The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hural, J. A.
Right arrow Articles by Brown, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hural, J. A.
Right arrow Articles by Brown, M. A.
The Journal of Immunology, 2000, 165: 3239-3249.
Copyright © 00 by The American Association of Immunologists

An Intron Transcriptional Enhancer Element Regulates IL-4 Gene Locus Accessibility in Mast Cells1

John A. Hural2,*, Millie Kwan*, Greg Henkel{dagger}, M. Benjamin Hock{ddagger} and Melissa A. Brown3,*,{ddagger}

* Graduate Program in Immunology and Molecular Pathogenesis, Emory University, Atlanta, GA 30322; {dagger} Aurora Biosciences Corporation, San Diego, CA 92121; {ddagger} Graduate Program in Genetics and Molecular Biology, and § Department of Pathology, Emory University, Atlanta, GA 30322


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cell type-specific expression of a gene is dependent on developmentally regulated modifications in chromatin structure that allow accessibility of basal and inducible transcription factors. In this study, we demonstrate that a cis-acting element in the second intron of the murine IL-4 gene has a dual function in regulating transcription in mast cells as well as chromatin accessibility of the IL-4 gene locus through its influence on the methylation state of the gene. Previous studies have shown that mast cell-restricted transcription factors GATA-1/2 and PU.1 associate with the intron element and regulate its activity. In this study, we use DNase I footprinting and mutational analyses to identify two additional sites that contribute to the element’s ability to enhance transcription. One of these sites associates preferentially with STAT5a and STAT5b. We also demonstrate that deletion of the element or mutation of the GATA binding site in the context of a stably integrated IL-4 genomic construct prevents maintenance of a demethylated locus in IL-4-producing mast cells. These data indicate that, analogous to Ig and TCR intron regulatory elements, the intron enhancer has an essential role in maintaining developmentally regulated demethylation at the IL-4 gene locus. In addition, they indicate that members of the GATA family of transcription factors likely play an important role in these processes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-4 is a pleiotropic cytokine that plays a central role in immunoregulation (for review, see Refs. 1 and 2). It is best known for its ability to induce selective Ig isotype switching in B lymphocytes and to promote the development of Ag-specific Th2 cells from naive CD4+ precursors. In mice, strain-specific differences in the levels of IL-4 produced in infections such as Leishmania major and Schistosoma mansoni contribute to the variable Th2 response that influences disease course (3, 4, 5, 6, 7, 8). However, IL-4 also has profound effects on the activation and/or growth of many other target cells, including endothelial cells, neutrophils, mast cells, eosinophils, and CD8+ T cells. The dysregulation of IL-4 production has been linked to allergic disease and autoimmunity in both human and murine models, attesting to its importance (9, 10). While most studies have focused on IL-4 production by select subsets of activated T lymphocytes, including Th2, {gamma}{delta}+, and NK1.1+ cells (2, 11, 12), mast cells also express IL-4 and are likely to provide a significant source of this cytokine in vivo (13, 14). In addition to de novo inducible synthesis, mast cells contain stores of preformed IL-4 that are released immediately upon activation (15). Mast cells are most prevalent at sites of Ag entry, such as the skin, respiratory tract, and gastrointestinal tract (16, 17), where mast cell-derived IL-4 can initiate inflammatory reactions of the innate immune response. Activated mast cells can also migrate to local lymph nodes (18). This observation supports the idea that mast cells can impact adaptive immune responses by localizing to sites of initial T cell activation and, through elaboration of cytokines such as IL-4, directly influence Th development.

IL-4 production by naive T cells is dependent on the delivery of at least two signals: cross-linkage of the TCR and costimulation through CD28 and/or CD40 ligand (19, 20). In contrast, mast cells are activated through Fc receptor interactions with IgE or IgG (21, 22), as well as via direct interactions with bacterial and parasite products, complement components, and neuropeptides such as Substance P (16, 23, 24, 25, 26, 27). We previously hypothesized that the differences in the ligand-receptor interactions leading to IL-4 production in these cell types would be reflected in distinct nuclear signaling events. There is now substantial evidence to support this hypothesis. For example, GATA-3 and Maf, transcription factors that are essential for maximal IL-4 gene expression by Th2 cells (28, 29), are not expressed in mast cells (30, 31). Intact STAT6 signaling pathways are also required for Th2 differentiation (32, 33, 34), yet mast cells exhibit STAT6-independent IL-4 production: bone marrow-derived mast cell precursors from STAT6-/- mice can differentiate into mature cells that express IL-4 levels comparable to those of wild-type cells (35). Finally, although IL-4 gene transcription is NF-AT-dependent in both mast cells and T cells, there is evidence that each cell type uses distinct NF-AT isoforms (36, 37, 38, 39).

A transcriptional regulatory element located in the second intron of the IL-4 gene may also contribute to cell type-specific expression patterns (40, 41). Several features of this element suggest that it is mast cell specific. Its location was defined by a DNase I hypersensitive site in chromatin examined from a variety of transformed and nontransformed mast cell lines but absent in EL-4 T cells. It exhibits mast cell-specific activity in enhancer-reporter assays, and sequences that contribute to its activity are the binding targets of factors selectively expressed in mast cells and not T cells. These factors include PU.1, an ets family member that is essential for mast cell development, and GATA-1 and -2. However, simultaneous mutation of both GATA and PU.1 binding sites reduces enhancer activity by ~50%, suggesting other regions also contribute to the enhancer activity.

In this study, we have further examined the molecular requirements for full enhancer activity of the intron regulatory element in murine mast cells. We demonstrate that a consensus STAT site that preferentially associates with STAT5 contributes to its enhancer activity in mast cells. We also provide evidence that the intron element plays a role in acquiring and/or maintaining the IL-4 gene locus in a demethylated state in IL-4-producing cells. An intact GATA binding site is essential for this function. Thus, analogous to the enhancer sequences identified in the intervening sequences of Ig and TCR genes, this element has a dual function: it acts as a transcriptional enhancer in transient transfection assays and also plays a role in conferring developmentally regulated demethylation to the IL-4 gene locus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines

CFTL-15 is a nontransformed murine mast cell line derived from fetal liver and is IL-3 dependent (42). These cells express low levels of IL-4 mRNA and protein constitutively and up-regulate this expression initiated in response to activation by cross-linking of the high affinity Fc{epsilon} receptor or calcium mobilization by treatment with ionomycin (14). CFTL-15 cells were cultured in complete RPMI 1640 containing 10% FCS in the presence of 25% WEHI-3B cell supernatants as a source of IL-3. Bone marrow-derived mast cells were derived from bone marrow taken from the femurs of 6- to 8-wk-old C57BL/6 mice and cultured under the same conditions as CFTL-15 mast cells except that recombinant murine stem cell factor (12.5 ng/ml; R&D Systems, Minneapolis, MN) was added during the first 2 wk of culture. In some experiments, ABFTL-3, a growth factor-independent Abelson murine leukemia virus-transformed murine mast cell line that expresses IL-4 constitutively, was used (13). M12 B cells have been described previously (43).

DNase I footprinting

In vitro DNA footprinting was conducted as described (44). Briefly, 10 µg of crude mast cell nuclear extracts were incubated with 0.5 ng (10,000–15,000 cpm) of a 32P-labeled DNA sequence corresponding to base pairs 353–554 of the 683-bp BglII fragment in the second intron of the IL-4 gene. Five nanograms of DNase I (Life Technologies) was added to the reaction, and the digestion was stopped after 60 min. A control reaction was conducted containing no nuclear extract. Following precipitation, the digested DNA fragments were resolved on a 6% denaturing polyacrylamide gel, and results were assessed by autoradiography. The final reaction conditions described above were determined by titrating concentrations of DNase I, protein, and competitor DNA, as well as varying digestion times. The sequence used in these experiments (bp 353–554) was amplified by PCR and subcloned into pGEM-3 (Promega, Madison, WI). The probe was prepared by linearizing pGEM-3 at the 3' or 5' end of the probe, dephosphorylating that end, and then cutting at the other end to release the fragment. The dephosphorylated end was labeled with [{gamma}-32P]ATP using T4 kinase. Sequence homology searches were performed using the Transfac database (Ref. 45 ; http://transfac.gbf.de/TRANSFAC/).

Reporter gene constructs

The murine IL-4 intron enhancer-reporter plasmid used in these studies was constructed by deleting a BglII/PstI fragment corresponding to base pairs 1–254 of the originally defined 683-bp enhancer in p-chloramphenicol acetyltransferase (CAT)4 promoter (Promega) (41). This subsequence corresponds to base pairs 255–683.

Site-directed mutagenesis

Mutations were introduced into the IL-4 intron/pCAT promoter reporter construct by oligonucleotide-directed mutagenesis using the either the Quick Change system (Stratagene, La Jolla, CA) or the Sculptor M13 kit (Amersham, Arlington Heights, IL; indicated by an asterisk). All mutations were verified by sequencing. The mutant forms of the oligonucleotides are as follows (altered nucleotides are underlined): m426, 415–446, 5'-GG GAGGGGACTCGATCGACAGGCTGATAGTGC*; m475, 491–454, 5'-GCTATTGATACACCTGCAGCAAGTCATGTGTTTGTCA; m482, 498–469, 5'-GCACAAAGCTACCTGCAGAGCATAGCCAAG; m491, 478–511, 5'-GCTGTATCAATAGCGATCGACATTTCAGTTCCTG*; m504,520–490, 5'-CCATGAAAACAGGCCTGCAGATGCACAAAGC; m514 (STAT), 495–433, 5'-GTGCATTTCAGTTCCTGTTGGCATGGAAACACACCACTG*; m523, 508–546, 5'-CCTGTTTTCATGGAACGATCGCACTGAGAATGAAAGGCC*; m531, 519–548, 5'-GGAAACACACCATGGCCAATGAAAGGCCCC; m538, 528–543, 5'-CCACTGAGAAGAGTCGGCCCCAAAG; m545, 533–563, 5'-GAGAATGAAAGGGTCGACCGTCTTGACTTAC; m553, 543–568, 5'-GGCCCCAAAGCCCGAGCTTACCAGTG. Derivation of the reporter constructs containing the GATA and PU.1 mutations have been previously described (41).

Transient transfections and CAT reporter gene assays

A total of 5 x 106 CFTL-15 mast cells were transfected by electroporation (Bio-Rad Gene Pulser at 425V and 400 µF; Richmond, CA) using 25 µg of reporter plasmid. After 24 h, cells were divided into two aliquots, and one aliquot was stimulated with 1 µg/ml ionomycin (Sigma). The cells were harvested 18 h poststimulation. Equal amounts of cell extracts were assayed for CAT activity using the scintillation diffusion assay as previously described (40). In some experiments, CAT data were normalized to the relative expression of a cotransfected pSV-ß-galactosidase expression vector (Promega) to correct for variations in transfection efficiency.

EMSA

Nuclear extracts of CFTL-15 mast cells were prepared using the method described by Dignam et al. or Fiering et al. (46, 47) with high concentrations of protease inhibitors (Boehringer Mannheim, Indianapolis, IN). Protein concentrations of the nuclear extracts were determined with the Bio-Rad protein assay kit. EMSAs were performed as previously described (38, 48). Briefly, 5 µg of crude nuclear extract was incubated with 0.1 ng (FP2, see below and Fig. 2GoA) or 1 ng (intron enhancer STAT (iSTAT), see below and Fig. 2GoA) 32P-labeled oligonucleotide for 1 h. Binding reactions with the FP2 probe were performed in a buffer containing 10 mM Tris (pH 7.5), 45 mM KCl, 1 mM EDTA, 0.1% Triton X-100, 12.5% glycerol, 0.5 mM DTT, and 20 µg/ml poly(dI-dC). Reactions with the iSTAT probe were conducted in 20 mM HEPES (pH 7.9), 40 mM KCl, 1 mM MgCl2, 0.1 mM EDTA, 4% Ficoll, 0.5 mM DTT, 1.2 mg/ml BSA, and 100 µg/ml poly(dI-dC). The protein/DNA complexes were separated on a 5% polyacrylamide gel in a buffer consisting of 25 mM Tris, 190 mM glycine, and 1 mM EDTA (for FP2 EMSAs) or 10 mM Tris, 10 mM boric acid, and 2 mM EDTA (for STAT EMSAs). For all competition experiments, a 100-fold molar excess of unlabeled competitor oligonucleotide was used.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. Mutations in the Pit 1-like and STAT binding sites within the intron element substantially reduce enhancer activity. A, Mutations introduced into the footprinted regions of the IL-4 gene intron enhancer within the context of a CAT IL-4 gene intron enhancer-reporter construct (base pairs 255–683). The numbering of mutations corresponds to the first disrupted base pair for each mutation in the 683-bp BglII fragment within the second intron. Mutations are indicated by gray boxes, consensus transcription factor binding sites are designated with light brackets, and footprinted regions (FP1–3) are indicated with heavy brackets. The sequences corresponding to the probe used for STAT binding analyses are also shown (iSTAT). B, CFTL-15 mast cells were transfected with equimolar amounts of the indicated IL-4 intron enhancer constructs. After an overnight incubation, cultures were stimulated with ionomycin, harvested 48 h posttransfection, and assayed for CAT activity as previously described (40 ). The data are compiled from at least four independent transfection experiments in which the wild-type control data was considered 100% activity. The activity of other plasmids is expressed relative to the wild-type activity. Error bars represent SD. In some experiments, the IL-4 reporter constructs were cotransfected with a ß-galactosidase expression construct (85 ) allowing normalization of the CAT activity to the transfection efficiency of each electroporation as previously described (40 ).

 
Oligonucleotide probe and competitor sequences

The following oligonucleotide probe and competitor sequences were used: intron enhancer STAT site probe (iSTAT), 5'-TGTTTTCATGGAAACACA; FP2 region probe (FP2), 5'-CATGACTTGGCTATGCTGTATCAATAGCTTTGTG; mutated intron enhancer STAT site (altered nucleotides are underlined) (miSTAT), 5'-TGTGGGCATGGAAACACA; ß-casein IFN-{gamma} activation site element (GAS), 5'-AGATTTCTAGGAATTCAAATC; IL-4 promoter STAT site –154 to –132 of the murine IL-4 5' region (48) (IL-4 STAT), 5'-TGATTTCACAGGAAAATT; consensus Pit 1, 5'-TGTCTTCCTGAATATGAATAAGAAATA; consensus Oct 1 (Oct), 5'-TGTCGAATGCAAATCACTAGAA; consensus AP-1, 5'-CGCTTGATGAGTCAGCCGGAA; FP2 m475 (m475), 5'-CATGACTTGCTGCAGGTGTATCAATAGCTTTGTG; FP2 m482 (m482), 5'-CATGACTTGGCTATGCTCTGCAGGTAGCTTTGTG.

Western blot analyses

Western blot analyses were performed essentially as described (44). Proteins were separated on 10% SDS-PAGE gels and electro-blotted to nitrocellulose membrane (Schleicher and Schuell, Keene, NH). The membranes were blocked with 5% nonfat dry milk in 10 mM Tris (pH 8.0), 150 mM NaCl, and 0.5% Tween 20. Anti-Pit 1 and anti-NF-{kappa}B Abs (rabbit polyclonal Ig) (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6 mouse mAbs (Zymed, San Francisco, CA) were used as the primary Ab at 1:1000 dilution. HRP-conjugated goat anti-rabbit secondary Ab (Amersham) was used at a 1:5000 dilution. The blots were visualized using the Renaissance Western blot chemiluminescence reagent (NEN, Boston, MA).

Oligonucleotide affinity precipitation

Large-scale (200–500 fold) EMSA binding reactions were conducted using the indicated 5' biotinylated probe. The resulting protein/DNA complexes were precipitated with streptavidin-agarose (Sigma, St. Louis, MO) and washed extensively with binding buffer. The specifically bound proteins were eluted with SDS-PAGE loading dye and separated on a 10% SDS-PAGE gel. The presence of specific proteins was visualized by Western blot analysis as described above.

Stable cell transfections

Two versions of an IL-4 genomic construct, with (gIL-4) and without (g{Delta}IL-4) the intron enhancer sequences, were stably transfected into CFTL-15 mast cells and M12 B cells together with pEGFP-N1, a green fluorescent protein (GFP)/neomycin-resistance gene expression vector (Clontech, Palo Alto, CA) at a 10:1 ratio using a Bio-Rad Gene Pulser at 425 V and 400 µF. The wild-type construct contains the complete IL-4 genomic sequence (gIL-4) from 797 bp 5' of the transcriptional start site to ~2000 bp 3' of the fourth exon. It was made by ligating the HindIII fragment of the IL-4 genomic clone, pMIL-5 (49), which contains exons I, II, and III, with a HindIII fragment from pMIL-1 (49) into pUC18. The enhancerless version of this construct was assembled from PCR-generated fragments that lack the 683-bp BglII intron enhancer element. Mutations in the GATA, ets, FP2 (m482), and STAT sites were made in the context of pMIL-5 (48), a construct containing exons I, II, and III using the Quik Change mutagenesis system (Stratagene). After transfection, the cells were cultured in medium containing 400–600 µg/ml G418 for at least 4 wk. Cells were cloned by limiting dilution. Integration of the transfected plasmids was monitored by flow cytometry and by PCR using genomic DNA as a template and vector- and IL-4 exon-specific primers.

Determination of the methylation status of the IL-4 gene locus

Genomic DNA was isolated from stably transfected and untransfected cells with DNAzol (Life Technologies, Rockville, MD) using the manufacturer’s suggested protocol. DNA was digested with HindIII followed by digestion with either MspI (methylation insensitive) or HpaII (methylation sensitive) (Life Technologies). The digested DNA was separated on a 1% agarose-TBE gel and transferred to nitrocellulose membrane by the Southern blot protocol as described (44). The blot was probed with a 32P-radiolabeled StuI/EcoRI fragment from the second intron of IL-4 (see Fig. 5GoA).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 5. The intron enhancer region is required for the demethylation of the IL-4 locus in mast cells. A, Schematic of IL-4 genomic constructs used in transfection experiments. HindIII sites are indicated by H. The location of HpaII/MspI sites within the second intron are designated by |. Light brackets indicate the StuI/EcoRI fragment used as a probe in Southern blot analysis. The approximate position of PCR primers used to verify the integration of the transfected constructs is also shown by arrows. B, PCR using vector- and gene-specific primers (see A) and genomic DNA isolated from M12 B cells and CFTL-15 mast cells that were transfected with the indicated plasmids. gIL-4 designates DNA isolated from cells transfected with the wild-type IL-4 genomic construct; g{Delta}IL-4 designates DNA isolated from cells transfected with the enhancerless IL-4 genomic construct. Ø designates control cells transfected with the GFP/neomycin vector alone. C, Analysis of the methylation status at the IL-4 gene locus in transfectants carrying stably integrated copies of IL-4 genomic constructs with and without the intron enhancer. Genomic DNAs from M12 B cells and CFTL-15 mast cells were subjected to Southern blot analysis. DNA was digested with either HindIII alone (-) (lanes 1, 4, and 7) or with HindIII followed by either MspI (M) (lanes 2, 5, and 8) or HpaII (H) (lanes 3, 6, and 9). Blots were probed with a 32P-labeled StuI-EcoRI fragment from the second intron of IL-4 (see A above). Ø designates cells that received the GFP/neomycin vector alone; gIL-4 designates DNA isolated from cells transfected with the wild-type IL-4 genomic construct; g{Delta}IL-4 designates DNA isolated from cells transfected with the enhancerless IL-4 genomic construct. Arrow indicates position of HpaII-insensitive HindIII fragment.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In vitro footprinting reveals three regions of protein binding within the IL-4 intron enhancer

Previous analyses of the sequences that comprise the IL-4 gene intron enhancer demonstrated that at least two elements, corresponding to consensus PU.1 (ets) and GATA binding sites, contribute to the enhancer’s activity (41). Because the simultaneous mutation of both these sites does not completely eliminate enhancer activity, it is likely that additional regions are involved. As a first step toward defining such potential sites, in vitro footprinting experiments were performed using mast cell nuclear extracts and a DNA probe comprising a 428-bp intron sequence. This probe (base pairs 255–683 of the 683-bp BglII fragment, see Fig. 1GoA) corresponds to a sequence that confers full enhancer activity in reporter construct assays (41). These assays revealed protein binding to three distinct regions, termed FP1, FP2, and FP3 (Fig. 1Go, B–D). FP1 encompasses a previously defined SP-1 site and the GATA binding site, while FP3 is adjacent to the PU.1 site (Fig. 2GoA). However, the sequences within FP2 and FP3 have not been previously analyzed for regulatory activity.



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 1. In vitro DNase I footprinting reveals three regions of protein binding within the intron enhancer. A, Schematic of the IL-4 gene indicating the 683-bp BglII (B) fragment in the second intron that contains the regulatory element. HS denotes the position of the mast cell-specific DNase I hypersensitive site that first indicated the presence of a regulatory element within the second intron of the IL-4 gene (40 ). Numbering of the nucleotides within this fragment is based on designating the first base of the BglII site as 1. B–D, In vitro DNase I footprinting of the IL-4 gene intron enhancer region. Mast cell nuclear extracts were incubated with PCR-generated 32P-end-labeled DNA fragments corresponding to base pairs 353–554 of the BglII enhancer fragment. The protein-DNA complexes were treated with DNase I, and fragments were resolved on a 6% denaturing polyacrylamide gel. B and C represent two different experiments with the probe labeled at the 5' end and the gel run for different lengths of time. D shows an experiment with the probe labeled from the 3' end, and arrows designate hypersensitive regions. The three regions of protein binding (footprints) are labeled FP1, FP2, and FP3. Ø indicates lanes in which no protein was added. A-T lanes represent dideoxy sequencing reactions of the intron fragment that are included as a sequence reference.

 
Additional sequences contribute to IL-4 enhancer activity

To examine the ability of sequences within FP1, FP2, and FP3 to confer enhancer activity, mutations were introduced into sequences that span the three footprinted regions of the intron sequence within the context of a CAT reporter construct (Fig. 2GoA). Transient transfection assays were performed in CFTL-15 mast cells to assess the consequence of these mutations on enhancer activity. As shown in Fig. 2GoB, the mutations designated m482, within FP2, and m514, within FP3, had the most profound effect on enhancer activity. Each mutation alone caused an 80% reduction in CAT activity relative to the wild-type levels. A transcription factor binding site homology search using the Transfac database (45) revealed that the m482 mutation alters a site resembling a consensus Pit 1 binding site. The mutation m514 disrupts a consensus STAT binding site (50, 51).

The site defined by m482 within FP2 forms specific DNA-protein complexes in mast cells

Specific DNA-protein interactions at regions defined by footprint analysis were first assessed by EMSA using an oligonucleotide probe corresponding to sequences in the FP2 region. A single complex forms using both unstimulated (data not shown) and stimulated CFTL15 nuclear extracts (Fig. 3GoA). Competition experiments with mutant forms of unlabeled FP2 demonstrate that the sequences defined by m482, but not m475, contribute to mast cell protein binding.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 3. Sequences defined by the m482 mutation are critical for protein binding in the FP2 region. A, EMSAs were performed with nuclear extracts isolated from ionomycin-stimulated CFTL-15 mast cells and the FP2 DNA probe. Where indicated, a 100-fold molar excess of unlabeled wild-type (self), mutated (m482 and m475), or unrelated (UR) competitor (an AP-1 consensus site) oligonucleotide was added to the standard binding reaction mixture. B, Pit-1 expression in mast cells. One hundred micrograms of crude nuclear extract from unstimulated M12 B cells, CFTL-15, or bone marrow-derived mast cells (BMMC) was analyzed by Western blot techniques using {alpha}-Pit-1 antisera. C, The binding of mast cell nuclear proteins to a consensus Pit 1 binding site was assayed using EMSA analysis. Where indicated, a 100-fold molar excess of unlabeled wild-type (self), mutated (m482 and m475), Oct binding site, or unrelated (UR) competitor (an AP-1 consensus site) oligonucleotide was added to the standard binding reaction mixture. D, Analysis of Pit 1 binding to FP2 sequences using DNA oligonucleotide affinity precipitation. Biotinylated oligonucleotides corresponding to the FP2 region of protein binding were incubated with crude CFTL-15 mast cell extract under the same binding conditions used for the EMSA experiments. After precipitation with streptavidin-agarose beads, the bound proteins were analyzed by Western blot with anti-Pit-1 antisera. Crude extracts and unbound fractions were also analyzed.

 
A protein antigenically related to Pit 1 is expressed in mast cells

Based on computer analyses (45), m482 disrupts a site resembling a Pit 1 binding site. Pit 1 was originally described as a pituitary-specific protein belonging to the POU domain family of transcription factors (52). Of potential interest is the finding that Pit 1 specifically interacts with another IL-4 intron binding protein, GATA-2, to regulate development of distinct pituitary cell types (53). Its expression in mast cells has not been previously evaluated. Western blot analysis of CFTL-15 and bone marrow-derived mast cell nuclear extracts was performed using commercially available anti-Pit 1 Abs. The results indicate that a protein of 38 kDa, the reported molecular mass of Pit 1, is expressed constitutively in both mast cell lines but not in M12 B cells (Fig. 3GoB) or T cells (data not shown).

Pit 1 does not associate with the intron enhancer element

The apparent constitutive and selective expression of this transcription factor in mast cells, together with protein binding to the Pit 1-like sequence in the FP2 region, suggests that Pit 1 may contribute to the activity of this element. To examine the possible involvement of Pit 1 in the FP2 complex, several experiments were performed. A Pit 1 consensus site oligonucleotide was used as a probe in EMSA experiments. Proteins in mast cell nuclear extracts form specific complexes with oligonucleotides containing the Pit 1 binding site (Fig. 3GoC). Of note, these complexes migrate with a distinct mobility compared with the FP2 complexes. Unlabeled oligonucleotides corresponding to the Pit 1 sequence or to an Oct 1 binding sequence compete for protein binding in competition experiments. However, protein binding to this sequence is not competed by a 100-fold molar excess of FP2 oligonucleotides. Likewise, competitor Pit 1 and Oct 1 consensus oligonucleotides do not disrupt FP2 DNA-protein complexes (data not shown). Neither the Pit 1 nor the FP2 protein-DNA complex were supershifted by the commercially available Pit 1 antisera (data not shown).

Oligonucleotide affinity precipitation assays were also performed. Large-scale binding reactions were performed using mast cell nuclear extracts and a biotinylated FP2 probe. DNA-protein complexes were precipitated with streptavidin-agarose beads. After extensive washing, specifically bound proteins were eluted and subjected to Western blot analysis using Pit 1 antisera. As shown in Fig. 3GoD, there is no evidence that anti-Pit 1-reactive proteins are specifically eluted from the FP2 probe. These data indicate that despite the strong constitutive expression of this protein in mast cells, Pit 1 does not associate with this IL-4 gene regulatory site. We speculate that a related, "Pit 1-like" factor, perhaps another member of the POU domain family, binds to this site in vivo.

STAT proteins bind the intron STAT element in mast cells

The functional region defined by m514 flanks the previously defined PU.1 binding site and directly disrupts a STAT consensus site (TTTCATGGAA) that could potentially bind either STAT6 (TTN6AA) or other STAT family members (TTN5AA) (50, 51). We first asked if this site could function as a bona fide STAT6 binding site. Extracts from IL-4-stimulated B cells were used in EMSA binding reactions with probes derived from the FP3 region, designated iSTAT (Fig. 2GoA). Two complexes are observed, both of which are competed by "self" (lane 2) but not by the unrelated AP-1 oligonucleotides (lane 4). A conventional STAT6 oligonucleotide corresponding to sequences present in the murine IL-4 promoter competes for proteins binding to the slower mobility complex (lane 3). STAT6-specific antisera can also supershift this complex (lane 5). These data indicate that STAT6 as well as other factors can bind to the iSTAT binding site. Similar experiments were conducted with extracts from unstimulated and IL-4- or ionomycin-stimulated mast cells. As shown in Fig. 4GoB, IL-4 induces the association of a single complex (lane 2). This complex contains a mast cell-specific isoform of STAT6 that lacks the C-terminal amino acids and fails to react with antisera that can supershift STAT6 in B and T cells (48). EMSA experiments with ionomycin-stimulated mast cell extracts reveal that several activation-dependent DNA-protein complexes form with the iSTAT probe (lane 3). Notably, the number and mobility of complexes formed with ionomycin-activated mast cell extracts are distinct when compared with the IL-4-induced complex.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 4. STAT5 preferentially binds to the IL-4 gene intron regulatory element. A, STAT6 can associate with the iSTAT element. Whole-cell extracts from IL-4-stimulated M12 B cells were used in EMSA experiments with a radiolabeled iSTAT probe (see Fig. 2GoA). Where indicated, a 100-fold molar excess of unlabeled wild-type (self), a defined STAT6 binding site, an AP-1 consensus site oligonucleotide, or anti-STAT6 Ab was added to the standard binding reaction mixture. Ø indicates no competitor is added. Arrows denote migration position of the STAT6-containing complex (filled) and supershifted with an anti-STAT6 Ab (open). B, IL-4 and ionomycin induce distinct protein-DNA complexes with the iSTAT probe. EMSA reactions were performed with whole-cell extracts from unstimulated (Ø), IL-4-treated, or ionomycin (I)-stimulated mast cells. Arrows denote three distinct ionomycin-induced complexes. C, EMSA analysis of protein-DNA interactions with the IL-4 gene iSTAT site. Binding reactions were performed with the iSTAT oligonucleotide probe and ionomycin-activated mast cell nuclear extracts. To examine the specificity of the various complexes, competition experiments were conducted using a 100-fold molar excess of the indicated unlabeled oligonucleotide added to the standard EMSA binding reaction. The filled arrow indicates the complex containing the putative STAT proteins. D, STAT5 binding to the enhancer in mast cells. DNA oligonucleotide affinity precipitations were performed with a biotinylated iSTAT probe and whole-cell CFTL-15 mast cell extracts. The specifically bound proteins were analyzed by western blot using anti-STAT1, anti-STAT2, anti-STAT3, anti-STAT4, anti-STAT5a, anti-STAT5b, anti-STAT6 murine mAbs, or purified rabbit anti-NF-{kappa}ß polyclonal Ab.

 
The specificity of the ionomycin-inducible protein-DNA interactions is demonstrated in cold competition experiments (Fig. 4GoC). Competition with a 100-fold molar excess of unlabeled iSTAT probe (self, lane 2), but not an unrelated probe (AP-1, lane 6), completely eliminated the detection of the complexes. These experiments also indicate that only the faster mobility complex contains proteins related to the STAT family of transcription factors. Competition with an unlabeled oligonucleotide containing a disruption in this STAT site (miSTAT (XXCATGAA), lane 3) fails to compete for proteins associated with the fast mobility complex but eliminates detection of the upper complexes. Surprisingly, while a ß-casein probe (GAS, lane 5), which can bind all STAT family members, competes solely for binding of this fast mobility complex, a consensus STAT6 (lane 4) probe competes poorly. These results indicate that ionomycin stimulation of mast cells, which can also activate STAT6 (48), does not result in STAT6 binding to this region. Rather, activation induces the formation of complexes that contain other STAT family members as well as factors unrelated to STAT.

The intron STAT site specifically binds STAT5a and STAT5b

Ionomycin induces the expression of both IL-3 and IL-4 in mast cells, which may in turn act in an autocrine fashion to activate STAT5 and STAT6, respectively, in these cells. To determine whether STAT5 binds to the iSTAT site in stimulated mast cells, DNA oligonucleotide affinity precipitation reactions were conducted as described above using a biotinylated version of the iSTAT probe. Both STAT5a- and STAT5b-specific Abs reacted with the bound protein fraction (Fig. 4GoD). In contrast, a STAT6 Ab showed only weak reactivity. Abs to STATs 1–4 and NF-{kappa}B failed to react with the bound protein fraction. Thus, STAT5a and 5b constitute the major components of the faster migrating inducible mast cell iSTAT complex.

The intron regulatory element influences the methylation state of the IL-4 gene in murine mast cells

Several cell type-restricted regulatory elements have been identified in the intervening sequences of both the Ig and TCR genes (for review see Refs. 54 and 55). Originally defined as conventional enhancer sequences in reporter assays, they appear to have an additional function in vivo. They have a major influence on chromatin accessibility of these loci. For example, deletion of the µ or {kappa} Ig enhancer element in the context of a stably transfected recombination substrate results in a loss of the ability to undergo recombination and methylation of the introduced sequences in appropriate cell types, indicative of an inaccessible chromatin configuration (56, 57).

Based on this paradigm, we asked whether the defined mast cell intron enhancer could also influence chromatin accessibility of the IL-4 gene. It is well established that methylated cytosines within chromosomal DNA are associated with gene inactivation, whereas demethylated regions correlate with transcriptionally active or inducible genes (58, 59). However, until recently, the relationship of DNA methylation state to the conventional markers of chromatin accessibility such as DNase I hypersensitivity and local histone acetylation has been less clear. The recent discovery of MeCp2, a protein that binds methylated CpG dinucleotides and recruits deacetylase activity to specific chromosomal regions, provides a direct link between methylation of DNA and histone deacetylation and, therefore, chromatin accessibility (60, 61). Thus, we asked whether the methylation state of integrated IL-4 gene contructs is influenced by the intron regulatory element. Two versions of an IL-4 genomic construct, with (gIL-4) and without (g{Delta}IL-4) the intron enhancer sequences (Fig. 5GoA), were stably transfected into CFTL-15 mast cells and M12 B cells, a non-IL-4-producing cell line, along with a GFP/neomycin-resistance gene expression vector. After at least 4 wk of selection in G418, genomic DNA was isolated from each transfectant culture.

We first verified that the appropriate constructs were integrated in each cell population using PCR. Primers that hybridize to pUC18 vector sequences 5' of the IL-4 gene cloning site as well as to sequences just 3' of the intron element were used to amplify the transfected IL-4 gene sequences (Fig. 5GoA). As shown in Fig. 5GoB, DNA from cells transfected with either the wild-type IL-4 construct or the deleted IL-4 construct but not those transfected with the GFP/neomycin vector alone served as successful templates and yielded a PCR product of the expected size. These data confirm that the wild-type and enhancerless IL-4 genomic constructs are stably integrated into both M12 B cells and CFTL-15 mast cells.

To assess the chromatin state, the methylation status of the transfected sequences was then examined by Southern blot analysis using a pair of enzymes whose recognition site is CCGG: HpaII, which is sensitive to methylated CpGs, and MspI, which cuts irrespective of the methylation state. Our hypothesis predicts that both the transfected wild-type and enhancerless genes will be methylated in non-IL-4-producing cells, but only the deleted construct will be methylated in IL-4-producing mast cells. As expected, both versions of the transfected IL-4 gene constructs are methylated in M12 cells (Fig. 5GoC, lanes 6 and 9, left), as is the endogenous gene, reflecting the inactivity of the IL-4 gene in B cells. The wild-type construct is demethylated in bulk cultures of transfected CFTL-15 mast cells (Fig. 5GoC, lane 6, right). In contrast, the integrated, enhancerless construct is methylated in IL-4-producing cells (as indicated by its resistance to HpaII digestion, Fig. 5GoC, lane 9, right), despite the demethylated state of the endogenous IL-4 locus. We speculate that the relatively light intensity of the HpaII-resistant band reflects the fact that fewer cells in the bulk-transfected culture contain the integrated transgene, whereas all contain the endogenous IL-4 gene. Using a probe corresponding to -800 to +60 of the IL-4 gene with the same DNA samples, we confirmed that demethylation of the two upstream HpaII sites present in the transfected construct (at ~749 and between intron I and II, see Fig. 5GoA) is likewise dependent on the presence of the intron regulatory element (data not shown).

Individual clones were also isolated from mast cell transfectants using limiting dilution cloning techniques. The analyses of two clones of each type of transfectant are presented in Fig. 6Go, A and B, and are representative of our analysis of at least four clones of each type. As shown in Fig. 6GoA, PCR analyses confirmed the appropriate IL-4 gene constructs are integrated into these clonal populations. In addition, the methylation status of the transfected constructs was identical with that observed in the bulk CFTL-15 mast cell cultures (Fig. 6GoB). The integrated enhancerless construct is resistant to HpaII digestion (lanes 15 and 18) in g{Delta}IL-4-transfectant clones, indicating a failure to become demethylated. It is notable that the intensity of the HpaII-resistant band is much stronger than that observed in experiments with the bulk-transfected cells, which likely reflects the higher proportion of cells containing the integrated transgene in these cloned lines. Taken together, these results strongly support the hypothesis that the intron sequences have an important role in regulating cell type-specific accessibility of the IL-4 gene in murine mast cells by influencing the methylation status of the locus.



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 6. Clonal populations of mast cell transfectants exhibit the same dependence on the intron regulatory element for demethylation. A, PCR using genomic DNA from cloned CFTL-15 mast cell transfectants. Primers that hybridize with the pUC18 vector in region 3' of the intron enhancer sequence are shown in Fig. 5GoA. Ø designates control cells transfected with the GFP/neomycin vector alone. gIL-4 designates DNA isolated from cells transfected with the wild type IL-4 genomic construct; g{Delta}IL-4 designates DNA isolated from cells transfected with the enhancerless IL-4 genomic construct. B, Analysis of the methylation status of the IL-4 gene locus in two different cloned CFTL-15 mast cell transfectants carrying stably integrated copies of IL-4 genomic constructs with and without the intron enhancer. Genomic DNA from cloned cells was subjected to Southern blot analysis as described above (Fig. 5GoC). M denotes samples digested with HindIII plus MspI, H denotes samples digested with HindIII plus HpaII, and denotes samples digested with HindIII alone. Arrow indicates position of HpaII-insensitive HindIII fragment.

 
Mutations in the intron GATA binding sites interfere with the ability to acquire and/or maintain a demethylated locus

We next asked whether the functionally important sites defined in enhancer assays could contribute to the ability of the intron element to influence IL-4 gene methylation status. Southern blot analyses were performed as described above using DNA isolated from cells stably transfected with IL-4 genomic constructs (see Fig. 7GoA) containing mutations in the GATA, ets, and STAT sites as well as the site defined by m482. PCRs with vector- and gene-specific primers were conducted to confirm integration of the constructs in transfected cells (Fig. 7GoB). As shown in Fig. 7GoC, DNA from the mGATA transfectants was unable to achieve a completely demethylated state as shown by its partial resistance to HpaII (lane 9). The same results were obtained in several independent experiments even under conditions in which the DNA samples were subjected to multiple treatments of excess enzyme to assure that complete digestion occurred. The STAT and ets site mutations, but not m482, also reproducibly resulted in decreased demethylation at some sites within the intron region of the transgene; however, the effect was less marked than that observed in the mutant GATA transfectants. Thus, association of GATA, and perhaps to a lesser extent STAT and PU.1, with an element in the second intron of the mouse IL-4 gene influences its methylation state.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 7. Mutations within intron transcription factor binding sites also disrupt the ability of the IL-4 gene locus to maintain a demethylated state. A, Schematic of mutant IL-4 genomic constructs used in transfection experiments. HindIII sites are indicated by H. The location of HpaII/MspI sites within the second intron are designated I as is the StuI/EcoRI fragment used as a probe in Southern blot analysis. The approximate position of PCR primers used to detect the integration of the transfected constructs is also shown by arrows. B, PCR using vector- and gene-specific primers (see A) and genomic DNA isolated from CFTL-15 mast cells that were transfected with the IL-4 genomic constructs containing the indicated mutations within the intron element. WT designates DNA isolated from cells transfected with the wild-type IL-4 genomic construct. C, Analysis of the methylation status at the IL-4 gene locus in transfectants carrying stably integrated copies of IL-4 genomic constructs with mutations in intron transcription factor binding sites. DNAs from transfected CFTL-15 mast cells were subjected to Southern blot analysis. DNA was digested with either HindIII alone (-) (lanes 1, 4, and 7) or with HindIII followed by either MspI (M) (lanes 2, 5, and 8) or HpaII (H) (lanes 3, 6, and 9). Blots were probed with a 32P-labeled StuI-EcoRI fragment from the second intron of IL-4 (see A above). WT designates DNA from cells that were transfected with the wild-type IL-4 gene construct.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
While most previous studies have focused on the cis- and trans-acting factors that initiate IL-4 gene transcription in activated cells, there is clearly an additional level of regulation. Studies in T cells (62, 63) as well as those in mast cells by our laboratory (S. K. Lee and M. A. Brown, manuscript in preparation) have established a role for developmentally regulated chromatin accessibility in IL-4 gene expression. DNase I hypersensitivity and demethylation within the IL-4 gene locus are observed at an early stage in the commitment to a Th2 or mast cell lineage. Importantly, these hallmarks of "open" chromatin are evident in both cell types, independent of active IL-4 transcription. These observations demonstrate that the acquisition of an IL-4-producing phenotype occurs in two steps: 1) developmental signals confer locus opening; and 2) activation signals in differentiated cells promote transcriptional activation of the IL-4 gene.

In this study, we provide evidence that the regulatory element defined within the second intron of the murine IL-4 gene plays a role in both these processes in mast cells. First, it functions as a position- and orientation-independent transcriptional enhancer in conventional reporter gene assays and can act with both the native IL-4 gene promoter as well as heterologous promoters (40). Enhancer activity is dependent on sequences forming binding sites for GATA-1 and GATA-2, PU.1, STAT5, and a Pit 1-related factor. Second, this element appears to play a role in mediating or maintaining locus opening. Both the endogenous IL-4 gene and a stably transfected wild-type IL-4 chromosomal gene construct are appropriately demethylated in IL-4-producing mast cells, indicative of an open locus. However, in IL-4-producing mast cells, the methylated state of a transfected construct lacking the intron regulatory element strongly suggests that these sequences are necessary to achieve and/or maintain an accessible chromatin configuration. The dependence on cell type-specific factors for this effect is demonstrated by the inability of either construct to exhibit a demethylated state in B cells.

This proposed "dual-function" element located within an IL-4 gene intron has many parallels to elements that influence developmentally regulated TCR and Ig gene expression in T and B lymphocytes (54, 55). Several studies of the TCR {alpha}, ß, and {delta} genes, as well as Ig heavy and light chain genes, demonstrate that sequences defined as enhancers in transient transfection assays also influence processes such as VDJ and VJ recombination as well as somatic mutation of the Ig genes. It is likely that these elements act to influence chromatin accessibility that allows the recombination machinery access to the region. In support of this idea, in vivo and in vitro studies of the {kappa}- and µ-chain enhancers confirm their role in demethylation of the Ig locus. For example, a transfected µ-chain gene containing the intron µ heavy chain enhancer is hypomethylated in pre-B cells, correlating with expression of the heavy chain gene. Deletion of the µ enhancer leads to transcriptional inactivation and de novo methylation (64). Similar types of analyses have shown that the {kappa} light chain enhancer also has a role in inducing demethylation of the locus in a lineage- and developmental stage-specific manner (65, 66). Genetic deletion of the TCR {alpha} and ß enhancers also negatively affects recombination (67, 68, 69). The apparent commonality of mechanisms that operate on such diverse gene systems such as the Ig, TCR, and IL-4 genes to regulate accessibility suggests that similar regulatory events occur at other gene loci. Indeed, these data may necessitate the development of a new paradigm for the in vivo function of many other gene regulatory elements, first defined as transcriptional enhancers, located in introns or elsewhere.

Our analysis of specific sites and proteins that associate with the intron element and mediate its activity also supports the idea that this element has dual function. Although little is known about the mechanisms through which enhancers act to influence locus opening, it is striking that many of the factors that associate with the functional elements of the IL-4 enhancer have been implicated in influencing chromatin accessibility at loci encoding other cell type-specific genes. These include GATA-1, PU.1, STAT5, and POU domain family factors. For example, it has been shown that GATA-1, expressed in myeloid lineage cells, is able to bind to GATA binding sites in nucleosomal DNA and cause extensive and cooperative breakage of the DNA/histone contacts (70). Thus, this factor likely plays an important role in initiating locus-opening events. PU.1, a factor whose expression is limited to B cells, macrophages, neutrophils, and mast cells (41, 71, 72, 73), can bind to plasmids containing the µ enhancer (71, 74). Binding by PU.1 does not alter the nucleosomal array that assembles around the transfected plasmid, but does increase the restriction enzyme accessibility within the enhancer (74). In addition, ectopically expressed PU.1 cooperates with other ets family members to induce Iµ transcription, a marker of locus opening that precedes VDJ recombination, and to increase chromatin sensitivity to restriction enzyme digestion in stably transfected NIH 3T3 and pro-T cells. Finally, it has been established that STAT family members can interact with transcriptional coactivators such as CBP/p300 and PCAF, proteins that express intrinsic histone acetyltransferase activity (75, 76, 77, 78, 79). Local histone acetylation is also associated with gene transcriptional activity and is another marker of accessible chromatin (80, 81). It has been proposed that through their interaction with these coactivators, transcription factors direct this histone acetyltransferase activity to specific gene regulatory regions. STAT5, in particular, activated through IL-7 signaling, can interact with p300/CBP through an adapter protein termed Nmi (77) and has been shown to regulate the accessibility of the TCR{gamma} locus (82, 83). The established roles for these IL-4 intron binding factors in chromatin opening is consistent with the idea that they play similar roles in modifying IL-4 gene chromatin in IL-4-producing cells.

It is still unclear whether the intron element mediates mast cell-specific effects on IL-4 gene expression. GATA-1/2, Pit 1, and PU.1 are not expressed in T cells, and we have been unable to demonstrate conventional enhancer activity in Th2-derived cell lines (J. Hural and M. A. Brown, manuscript in preparation), supporting the idea that this element acts as a mast cell-specific enhancer. However, this intron region is also demethylated during the course of T cell differentiation (63), and Agarwal and Rao recently demonstrated that the appearance of intron DNase I hypersensitive sites are associated with the development of an IL-4-producing phenotype in Th2 cells (62). Of note, these sites appear to be in close proximity to, but spatially distinct from, those identified in mast cells. These findings raise the possibility that despite its lack of enhancer activity, the second intron is essential for regulating IL-4 transcription in both cell lineages. In T cells, it may only be involved in processes that mediate chromatin remodeling. Just as there are distinct cell type-specific factors that regulate transcriptional activation of the IL-4 gene, different developmental pathways leading to mast cell vs T cell development may necessitate the use of distinct subsets of factors and sites for locus opening. Related, but distinct factors that impact Th2 development, such as GATA-3 and STAT6 (28, 34), may act on this element in T cells and serve such a function. This possibility is currently being examined.

Many questions remain regarding the relative in vivo contribution of this enhancer element and its associated trans-acting factors in directing transcriptional enhancement vs induction and/or maintenance of locus accessibility. Because these elements are generally defined in transient transfection assays where the native chromosomal context of a sequence is not preserved, we cannot exclude the possibility that it does not act in direct transcriptional enhancement in vivo. The observed enhancer activity in such assays may merely be a marker of its influence on transcription but is unrelated to its physiologic role. However, if the intron does mediate both functions in mast cells, determining whether the same set of transcription factors mediates both effects will be of great interest. The range of influence that the intron regulatory element exerts on the accessibility of the entire IL-4 gene locus is also undefined. It will be important to determine whether the intron element exerts only a local influence or also regulates the accessibility of distal sequences, such as those comprising the IL-13/IL-4 intergenic region. This region is postulated to play a role in coordinately regulating the expression of cytokine genes that are linked on chromosome 11 in mice and chromosome 5 in humans (84). Future studies using transgenic mice as well as those with targeted deletions in genes encoding the implicated factors will address these issues.


    Acknowledgments
 
We thank Drs. Jerry Boss, Melanie Sherman, and Virginia Secor, as well as Susan Lee, for critical reading of the manuscript and helpful discussions. We are also grateful to Doris Powell who contributed to the generation of the IL-4 genomic constructs and analysis of the transfectants, Tammy Nachman who provided important assistance with cell culture and cloning, and Janice Moser who assisted with flow cytometric analysis of transfectants.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants AI 34040 and CA47992 and a scholarship from the Leukemia Society of America (to M.A.B.). Back

2 Current address: Infectious Disease Research Institute, Corixa Corporation, 1124 Columbia Street, Suite 200, Seattle, WA 98104. Back

3 Address correspondence and reprint requests to Dr. Melissa A. Brown, Emory University, Department of Pathology, 1639 Pierce Drive, Atlanta, GA 30322. Back

4 Abbreviations used in this paper: CAT, chloramphenicol acetyltransferase; iSTAT, intron enhancer STAT; GAS, IFN-{gamma} activation site; GFP, green fluorescent protein. Back

Received for publication March 21, 2000. Accepted for publication July 5, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brown, M. A., J. Hural. 1997. Functions of IL-4 and control of its expression. Crit. Rev. Immunol. 17:1.[Medline]
  2. Paul, W. E.. 1991. Interleukin 4: a prototypic immunoregulatory cytokine. Blood 77:1859.[Free Full Text]
  3. Sadick, M. D., F. P. Heinzel, B. J. Holaday, R. T. Pu, R. S. Dawkins, R. M. Locksley. 1990. Cure of murine leishmaniasis with anti-interleukin-4 monoclonal antibody: evidence for a T cell-dependent, interferon {gamma}-independent mechanism. J. Exp. Med. 171:115.[Abstract/Free Full Text]
  4. Locksley, R. M., F. P. Heinzel, M. D. Sadick, B. J. Holaday, Jr K. D. Gardner. 1987. Murine cutaneous leishmaniasis: susceptibility correlates with differential expansion of helper T cell subsets. Ann. Inst. Pasteur Immunol. 138:744.[Medline]
  5. Launois, P., K. G. Swihart, G. Milon, J. A. Louis. 1997. Early production of IL-4 in susceptible mice infected with Leishmania major rapidly induces IL-12 unresponsiveness. J. Immunol. 158:3317.[Abstract]
  6. Chatelain, R., K. Varkila, R. L. Coffman. 1992. IL-4 induces a Th2 response in Leishmania major-infected mice. J. Immunol. 148:1182.[Abstract]
  7. Pearce, E., E. Sabin. 1995. Early IL-4 production by non-CD4+ cells at the site of antigen deposition predicts the development of a T helper 2 cell response to Schistosoma mansoni eggs. J. Immunol. 155:4844.[Abstract]
  8. Scott, P., E. Pearce, W. Cheer, R. I. Coffman, A. Sher. 1989. Role of cytokines and CD4+ T cell subsets in the regulation of parasite immune disease. Immunol. Rev. 112:161.[Medline]
  9. Ricci, M.. 1994. IL-4: a key cytokine in atopy. Clin. Exp. Allergy. 24:801.[Medline]
  10. Schattner, A.. 1994. Lymphokines in autoimmunity—a critical review. Clin. Immunol. Immunopath. 70:177.[Medline]
  11. Paul, W. E., R. A. Seder. 1994. Lymphocyte responses and cytokines. Cell 76:241.[Medline]
  12. Ferrick, D. A., M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, H. Lepper. 1995. Differential production of interferon-{gamma} and interleukin-4 in response to Th1- and Th2-stimulating pathogens by {gamma}{delta} T cells in vivo. Nature 373:255.[Medline]
  13. Brown, M. A., J. H. Pierce, C. J. Watson, J. Falco, J. N. Ihle, W. E. Paul. 1987. B cell stimulatory factor-1/interleukin-4 mRNA is expressed by normal and transformed mast cell lines. Cell 50:809.[Medline]
  14. Plaut, M., J. H. Pierce, C. J. Watson, J. Hanley-Hyde, R. P. Nordon, W. E. Paul. 1989. Mast cell lines produce lymphokines in response to cross-linkage of Fc{epsilon}RI or to calcium ionophores. Nature 339:64.[Medline]
  15. Bradding, P., I. H. Feather, P. H. Howarth, R. Mueller, J. A. Roberts, K. Britten, J. P. A. Bews, T. C. Hunt, Y. Okayama, C. H. Heusser, et al 1992. Interleukin-4 is localized to and released by human mast cells. J. Exp. Med. 176:1381.[Abstract/Free Full Text]
  16. Abraham, S. N., R. Malavia. 1997. Mast cells in infection and immunity. Infect. Immun. 65:3501.[Medline]
  17. Galli, S., B. Wershil. 1996. The two faces of the mast cell. Nature 381:21.[Medline]
  18. Wang, H.-W., N. N. Tedia, A. R. Lloyd, D. Wakefield, H. P. McNeil. 1998. Mast cell activation and migration to lymph nodes during induction of an immune response in mice. J. Clin. Invest. 102:1617.[Medline]
  19. Mueller, D. L., M. K. Jenkins, R. H. Schwartz. 1989. Clonal expansion versus functional clonal inactivation: a costimulatory signalling pathway determines the outcome of T cell antigen receptor occupancy. Annu. Rev. Immunol. 7:445.[Medline]
  20. Bluestone, J.. 1995. New perspectives of CD28–B7 mediated T cell costimulation. Immunity 2:555.[Medline]
  21. Ravetch, J. V., J. P. Kinet. 1991. Fc receptors. Annu. Rev. Immunol. 9:457.[Medline]
  22. Beaven, M. A., H. Metzger. 1993. Signal transduction by Fc receptors: the Fc{epsilon}RI case. Immunol. Today 14:222.[Medline]
  23. Malavija, R., T. Ikeda, E. Ross, S. Abraham. 1996. Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-{alpha}. Nature 381:77.[Medline]
  24. Bidri, M., I. Vouldoukis, M. D. Mossalayi, P. Debre, J.-J. Guillosson, D. Mazier, M. Arock. 1997. Evidence for direct interaction between mast cells and Leishmania parasites. Parasite Immunol. 19:475.[Medline]
  25. Bischoff, S. C., T. Brunner, A. L. de Weck, C. A. Dahinden. 1990. Interleukin 5 modifies histamine release and leukotriene generation by human mast cells in response to diverse antagonists. J. Exp. Med. 172:1577.[Abstract/Free Full Text]
  26. Bischoff, S. C., C. A. Dahinden. 1992. Effect of nerve growth factor on the release of inflammatory mediators by mature human mast cells. Blood 79:2662.[Abstract/Free Full Text]
  27. Ansel, J., J. R. Brown, D. G. Payan, M. A. Brown. 1993. Substance P selectively activates TNF-{alpha} gene expression in murine mast cells. J. Immunol. 150:4478.[Abstract]
  28. Zheng, W., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587.[Medline]
  29. Ho, I.-C., M. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  30. Zon, L. I., M. F. Gurish, R. L. Stevens, C. Mather, D. S. Reynolds, K. F. Austen, S. H. Orkin. 1991. GATA-binding transcription factors in mast cells regulate the promoter of the mast cell carboxypeptidase A gene. J. Biol. Chem. 266:22948.[Abstract/Free Full Text]
  31. Sherman, M. A., T. Y. Nachman, M. A. Brown. 1999. Cutting edge: IL-4 production by mast cells does not require c-maf. J. Immunol. 163:1733.[Abstract/Free Full Text]
  32. Shimoda, K., J. Deursen, M. Sangster, S. Sarawar, R. Carson, R. Tripp, C. Chu, F. Quelle, T. Nosaka, D. Vignale, et al 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630.[Medline]
  33. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, S. Akira. 1996. Essential role of Stat6 in IL-4 signalling. Nature 380:627.[Medline]
  34. Kaplan, M., U. Schindler, S. Smiley, M. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for the development of Th2 cells. Immunity 4:313.[Medline]
  35. Sherman, M. A., V. H. Secor, S. K. Lee, R. D. Lopez, M. A. Brown. 1999. STAT6-independent production of IL-4 by mast cells. Eur. J. Immunol. 29:1235.[Medline]
  36. Rooney, J. W., M. R. Hodge, P. G. McCaffrey, A. Rao, L. H. Glimcher. 1994. A common factor regulates both Th1 and Th2-specific cytokine gene expression. EMBO J. 13:625.[Medline]
  37. Rooney, J. W., T. Hoey, L. H. Glimcher. 1995. Coordinate and cooperative roles for NF-AT and AP-1 in the regulation of the murine IL-4 gene. Immunity 2:473.[Medline]
  38. Tara, D., D. L. Weiss, M. A. Brown. 1995. Characterization of the constitutive and inducible components of a T cell activation responsive element. J. Immunol. 154:4592.[Abstract]
  39. Weiss, D., J. Hural, D. Tara, L. Timmerman, G. Henkel, M. Brown. 1995. Nuclear factor of activated T cells is associated with a mast cell interleukin-4 transcription complex. Mol. Cell. Biol. 16:228.[Abstract]
  40. Henkel, G., D. L. Weiss, R. McCoy, T. Deloughery, D. Tara, M. A. Brown. 1992. A DNase I hypersensitive site defines a mast cell enhancer. J. Immunol. 149:323.[Abstract]
  41. Henkel, G., M. A. Brown. 1994. PU.1 and GATA: components of a mast cell-specific interleukin 4 intronic enhancer. Proc. Natl. Acad. Sci. USA 91:7737.[Abstract/Free Full Text]
  42. Pierce, J. H., P. O. DiFiore, S. A. Aaronson, M. Potter, J. Pumphry, A. Scott, J. Ihle. 1985. Neoplastic transformation of mast cells by Abelson MuLV: abrogation of IL-3 dependence by a nonautocrine mechanism. Cell 41:685.[Medline]
  43. Rothman, P., S. C. Li, B. Gorham, L. Glimcher, F. Alt, M. Boothby. 1991. Identification of a conserved lipopolysaccharide-plus-interleukin-4-responsive element located at the promoter of germ line {epsilon} transcripts. Mol. Cell. Biol. 11:5551.[Abstract/Free Full Text]
  44. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl. 1987. In Current Protocols in Molecular Biology Vol. 1: John Wiley and Sons, New York.
  45. Wingender, E., X. Chen, R. Hehl, H. Karas, I. Leibich, V. Matys, T. Meinhardt, M. Pruss, I. Reuter, F. Schacherer. 2000. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res. 28:316.[Abstract/Free Full Text]
  46. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  47. Fiering, J., J. P. Northrop, G. P. Nolan, P. S. Mattila, G. R. Crabtree, L. A. Herzenberg. 1990. Single cell assay of a transcription factor reveals a threshold in transcription activated by signals emanating from the T-cell antigen receptor. Genes Dev. 4:1823.[Abstract/Free Full Text]
  48. Sherman, M. A., V. Secor, M. A. Brown. 1999. IL-4 preferentially activates a novel STAT6 isoform in mast cells. J. Immunol. 162:2703.[Abstract/Free Full Text]
  49. Otsuka, T., D. Villaret, T. Yokata, Y. Takebe, F. Lee, N. Arai, K. Arai. 1987. Structural analysis of the mouse chromosomal gene encoding interleukin 4 which express B cell, T cell and mast cell stimulating activities. Nucleic Acids Res. 15:333.[Abstract/Free Full Text]
  50. Schindler, U., P. Wu, M. Rothe, M. Brasseur, S. L. McKnight. 1995. Components of a Stat recognition code: evidence for two layers of molecular selectivity. Immunity 2:659.
  51. Seidel, H. M., L. H. Milocco, P. Lamb, J. E. Darnell, S. R. B., and J. Rosen. 1995. Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. Proc. Natl. Acad. Sci. USA 92:3041.
  52. Ryan, A. K., M. G. Rosenfeld. 1997. POU domain family: flexibility, partnerships and developmental codes. Genes Dev. 11:1207.[Free Full Text]
  53. Dasen, J. S., S. M. O’Connell, S. E. Flynn, M. Treier, A. S. Gleiberman, D. P. Szeto, F. Hooshmand, A. A. K., and M. G. Rosenfeld. 1999. Reciprocal interaction of Pit 1 and GATA 2 mediate signaling gradient-induced determination of pituitary cell types. Cell 97:587.
  54. Lewis, S. M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56:27.[Medline]
  55. Clevers, H., P. Ferrier. 1998. Transcriptional control during T-cell development. Curr. Opin. Immunol. 10:166.[Medline]
  56. Serwe, M., F. Sablitzky. 1993. V(D)J recombination in B cells is impaired but not blocked by targeted deletion of the immunoglobulin heavy chain intron enhancer. EMBO J. 12:2321.[Medline]
  57. Demengeot, J., E. M. Oltz, F. W. Alt. 1995. Promotion of V(D)J recombinational accessibility by the intronic E{kappa} element: role of the {kappa}B motif. Int. Immunol. 7:1995.[Abstract/Free Full Text]
  58. Kass, S. U., D. Pruss, A. P. Wolffe. 1997. How does DNA methylation repress transcription?. Trends Genet. 13:444.[Medline]
  59. Mostoslavsky, R., Y. Bergman. 1997. DNA methylation: regulation of gene expression and role in the immune system. Biochim. Biophys. Acta 1333:F29.[Medline]
  60. Nan, X., H. Ng, C. A. Johnson, C. D. Laherty, B. M. Turner, R. N. Eiseman, and A. Bird. 1998. Transcriptional repression by the methy-CpG-binding protein MeCps involves a histone deacetylase complex. Nature 393.
  61. Jones, P. L., G. J. Veenstra, P. A. Wade, D. Verrmaak, S. U. Kass, N. Landsberger, J. Strouboulis, A. P. Wolffe. 1998. Methylated DNA and MeCP2 recruit histone deacteylase to repress transcription. Nat. Genet. 19:187.[Medline]
  62. Agarwal, S., A. Rao. 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9:765.[Medline]
  63. Bird, J. J., D. R. Brown, A. C. Mullen, N. H. Moskowitz, >M. A. Mahowald, J. R. Sider, T. F. Gajewski, C.-R. Wang, and S. L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity:229.
  64. Grosschedl, R., M. Marx. 1988. State of an immunoglobulin µ gene requires continuous enhancer function. Cell 55:645.[Medline]
  65. Kirillov, A., B. Kistler, R. Mostoslavsky, H. Cedar, T. Wirth, Y. Bergman. 1996. A role of nuclear NF-{kappa}B in B-cell-specific demethylation of the Ig{kappa} locus. Nat. Genet. 13:435.[Medline]
  66. Lichtenstein, M., G. Keini, H. Cedar, Y. Bergman. 1994. B cell-specific demethylation: a novel role for the intronic {kappa} enhancer. Cell 76:913.[Medline]
  67. Sleckman, B. P., C. G. Bardon, R. Ferrini, L. Davidson, F. W. Alt. 1997. Function of the TCR {alpha} enhancer in {alpha}/ß and {gamma}/{delta} T cells. Immunity 4:505.
  68. Bories, J. C., J. Demengeot, L. Davidson, F. Alt. 1996. Gene-targeted deletion and replacement mutations of the T-cell receptor ß-chain enhancer: the role of enhancer elements in controlling V(D)J recombination accessibility. Proc. Natl. Acad. Sci. USA 93:7871.[Abstract/Free Full Text]
  69. Bouvier, G., F. Watrin, M. Naspetti, C. Verthuy, P. Naquet, P. Ferrier. 1996. Deletion of the mouse T-cell receptor ß enhancer blocks {alpha}ß T cell development. Proc. Natl. Acad. Sci. USA 93:7877.[Abstract/Free Full Text]
  70. Boyes, J., J. Omichinski, D. Clark, M. Pikaart, G. Felsenfeld. 1998. Perturbation of nucleosome strucutre by the erythroid transcription factor GATA-1. J. Mol. Biol. 279:529.[Medline]
  71. Nelsen, B., G. Tian, B. Erman, J. Gregoire, R. Maki, B. Graves, R. Sen. 1992. Regulation of lymphoid-specific immunoglobulin µ heavy chain gene enhancer by ets-domain proteins. Science 261:82.
  72. Hromas, R., A. Orazi, R. S. Neiman, R. Maki, C. Van Beveran, J. Moore, M. Klemsz. 1993. Hematopoietic lineage- and stage-restricted expression of the ets oncogene family member PU.1. Blood 82:2998.[Abstract/Free Full Text]
  73. Galson, D. L., J. O. Hensold, T. R. Bishop, M. M. Schalling, A. D. D’Andrea, C. Jones, P. E. Auron, E. D. Housman. 1993. Mouse ß-globin DNA-binding protein B1 is identical to a proto-oncogene, the trancription factor Spi/Pu.1, and is restricted in expression to hematopoietic cells and the testis. Mol. Cell. Biol. 13:2929.[Abstract/Free Full Text]
  74. Nikolajczyk, B. S., J. A. Sanchez, R. Sen. 1999. ETS protein-dependent accessibility changes at the immunoglobulin µ heavy chain enhancer. Immunity 11:11.[Medline]
  75. Gingras, S., J. Simard, B. Groner, E. Pfitzner. 1999. p300/CBP is required for transcriptional induction by interleukin-4 and interacts with Stat6. Nucleic Acids Res. 27:2722.[Abstract/Free Full Text]
  76. Pfitzner, E., R. Jahne, M. Wissler, E. Stoecklin, B. Groner. 1998. p300/CREB-binding protein enhances the prolactin-mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat 5-mediated suppression of the glucocorticoid response. Mol. Endocrinol. 12:1582.[Abstract/Free Full Text]
  77. Zhu, M., S. John, M. Berg, W. J. Leonard. 1999. Functional association of Nmi with Stat5 and Stat1 in IL-2- and IFN-{gamma}-mediated signaling. Cell 96:121.[Medline]
  78. Paulson, M., S. Pisharody, L. Pan, S. Guadagno, A. L. Mui, D. E. Levy. 1999. Stat protein transactivation domains recruit p300/CBP through widely divergent sequences. J. Biol. Chem. 274:25343.[Abstract/Free Full Text]
  79. Horvai, A. E., L. Xu, E. Korzus, G. Brard, D. Kalafus, T. M. Mullen, D. W. Rose, M. G. Rosenfeld, C. K. Galss. 1997. Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc. Natl. Acad. Sci. USA 94:1074.[Abstract/Free Full Text]
  80. Grunstein, M.. 1997. Histone acetylation in chromatin structure and transcription. Nature 389:349.[Medline]
  81. Kuo, M.-H., J. Zhou, P. Jambeck, M. E. A. Churchill, C. D. Allis. 1998. Histone acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo. Genes Dev. 12:627.[Abstract/Free Full Text]
  82. Ye, S. K., K. Maki, T. Kitamura, S. Sunaga, K. Akashi, J. Domen, I. L. Weissman, T. Honjo, K. Ikuta. 1999. Induction of germline transcription in the TCR{gamma} locus by Stat5: implications for accessibility control by the IL-7 receptor. Immunity 11:213.[Medline]
  83. Durum, S. K., S. Candeias, H. Nakajima, W. J. Leonard, A. M. Baird, L. J. Berg, K. Muegge. 1998. Interleukin 7 receptor control of T cell receptor {gamma} gene rearrangement: role of receptor-associated chains and locus accessibility. J. Exp. Med. 188:2223.
  84. Loots, G. G., R. M. Locksley, C. M. Blankespoor, Z. E. Wang, W. Miller, E. M. Rubin, K. A. Frazer. 2000. Identification of a coordinate regulator of interleukins 4, 13, and by cross-species sequence comparisons. Science 288:136.[Abstract/Free Full Text]
  85. Price, J., D. Turner, C. Cepko. 1987. Lineage analysis in the vertebrate nervous system by retrovirus-mediated gene transfer. Proc. Natl. Acad. Sci. USA 84:156.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. Tsuji-Takayama, M. Suzuki, M. Yamamoto, A. Harashima, A. Okochi, T. Otani, T. Inoue, A. Sugimoto, T. Toraya, M. Takeuchi, et al.
The Production of IL-10 by Human Regulatory T Cells Is Enhanced by IL-2 through a STAT5-Responsive Intronic Enhancer in the IL-10 Locus
J. Immunol., September 15, 2008; 181(6): 3897 - 3905.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Yagi, S. Tanaka, Y. Motomura, and M. Kubo
Regulation of the Il4 Gene Is Independently Controlled by Proximal and Distal 3' Enhancers in Mast Cells and Basophils
Mol. Cell. Biol., December 1, 2007; 27(23): 8087 - 8097.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Monticelli, D. U. Lee, J. Nardone, D. L. Bolton, and A. Rao
Chromatin-based regulation of cytokine transcription in Th2 cells and mast cells
Int. Immunol., November 1, 2005; 17(11): 1513 - 1524.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-O. Tykocinski, P. Hajkova, H.-D. Chang, T. Stamm, O. SOzeri, M. LOhning, J. Hu-Li, U. Niesner, S. Kreher, B. Friedrich, et al.
A Critical Control Element for Interleukin-4 Memory Expression in T Helper Lymphocytes
J. Biol. Chem., August 5, 2005; 280(31): 28177 - 28185.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Y. Wong, J. Lin, B. G. Forget, D. M. Bodine, and P. G. Gallagher
Sequences Downstream of the Erythroid Promoter Are Required for High Level Expression of the Human {alpha}-Spectrin Gene
J. Biol. Chem., December 31, 2004; 279(53): 55024 - 55033.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Masuda, Y. Yoshikai, H. Kume, and T. Matsuguchi
The Interaction between GATA Proteins and Activator Protein-1 Promotes the Transcription of IL-13 in Mast Cells
J. Immunol., November 1, 2004; 173(9): 5564 - 5573.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Monticelli, D. C. Solymar, and A. Rao
Role of NFAT Proteins in IL13 Gene Transcription in Mast Cells
J. Biol. Chem., August 27, 2004; 279(35): 36210 - 36218.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Baguet and M. Bix
Chromatin landscape dynamics of the Il4-Il13 locus during T helper 1 and 2 development
PNAS, August 3, 2004; 101(31): 11410 - 11415.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J.-V. Chamary and L. D. Hurst
Similar Rates but Different Modes of Sequence Evolution in Introns and at Exonic Silent Sites in Rodents: Evidence for Selectively Driven Codon Usage
Mol. Biol. Evol., June 1, 2004; 21(6): 1014 - 1023.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Cote-Sierra, G. Foucras, L. Guo, L. Chiodetti, H. A. Young, J. Hu-Li, J. Zhu, and W. E. Paul
Interleukin 2 plays a central role in Th2 differentiation
PNAS, March 16, 2004; 101(11): 3880 - 3885.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Sherman, D. R. Powell, and M. A. Brown
IL-4 Induces the Proteolytic Processing of Mast Cell STAT6
J. Immunol., October 1, 2002; 169(7): 3811 - 3818.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Santangelo, D. J. Cousins, N. E. E. Winkelmann, and D. Z. Staynov
DNA Methylation Changes at Human Th2 Cytokine Genes Coincide with DNase I Hypersensitive Site Formation During CD4+ T Cell Differentiation
J. Immunol., August 15, 2002; 169(4): 1893 - 1903.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. E. Fields, S. T. Kim, and R. A. Flavell
Cutting Edge: Changes in Histone Acetylation at the IL-4 and IFN-{gamma} Loci Accompany Th1/Th2 Differentiation
J. Immunol., July 15, 2002; 169(2): 647 - 650.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hural, J. A.
Right arrow Articles by Brown, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hural, J. A.
Right arrow Articles by Brown, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS