in the resolution of malaria in B cell-deficient mice lacking AMI.

Specifically, we have addressed the following issues to define further the role of NO in resolving bloodstage malaria. First, we examined whether the level of stable breakdown products of NO (NOx = NO2- + NO3-) is markedly increased during descending parasitemia in an attempt to associate NO production with parasite killing by the immune response. Second, we examined which of the two possible isoforms of NO that may contribute to NO production in blood actually produce NO during malaria and whether this isoform is required for clearance of malarial parasites from blood. It is possible that AMI compensates for macrophage-derived NO, much as we had observed earlier for {gamma}{delta} T cells. In this case, NOS-deficient mice will resolve their malaria with a similar time course as controls even though NO may play a role in protection. Third, we determined the requirement for NO in the resolution of malaria in B cell-deficient mice lacking AMI to rule out possible enhanced AMI replacing the role of NO. Fourth, we assessed whether high levels of NO elicited by P. acnes treatment results in killing of parasites to determine whether NO production is sufficient for protection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice, parasites, and infection of mice

Female and male C57BL/6 and BALB/c mice between 4–5 wk of age were purchased from The Jackson Laboratory (Bar Harbor, ME) and were infected between 6 and 16 wk of age. B cell-deficient (JHD) mice, a gift from Dr. Weidanz (University of Wisconsin, Madison, WI), were used to eliminate the possibility of enhanced AMI functioning in place of NO. Breeder NOS20/0 and NOS30/0 mice (C57BL/6 background) were purchased from The Jackson Laboratory. JHD mice (strain 129 background), which fail to produce Igs due to the targeted deletion of the JH gene segments in embryonic stem cells, are devoid of surface Ig+ cells in the periphery because B cell differentiation is blocked at the large CD43+ precursor stage (25). NOS20/0 and NOS30/0 mice lack functional NOS2 and NOS3 genes, respectively (26, 27). JHD, NOS20/0, and NOS30/0 mice were bred at Louisiana State University Health Sciences Center (Shreveport, LA).

To generate animals lacking both B cells and NOS2, JHD mice were intercrossed with NOS20/0 mice (JHD x NOS20/0). The lack of B cells was verified by obtaining 10 µl of blood from the mouse’s tail, lysing the erythrocytes by hypotonic shock, then assessing the percentage of B220+ cells in the blood of the mice by flow cytometry (28, 29). B cell-deficient mice had a similar percentage of leukocytes expressing B220 (<0.2%) as the isotype control, whereas B cell-intact mice had >40%.

PCR analyses for the intact and disrupted NOS2 gene were performed to genotype mice. Briefly, about 50 µl of blood was obtained from each mouse, and the DNA was extracted from the blood with the blood DNA kit from Amersham-Pharmacia (Piscataway, NJ). PCR was performed as described previously (30), except that different primers were used. NOS2 primer 1 (GAGGAGAGAGATCCGATTTAGAGTCTTGG) and NOS2 primer 2 (TGAAGCCATGACCTTTCGCATTAGCATGG) were added to identify an NOS2 gene (26) or neo primer (ACTGCTCGACATTGGGTGGAAACATTCC) plus NOS2 primer 3 (GACAGGTGTGAGCTACCACATCTGAGTC) to identify the disrupted allele (26). The PCR products were analyzed on an ethidium bromide (Sigma, St. Louis, MO)-stained 1.5% agarose gel (Life Technologies, Gaithersburg, MD). NOS2 knockout mice had no PCR product for NOS2, but did have a disrupted allele product, wild-type mice had a NOS2 PCR product but no disrupted allele product, and heterozygous mice had both PCR products.

LPS-treated mice (20 mg/kg) with no NOS2 PCR product had serum NOx (NO2- plus NO3-) levels similar to those in untreated controls, whereas mice containing a NOS2 PCR product (both wild-type and heterozygous) had significantly elevated serum NOx levels, confirming that the PCR genotyping of NOS2 gene was correct.

All mice used in our studies were on a defined background except for the JHDxNOS2 mice, which were a mixture of C57BL/6 and strain 129. To ensure that genetic variability between the different strains did not influence our results, we used B cell-deficient littermates that were NOS2-null homozygotes (as our test group) and NOS2 heterozygotes (as our control group).

Parasites and infection of mice

The malarial parasite P. chabaudi adami 556KA, a gift from Dr. William Weidanz, used in these studies was maintained and used as described previously (31). This strain is not lethal in mice with an intact immune system, but results in high levels of unremitting parasitemia in immunodeficient SCID mice (28). Frozen parasite stabilate was injected i.p. into a BALB/c source mouse, and blood was obtained from the source mouse to generate the inoculum for the experimental animals. Experimental mice were injected on day 0 of infection with 106 erythrocytes parasitized with P. chabaudi, and the parasitemia was assessed by enumerating between 200 and 1000 erythrocytes in Giemsa-stained thin blood films. In each experiment groups of at least four mice of either sex were used. In experiments using NOS20/0 mice and the time course of NO production, only female mice were used. In all other experiments approximately equal numbers of male and female mice were used in each group to ensure that gender did not influence the results.

Treatment of mice

Mice were injected i.p. with LPS (Sigma) at a dose of 400 µg/mouse in 0.2 ml of saline. Sera were harvested from the LPS-treated mice and analyzed for NOx levels.

P. acnes (Burroughs Welcome) was formalin treated and therefore killed. P. acnes were suspended in PBS at a concentration of 7 mg/ml, and 0.3 ml was injected i.p. into each mouse. For a 20-g mouse (the approximate weight of mice used in this study) this represents a dose of about 100 mg/kg. This dose has been used by others (12, 13).

Mice were injected i.p. with 5 µg/mouse of AG or 6.25 µg/mouse of S-methylisothiourea (SMT) in 0.1 ml of saline or saline alone. AG and especially SMT at these doses are potent inhibitors of NOS2 (32, 33). These NOS2 inhibitor solutions were prepared fresh daily just before injection.

We injected the treatment i.p in experiments in which repeated injections were required or where a large volume (>0.2 ml) must be provided. Injections i.p. nonspecifically activate cells in the peritoneum, and this nonspecific activation of phagocytes may reduce viability of parasites in the inoculum. Thus, in the NOS2 inhibitor and P. acnes treatment experiments, we injected the treatment i.p. and the parasites i.v.

Measurement of serum NOx levels

Mice were anesthetized by i.p. injection of ketamine, then >0.5 ml of blood was obtained by cardiac puncture. The blood was allowed to clot at 4°C for several hours, then the supernatant was removed after centrifugation. The serum nitrate and nitrite levels were determined by first reducing all nitrate to nitrite using nitrate reductase, and then total nitrite was quantified using the Griess reaction (34). All samples in a single experiment were assayed simultaneously to ensure consistency. The serum NOx values for uninfected mice are shown in the figures on day 0 of infection.

Statistical analysis

ANOVA with the StatView program (SAS Institute, Cary, NC) was performed to statistically compare parasitemia and serum NOx levels in the different groups of mice. There were at least four mice in each group. An asterisk in the figures denotes p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In P. chabaudi malaria, immunologically intact mice suppress their acute infection by about day 14 of infection, then develop chronic malaria that is sterilized by about day 40 of infection. B cell-deficient mice suppress their acute P. chabaudi parasitemia with the same time course as C57BL/6 mice, but few B cell-deficient mice sterilize their infections. Instead, B cell-deficient mice have low grade, chronic P. chabaudi parasitemia for at least a year (35, 36, 37) (our unpublished observations).

NO in serum is significantly enhanced during descending P. chabaudi parasitemia in C57BL/6 mice, a period when malarial parasites are killed by the immune response

To determine whether NO production is enhanced in mice during the course of P. chabaudi malaria, we injected C57BL/6 mice i.p. with 106 erythrocytes parasitized with P. chabaudi and analyzed sera from groups of four mice at selected time points during the course of the infection. Serum NOx levels were increased 2- to 3-fold (p < 0.05) during peak and descending parasitemia compared with levels in uninfected controls (Fig. 1Go). The large increase on day 14 compared with levels on days 12 and 10 of P. chabaudi infection is probably an experimental artifact, with the average results on day 14 slightly higher and those on days 10 and 12 slightly lower due to experimental variation. In the second experiment similar serum NOx levels were detected on days 12 and 14 of infection, and these were the maximal levels. Upon suppression of the acute P. chabaudi infection, the serum NOx levels in C57BL/6 mice on day 20 of infection were similar to those in uninfected controls (p = 0.5; Fig. 1Go).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 1. Time course of P. chabaudi parasitemia and NO production in C57BL/6 mice. C57BL/6 mice were injected i.p. with 106 erythrocytes parasitized with P. chabaudi, and the parasitemia was assessed (left axis, line graph). At each of the selected time points, the level of serum NOx was determined for each mouse (group of four), and the results were averaged (right axis, bar chart). The bar on day 0 represents the average serum NOx level in uninfected controls. Three mice of 25 were omitted because their parasitemia was delayed by >2 SD, and their NOx levels differed from their means by >2 SD. The bars on day 0 represent the average serum NOx level in uninfected controls. This experiment was repeated twice with similar results. *, p < 0.05 for the comparison with uninfected controls.

 
Inflammatory cell-derived NOS2, but not endothelial-derived NOS3, produces NO during P. chabaudi malaria, but this NO is not required to suppress P. chabaudi malaria in C57BL/6 mice

To determine whether NO produced at peak parasitemia and during descending parasitemia is actually required for resolution of P. chabaudi, we injected NOS20/0 mice with 106 erythrocytes parasitized with P. chabaudi and analyzed sera from groups of four mice at selected time points during the course of the infection. We selected day 14 of infection because this time point is close to peak serum NOx production; day 20 of infection was also evaluated to verify that no aberrant NO production was occurring in the NOS20/0 mice during chronic malaria.

On day 14 of P. chabaudi infection, C57BL/6 mice had significantly (p < 0.05) elevated serum NOx levels compared with those in NOS20/0 mice (Fig. 2Go). The level of serum NOx in NOS20/0 mice was similar on day 14 of infection and on day 20 of infection and in uninfected control NOS20/0 mice. Despite the >5-fold difference in serum NOx in NOS20/0 mice compared with C57BL/6 controls, NOS20/0 mice had a similar time course of P. chabaudi parasitemia as C57BL/6 controls (Fig. 2Go).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. Time course of P. chabaudi parasitemia and NO production in NOS2-deficient mice and C57BL/6 controls. NOS2-deficient and C57BL/6 mice were injected i.p. with 106 erythrocytes parasitized with P. chabaudi (left axis, line graph). At each of the selected time points, the level of serum NOx was determined for each mouse and averaged (right axis, bar chart). •, NOS2-deficient mice; , C57BL/6 controls. The bars on day 0 represent the average serum NOx level in uninfected controls. This experiment was repeated three times with similar results. *, p < 0.05 for the comparison with uninfected controls.

 
To determine whether endothelial NOS3 contributes to NO production and protection against experimental malaria, we injected i.p. NOS30/0 mice and C57BL/6 controls with 106 erythrocytes parasitized with P. chabaudi. Serum NOx levels in P. chabaudi-infected NOS30/0 mice were similar to those in infected C57BL/6 mice on day 14 of infection (Fig. 3Go). The time course of P. chabaudi parasitemia in NOS30/0 mice was similar to that in C57BL/6 controls (Fig. 3Go). In the second experiment there was a statistically significant (p < 0.05) delay in clearance of parasitemia, but this modest delay (3 days) was probably not biologically significant.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. Time course of P. chabaudi parasitemia and NO production in NOS3-deficient mice and C57BL/6 controls. NOS3-deficient mice and C57BL/6 controls were injected i.p. with 106 erythrocytes parasitized with P. chabaudi (left axis, line graph). At each of the selected time points, the level of serum NOx for each mouse was averaged (right axis, bar chart). •, NOS3-deficient mice; , C57BL/6 controls. This experiment was repeated twice with similar results. *, p < 0.05 for the comparison with uninfected controls.

 
We also evaluated whether NOS3 produces NO in response to a bacterial infection to ascertain whether NOS3, in general, does not contribute to NO production during bloodstage infection. LPS is the component of the bacterial cell wall that induces NO production in vivo. LPS (400 µg/mouse) was injected i.p. into groups of NOS20/0 and NOS30/0 mice and C57BL/6 controls. Serum NOx levels in LPS-treated NOS20/0 mice (48 ± 5 µM) were 1- to 2-fold higher than those in untreated NOS20/0 and untreated C57BL/6 mice (20 ± 13 and 30 ± 10 µM, respectively). In contrast, serum NOx levels in NOS30/0 mice (455 ± 5 µM) were greater than those in LPS-treated C57BL/6 controls (378 ± 11 µM), and both levels were >10-fold higher (p < 0.05) than those in untreated C57BL/6 mice (30 ± 10 µM).

NO is not required to suppress acute P. chabaudi malaria, and plasticity of the immune response is not the explanation for the lack of an effect of NO on parasitemia

Plasticity of the immune response, with AMI being enhanced in the absence of macrophage-derived NO, a component of CMI, may explain why NOS2-deficient mice do not develop exacerbated P. chabaudi malaria. To determine whether NO generated in the absence of AMI is required to suppress acute P. chabaudi infections, we injected i.p. 106 P. chabaudi parasitized erythrocytes into B cell- plus NOS2-deficient mice. B cell- plus NOS2-deficient mice infected with P. chabaudi had serum NOx levels on days 10 and 20 of infection similar to those in uninfected controls, whereas infected B cell-deficient mice had significantly (p < 0.05) elevated serum NOx levels (Fig. 4Go). However, B cell-deficient mice lacking NOS2 suppressed their acute infections with a similar time course as B cell-deficient control mice with NOS2 (Fig. 4Go). B cell- plus NOS2-deficient mice had similar parasitemia during the period of chronic parasitemia compared with control mice lacking B cells but capable of producing NO.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. Time course of P. chabaudi parasitemia and NO production in B cell- plus NOS2-deficient mice and B cell-deficient (NOS20/+) controls. Mice genotyped for B cell production by flow cytometry and NOS2 by PCR were injected i.p. with 106 P. chabaudi-parasitized erythrocytes, and the average parasitemia was assessed (left axis, line graph). Groups of five mice were sacrificed on days 10 and 20 of infection, and serum NOx levels were measured using the Griess reaction.). {blacksquare}, B cell plus NOS2-deficient mice; {circ}, B cell-deficient (NOS20/+) controls. This experiment was repeated twice with similar results. *, p < 0.05 for the comparison with uninfected controls.

 
To test whether NOS2 inhibitors have an effect in our hands, we treated B cell-deficient and C57BL/6 mice with inhibitors of NOS2. Groups of five mice were injected i.v. with 106 erythrocytes parasitized by P. chabaudi then injected i.p. each day with 5 µg/mouse of AG or 6.25 µg/mouse of SMT in 0.1 ml of saline or saline alone. Both AG and especially SMT are potent inhibitors of NOS2 (32, 33). The parasitemia time courses in two separate experiments were similar in treated and control animals, and no animals died during the course of these experiments.

Elevated and sustained NO production induced by treatment with P. acnes does not mediate enhanced P. chabaudi clearance from the circulation

To determine directly whether NO produced at high levels during ascending parasitemia when the parasites are rapidly replicating can actually kill these bloodstage malarial parasites, we injected C57BL/6 mice i.p. with 0.3 ml of formalin-killed P. acnes and then injected these animals i.v. with 106 P. chabaudi-parasitized erythrocytes 4 days later. This time sequence was chosen because formalin-killed P. acnes produced increased levels of serum NOx in C57BL/6 mice on day 4 of treatment (191 ± 8 µM) compared with those in PBS-treated controls (31 ± 4 µM). Serum NOx levels in P. acnes-treated C57BL/6 mice peaked on day 8 of treatment (1,069 ± 41 µM), then this high level of macrophage-derived NO declined gradually over a 1-wk period (on day 12, 937 ± 211 µM; on day 16 of treatment, 377 ± 339 µM) (12, 13). Having high levels of NO present at the time of infection gives NO the greatest chance to kill malarial parasites and influence the parasitemia time course. At this time, there is the least likelihood that other molecules induced by infection (such as superoxide) quench NO. Moreover, P. chabaudi parasitemia peaks on day 8 of infection; P. chabaudi parasites in the P. acnes-treated mice therefore are replicating in the presence of continuous high level secretion of NO. We assessed serum NOx levels on day 10 of infection (day 14 of treatment) to verify that significant levels of NO were produced.

Infection control C57BL/6 and NOS20/0 mice injected with PBS at the same time as the test group was treated with P. acnes had a similar time course of P. chabaudi parasitemia, with peak parasitemia >10% (Fig. 5GoA). Treatment of C57BL/6 and NOS20/0 mice with P. acnes significantly (p < 0.05) reduced parasitemia in both groups of mice compared with that in PBS-treated controls (Fig. 5GoA). NOS20/0 mice treated with P. acnes had levels of serum NOx on days 8 and 16 of infection similar to those in uninfected, untreated NOS20/0 and C57BL/6 control mice (Fig. 5GoB). In contrast, C57BL/6 treated with P. acnes had significantly (p < 0.05; ~30-fold on day 8 of infection (day 12 after treatment), 10-fold on day 16 of infection (day 20 after treatment)) increased levels of serum NOx compared with those in NOS20/0 mice (Fig. 5GoB). However, the parasitemia was similar in NOS20/0 mice treated with P. acnes and in P. acnes-treated C57BL/6 controls (Fig. 5GoB). Similar results were obtained in a replicate experiment.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5. A, Time course of P. chabaudi parasitemia in NOS2-deficient and C57BL/6 mice treated with either P. acnes or PBS. B, Time course of P. chabaudi parasitemia and NO production in NOS2-deficient mice and C57BL/6 controls infected with P. chabaudi and treated with P. acnes. This experiment was performed twice. Two identical experiments were performed using B cell- plus NOS2-deficient mice and B cell-deficient controls. Five NOS2-deficient or C57BL/6 mice were analyzed for NO production on day 20 of P. chabaudi infection, and four mice of each type were analyzed on day 10 of infection. {blacksquare}, NOS2-deficient mice; {circ}, C57BL/6 controls treated with P. acnes. There was no statistical difference in parasitemia between the two groups at any time point.

 
We performed the identical experimental procedure in B cell- plus NOS2-deficient mice and B cell-deficient controls, and the results were similar to those described above for B cell-intact mice. On days 10 and 16 of P. chabaudi infection, B cell-deficient plus NOS2-heterozygous mice treated with P. acnes had significantly (p < 0.05) elevated levels of serum NOx compared with B cell- plus NOS2-deficient mice treated with P. acnes, yet the parasitemia in the two groups of mice was similar.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The role of NO in the clearance of bloodstage malarial parasites remains uncertain. We therefore performed studies to determine whether 1) NO is produced during bloodstage P. chabaudi malaria; 2) the lack of the ability to synthesize NO affects the course of P. chabaudi malaria; 3) redundancy explains why NOS2-deficient mice resolve their P. chabaudi parasitemia with a similar time course as controls; and 4) overproduction of NO kills malarial parasites and consequently alters the course of malaria.

Our observation that serum NOx levels are 2- to 3-fold (p < 0.05) elevated during descending parasitemia indicates that NO is present when the immune response is killing parasites. In contrast, Taylor-Robinson et al. (20) have reported that serum NOx was elevated only on a single day during the period of descending parasitemia (~8 days) and that NO was required to suppress P. chabaudi parasitemia. How a labile molecule such as NO can be required for suppression of infection yet kill parasites before it is detectable and continue killing beyond the time when it is inactivated was not addressed by these investigators.

Because NO is present during the period when the immune system is killing malarial parasites, we next examined the time course of parasitemia in gene-targeted knockout mice deficient in NO production. We examined mice that were deficient in the two isoforms that may contribute to NO production in the blood, namely, endothelial and inflammatory NOS. Serum NOx levels were elevated on day 14 of P. chabaudi infection in NOS30/0 and C57BL/6 mice, but not in the infected NOS20/0 mice, indicating that the NOS2 isoform is responsible for the majority of NO produced during malaria. Our observation that NOS20/0 and NOS30/0 mice resolve their P. chabaudi infections with a similar time course as controls together with the studies by Favre et al. (21) and Yoneto et al. (22) indicate that NO is not required for the resolution of acute malaria. P. chabaudi parasitemia did not recrudress during chronic malaria in NOS20/0, NOS30/0, and C57BL/6 mice, indicating that NO is not required, as it is in L. major infections (5), to maintain protection during the chronic phase of the infection. The parasitemia is also similar in the presence and the absence of NOS2 in B cell-deficient mice with chronic low grade parasitemia.

The ability of NOS isoform-deficient mice to produce serum NO in response to bacterial LPS is similar to the response to P. chabaudi. When we injected i.p. NOS-deficient mice with LPS to induce NO production in the blood, the NOS30/0 and C57BL/6 controls had elevated serum NOx levels, but the NOS20/0 mice did not. These data support the concept that NOS2 enzyme functions to produce anti-microbial NO in response to infection, whereas NOS3 produces NO to maintain vascular tone.

One study with pharmacological inhibitors of NOS2 showed marked effects of the inhibitor AG on the time course of P. chabaudi parasitemia (20). In contrast, several other studies do not report an effect of the same NOS2 inhibitor on parasitemia (15, 16, 38). Jacobs et al. (16) observe some mortality during ascending P. chabaudi parasitemia, whereas Favre et al. (21) do not. We also observed that B cell-intact and B cell-deficient mice treated with inhibitors of NOS2 (aminoguanidine or SMT) resolved P. chabaudi malaria with similar time courses as saline-treated controls without mortality. The explanation for the differing results may lie in malarial strain variations, with the strain used by Jacobs et al. (16) being more virulent than that used by Favre et al. (21) and us. The preponderance of evidence obtained from both NOS-deficient and pharmacological inhibitors of NOS2 indicates that NO is not required for suppression of P. chabaudi or maintenance of the chronic malaria.

As discussed in detail in the introduction, it is possible that plasticity of the immune response, with enhanced AMI functioning instead of NO, explains the similar time courses of P. chabaudi parasitemia in knockout and treated mice compared with controls. However, our finding that mice lacking both B cells and NOS2 resolve their P. chabaudi parasitemia with similar time courses as B cell-deficient controls with NOS2 indicates that plasticity by AMI does not explain why NOS-deficient mice do not have exacerbated P. chabaudi malaria.

Rockett et al. reported that high levels of NO are toxic toPlasmodium falciparum in vitro (38). The lower the oxygen tension, the greater the efficacy of NO against P. falciparum in vitro, suggesting that superoxides are scavenging NO (39). In addition, the lack of exacerbation of P. chabaudi malaria in the absence of NO does not directly address whether NO can be induced to function in killing malarial parasites. A threshold of NO may be needed for NO to kill malarial parasites. Alternatively, other molecules, such as superoxide, may inactivate NO in vivo during experimental malaria. We therefore examined whether the production of high levels of NO production at the time of infection and during ascending parasitemia would influence the course of P. chabaudi parasitemia. We selected treatment with formalin-killed P. acnes to induce NO production because 1) P. acnes is known to induce nonspecific protection against malaria; 2) it does not produce toxic byproducts like other NO generators; 3) the enhanced NO production occurs for at least 1 wk after a single treatment; and 4) the NO is biologically active (12). P. acnes treatment induced increased serum NOx levels by day 4 of treatment with a peak serum NOx on day 8 of treatment (>10-fold higher in P. acnes-treated C57BL/6 mice (1069 µM) than in P. chabaudi-infected C57BL/6 mice (61 µM); ~50-fold higher in P. acnes-treated C57BL/6 mice (1069 µM) than in P. chabaudi-infected NOS2-deficient mice (22 µM)). Our observation that P. acnes-treated mice with markedly enhanced levels of NO suppress their P. chabaudi parasitemia with a similar time course as treated mice lacking NOS2 (with baseline NO) indicates that serum NO is not sufficient to prevent malarial parasites from replicating in blood.

Allison and colleagues as well as Nussenzweig reported decades ago that treatment of mice with P. acnes results in nonspecific protection against bloodstage malaria and activation of macrophages (40, 41, 42). Several groups report that liver macrophages are the source of NO following P. acnes treatment (12, 13). In addition, splenic macrophages are the source of NO during P. chabaudi malaria (19). Treatment of mice with P. acnes in our experiments results in marked protection against bloodstage P. chabaudi malaria and high levels of serum NOx. This protection, as detailed above, is attributable to a mechanism(s) other than NO.

Despite increased levels of NO detected during descending parasitemia, a period when parasites are killed, our results indicate that NO is not required to resolve P. chabaudi malaria even after taking into account the possibility of enhanced AMI. The NO produced during P. chabaudi malaria is due to inflammatory NOS rather than endothelial NOS. These studies also illustrate the danger of extrapolating function from the enhanced production of a compound. The observation of increased NO during descending parasitemia would lead to an erroneous result in this instance.


    Acknowledgments
 
We thank Dr. William Weidanz, Francine Cigel, and Joan Batchelder for their help in initiating this project. Dr. David Jourd’heuil provided valuable assistance with the assessment of serum NOx levels.


    Footnotes
 
1 This work was supported in part by a grant from the National Institutes of Health (AI40667). Back

2 Address correspondence and reprint requests to Dr. Henri C. van der Heyde, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, P.O. Box 33932, Shreveport, LA 71130. Back

3 Abbreviations used in this paper: NOS, NO synthase; AMI, Ab-mediated immunity; CMI, cell-mediated immunity; NOx, NO2- plus NO3-; AG, aminoguanidine hemisulfate (NOS2 inhibitor); SMT, S-methylisothiourea (NOS2 inhibitor). Back

Received for publication April 10, 2000. Accepted for publication June 28, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Grisham, M. B., D. Jourd’Heuil, D. A. Wink. 1999. Nitric oxide. I. Physiological chemistry of nitric oxide and its metabolites: implications in inflammation. Am. J. Physiol. 276:G315.[Abstract/Free Full Text]
  2. Nathan, C., Q. W. Xie. 1994. Nitric oxide synthases: roles, tolls, and controls. Cell 78:915.[Medline]
  3. Nathan, C.. 1997. Inducible nitric oxide synthase: what difference does it make?. J. Clin. Invest. 100:2417.[Medline]
  4. Wei, X. Q., I. G. Charles, A. Smith, J. Ure, G. J. Feng, F. P. Huang, D. Xu, W. Muller, S. Moncada, F. Y. Liew. 1995. Altered immune responses in mice lacking inducible nitric oxide synthase. Nature 375:408.[Medline]
  5. Stenger, S., N. Donhauser, H. Thuring, M. Rollinghoff, C. Bogdan. 1996. Reactivation of latent leishmaniasis by inhibition of inducible nitric oxide synthase. J. Exp. Med 183:1501.[Abstract/Free Full Text]
  6. Bredt, D. S., S. H. Snyder. 1990. Isolation of nitric oxide synthetase, a calmodulin-requiring enzyme. Proc. Natl. Acad. Sci. USA 87:682.[Abstract/Free Full Text]
  7. Green, S. J., L. F. Scheller, M. A. Marletta, M. C. Seguin, F. W. Klotz, M. Slayter, B. J. Nelson, C. A. Nacy. 1994. Nitric oxide: cytokine-regulation of nitric oxide in host resistance to intracellular pathogens. Immunol. Lett. 43:87.[Medline]
  8. Taylor-Robinson, A. W., F. Y. Liew, A. Severn, D. Xu, S. J. McSorley, P. Garside, J. Padron, R. S. Phillips. 1994. Regulation of the immune response by nitric oxide differentially produced by T helper type 1 and T helper type 2 cells. Eur. J. Immunol. 24:980.[Medline]
  9. Pollock, J. S., U. Forstermann, J. A. Mitchell, T. D. Warner, H. H. Schmidt, M. Nakane, F. Murad. 1991. Purification and characterization of particulate endothelium-derived relaxing factor synthase from cultured and native bovine aortic endothelial cells. Proc. Natl. Acad. Sci. USA 88:10480.[Abstract/Free Full Text]
  10. Bredt, D. S., C. D. Ferris, S. H. Snyder. 1992. Nitric oxide synthase regulatory sites: phosphorylation by cyclic AMP- dependent protein kinase, protein kinase C, and calcium/calmodulin protein kinase; identification of flavin and calmodulin binding sites. J. Biol. Chem. 267:10976.[Abstract/Free Full Text]
  11. Bredt, D. S., P. M. Hwang, C. E. Glatt, C. Lowenstein, R. R. Reed, S. H. Snyder. 1991. Cloned and expressed nitric oxide synthase structurally resembles cytochrome P-450 reductase. Nature 351:714.[Medline]
  12. Geller, D. A., A. K. Nussler, M. Di Silvio, C. J. Lowenstein, R. A. Shapiro, S. C. Wang, R. L. Simmons, T. R. Billiar. 1993. Cytokines, endotoxin, and glucocorticoids regulate the expression of inducible nitric oxide synthase in hepatocytes. Proc. Natl. Acad. Sci. USA 90:522.[Abstract/Free Full Text]
  13. Rees, D. D., F. Q. Cunha, J. Assreuy, A. G. Herman, S. Moncada. 1995. Sequential induction of nitric oxide synthase by Corynebacterium parvum in different organs of the mouse. Br. J. Pharmacol. 114:689.[Medline]
  14. Favre, N., B. Ryffel, G. Bordmann, W. Rudin. 1997. The course of Plasmodium chabaudi chabaudi infections in interferon-{gamma} receptor deficient mice. Parasite Immunol. 19:375.[Medline]
  15. Stevenson, M. M., M. F. Tam, S. F. Wolf, A. Sher. 1995. IL-12-induced protection against blood-stage Plasmodium chabaudi AS requires IFN-{gamma} and TNF-{alpha} and occurs via a nitric oxide-dependent mechanism. J. Immunol. 155:2545.[Abstract]
  16. Jacobs, P., D. Radzioch, M. M. Stevenson. 1995. Nitric oxide expression in the spleen, but not in the liver, correlates with resistance to blood-stage malaria in mice. J. Immunol. 155:5306.[Abstract]
  17. Jacobs, P., D. Radzioch, M. M. Stevenson. 1996. In vivo regulation of nitric oxide production by tumor necrosis factor {alpha} and {gamma} interferon, but not by interleukin-4, during blood stage malaria in mice. Infect. Immun. 64:44.[Abstract]
  18. Grun, J. L., C. A. Long, W. P. Weidanz. 1985. Effects of splenectomy on antibody-independent immunity to Plasmodium chabaudi adami malaria. Infect. Immun. 48:853.[Abstract/Free Full Text]
  19. Ahvazi, B. C., P. Jacobs, M. M. Stevenson. 1995. Role of macrophage-derived nitric oxide in suppression of lymphocyte proliferation during blood-stage malaria. J. Leukocyte Biol. 58:23.[Abstract]
  20. Taylor-Robinson, A. W., R. S. Phillips, A. Severn, S. Moncada, F. Y. Liew. 1993. The role of TH1 and TH2 cells in a rodent malaria infection. Science 260:1931.[Abstract/Free Full Text]
  21. Favre, N., B. Ryffel, W. Rudin. 1999. Parasite killing in murine malaria does not require nitric oxide production. Parasitology 118:139.
  22. Yoneto, T., T. Yoshimoto, C. R. Wang, Y. Takahama, M. Tsuji, S. Waki, H. Nariuchi. 1999. Gamma interferon production is critical for protective immunity to infection with blood-stage Plasmodium berghei XAT but neither NO production nor NK cell activation is critical. Infect. Immun. 67:2349.[Abstract/Free Full Text]
  23. van der Heyde, H. C., M. M. Elloso, W. L. Chang, M. Kaplan, D. D. Manning, W. P. Weidanz. 1995. {gamma}{delta} T cells function in cell-mediated immunity to acute blood- stage Plasmodium chabaudi adami malaria. J. Immunol. 154:3985.[Abstract]
  24. Weidanz, W. P., J. R. Kemp, J. M. Batchelder, F. K. Cigel, M. Sandor, H. C. Heyde. 1999. Plasticity of immune responses suppressing parasitemia during acute Plasmodium chabaudi malaria. J. Immunol. 162:7383.[Abstract/Free Full Text]
  25. Chen, J., M. Trounstine, F. W. Alt, F. Young, C. Kurahara, J. F. Loring, D. Huszar. 1993. Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int. Immunol. 5:647.[Abstract/Free Full Text]
  26. Laubach, V. E., E. G. Shesely, O. Smithies, P. A. Sherman. 1995. Mice lacking inducible nitric oxide synthase are not resistant to lipopolysaccharide-induced death. Proc. Natl. Acad. Sci. USA 92:10688.[Abstract/Free Full Text]
  27. Shesely, E. G., N. Maeda, H. S. Kim, K. M. Desai, J. H. Krege, V. E. Laubach, P. A. Sherman, W. C. Sessa, O. Smithies. 1996. Elevated blood pressures in mice lacking endothelial nitric oxide synthase. Proc. Natl. Acad. Sci. USA 93:13176.[Abstract/Free Full Text]
  28. van der Heyde, H. C., D. D. Manning, W. P. Weidanz. 1993. Role of CD4+ T cells in the expansion of the CD4-, CD8- {gamma}{delta} T cell subset in the spleens of mice during blood-stage malaria. J. Immunol. 151:6311.[Abstract]
  29. van der Heyde, H. C., D. D. Manning, D. C. Roopenian, W. P. Weidanz. 1993. Resolution of blood-stage malarial infections in CD8+ cell-deficient ß2-m0/0 mice. J. Immunol. 151:3187.[Abstract]
  30. van der Heyde, H. C., B. Pepper, J. Batchelder, F. Cigel, W. P. Weidanz. 1997. The time course of selected malarial infections in cytokine-deficient mice. Exp. Parasitol. 85:206.[Medline]
  31. Hoffmann, E. J., W. P. Weidanz, C. A. Long. 1984. Susceptibility of CXB recombinant inbred mice to murine plasmodia. Infect. Immun. 43:981.[Abstract/Free Full Text]
  32. Bucala, R., K. J. Tracey, A. Cerami. 1991. Advanced glycosylation products quench nitric oxide and mediate defective endothelium-dependent vasodilatation in experimental diabetes. J. Clin. Invest. 87:432.
  33. Szabo, C., G. J. Southan, C. Thiemermann. 1994. Beneficial effects and improved survival in rodent models of septic shock with S-methylisothiourea sulfate, a potent and selective inhibitor of inducible nitric oxide synthase. Proc. Natl. Acad. Sci. USA 91:12472.[Abstract/Free Full Text]
  34. Grisham, M. B., G. G. Johnson, J. Lancaster. 1999. Quantitation of nitrate and nitrite in extracellular fluids. Methods Enzymol. 268:237.
  35. van der Heyde, H. C., D. Huszar, C. Woodhouse, D. D. Manning, W. P. Weidanz. 1994. The resolution of acute malaria in a definitive model of B cell deficiency, the JHD mouse. J. Immunol. 152:4557.[Abstract]
  36. Grun, J. L., W. P. Weidanz. 1981. Immunity to Plasmodium chabaudi adami in the B-cell-deficient mouse. Nature 290:143.[Medline]
  37. von der, W. T., N. Honarvar, J. Langhorne. 1996. Gene-targeted mice lacking B cells are unable to eliminate a blood stage malaria infection. J. Immunol. 156:2510.[Abstract]
  38. Rockett, K. A., M. M. Awburn, W. B. Cowden, I. A. Clark. 1991. Killing of Plasmodium falciparum in vitro by nitric oxide derivatives. Infect. Immun. 59:3280.[Abstract/Free Full Text]
  39. Taylor-Robinson, A. W., M. Looker. 1998. Sensitivity of malaria parasites to nitric oxide at low oxygen tensions. Lancet 351:1630.[Medline]
  40. Nussenzweig, R. S.. 1967. Increased nonspecific resistance to malaria produced by administration of killed Corynebacterium parvum. Exp. Parasitol. 21:224.[Medline]
  41. Clark, I. A., F. E. Cox, A. C. Allison. 1977. Protection of mice against Babesia spp. and Plasmodium spp. with killed Corynebacterium parvum. Parasitology 74:9.[Medline]
  42. Allison, A. C., E. M. Eugui. 1983. The role of cell-mediated immune responses in resistance to malaria, with special reference to oxidant stress. Annu. Rev. Immunol. 1:361.[Medline]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
P. Sobolewski, I. Gramaglia, J. A. Frangos, M. Intaglietta, and H. van der Heyde
Plasmodium berghei Resists Killing by Reactive Oxygen Species
Infect. Immun., October 1, 2005; 73(10): 6704 - 6710.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. M. Potter, A. J. Mitchell, W. B. Cowden, L. A. Sanni, M. Dinauer, J. B. de Haan, and N. H. Hunt
Phagocyte-Derived Reactive Oxygen Species Do Not Influence the Progression of Murine Blood-Stage Malaria Infections
Infect. Immun., August 1, 2005; 73(8): 4941 - 4947.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. M. Gillman, J. Batchelder, P. Flaherty, and W. P. Weidanz
Suppression of Plasmodium chabaudi Parasitemia Is Independent of the Action of Reactive Oxygen Intermediates and/or Nitric Oxide
Infect. Immun., November 1, 2004; 72(11): 6359 - 6366.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
A. Sharma, A. Eapen, and S. K. Subbarao
Parasite Killing in Plasmodium vivax Malaria by Nitric Oxide: Implication of Aspartic Protease Inhibition
J. Biochem., September 1, 2004; 136(3): 329 - 334.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Fortin, M.M. Stevenson, and P. Gros
Susceptibility to malaria as a complex trait: big pressure from a tiny creature
Hum. Mol. Genet., October 1, 2002; 11(20): 2469 - 2478.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van der Heyde, H. C.
Right arrow Articles by Grisham, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van der Heyde, H. C.
Right arrow Articles by Grisham, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS