|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
*
Departments of Microbiology and Immunology and
Molecular and Cellular Physiology,
Inflammation and Immunology Research Group, Louisiana State University Health Sciences Center, Shreveport, LA 71130
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
99%) control bloodstage malaria,
suggesting that components of the immune system kill replicating
parasites in the blood. However, the precise mechanisms by which
bloodstage parasites are killed remain to be determined. We therefore
tested whether NO represents an important defense mechanism against
bloodstage malaria. NO has potent biological activity, including maintaining vascular physiology, modulating inflammatory responses, and functioning in host defense against micro-organisms (1, 2, 3). This free radical has a biological half-life of seconds under normal physiologic oxygen tension. NO diffuses freely across membranes to mediate its effects. NO plays a vital role in the suppression of the acute parasitemia in experimental Leishmania major infections (4) as well in the prevention of reactivation of chronic low grade infection (5).
There are three different isoforms of the NO synthase (NOS)3 enzyme that produces NO from the terminal guanidino nitrogen of arginine (1). Neuronal NOS (NOS1) is expressed primarily in the brain (6). Inflammatory NOS (NOS2) is expressed by cells of the immune systems, primarily macrophages and neutrophils, and this isoform plays a major role in anti-microbial defense (7). T cells reportedly also produce NO (8). Endothelial NOS (NOS3) is expressed by vascular endothelial cells (9). There are two isoforms of NOS that may contribute to NO production during bloodstage malaria, namely inflammatory NOS and endothelial NOS. Bloodstage malaria in mice and humans results in marked activation of endothelial cells, which, in turn, could contribute to NO production. Thus, endothelial and inflammatory NOS may contribute significantly to NO production during malaria.
The different NOS isoforms have different means of causing the enzyme to produce NO. Neuronal and endothelial NOS are expressed constitutively. Calcium binding to calmodulin within the neuronal or endothelial NOS enzyme complex results in activation of the complex and the production of NO. Inflammatory NOS is normally expressed at low basal levels (10, 11). In contrast to neuronal and endothelial NOS, this enzyme is not regulated by calcium-calmodulin binding and is always active. The levels of expression of inflammatory NOS determine the production of NO by immune cells. Treatment of mice with Propionibacterium acnes (formerly called Corynebacterium parvum) leads to high levels of NO in the serum of treated rodents, but the animals do not die (12, 13). Serum NO levels peak at about 50-fold and remain at least 10-fold greater than those in untreated controls for >1 wk (12, 13). The ability of P. acnes to activate macrophages to produce high levels of NO production allows in vivo testing to determine whether NO can kill replicating malarial parasites.
Unlike the clear role for NO in the resolution of Leishmania
major and liverstage malaria, the role of NO in the
clearance of bloodstage malaria is less defined. Several groups report
a relation between protection against bloodstage malaria and NO levels
in serum. Favre and colleagues (14) found that
IFN-
R0/0 mice are more susceptible to P.
chabaudi infections, and this susceptibility relates to
significantly lower serum NOx
(NO2- plus
NO3-) levels in
IFN-
R0/0 mice compared with controls.
Stevenson and colleagues (15, 16, 17) reported that TNF-
,
IFN-
, and IL-12 are required in vivo to activate serum NO production
during P. chabaudi malaria and that enhanced NO production
relates to protection. The intact spleen is required to resolve
bloodstage malaria (18), and splenocytes in C57BL/6 mice
up-regulate NOS2 mRNA during P. chabaudi malaria.
Macrophages from P. chabaudi-infected mice produce increased
amounts of NO in vitro, suggesting that this cell type is also the
source of NO in vivo (19). Collectively, these findings
indicate that NO production is induced during bloodstage malaria in
splenic macrophages by a pathway that includes IL-12, TNF-
, and
IFN-
. These findings also suggest that NO plays a role in protection
against malaria.
Taylor-Robinson and colleagues (20) first reported a definite role for NO in the resolution of P. chabaudi malaria. They observed that CD4+ T cell clones of the Th1 type transferred protection to CD4+ T cell-depleted and thymectomized recipient mice, but that treatment of the recipients with NOS2 inhibitors abrogated this protection (20). They concluded that Th1 cells produce NO or activate macrophages to secrete NO that, in turn, kills bloodstage malarial parasites.
In contrast to these results, treatment with the NOS2 inhibitor aminoguanidine (AG) does not alter the time course of P. chabaudi parasitemia (16, 21). In experiments performed by Jacobs et al. (16), AG treatment results in some death during ascending P. chabaudi parasitemia; Favre et al. (21), however, do not observe this mortality. NOS2-deficient mice resolve P. chabaudi (21) and Plasmodium berghei XAT (22) parasitemia with a similar time course as C57BL/6 controls, indicating that NO is not required to kill bloodstage parasites.
Results obtained from treatment of CD4-reconstituted SCID mice with a NOS2 inhibitor are in stark contrast with results obtained in NOS2 knockout mice. Differences between contrasting results observed in knockout mice vs treated mice are often explained by the concept of redundancy. Knockout mice with their lifelong deficiency have harnessed other components of the immune system to compensate for the deficiency, whereas treated mice do not have the time to compensate. Compensate means that the depleted protein is replaced by another protein with a similar function. For example, IL-13 may compensate for IL-4 deficiency. Compensation implies that a negative result in knockout mice should not necessarily be interpreted to mean that the missing component has no role. To test whether compensation is an explanation for the contrasting results, we elicited by P. acnes treatment 50-fold higher levels of NO than those in uninfected mice during ascending P. chabaudi parasitemia and assessed its effect on the infection.
Our results in bloodstage malaria indicate that during an immune
response there is cross-talk between different effector arms of the
immune response, with each limiting the others response
(23). Thus, if Ab-mediated immunity (AMI) is deficient,
then B cells no longer signal to limit cell-mediated immunity (CMI;
specifically 
T cells), and consequently, CMI is enhanced in
bloodstage malaria (23). Conversely, if components of CMI
(for example, 
T cells) are missing, then 
T cells no
longer signal to limit the B cell response, and AMI is enhanced
(24). We have termed plasticity of the immune response
this ability to enhance effector arms of the immune response in the
absence of another immune component (24). It is therefore
possible that AMI is augmented in the absence of macrophage-derived NO,
another component of CMI. If augmentation by AMI for NO occurs, then
the parasitemia time course will be similar in NOS-deficient mice and
controls even though NO may function in killing malarial parasites. To
eliminate this possibility, we examined the role of NO in the
resolution of malaria in B cell-deficient mice lacking AMI.
Specifically, we have addressed the following issues to define further
the role of NO in resolving bloodstage malaria. First, we examined
whether the level of stable breakdown products of NO (NOx =
NO2- +
NO3-) is markedly increased
during descending parasitemia in an attempt to associate NO production
with parasite killing by the immune response. Second, we examined which
of the two possible isoforms of NO that may contribute to NO production
in blood actually produce NO during malaria and whether this isoform is
required for clearance of malarial parasites from blood. It is possible
that AMI compensates for macrophage-derived NO, much as we had observed
earlier for 
T cells. In this case, NOS-deficient mice will
resolve their malaria with a similar time course as controls even
though NO may play a role in protection. Third, we determined the
requirement for NO in the resolution of malaria in B cell-deficient
mice lacking AMI to rule out possible enhanced AMI replacing the role
of NO. Fourth, we assessed whether high levels of NO elicited by
P. acnes treatment results in killing of parasites to
determine whether NO production is sufficient for protection.
| Materials and Methods |
|---|
|
|
|---|
Female and male C57BL/6 and BALB/c mice between 45 wk of age were purchased from The Jackson Laboratory (Bar Harbor, ME) and were infected between 6 and 16 wk of age. B cell-deficient (JHD) mice, a gift from Dr. Weidanz (University of Wisconsin, Madison, WI), were used to eliminate the possibility of enhanced AMI functioning in place of NO. Breeder NOS20/0 and NOS30/0 mice (C57BL/6 background) were purchased from The Jackson Laboratory. JHD mice (strain 129 background), which fail to produce Igs due to the targeted deletion of the JH gene segments in embryonic stem cells, are devoid of surface Ig+ cells in the periphery because B cell differentiation is blocked at the large CD43+ precursor stage (25). NOS20/0 and NOS30/0 mice lack functional NOS2 and NOS3 genes, respectively (26, 27). JHD, NOS20/0, and NOS30/0 mice were bred at Louisiana State University Health Sciences Center (Shreveport, LA).
To generate animals lacking both B cells and NOS2, JHD mice were intercrossed with NOS20/0 mice (JHD x NOS20/0). The lack of B cells was verified by obtaining 10 µl of blood from the mouses tail, lysing the erythrocytes by hypotonic shock, then assessing the percentage of B220+ cells in the blood of the mice by flow cytometry (28, 29). B cell-deficient mice had a similar percentage of leukocytes expressing B220 (<0.2%) as the isotype control, whereas B cell-intact mice had >40%.
PCR analyses for the intact and disrupted NOS2 gene were performed to genotype mice. Briefly, about 50 µl of blood was obtained from each mouse, and the DNA was extracted from the blood with the blood DNA kit from Amersham-Pharmacia (Piscataway, NJ). PCR was performed as described previously (30), except that different primers were used. NOS2 primer 1 (GAGGAGAGAGATCCGATTTAGAGTCTTGG) and NOS2 primer 2 (TGAAGCCATGACCTTTCGCATTAGCATGG) were added to identify an NOS2 gene (26) or neo primer (ACTGCTCGACATTGGGTGGAAACATTCC) plus NOS2 primer 3 (GACAGGTGTGAGCTACCACATCTGAGTC) to identify the disrupted allele (26). The PCR products were analyzed on an ethidium bromide (Sigma, St. Louis, MO)-stained 1.5% agarose gel (Life Technologies, Gaithersburg, MD). NOS2 knockout mice had no PCR product for NOS2, but did have a disrupted allele product, wild-type mice had a NOS2 PCR product but no disrupted allele product, and heterozygous mice had both PCR products.
LPS-treated mice (20 mg/kg) with no NOS2 PCR product had serum NOx (NO2- plus NO3-) levels similar to those in untreated controls, whereas mice containing a NOS2 PCR product (both wild-type and heterozygous) had significantly elevated serum NOx levels, confirming that the PCR genotyping of NOS2 gene was correct.
All mice used in our studies were on a defined background except for the JHDxNOS2 mice, which were a mixture of C57BL/6 and strain 129. To ensure that genetic variability between the different strains did not influence our results, we used B cell-deficient littermates that were NOS2-null homozygotes (as our test group) and NOS2 heterozygotes (as our control group).
Parasites and infection of mice
The malarial parasite P. chabaudi adami 556KA, a gift from Dr. William Weidanz, used in these studies was maintained and used as described previously (31). This strain is not lethal in mice with an intact immune system, but results in high levels of unremitting parasitemia in immunodeficient SCID mice (28). Frozen parasite stabilate was injected i.p. into a BALB/c source mouse, and blood was obtained from the source mouse to generate the inoculum for the experimental animals. Experimental mice were injected on day 0 of infection with 106 erythrocytes parasitized with P. chabaudi, and the parasitemia was assessed by enumerating between 200 and 1000 erythrocytes in Giemsa-stained thin blood films. In each experiment groups of at least four mice of either sex were used. In experiments using NOS20/0 mice and the time course of NO production, only female mice were used. In all other experiments approximately equal numbers of male and female mice were used in each group to ensure that gender did not influence the results.
Treatment of mice
Mice were injected i.p. with LPS (Sigma) at a dose of 400 µg/mouse in 0.2 ml of saline. Sera were harvested from the LPS-treated mice and analyzed for NOx levels.
P. acnes (Burroughs Welcome) was formalin treated and therefore killed. P. acnes were suspended in PBS at a concentration of 7 mg/ml, and 0.3 ml was injected i.p. into each mouse. For a 20-g mouse (the approximate weight of mice used in this study) this represents a dose of about 100 mg/kg. This dose has been used by others (12, 13).
Mice were injected i.p. with 5 µg/mouse of AG or 6.25 µg/mouse of S-methylisothiourea (SMT) in 0.1 ml of saline or saline alone. AG and especially SMT at these doses are potent inhibitors of NOS2 (32, 33). These NOS2 inhibitor solutions were prepared fresh daily just before injection.
We injected the treatment i.p in experiments in which repeated injections were required or where a large volume (>0.2 ml) must be provided. Injections i.p. nonspecifically activate cells in the peritoneum, and this nonspecific activation of phagocytes may reduce viability of parasites in the inoculum. Thus, in the NOS2 inhibitor and P. acnes treatment experiments, we injected the treatment i.p. and the parasites i.v.
Measurement of serum NOx levels
Mice were anesthetized by i.p. injection of ketamine, then >0.5 ml of blood was obtained by cardiac puncture. The blood was allowed to clot at 4°C for several hours, then the supernatant was removed after centrifugation. The serum nitrate and nitrite levels were determined by first reducing all nitrate to nitrite using nitrate reductase, and then total nitrite was quantified using the Griess reaction (34). All samples in a single experiment were assayed simultaneously to ensure consistency. The serum NOx values for uninfected mice are shown in the figures on day 0 of infection.
Statistical analysis
ANOVA with the StatView program (SAS Institute, Cary, NC) was performed to statistically compare parasitemia and serum NOx levels in the different groups of mice. There were at least four mice in each group. An asterisk in the figures denotes p < 0.05.
| Results |
|---|
|
|
|---|
NO in serum is significantly enhanced during descending P. chabaudi parasitemia in C57BL/6 mice, a period when malarial parasites are killed by the immune response
To determine whether NO production is enhanced in mice during the
course of P. chabaudi malaria, we injected C57BL/6 mice i.p.
with 106 erythrocytes parasitized with P.
chabaudi and analyzed sera from groups of four mice at selected
time points during the course of the infection. Serum NOx levels were
increased 2- to 3-fold (p < 0.05) during peak
and descending parasitemia compared with levels in uninfected controls
(Fig. 1
). The large increase on day 14
compared with levels on days 12 and 10 of P. chabaudi
infection is probably an experimental artifact, with the average
results on day 14 slightly higher and those on days 10 and 12 slightly
lower due to experimental variation. In the second experiment similar
serum NOx levels were detected on days 12 and 14 of infection, and
these were the maximal levels. Upon suppression of the acute P.
chabaudi infection, the serum NOx levels in C57BL/6 mice on day 20
of infection were similar to those in uninfected controls
(p = 0.5; Fig. 1
).
|
To determine whether NO produced at peak parasitemia and during descending parasitemia is actually required for resolution of P. chabaudi, we injected NOS20/0 mice with 106 erythrocytes parasitized with P. chabaudi and analyzed sera from groups of four mice at selected time points during the course of the infection. We selected day 14 of infection because this time point is close to peak serum NOx production; day 20 of infection was also evaluated to verify that no aberrant NO production was occurring in the NOS20/0 mice during chronic malaria.
On day 14 of P. chabaudi infection, C57BL/6 mice had
significantly (p < 0.05) elevated serum NOx
levels compared with those in NOS20/0 mice (Fig. 2
). The level of serum NOx in
NOS20/0 mice was similar on day 14 of infection
and on day 20 of infection and in uninfected control
NOS20/0 mice. Despite the >5-fold difference in
serum NOx in NOS20/0 mice compared with C57BL/6
controls, NOS20/0 mice had a similar time course
of P. chabaudi parasitemia as C57BL/6 controls
(Fig. 2
).
|
|
NO is not required to suppress acute P. chabaudi malaria, and plasticity of the immune response is not the explanation for the lack of an effect of NO on parasitemia
Plasticity of the immune response, with AMI being enhanced in the
absence of macrophage-derived NO, a component of CMI, may explain why
NOS2-deficient mice do not develop exacerbated P. chabaudi
malaria. To determine whether NO generated in the absence of AMI is
required to suppress acute P. chabaudi infections, we
injected i.p. 106 P. chabaudi
parasitized erythrocytes into B cell- plus NOS2-deficient mice. B cell-
plus NOS2-deficient mice infected with P. chabaudi had serum
NOx levels on days 10 and 20 of infection similar to those in
uninfected controls, whereas infected B cell-deficient mice had
significantly (p < 0.05) elevated serum NOx
levels (Fig. 4
). However, B
cell-deficient mice lacking NOS2 suppressed their acute infections with
a similar time course as B cell-deficient control mice with NOS2 (Fig. 4
). B cell- plus NOS2-deficient mice had similar parasitemia during the
period of chronic parasitemia compared with control mice lacking B
cells but capable of producing NO.
|
Elevated and sustained NO production induced by treatment with P. acnes does not mediate enhanced P. chabaudi clearance from the circulation
To determine directly whether NO produced at high levels during ascending parasitemia when the parasites are rapidly replicating can actually kill these bloodstage malarial parasites, we injected C57BL/6 mice i.p. with 0.3 ml of formalin-killed P. acnes and then injected these animals i.v. with 106 P. chabaudi-parasitized erythrocytes 4 days later. This time sequence was chosen because formalin-killed P. acnes produced increased levels of serum NOx in C57BL/6 mice on day 4 of treatment (191 ± 8 µM) compared with those in PBS-treated controls (31 ± 4 µM). Serum NOx levels in P. acnes-treated C57BL/6 mice peaked on day 8 of treatment (1,069 ± 41 µM), then this high level of macrophage-derived NO declined gradually over a 1-wk period (on day 12, 937 ± 211 µM; on day 16 of treatment, 377 ± 339 µM) (12, 13). Having high levels of NO present at the time of infection gives NO the greatest chance to kill malarial parasites and influence the parasitemia time course. At this time, there is the least likelihood that other molecules induced by infection (such as superoxide) quench NO. Moreover, P. chabaudi parasitemia peaks on day 8 of infection; P. chabaudi parasites in the P. acnes-treated mice therefore are replicating in the presence of continuous high level secretion of NO. We assessed serum NOx levels on day 10 of infection (day 14 of treatment) to verify that significant levels of NO were produced.
Infection control C57BL/6 and NOS20/0 mice
injected with PBS at the same time as the test group was treated with
P. acnes had a similar time course of P. chabaudi
parasitemia, with peak parasitemia >10% (Fig. 5
A). Treatment of C57BL/6 and
NOS20/0 mice with P. acnes
significantly (p < 0.05) reduced parasitemia
in both groups of mice compared with that in PBS-treated controls (Fig. 5
A). NOS20/0 mice treated with
P. acnes had levels of serum NOx on days 8 and 16 of
infection similar to those in uninfected, untreated
NOS20/0 and C57BL/6 control mice (Fig. 5
B). In contrast, C57BL/6 treated with P. acnes
had significantly (p < 0.05;
30-fold on day
8 of infection (day 12 after treatment), 10-fold on day 16 of infection
(day 20 after treatment)) increased levels of serum NOx compared with
those in NOS20/0 mice (Fig. 5
B).
However, the parasitemia was similar in NOS20/0
mice treated with P. acnes and in P.
acnes-treated C57BL/6 controls (Fig. 5
B). Similar
results were obtained in a replicate experiment.
|
| Discussion |
|---|
|
|
|---|
Our observation that serum NOx levels are 2- to 3-fold
(p < 0.05) elevated during descending
parasitemia indicates that NO is present when the immune response is
killing parasites. In contrast, Taylor-Robinson et al.
(20) have reported that serum NOx was elevated only on a
single day during the period of descending parasitemia (
8 days) and
that NO was required to suppress P. chabaudi
parasitemia. How a labile molecule such as NO can be required for
suppression of infection yet kill parasites before it is detectable and
continue killing beyond the time when it is inactivated was not
addressed by these investigators.
Because NO is present during the period when the immune system is killing malarial parasites, we next examined the time course of parasitemia in gene-targeted knockout mice deficient in NO production. We examined mice that were deficient in the two isoforms that may contribute to NO production in the blood, namely, endothelial and inflammatory NOS. Serum NOx levels were elevated on day 14 of P. chabaudi infection in NOS30/0 and C57BL/6 mice, but not in the infected NOS20/0 mice, indicating that the NOS2 isoform is responsible for the majority of NO produced during malaria. Our observation that NOS20/0 and NOS30/0 mice resolve their P. chabaudi infections with a similar time course as controls together with the studies by Favre et al. (21) and Yoneto et al. (22) indicate that NO is not required for the resolution of acute malaria. P. chabaudi parasitemia did not recrudress during chronic malaria in NOS20/0, NOS30/0, and C57BL/6 mice, indicating that NO is not required, as it is in L. major infections (5), to maintain protection during the chronic phase of the infection. The parasitemia is also similar in the presence and the absence of NOS2 in B cell-deficient mice with chronic low grade parasitemia.
The ability of NOS isoform-deficient mice to produce serum NO in response to bacterial LPS is similar to the response to P. chabaudi. When we injected i.p. NOS-deficient mice with LPS to induce NO production in the blood, the NOS30/0 and C57BL/6 controls had elevated serum NOx levels, but the NOS20/0 mice did not. These data support the concept that NOS2 enzyme functions to produce anti-microbial NO in response to infection, whereas NOS3 produces NO to maintain vascular tone.
One study with pharmacological inhibitors of NOS2 showed marked effects of the inhibitor AG on the time course of P. chabaudi parasitemia (20). In contrast, several other studies do not report an effect of the same NOS2 inhibitor on parasitemia (15, 16, 38). Jacobs et al. (16) observe some mortality during ascending P. chabaudi parasitemia, whereas Favre et al. (21) do not. We also observed that B cell-intact and B cell-deficient mice treated with inhibitors of NOS2 (aminoguanidine or SMT) resolved P. chabaudi malaria with similar time courses as saline-treated controls without mortality. The explanation for the differing results may lie in malarial strain variations, with the strain used by Jacobs et al. (16) being more virulent than that used by Favre et al. (21) and us. The preponderance of evidence obtained from both NOS-deficient and pharmacological inhibitors of NOS2 indicates that NO is not required for suppression of P. chabaudi or maintenance of the chronic malaria.
As discussed in detail in the introduction, it is possible that plasticity of the immune response, with enhanced AMI functioning instead of NO, explains the similar time courses of P. chabaudi parasitemia in knockout and treated mice compared with controls. However, our finding that mice lacking both B cells and NOS2 resolve their P. chabaudi parasitemia with similar time courses as B cell-deficient controls with NOS2 indicates that plasticity by AMI does not explain why NOS-deficient mice do not have exacerbated P. chabaudi malaria.
Rockett et al. reported that high levels of NO are toxic toPlasmodium falciparum in vitro (38). The lower the
oxygen tension, the greater the efficacy of NO against P.
falciparum in vitro, suggesting that superoxides are scavenging NO
(39). In addition, the lack of exacerbation of P.
chabaudi malaria in the absence of NO does not directly address
whether NO can be induced to function in killing malarial parasites. A
threshold of NO may be needed for NO to kill malarial parasites.
Alternatively, other molecules, such as superoxide, may inactivate NO
in vivo during experimental malaria. We therefore examined whether the
production of high levels of NO production at the time of infection and
during ascending parasitemia would influence the course of P.
chabaudi parasitemia. We selected treatment with formalin-killed
P. acnes to induce NO production because 1) P.
acnes is known to induce nonspecific protection against malaria;
2) it does not produce toxic byproducts like other NO generators; 3)
the enhanced NO production occurs for at least 1 wk after a single
treatment; and 4) the NO is biologically active (12).
P. acnes treatment induced increased serum NOx levels by day
4 of treatment with a peak serum NOx on day 8 of treatment (>10-fold
higher in P. acnes-treated C57BL/6 mice (1069 µM) than in
P. chabaudi-infected C57BL/6 mice (61 µM);
50-fold
higher in P. acnes-treated C57BL/6 mice (1069 µM) than in
P. chabaudi-infected NOS2-deficient mice (22 µM)). Our
observation that P. acnes-treated mice with markedly
enhanced levels of NO suppress their P. chabaudi parasitemia
with a similar time course as treated mice lacking NOS2 (with baseline
NO) indicates that serum NO is not sufficient to prevent malarial
parasites from replicating in blood.
Allison and colleagues as well as Nussenzweig reported decades ago that treatment of mice with P. acnes results in nonspecific protection against bloodstage malaria and activation of macrophages (40, 41, 42). Several groups report that liver macrophages are the source of NO following P. acnes treatment (12, 13). In addition, splenic macrophages are the source of NO during P. chabaudi malaria (19). Treatment of mice with P. acnes in our experiments results in marked protection against bloodstage P. chabaudi malaria and high levels of serum NOx. This protection, as detailed above, is attributable to a mechanism(s) other than NO.
Despite increased levels of NO detected during descending parasitemia, a period when parasites are killed, our results indicate that NO is not required to resolve P. chabaudi malaria even after taking into account the possibility of enhanced AMI. The NO produced during P. chabaudi malaria is due to inflammatory NOS rather than endothelial NOS. These studies also illustrate the danger of extrapolating function from the enhanced production of a compound. The observation of increased NO during descending parasitemia would lead to an erroneous result in this instance.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Henri C. van der Heyde, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, P.O. Box 33932, Shreveport, LA 71130. ![]()
3 Abbreviations used in this paper: NOS, NO synthase; AMI, Ab-mediated immunity; CMI, cell-mediated immunity; NOx, NO2- plus NO3-; AG, aminoguanidine hemisulfate (NOS2 inhibitor); SMT, S-methylisothiourea (NOS2 inhibitor). ![]()
Received for publication April 10, 2000. Accepted for publication June 28, 2000.
| References |
|---|
|
|
|---|
receptor deficient mice. Parasite Immunol. 19:375.[Medline]
and TNF-
and occurs via a nitric oxide-dependent mechanism. J. Immunol. 155:2545.[Abstract]
and
interferon, but not by interleukin-4, during blood stage malaria in mice. Infect. Immun. 64:44.[Abstract]

T cells function in cell-mediated immunity to acute blood- stage Plasmodium chabaudi adami malaria. J. Immunol. 154:3985.[Abstract]

T cell subset in the spleens of mice during blood-stage malaria. J. Immunol. 151:6311.[Abstract]
This article has been cited by other articles:
![]() |
P. Sobolewski, I. Gramaglia, J. A. Frangos, M. Intaglietta, and H. van der Heyde Plasmodium berghei Resists Killing by Reactive Oxygen Species Infect. Immun., October 1, 2005; 73(10): 6704 - 6710. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Potter, A. J. Mitchell, W. B. Cowden, L. A. Sanni, M. Dinauer, J. B. de Haan, and N. H. Hunt Phagocyte-Derived Reactive Oxygen Species Do Not Influence the Progression of Murine Blood-Stage Malaria Infections Infect. Immun., August 1, 2005; 73(8): 4941 - 4947. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Gillman, J. Batchelder, P. Flaherty, and W. P. Weidanz Suppression of Plasmodium chabaudi Parasitemia Is Independent of the Action of Reactive Oxygen Intermediates and/or Nitric Oxide Infect. Immun., November 1, 2004; 72(11): 6359 - 6366. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sharma, A. Eapen, and S. K. Subbarao Parasite Killing in Plasmodium vivax Malaria by Nitric Oxide: Implication of Aspartic Protease Inhibition J. Biochem., September 1, 2004; 136(3): 329 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fortin, M.M. Stevenson, and P. Gros Susceptibility to malaria as a complex trait: big pressure from a tiny creature Hum. Mol. Genet., October 1, 2002; 11(20): 2469 - 2478. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |