The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stratmann, T.
Right arrow Articles by Teyton, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stratmann, T.
Right arrow Articles by Teyton, L.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Diabetes Type 1
The Journal of Immunology, 2000, 165: 3214-3225.
Copyright © 00 by The American Association of Immunologists

The I-Ag7 MHC Class II Molecule Linked to Murine Diabetes Is a Promiscuous Peptide Binder1

Thomas Stratmann*, Vasso Apostolopoulos{ddagger}, Valérie Mallet-Designe*, Adam L. Corper{ddagger}, Christopher A. Scott2,{ddagger}, Ian A. Wilson{ddagger}, Angray S. Kang3,{ddagger} and Luc Teyton4,*

Departments of * Immunology and {dagger} Molecular Biology, and {ddagger} The Skaggs Institute for Chemical Biology, The Scripps Research Institute, La Jolla, CA 92037


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Susceptibility to insulin-dependent diabetes mellitus is linked to MHC class II genes. The only MHC class II molecule expressed by nonobese diabetic (NOD) mice, I-Ag7, shares a common {alpha}-chain with I-Ad but has a peculiar ß-chain. As with most ß-chain alleles linked to diabetes susceptibility, I-Ag7 contains a nonaspartic residue at position ß57. We have produced large amounts of empty I-Ag7 molecules using a fly expression system to characterize its biochemical properties and peptide binding by phage-displayed peptide libraries. The identification of a specific binding peptide derived from glutamic acid decarboxylase (GAD65) has allowed us to crystallize and obtain the three-dimensional structure of I-Ag7. Structural information was critical in evaluating the binding studies. I-Ag7, like I-Ad, appears to be very promiscuous in terms of peptide binding. Their binding motifs are degenerate and contain small and/or small hydrophobic residues at P4 and P6 of the peptide, a motif frequently found in most globular proteins. The degree of promiscuity is increased for I-Ag7 over I-Ad as a consequence of a larger P9 pocket that can specifically accommodate negatively charged residues, as well as possibly residues with bulky side chains. So, although I-Ad and I-Ag7 are structurally closely related, stable molecules and good peptide binders, they differ functionally in their ability to bind significantly different peptide repertoires that are heavily influenced by the presence or the absence of a negatively charged residue at position 57 of the ß-chain. These characteristics link I-Ag7 with autoimmune diseases, such as insulin-dependent diabetes mellitus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin-dependent diabetes mellitus (IDDM)5 is an autoimmune disease in which the target tissue is the endocrine pancreas. Human and murine diseases share a number of similarities. Both are spontaneous, occur at a young age, have a similar genetic makeup, and progress in two steps: insulitis, followed by ß cell destruction. In the nonobese diabetic (NOD) mouse, islet infiltration of T cells, B cells, macrophages, and dendritic cells starts at 3–4 wk of age (1, 2) and is followed by a progressive destruction of the islets over a period of a few weeks. The susceptibility to IDDM is determined by the conjunction of multiple genetic factors with unknown environmental factors (3). The mapping of the different loci that contribute to the genetic susceptibility to IDDM has uncovered a minimum of 15 genes in both the human and the NOD mouse, most of which are not yet characterized. However, one group of genes is linked to the autoimmune process itself, and among these are MHC genes (4, 5), whereas the other is composed of a set of "pancreatic susceptibility" genes, which render the pancreas susceptible to the damage by environmental factors. In this respect, like most autoimmune diseases, IDDM develops in two stages: pancreatic injury, followed by an inappropriate autoimmune response.

A striking feature of class II molecules associated with IDDM is the presence of a serine, alanine, or valine residue at position 57 of the ß-chain instead of a conserved aspartic acid in IDDM-resistant haplotypes (3). In the case of I-Ag7, the class II heterodimer is made of an I-Ad {alpha}-chain paired with the unique I-Ag7 ß-chain that differs from I-Ad ß at 17 positions, all clustered in the first variable domain. Only two of these differences are unique across all I-A haplotypes at position ß56 and ß57. At ß57, a serine residue replaces an aspartic acid, and, at ß56, a histidine replaces a proline (6). Introduction of various alleles, such as Ak{alpha}/Akß or Adß alone into the NOD background protects these animals from or reduces diabetes (7, 8). Furthermore, replacement of the normal I-Ag7 serine ß57 by an aspartic acid reduces diabetes in transgenic NOD mice (9), and replacement of histidine ß56 by a proline has an even deeper impact by preventing both diabetes and insulitis (10). Thus, positions ß56 and ß57 play a critical role in the context of I-Ag7 and are most likely associated with the altered binding and selectivity of peptides compared with other MHC class II molecules.

In terms of peptide binding to I-Ag7 molecules, the number of studies so far is somewhat limited. Elution of peptides from B cell-purified I-Ag7 molecules has not uncovered any striking features compared with other class II molecules (11). However, a few peptides had a negatively charged residue in their C terminus (11) but the series of sequenced peptides was too limited to draw general conclusions. Peptide binding to I-Ag7 has also been studied by alanine-scanning mutagenesis of known binding peptides, as well as by binding of substituted polyalanine peptides (12, 13). These studies did not come to a consensus regarding a requirement for a negatively charged residue in the C terminus. From a structural point of view, the advantage of such a residue can be easily explained. The exchange of aspartate ß57 by a serine removes the salt bridge with arginine {alpha}76, as seen, for example, in I-Ad (14), and exposes a positive charge in the P9 pocket that would favor the pairing with a negative charge provided by the peptide (15).

To date, only a few biochemical studies on I-Ag7 have been conducted. In one study, the half-life of I-Ag7 molecules at 37°C was shorter than that of I-Ad and I-Ab molecules (16). This characteristic was associated with the SDS instability of the molecule (12, 16, 17, 18), and was interpreted as being a sign of poor binding capability, because SDS stability has been associated with both peptide binding (19, 20, 21) and MHC class II half-life (22). However, SDS stability is not a reliable marker of peptide occupancy. Indeed, some MHC class II molecules, such as I-Ad, are very unstable with or without peptide, whereas others, such as HLA-DR1 or I-Ab, are very stable, even when occupied with low affinity peptides. On the contrary, a normal peptide binding capacity and a normal cell surface half-life of I-Ag7 molecules have also been reported (12, 13), prompting us to re-evaluate these issues but with a different approach. The final and most important reason to reassess the function of I-Ag7 molecules is the existence of the Biozzi AB/H mouse, which expresses only I-Ag7 as its MHC class II (23) but does not develop IDDM or any spontaneous autoimmune features, yet mounts above-normal immune responses against most Ags. This feature constitutes the strongest in vivo argument to rule out any major misfolding and malfunction of the I-Ag7 molecule itself in terms of peptide binding.

To carry out this study, recombinant empty I-Ag7 molecules were produced in Drosophila melanogaster cells. Purified empty molecules were used to evaluate peptide binding to a large panel of peptides, to screen random cDNA fragment phage display libraries for the identification of I-Ag7 epitopes within OVA and glutamic acid decarboxylase 65 (GAD65) proteins, and to screen a random 12-mer phage-displayed peptide library in the search for an I-Ag7 binding motif. The results were used to construct and express tethered peptide I-Ag7 molecules for crystallographic studies.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA and bacterial strains

Phage vector pJCM13-88 containing a second synthetic copy of gene VIII has been described elsewhere (24). The random 12-mer peptide M13 phage display library JCM13-88-X12 was constructed in our laboratory in collaboration with Dr. C. Glass (R.W. Johnson Pharmaceutical Research Institute, La Jolla, CA). Plasmid pBSK-GAD65 containing the murine GAD65 coding sequence previously cloned from a C57BL/6 brain cDNA library was provided by Dr. J. Fehling (Basel Institute, Basel, Switzerland). The OVA coding sequence (25) subcloned into pCMU4 was obtained from Dr. K. Frueh (R.W. Johnson Pharmaceutical Research Institute). Bacterial strains Escherichia coli XL1-Blue and E. coli XLOLR were obtained from Stratagene (La Jolla, CA).

Construction, expression, and purification of I-Ag7 molecules

The wild-type cDNA for the I-Ag7 ß-chain was modified to generate two constructs to express empty and peptide-filled molecules, as previously reported for I-Ad (26, 27). For the expression of empty molecules, the cDNA was interrupted after the codon for the last tryptophan before the transmembrane segment and extended by a linker (SSADL), a thrombin site (LVPRGS), a basic zipper, and a hexa-histidine tail. To tether peptides to the ß-chain, a hybrid cDNA was constructed by substituting the natural signal sequence of I-Ag7 by the HLA-A2 signal sequence followed by the first four residues of the {alpha}1 domain of HLA-A2, a multiple cloning site, a glycine-serine linker, and the ß1 domain of I-Ag7. Oligonucleotides corresponding to the peptide sequence were cloned between the SacII and BglII sites of the polylinker. The coding sequence of the extracellular domain of the human invariant chain (Ii) was cloned in frame with the HLA-A2 signal sequence followed by six histidine codons (26). The I-Ad {alpha}-chain was also modified by the addition of a BirA biotinylation sequence following the acidic zipper and proceeding the histidine tag (28). All constructs were subcloned into the metallothionein promoter-based fly expression vector pRMHa3 (29). Modified ß-chains were transfected along with the soluble I-Ad acid zipper {alpha}-chain or soluble I-Ad acid zipper biotin {alpha}-chain (26, 27) to produce empty and peptide-filled I-Ag7 molecules. I-Ag7/Ii complexes were expressed by transfecting cDNAs for the {alpha}- and ß-chain without histidine coding sequences and the human Ii construct. The various cDNA combinations were cotransfected into D. melanogaster SC2 cells by calcium phosphate precipitation. A neomycin-resistance gene was added to the transfection at a 1:200 ratio to allow the selection of stable cell lines in the presence of 0.5 mg/ml of G418. Expression was tested at 4 wk after a 3-day induction with 0.7 mM CuSO4 and immunoprecipitation with nickel-agarose beads (Qiagen, Chatsworth, CA). Large-scale preparations were made using serum-free media (Insect-Xpress; BioWhittaker, Walkersville, MD) in roller bottles. Supernatants were concentrated and buffer exchanged against PBS by tangential flow. Recombinant proteins were purified at 4°C by batch binding to nickel-agarose beads and elution with a step gradient of imidazole. Empty molecules were further purified by gel filtration over a Superdex 200 column. Peptide-filled molecules were purified to homogeneity by ion exchange chromatography over a MonoQ10/10 column at pH 8.4 (Pharmacia, Piscataway, NJ). I-Ag7 Ii complexes were produced in Schneider’s media, 10% FCS, in triple-layered flasks. Metal induction was conducted in the presence of 5 mM pepstatin A and 5 mM leupeptin. Following the initial nickel-agarose step, purification was conducted by a succession of anion exchange (MonoQ10/10), hydrophobic interaction chromatography (Phenylsuperose 10), and gel filtration (Superdex 200). Purified proteins were kept in PBS, pH 7.4, containing 0.02% NaN3 at 4°C.

Biochemical analysis, SDS-PAGE, and isoelectric focusing

Purifications were monitored by SDS-PAGE followed by Coomassie Brilliant Blue R 250 staining. Two-dimensional gel electrophoresis was performed as described (26) using 3.5–10.0 nonequilibrium pH gradient electrophoresis (NEPHGE) in the first dimension and 12% SDS-PAGE in the second dimension followed by Coomassie Brilliant Blue staining.

Vector constructs and random cDNA fragment libraries

Control phage constructs pJCM13-88-OVA and pJCM13-88-ROI coding for the OVA peptide 323-339 (ISQAVHAAHAEINEAGR) and the synthetic peptide ROI (VHAAHAVHAAHAVHA), respectively, were cloned as fusions to the N terminus of gene VIII by a GGGGS linker sequence. Vector pORFES IV was digested with NheI/HindIII and the stuffer replaced by the following annealed oligonucleotides: 5'-CTAGCGTAGCTCAGGCCGGTGGCGGTATATCTCAAGCTGTCCATGCAGCACATGCAGAAATCAATGAAGCAGGCAGAGGTGGCGGTGGCTCCCA-3', 5'-AGCTTGGGAGCCACCGCCACCTCTGCCTGCTTCATTGATTTCTGCAT GTGCTGCATGGACAGCTTGAGATATACCGCCACCGGCCTGAGCTAC G-3' (pORFESIVOVA); 5'-CTAGCGTAGCTCAGGCCGGTGGCGGTGTTC ACGCTGCTCACGCAGTTCACGCTGCACACGCTGTTCACGCAGGTGG CGGTGGCTCCCA-3' and 5'-AGCTTGGGAGCCACCGCCACCTGCGTGA ACAGCGTGTGCAGCGTGAACTGCGTGAGCAGCGTGAACACCGCCAC CGGCCTGAGCTACG-3' (pORFESIV-ROI). The ligated vectors were digested with XbaI/HindIII, and the inserts were directionally cloned into JCM13-88.

The construction of cDNA fragment phage display libraries will be described in details elsewhere (T. Stratmann, L. Teyton, and A. S. Kang, manuscript in preparation). Briefly, plasmids pCMU4 and pBSk-GAD65 were treated with BamHI and SacI/HindIII to release the GAD65 and OVA coding sequence, respectively. Random DNA fragmentation was established by digesting the inserts with DNase I and, subsequently, with mung bean nuclease to obtain blunt ends. The DNA fragments were ligated into pORFESIV that had been cleaved with NaeI and transformed into E. coli XLOLR cells, resulting in two primary libraries of 6 x 105 (OVA) and 2.6 x 106 (GAD65) independent clones. The fragments restoring the reading frame of the selection marker ß-lactamase were rescued by treatment of the recovered plasmids with XbaI/HindIII and separated by agarose gel electrophoresis. Inserts of ~160–210 bp of length (corresponding to 40–90 bp of random DNA fragment length) were isolated and cloned into pJCM13-88 to express peptide fragments at the N terminus of the synthetic copies of gene VIII of bacteriophage M13 upon transformation into E. coli XL1-Blue cells. Bacteriophages were propagated overnight at 30°C and prepared by standard methods. The sizes of the final libraries were 1.7 x 106 independent clones for the OVA library, JCM13-88-rOVA, and 7 x 106 clones for the GAD65 library, JCM13-88-rGAD65.

Phage inhibition assay and selection of M13 random 12-mer peptide and cDNA fragment display libraries

To assess specific binding of phages JCM13-88-OVA and JCM13-88-ROI to empty I-Ag7molecules, phages were incubated with 20 ng of recombinant I-Ag7 for 2 h at 37°C in 100 µl of 50 mM NaAc, pH 5.0, and 0.05% Tween 20 containing 0.02% NaN3 in a micro tube in duplicates in the presence or absence of the ROI peptide at various concentrations. After neutralization with 1 M Tris, samples were transferred to Reacti-Bind metal chelate microtiter plates (100 µl per well; Pierce, Rockford, IL) that had been blocked with 0.5% BSA in PBS containing 0.02% NaN3, and incubated at room temperature for 2 h under gentle agitation. Each well was washed 10 times with 300 µl of PBS containing 0.05% Tween 20 (PBST), and binding phages were eluted with 100 µl of 100 mM glycine, pH 2.2, for 10 min at room temperature. After neutralization with 1 M Tris, the phage titer was determined. Selection of the libraries JCM13-88-X12, JCM13-88-rOVA, and JCM13-88-rGAD65 was as described above, with the difference that 200 ng instead of 20 ng of I-Ag7 was used and that no free peptide was added. Eluted phages were propagated in E. coli XL1-Blue cells, and the selection was repeated three or four times. After selection, DNA from randomly chosen individual clones was prepared and analyzed by sequencing.

Peptide competition assay to MHC class II molecules

A modified competition assay (ELISA) was used to determine binding of peptides to I-Ag7 and I-Ad molecules using biotinylated OVA323–339, or in some cases, biotinylated ROI peptide and unlabeled peptides (13, 30). Microtiter plates (96-well, Maxisorb; Nunc, Naperville, IL) were coated with anti-I-A ß-chain-specific mAb M5.114 (100 µl/well, 5 µg/ml in 100 mM NaCO3, pH 9.6; American Type Culture Collection, Manassas, VA) overnight at 4°C. Plates were washed five times with PBST, blocked overnight with 200 µl of PBS containing 5% BSA at 37°C, and washed. In a second set of plates, 200 ng of empty I-Ag7 or I-Ad was incubated in 100 µl binding buffer (6.7 mM citric phosphate, pH 10.4, 0.15 M NaCl, 2% Nonidet P-40, 2 mM EDTA) containing 300 nM of biotinylated OVA323–339 peptide with varying concentrations of test peptide at 37°C overnight. The samples were transferred to the coated plates and incubated for 4 h at room temperature. The plates were washed 10 times with PBST for >1 h, followed by five additional washes with PBS for >30 min. Plates were incubated with 100 µl/well of PBS containing streptavidin-conjugated alkaline phosphatase (0.7 µg/ml) for 1 h at room temperature and washed as before. Biotinylated molecules were colorimetrically detected by overnight incubation with para-nitrophenyl phosphate at 4°C, and the absorbance at {lambda}405 nm was determined using a 96-well plate reader. Although we observed differences between batches of I-Ag7 and I-Ad molecules in terms of maximal binding capacity and half-lives of the preparations, their IC50 values and the relative binding capacity of I-Ag7 vs I-Ad were reproducible.

Biotinylation and FACS analysis

MHC class II molecules with the biotinylation sequence were purified, as described above, and biotinylated with the BirA enzyme according to the manufacturer instructions (Avidity, Denver, Co). Biotinylated molecules were tetramerized with PE-labeled streptavidin (BioSource International, Camarillo, CA) and used for FACS. Staining was performed at 4°C for 2 h with 10 µM of labeled tetramers. Analysis was performed on a FACScaliber instrument (Becton Dickinson, Mountain View, CA). Data were analyzed using CellQuest software (Becton Dickinson). GAD65524–538-specific hybridomas were provided by Dr. P. Reich (Anergen, Redwood City, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of empty molecules

We have previously reported the successful production of large amounts of I-Ad molecules in D. melanogaster SC2 cells and their crystallization with covalently linked single peptides (14, 26, 27). Soluble, secreted, and empty I-Ag7 molecules were expressed in a similar manner. Their transmembrane and cytoplasmic domains were deleted and replaced by leucine zippers to enhance heterodimeric chain pairing (14, 27). Levels of expression in SC2 cells were comparable to I-Ad expression levels, and oscillated between 0.2 and 0.5 mg/L of final purified product. No aggregation of the empty molecules was noted at any stage of purification. The purification of these molecules was conducted by a combination of nickel-agarose affinity chromatography and gel filtration at neutral pH (Fig. 1Go). The {alpha}- and ß-chains were secreted at equimolar ratios (Fig. 1GoA). To test the stability of these dimers, leucine zippers were removed by thrombin digestion at 37°C for 4 h and the digest was analyzed by gel filtration and SDS-PAGE after undigested molecules were removed using nickel-agarose beads. Uncut and cut material were incubated at 37°C for 60 min before gel filtration. Both samples had the same retention time (15 ml, 55 kDa) on the Superdex 200 profile (Fig. 1GoB) indicating that, with or without zippers, these molecules had no tendency to dissociate into monomeric chains or to aggregate, suggesting that the loss of the ß57/{alpha}76 salt bridge was not critical for the stability of the I-Ag7 heterodimer. Unlike Ab affinity chromatography (26), this purification procedure does not use extreme pH and has a major impact in term of assessing the binding of peptides to purified empty I-Ag7 or I-Ad molecules. Whereas Ab affinity-purified empty MHC molecules were really empty (26), molecules purified at neutral pH were found to be associated with a large collection of peptides that could be stripped at acidic pH and analyzed by mass spectrometry (Fig. 1GoC). This same phenomenon has been described for empty MHC class I molecules expressed in the fly system (31). Thus, it would be proper to call these molecules "functionally empty", instead of "empty", because they are associated with low affinity peptides. These peptides could easily be displaced by higher affinity peptides in a binding assay (Fig. 2Go). Direct binding of peptides and specificity of peptide binding (tested by competition) were shown for both I-Ad and I-Ag7 with the ROI peptide (VHAAHAVHAAHAVHA) (Fig. 2Go, A and B).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of recombinant I-Ag7 molecules. A, Empty I-Ag7 molecules were purified from transfected SC2 cell culture supernatant and purified by metal chelate affinity chromatography followed by size exclusion chromatography. In addition, I-Ag7 molecules complexed to the Ii were purified by ion exchange chromatography. Eluted fractions were analyzed by one-dimensional SDS-PAGE and the pooled fractions by two-dimensional gel electrophoresis (NEPHGE followed by 12% SDS-PAGE). B, Size exclusion chromatography of empty I-Ag7 molecules before and after cleavage of the zipper. C, Mass spectrometry analysis of peptides obtained by acid elution from "empty" I-Ag7 molecules.

 


View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 2. Examples for binding of peptides by empty I-Ag7 and I-Ad molecules. A, I-Ag7 and I-Ad molecules were incubated with increasing concentrations of biotinylated OVA323–339 peptide in a direct binding assay. B, For binding inhibition assays, I-Ag7 and I-Ad molecules were incubated with 300 nM of biotinylated OVA323–339 peptide and increasing concentrations of test peptides. The inhibition using the ROI peptide is shown. Negative control peptides for I-Ag7 and I-Ad were HEL50–62 and GAD345–361, respectively.

 
Association of I-Ag7 molecules with the Ii

Correct folding of the recombinant I-Ag7 molecule in the fly expression system was further demonstrated by its ability to associate with the Ii. A soluble form of human Ii with an N-terminal hexa-histidine tag was cotransfected with I-Ag7 {alpha} and ß constructs retaining zippers but no histidine tag. The cell line was cloned and the single cell clone 134, which expresses equivalent amounts of the three chains, was used for further studies. Complexes of the three chains, {alpha}-ß-Ii, were isolated by nickel-agarose chromatography (binding only Ii) followed by gel filtration, hydrophobic interaction chromatography, and ion exchange chromatography. The presence of all three chains was demonstrated by SDS-PAGE and two-dimensional gel analysis of the final pooled fractions (Fig. 1GoA). Again, the behavior of I-Ag7/Ii complexes was almost identical with the behavior of I-Ad/Ii complexes (26). Peptides could be loaded on these complexes at acidic pH in the absence of accessory molecules (data not shown, 26). These results confirmed the observation by Peterson and Sant (17) that I-Ag7 associates normally with the Ii, excluding possible gross defects of intercellular trafficking.

Promiscuous peptide motif for I-Ad and I-Ag7 molecules

A broad number of MHC class I and class II molecules binding motifs have been identified by direct sequencing of natural peptides and/or binding of random peptides and sequencing (32). For HLA-DQ and I-A molecules, the same strategy has not proven very fruitful, and most of these haplotypes have no clearly defined motif to date. In the case of I-Ag7, the number of studies addressing the issue is very limited and they have yielded rather controversial results (11, 12, 13). To try to address this question, we followed a strategy previously used by Hammer and colleagues to identify the HLA-DR1 class II molecule binding motif based on the selection of random peptide M13 phage display libraries with purified MHC molecules (33).

A random 12-mer peptide phage library was selected by four consecutive rounds of panning against empty I-Ag7 molecules. An increase of the absolute amount of eluted phages, combined with an increase of binding over background up to ~2700-fold after the third round of selection indicated the enrichment of binding clones from the original library (Fig. 3GoA). One hundred and two clones of the third and fourth round of selection and 107 clones from the naive library were further analyzed by direct sequencing (Table IGo). In the selected library, four different clones were identified multiple times. A binding motif was sought by manual alignment and by using CLUSTAL W 1.7 (Human Center, Baylor College of Medicine, Houston, TX; Ref. 34), as well as PILEUP software (program of the Genetics Computer Group, Madison, WI). When the total numbers of all 20 aa from the enriched library (averaged to 100 clones) were compared with the total numbers of the same amount of sequences from the naive library (Table IIGo), only minor enrichments were found in the selected library for cysteine (65 vs 50), glutamate (41 vs 31), and phenylalanine (75 vs 51). However, these residues were randomly distributed along the sequence, and no motif was apparent.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 3. Selection phage display libraries against empty I-Ag7 and I-Ad molecules. A and B, A random 12-mer peptide phage display library was selected for four rounds against I-Ag7 molecules and for two rounds against I-Ad molecules. C and D, Random fragment libraries prepared from OVA and GAD65 cDNAs, respectively, were selected for four rounds against I-Ag7 molecules.

 

View this table:
[in this window]
[in a new window]
 
Table I. Amino acid sequences of 102 peptides displayed on M13 phages of the JCM13-88-X12 random peptide library selected by empty I-Ag7 molecules1

 

View this table:
[in this window]
[in a new window]
 
Table II. Amino acid sequences of 107 peptides displayed on the surface of M13 of the random 12-mer library before selection1

 
Synthetic peptides were then made for two of the sequences picked randomly from the I-Ag7-selected library, TSS31 (NYYPWSIIPSIG) and TSS39 (HVHYPAVLIPRD), and tested for binding to I-Ag7 and I-Ad. TSS31 bound equally well to both I-A molecules (0.08 and 0.15 µM for I-Ag7 and I-Ad, respectively), whereas TSS39 was a weak binder to I-Ad (0.14 µM) but a stronger binder to I-Ag7 (0.016 µM) (Table IIIGo). These results suggested specific selection for I-Ag7 binding during panning. With respect to negatively charged residues that could compensate for the absence of the aspartic acid ß57 in I-Ag7, aspartic and glutamic acids were found more frequently within the last four residues of the I-Ag7-selected library (30.4%, Table IGo) than in the I-Ad (12.3%, Table IVGo) or naive (22.4%, Table IIGo) libraries.


View this table:
[in this window]
[in a new window]
 
Table III. Comparison of peptide binding to empty I-Ag7 and I-Ad molecules1

 

View this table:
[in this window]
[in a new window]
 
Table IV. Amino acid sequences of 57 peptides displayed on M13 phages of the JCM13-88-X12 random peptide library selected by empty I-Ad molecules1

 
The same experiment of panning the random library on purified MHC molecules was repeated with empty I-Ad molecules (Fig. 3GoB). A strong enrichment of binding clones was observed after one and two rounds of panning. A total of 57 clones were sequenced and analyzed for a possible binding motif (Table IVGo). Two hydrophobic amino acids were enriched in the selected library, leucine (151 vs 117) and phenylalanine (72 vs 51), whereas lysine was also increased (44 vs 28) and serine diminished (116 vs 142). Again, no apparent motif could be determined, but the prevalence of hydrophobic residues satisfies the optimal requirement for such residues at the P4 and P6 positions in binding peptide to I-Ad, as deduced from the crystal structure of two I-Ad peptide complexes (14).

We used the three-dimensional structure of I-Ag7 complexed with GAD207–220 to rationalize these binding studies. Like I-Ad, I-Ag7 does not use large side chains to anchor in its pockets for peptide binding. Instead, the binding energy is provided mainly by interaction of the peptide backbone with the peptide-binding groove. From the structural data, we were able to suggest the following binding motif: P1, degenerate; P4 optimal, P, L, V, I, G, A, and C; P4 nonoptimal, M, S, T, N, Q, and H; P6 optimal, L, V, I, P, S, T, G, A, C, and N; P6 nonoptimal, D; P9 optimal, D, E, S, G, and A; P9 nonoptimal, M, L, I, V, P, C, N, H, Q, and T (15). Using that motif, we could align the vast majority of peptides known to bind to I-Ag7. Peptides from the unselected, as well as the selected I-Ag7 and I-Ad peptide libraries, respectively, were then aligned based on that motif. In the unselected (naive) library, 36% of the sequences could satisfactorily be fitted using the optimal alignment for I-Ag7 (P4, P6, and P9 using optimal side chains). This number rose to 74% if one nonoptimal residue was allowed only at one position. After selection against I-Ag7, these numbers changed for round 3 to 27 and 65% (optimal and nonoptimal fit peptides, respectively) and to 32 and 64% for round 4. Two clones, which were identified multiple times in round 3, were eliminated under these strict rules for motif-containing clones (Table IGo). However, it is likely that these sequences bind to I-Ag7; this hypothesis will be tested later using synthetic peptides. For I-Ad, 54 and 55% could be aligned in the unselected and the selected library using the optimal and nonoptimal motif, respectively. In summary, essentially no enhancement of sequences containing this binding motif was observed after selection. This result can be easily explained by the high numbers of potential binding clones in the unselected library. For comparison, <1% of clones of the naive library contained a motif for I-Eb or I-Ak (33, 35). Selection of the same library for binding to these particular MHC class II molecules should lead to a clear enrichment of motif-containing clones.

Isolation of OVA and GAD65 peptides able to associate to I-Ag7 molecules

The number of peptides known to bind I-Ag7 molecules is limited. The number of known self-peptides is even smaller and, for most of them, their affinity is unknown. Because functional and structural studies of MHC molecules require the identification of the appropriate peptide, we decided to design a general method to identify I-Ag7 binding peptides. Several groups, including ours, have previously shown that Ab-specific epitopes can be retrieved from random cDNA fragment phage display libraries (36, 37, 38). Generally, these libraries consist of 15–30 aa peptide fragments that are generated by random cDNA fragmentation and expressed as fusions to one of the surface proteins of bacteriophage M13. A similar strategy was used to isolate peptides that bound to empty MHC class II molecules. The approach was tested by constructing two phages displaying peptides known to bind I-Ag7 and I-Ad: OVA323–339 (phage JCM13-88-OVA) and ROI (phage JCM13-88-ROI) (13, 39). These peptides were fused to the N terminus of protein VIII and a four glycine-one serine linker. Specificity of binding was demonstrated by incubating JCM13-88-OVA and JCM13-88-ROI phages with empty I-Ag7 molecules with increasing concentrations of free ROI peptide. Binding of phages was dose-dependently decreased by increasing doses of ROI but not by a non-I-Ag7-specific control peptide (data not shown). Based on this result, two cDNA fragment libraries were constructed from the OVA and murine GAD65 cDNAs called JCM13-88-rOVA and JCM13-88-rGAD65, respectively. GAD65 was chosen because it has been identified as one of the major autoantigens in IDDM in both humans and mice (40, 41, 42). OVA was used as a control. Both libraries were subjected to four successive rounds of selection (Fig. 3Go, C and D). After the fourth round, binding of the JCM13-88-rOVA library had doubled as compared with the first round of selection, and binding was 650 times more than background. To identify binding peptides, phage clones were randomly chosen from the third and fourth rounds of selection and sequenced (Table VGo). Of 60 clones analyzed, 13 clones were coded for OVA peptides. Alignment of these sequences revealed two major consensus sequences: GISSAESLKISQA, OVA314–326 and SVSEE FRADHPFL, OVA353–365. The previously described I-Ag7 and I-Ad epitope OVA323–339 sequence was found in only one clone. Both consensus sequences could be aligned multiple times using our predicted I-Ag7 motif. The affinity of OVA323–339 and OVA353–365 synthetic peptides was measured directly for empty I-Ag7 molecules (Table IIIGo). Interestingly, OVA353–365 did not bind to I-Ad but, at 25 nM, was one of the best I-Ag7 binders that we identified in this study compared with 0.1 µM for OVA323–339. Thus, these data suggest that I-Ag7 and I-Ad can bind both similar and haplotype-specific epitopes from the same protein.


View this table:
[in this window]
[in a new window]
 
Table V. Ovalbumin peptides selected by empty I-Ag7 molecules1

 
From the GAD65 library, 54 clones were sequenced. Seventeen clones (8/27 in round 3, 9/27 in round 4) coded for known GAD65 peptide sequences (Table VIGo). The most represented sequence was YEIAPVFVLLE, GAD65 residues 207-217, which appeared in 10 clones (59%) and which mapped within a sequence previously identified as the major GAD65 epitope in vivo (43, 44, 45). The second consensus sequence, GAD65105–119, had not been described as being a functional epitope, but its binding to I-Ag7 molecules was confirmed in a binding assay (Table IIIGo). The second major functional epitope identified by Chao and McDevitt as well as Zechel et al. (43, 44, 45), GAD65 residues 221–235, partially overlapped with clone TSS116. Therefore, it is noticeable that, in vitro, we were able to identify two of the three major functional determinants for GAD65.


View this table:
[in this window]
[in a new window]
 
Table VI. Glutamic acid 65 peptides selected by empty I-Ag7 molecules1

 
The various peptides that were identified and chemically synthesized, as well as a collection of peptides that had been shown previously by other groups to stimulate I-Ag7-restricted autoreactive T cells (40, 43, 44, 45), were tested for their ability to bind empty I-Ag7 and I-Ad molecules (Table IIIGo). From the compilation of these data, three main features emerged: 1) none of the peptides had very high affinity (<1 nM) for I-Ad or I-Ag7 molecules, 2) at the cutoff of 10 µM (medium affinity), I-Ag7 bound slightly more peptides (16/20) than I-Ad molecules (9/20), and 3) specificity was high with only 9 of 20 peptides binding to both haplotypes (<10 µM). Also, as recently reported (46), the binding of the full-length class II-associated invariant chain peptide (81-104, human sequence) to I-Ag7 was found to be of relatively low affinity (1.3 µM) compared with its binding to I-Ad (0.18 µM).

Expression and crystallization of a series of I-Ag7 peptide complexes

Because one of our goals was to carry out functional and structural studies of I-Ag7 molecules, a series of peptide sequences were cloned in frame into the HLA-A2-I-Ag7 ß-chain hybrid construct (see Materials and Methods) and transfected with the I-Ad {alpha}-chain into SC2 cells. The functionality of the recombinant product was tested for its ability to stimulate T cell hybridomas in a plate assay (26 , and data not shown) and to stain T cells after biotinylation and tetramerization with PE-labeled streptavidin (Fig. 4Go). All molecules were purified by a succession of nickel-agarose chromatography, ion exchange, and gel filtration (isoelectric point values ranged from 5.5 to 7.5). The two-dimensional analysis of some of these molecules is shown in Fig. 5Go. Protein yields ranged from 0.2 to 2 mg/L and correlated very closely with peptide affinities. The crystallization of four complexes was successful: OVA323–339, ROI, GAD207–220, and GAD221–235. However, the I-Ag7 OVA323–339 and I-Ag7 ROI complex crystals were needles that could not be grown to sufficient size for crystallographic analysis. But, data quality crystals could be obtained, after removal of the leucine zipper with thrombin digestion, for I-Ag7 GAD207–220 and GAD221–235 complexes. Diffraction data to 2.6 and 3.0Å were obtained for I-Ag7 GAD207–220 and GAD221–235, respectively, upon cryocooling of the crystals, and these structures have been determined by x-ray crystallography (15).



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 4. Flow cytometric analysis of three different murine T cell hybridomas specific for GAD524–538. Hybridomas were stained with biotinylated I-Ag7 molecules tethered to the GAD524–538 peptide and tetramerized using PE-labeled streptavidin (dotted lines). Empty I-Ag7 tetramers were used as a reference for staining (solid lines).

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 5. Expression of peptide-filled I-Ag7 molecules. A series of peptide sequences was tethered to the ß-chain of I-Ag7. Expression of both chains was analyzed by two-dimensional gel electrophoresis (NEPHGE followed by a 12% SDS-PAGE) using purified molecules.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The association and link of MHC class II haplotypes with certain autoimmune diseases has been known for 25 years, yet the definitive explanation has not been established at the structural level and many hypotheses on the link are currently debated. IDDM is one of the few diseases that gives the opportunity to test many of these hypotheses connecting autoimmunity and MHC class II. First, the correlation between HLA-DQ8 in human and I-Ag7 in the mouse and IDDM is well established and both molecules have a nonaspartic acid at position ß57 (6, 47). Second, the NOD mouse is a spontaneous model of IDDM that shares many features with the human disease (3). In addition, IDDM in the NOD mouse can be prevented by transgenesis with modified ß56 and or ß57 ß-chains (9, 10), highlighting the critical role for these residues in disease. Surprisingly, biochemical characterizations of the I-Ag7 molecule have been scarce and, until recently, no structural studies had been reported.

To address some of the most fundamental questions about the biology of this molecule, we expressed I-Ag7 in a soluble recombinant form in fly cells. The previous expression of its close relative I-Ad in the same system (14, 26, 27) allowed us to compare the two molecules in terms of stability, aggregation, and peptide binding. From the few biochemical studies that have been published on I-Ag7, one of the main impressions was that the molecule was unstable, and a poor peptide binder (12, 16, 17, 18). The loss of the salt bridge between ßAsp57 and {alpha}Arg86, seen in other MHC class II molecules, could be the structural basis for poor chain pairing, instability, and poor peptide binding of I-Ag7. Contrary to our expectations, the biochemical and biophysical comparison between the two I-Ad and I-Ag7 haplotypes revealed very few differences. Expression levels of both molecules were almost identical, and they exhibited no tendency to aggregate. In addition, the I-Ag7 dimer was shown to be stable at 37°C, even after removal of the leucine zipper. More importantly, both molecules bound peptides equally well. The first evidence of peptide binding was provided by the elution of peptides from the "empty" molecules. Most of these peptides are low affinity binders that can be readily exchanged in a binding assay and that were stripped from the groove when molecules were Ab affinity purified (26). Peptide binding was lost in a few days for low pH-eluted molecules, whereas histidine-tagged molecules were stable for several weeks. The occupancy of empty MHC molecules made in the fly expression system by low affinity peptides has already been noted for the class I molecules H-2Kb (31) and H-2Ld (48). The screen of a random peptide library with "empty" I-Ad and I-Ag7 molecules confirmed the degeneracy of binding motif for both molecules as no particular anchor residues became apparent in the screen. Then, it became obvious from the crystal structures of I-Ag7 and I-Ad molecules, respectively, that both molecules could bind peptide without using large anchor residues, unlike most other MHC class I and class II molecules (14, 15, 32). However, both structures, in combination with previously reported peptide binding studies and in vivo data as well as our own peptide binding studies, allowed a rational approach to determine a binding motif for both molecules. The major energy for peptide binding appears to be primarily provided by the interaction of the peptide binding groove with the peptide backbone; the accommodation of side chains into the P1, P4, P6, and P9 pockets was based on the combination of size and hydrophobicity of each pocket. The peptide P1 position appears degenerate; at P4, small hydrophobic residues, and, at P6, small hydrophobic or hydrophilic side chains can be accommodated. Finally, P9 has a preference for either negatively charged or small neutral residues, in case of I-Ag7, and for small neutral residues in case of I-Ad, respectively. Alignment of our random peptide library, before and after selection against I-Ag7 and I-Ad, revealed no increase in the number of clones containing a motif. The combination of high persistence of the motif in the unselected library with the necessity to analyze randomly picked clones after selection explains these results. In contrast, an enrichment of motif-displaying clones would be expected in case of selection against, e.g., I-Ek or I-Ak because <1% of clones of the unselected library contains a motif for either molecule (32, 35).

The second most important point of our study was the identification of new I-Ag7 epitopes using phage display of cDNA fragments. The advantage of this approach is that it is fast and doable for any cDNA or cDNA library. The main disadvantage is that it is based solely on MHC binding; therefore, binding peptides that will not be available in vivo by degradation in Ag processing cells will still be selected. As a consequence, the identification of functional epitopes using this method requires the immunization of animals with the whole protein and the test for reactivity of this peptide. In the case of GAD65, the immunization of NOD mice with the protein and the screen for peptide reactivity had already been conducted by two groups (43, 44, 45). It is interesting to note that the major sequence that we selected (207–217) was also the dominant functional epitope (43, 44, 45). In the GAD65 sequence, a surprising 126 peptides can be identified that meet the requirement of the I-Ag7 motif (Table VIIGo). In comparison, no sequence can be aligned with the strict motif of either I-Ek or I-Ak.


View this table:
[in this window]
[in a new window]
 
Table VII. Alignment of GAD65 peptides using the I-Ag7 binding motif1

 
Furthermore, we have tested a set of 15-mer synthetic peptides overlapping by three amino acids and covering the entire sequence of GAD65, and we identified 13 peptides that bind to I-Ag7 molecules and five peptides that bind to I-Ad (15). GAD205–219 was among the peptides with the highest affinity for I-Ag7, which explains why it was preferentially selected from the random cDNA fragment library. In addition, we also selected one clone that mapped partially into the second major epitope (221–235). The majority of binding peptides contained the structure-determined motif. Multiple explanations may account for the fact that we did not detect binding of more peptides. First, the set of peptides that was used for binding studies represented only a limited number of all possible GAD65 peptides fitting the motif of I-Ag7; second, flanking residues, such as P1 and P10, may interfere with peptide binding. And finally, several factors may have influenced our binding assay, such as reduced solubility of some peptides as well as some impurities of peptides from the chemical synthesis (unpurified peptides of a pinsynthesis, PEPSETS; Chiron Technologies, Emeryville, CA) were used in the GAD65 epitope-mapping experiment. Nevertheless, it is noteworthy that, compared with I-Ad, I-Ag7 binds more than twice as many peptides under the same conditions and that, unlike other MHC class I or class II molecules, I-Ag7 binds numerous peptides from a single protein in vivo. The screening of the OVA-derived cDNA fragment library revealed the same tendency. In addition to the I-Ad323–339 epitope, a number of alternative sequences able to bind I-Ag7 with high affinity were identified. We are currently testing the functional relevance of these peptides by immunizing NOD mice with whole OVA. In conclusion, this phage display method appears to be a valid technique to identify MHC binding peptides. Its coupling to immunization and functional screening should lead to the rapid identification of new class II-restricted epitopes. This technique has allowed us to express a number of I-Ag7 molecules with tethered peptides to attempt crystallization and perform functional studies with tetramers. Tetrameric I-Ag7 molecules tethered with various peptides will allow studies on the generation of autoreactive T cells in vivo in the NOD mouse and follow T cell selection for particular epitopes. The tolerizing role of I-Ag7 peptide complexes will also be interesting to study using recombinant molecules as well as transgenic mice.

In summary, recombinant I-Ad and I-Ag7 molecules appeared to be very similar in term of stability, solubility, and peptide binding. Binding motifs of both molecules are degenerate, allowing them to bind a wide selection of peptides. Based on the binding of a large collection of unselected peptides, I-Ag7 molecules appeared more promiscuous than I-Ad molecules. The same conclusion was reached recently by Carrasco-Martin and colleagues using a different approach (49). This promiscuity is certainly associated with a lower average affinity of peptides for I-Ag7 molecules, and will translate in vivo by shorter half-lives at the cell surface for I-Ag7 peptide complexes (22). This "functional instability" could lead to inoperative thymic selection and high frequency of autoreactive T cells on a diabetic genetic background (50). The determination of the crystal structure of I-Ag7 complexed to self-peptides will help us design new experiments to test these hypotheses.


    Acknowledgments
 
We thank Drs. Agnes Lehnen and Jörg Fehling for providing the cDNAs for I-Ag7ß and GAD65. Special thanks to Amanda Moore for secretarial assistance and to Randy Stefanko and Michael Wallace for their valuable technical assistance.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants DK55037 (to L.T.) and CA58896 (to I.A.W.). A.S.K. is grateful for an Investigators Award from the Cancer Research Institute/Partridge Foundation. V.A. was supported by a National Health and Medical Research Council C.J. Martin Fellowship. This is publication 12732-IMM from The Scripps Research Institute. Back

2 Current address: Department of Medicine 0613-C, University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92083-0613. Back

3 Current address: Abgenix Inc., 7601 Dumbarton Circle, Fremont, CA 94555. Back

4 Address correspondence and reprint requests to Dr. Luc Teyton, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. Back

5 Abbreviations used in this paper: IDDM, insulin-dependent diabetes mellitus; NOD, nonobese diabetic; GAD, glutamic acid decarboxylase; NEPHGE, nonequilibrium pH gradient electrophoresis; Ii, invariant chain; PBST, PBS containing 0.05% Tween 20. Back

Received for publication April 5, 2000. Accepted for publication June 26, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lo, D., C. R. Reilly, B. Scott, R. Liblau, R. O. McDevitt, L. C. Burkly. 1993. Antigen-presenting cells in adoptively transferred and spontaneous autoimmune diabetes. Eur. J. Immunol. 23:1693.[Medline]
  2. Miller, B. J., M. C. Apple, J. J. O’Neil, L. S. Wicker. 1988. Both the LYT-2+ and L3T4+ T cell subset are required for the transfer of diabetes in nonobese diabetic mice. J. Immunol. 140:52.[Abstract]
  3. Tisch, R., H. McDevitt. 1996. Insulin-dependent diabetes mellitus. Cell 85:291.[Medline]
  4. Vyse, T. J., J. A. Todd. 1996. Genetic analysis of autoimmune diabetes. Cell 85:311.[Medline]
  5. Wicker, L. S., J. A. Todd, L. Peterson. 1995. Genetic control of autoimmune diabetes in the NOD mouse. Annu. Rev. Immunol. 13:179.[Medline]
  6. Acha-Orbea, H., H. O. McDevitt. 1987. The first external domain of the nonobese diabetic mouse class II I-A ß chain is unique. Proc. Natl. Acad. Sci. USA 84:2435.[Abstract/Free Full Text]
  7. Miyazaki, T., M. Uno, M. Uehira, H. Kikutani, T. Kishimoto, M. Kimoto, H. Nishimoto, J. Miyazaki, K. Yamamura. 1990. Direct evidence for the contribution of the unique I-ANOD to the development of insulitis in non-obese diabetic mice. Nature 345:722.[Medline]
  8. Singer, S. M., R. Tisch, X.-D. Yang, H. O. McDevitt. 1993. An Aßd transgene prevents diabetes in nonobese diabetic mice by inducing regulatory T cells. Proc. Natl. Acad. Sci. USA 90:9566.[Abstract/Free Full Text]
  9. Quartey-Papafio, R., T. Lund, P. Chandler, J. Picard, P. Ozegbe, S. Day, P. R. Hutchings, L. O’Reilly, D. Kioussis, E. Simpson, A. Cooke. 1995. Aspartate at position 57 of nonobese diabetic I-Ag7 ß-chain diminishes the spontaneous incidence of insulin-dependent diabetes mellitus. J. Immunol. 154:5567.[Abstract]
  10. Lund, T., L. O’Reilly, P. Hutchings, O. Kanagawa, E. Simpson, R. Gravely, P. Chandler, J. Dyson, J. K. Picard, A. Edwards, D. Kioussi, A. Cooke. 1990. Prevention of insulin diabetes mellitus in non-obese diabetic mice by transgenes encoding modified I-A ß-chain or normal I-E {alpha}-chain. Nature 345:727.[Medline]
  11. Reich, E. P., H. von Grafenstein, A. Barlow, K. E. Swenson, K. Williams, C. A. Janeway. 1994. Self peptides isolated from MHC glycoproteins of non-obese diabetic mice. J. Immunol. 152:2279.[Abstract]
  12. Reizis, B., M. Eisenstein, J. Bockova, S. Könen-Waisman, F. Mor, D. Elias, I. R. Cohen. 1997. Molecular characterization of the diabetes-associated mouse MHC class II protein, I-Ag7. Int. Immunol. 9:43.[Abstract/Free Full Text]
  13. Harrison, L. C., M. C. Honeyman, S. Trembleau, S. Gregori, F. Gallazzi, P. Augstein, V. Brusic, J. Hammer, L. Adorini. 1997. A peptide binding motif for I-Ag7, the class II major histocompatibility complex (MHC) molecule of NOD and Biozzi AB/H mice. J. Exp. Med. 185:1013.[Abstract/Free Full Text]
  14. Scott, C. A., P. A. Peterson, L. Teyton, I. A. Wilson. 1998. Crystal structures of two I-Ad-peptide complexes reveal that high affinity can be achieved without large anchor residues. Immunity 8:319.[Medline]
  15. Corper, A. L., T. Stratmann, V. Apostolopoulos, C. A. Scott, K. C. Garcia, A. S. Kang, I. A. Wilson, L. Teyton. 2000. A structural framework for deciphering the link between I-Ag7 and murine autoimmune diabetes. Science 288:505.[Abstract/Free Full Text]
  16. Carrasco-Martin, E., J. Shimizu, O. Kanagawa, E. R. Unanue. 1996. The class II MHC I-Ag7 molecules from non-obese diabetic mice are poor peptide binders. J. Immunol. 156:450.[Abstract]
  17. Peterson, M., A. J. Sant. 1998. The inability of the nonobese diabetic mouse class II molecule to form stable peptide complexes does not reflect a failure to interact with DM. J. Immunol. 161:2961.[Abstract/Free Full Text]
  18. Nabavieh, A., H. Chou, I. Volokhov, J. E. Lee, L. E. Purdy, J. F. Elliott, B. Singh, J. Madrenas. 1998. Development of an I-Ag7-expressing antigen-presenting cell line: intrinsic molecular defect in compact I-Ag7 dimer generation. J. Autoimmun. 11:63.[Medline]
  19. Germain, R. N., L. R. Hendrix. 1991. MHC class II structure, occupancy and surface expression determined by post-endoplasmatic reticulum antigen binding. Nature 353:134.[Medline]
  20. Sadegh-Nasseri, S., R. N. Germain. 1991. A role for peptide in determining MHC class II structure. Nature 353:167.[Medline]
  21. Stern, L. J., D. C. Wiley. 1992. The human class II MHC protein HLA-DR1 assembles as empty {alpha}ß heterodimers in the absence of antigenic peptide. Cell 68:465.[Medline]
  22. Nelson, C. A., S. J. Petzold, E. R. Unanue. 1994. Peptides determine the lifespan of MHC class II molecules in the antigen presenting cell. Nature 371:250.[Medline]
  23. Liu, G. Y., D. Baker, S. Fairchild, F. Figueroa, R. Quartey-Papfio, M. Tone, D. Healey, A. Cooke, J. L. Turk, D. C. Wraith. 1993. Complete characterization of the expressed immune response genes in Biozzi AB/H mice: structural and functional identity between AB/H and NOD A region molecules. Immunogenetics 37:296.[Medline]
  24. Chappel, J. C., M. He, A. S. Kang. 1998. Modulation of antibody display on M13 filamentous phage. J. Immunol. Methods 221:25.[Medline]
  25. McReynolds, L. A., B. W. O’Malley, A. D. Nisbet, J. E. Fothergill, D. Givol, S. Fields, M. Robertson, G. G. Brownlee. 1978. Sequence of ovalbumin mRNA. Nature 273:723.[Medline]
  26. Scott, C. A., K. C. Garcia, F. R. Carbone, I. A. Wilson, L. Teyton. 1996. Role of chain pairing for the production of soluble IA major histocompatibility complex class II molecules. J. Exp. Med. 183:2087.[Abstract/Free Full Text]
  27. Scott, C. A., K. C. Garcia, E. A. Stura, P. A. Peterson, I. A. Wilson, L. Teyton. 1998. Engineering protein for X-ray crystallography: the murine major histocompatibility complex class II molecule I-Ad. Protein Sci. 7:413.[Medline]
  28. Schatz, P. J.. 1993. Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Biotechnology (NY) 11:1138.[Medline]
  29. Matsumura, M., Y. Saito, M. Jackson, E. S. Song, P. Peterson. 1992. In vitro peptide binding to soluble empty class I major histocompatibility molecules isolated from Drosophila melanogaster cells. J. Biol. Chem. 267:23589.[Abstract/Free Full Text]
  30. Sloan, V. S., P. Cameron, G. Porter, M. Gammon, M. Amaya, E. Mellins, D. M. Zaller. 1995. Mediation by HLA-DM of dissociation of peptides from HLA-DR. Nature 375:802.[Medline]
  31. Fremont, D. H., E. A. Stura, M. Matsumura, P. A. Peterson, I. A. Wilson. 1995. Crystal structure of an H-2Kb-ovalbumin peptide complex reveals the interplay of primary and secondary anchor positions in the major histocompatibility complex binding groove. Proc. Natl. Acad. Sci. USA 92:2479.[Abstract/Free Full Text]
  32. Rammensee, H. G., T. Friede, S. Stevanovic. 1995. MHC ligands and peptide motifs: first listing. Immunogenetics 41:178.[Medline]
  33. Hammer, J., B. Takacs, F. Sinigaglia. 1992. Identification of a motif for HLA-DR1 binding peptides using M13 display libraries. J. Exp. Med. 176:1007.[Abstract/Free Full Text]
  34. Thompson, J. D., D. G. Higgins, T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673.[Abstract/Free Full Text]
  35. Fremont, D. H., D. Monnaie, C. A. Nelson, W. A. Hendrickson, E. R. Unanue. 1998. Crystal structure of I-Ak in complex with a dominant epitope of lysozyme. Immunity 8:305.[Medline]
  36. Petersen, P., D. Song, B. Hügle-Dörr, I. Oldenburg, E. Bautz. 1995. Mapping of linear epitopes recognized by monoclonal antibodies with gene-fragment phage display libraries. Mol. Gen. Genet. 249:425.[Medline]
  37. Wang, L.-F., D. H. D. Plessis, J. R. White, A. D. Hyatt, B. T. Eaton. 1995. Use of a gene-targeted phage display random epitope library to map an antigenic determinant on the bluetongue virus outer capsid protein VP5. J. Immunol. Meth. 178:1.[Medline]
  38. van Zonneveld, A.J., B. M. van den Berg, M. van Meijer, H. Pannekoek. 1995. Identification of functional interaction sites on proteins using bacteriophage-displayed random epitope libraries. Gene 167:49.[Medline]
  39. Sette, A., J. Sidney, M. Albertson, C. Miles, S. M. Colon, T. Pedrazzini, A. G. Lamont, H. M. Grey. 1990. A novel approach to the generation of high affinity class II-binding peptides. J. Immunol. 145:1809.[Abstract]
  40. Kaufman, D. L., M. Clare-Salzler, J. Tian, T. Frosthuber, G. S. P. Ting, P. Robinson, M. A. Atkinson, E. E. Sercarz, A. J. Tobin, P. V. Lehmann. 1993. Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine insulin-dependent diabetes. Nature 366:69.[Medline]
  41. Tisch, R., X.-D. Yang, S. M. Singer, R. S. Liblau, L. F. Fugger, H. O. McDevitt. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice. Nature 366:72.[Medline]
  42. Yoon, J.-W., C.-S. Yoon, H.-W. Lim, Q. Q. Huang, Y. Kang, K. H. Pyun, K. Hirasawa, R. S. Sherwin, H.-S. Jun. 1999. Control of autoimmune diabetes in NOD mice by GAD expression or suppression in ß cells. Science 284:1183.[Abstract/Free Full Text]
  43. Chao, C.-C., H. O. McDevitt. 1997. Identification of immunogenic epitopes of GAD 65 presented by I-Ag7 in non-obese diabetic mice. Immunogenetics 46:29.[Medline]
  44. Zechel, M. A., J. F. Elliott, M. A. Atkinson, B. Singh. 1998. Characterization of novel T-cell epitopes on 65 kDa and 67 kDa glutamic acid decarboxylase relevant in autoimmune responses in NOD mice. J. Autoimmun. 11:83.[Medline]
  45. Zechel, M. A., M. D. Krawetz, B. Singh. 1998. Epitope dominance: evidence for reciprocal determinant spreading to glutamic acid decarboxylase in non-obese diabetic mice. Immunol. Rev. 164:111.[Medline]
  46. Hausmann, D. H. F., B. Yu, S. Hausmann, K. W. Wucherpfenning. 1999. pH-dependent peptide binding properties of the type I diabetes-associated I-Ag7 molecule: rapid release of CLIP at an endosomal pH. J. Exp. Med. 189:1723.[Abstract/Free Full Text]
  47. Yasunaga, S., A. Kimura, K. Hamaguchi, K. S. Ronningen, T. Sasazuki. 1999. Different contribution of HLA-DR and -DQ genes in susceptibility and resistance to insulin-dependent diabetes mellitus (IDDM). Tissue Antigens 47:37.
  48. Speir, J. A., K. C. Garcia, A. Brunmark, M. Degano, P. A. Peterson, L. Teyton, I. A. Wilson. 1998. Structural basis of 2C TCR allorecognition of H-2Ld peptide complexes. Immunity 8:553.[Medline]
  49. Carrasco-Martin, E., O. Kanagawa, E. R. Unanue. 1999. The lack of consensus for I-Ag7-peptide binding motifs: is there a requirement for anchor amino acid side chains?. Proc. Natl. Acad. Sci. USA 96:8621.[Abstract/Free Full Text]
  50. Kanagawa, O., S. M. Martin, B. A. Vaupel, E. Carrasco-Martin, E. R. Unanue. 1998. Autoreactivity of T cells from nonobese diabetic mice: an I-Ag7-dependent reaction. Proc. Natl. Acad. Sci. USA 95:1721.[Abstract/Free Full Text]
  51. Lee, D. S., J. Tian, T. Phan, D. L. Kaufman. 1993. Cloning and sequence of a murine cDNA encoding glutamate decarboxylase (GAD65). Biochim. Biophys. Acta 1216:157.[Medline]
  52. Smilek, D. E., C. B. Lock, H. O. McDevitt. 1990. Antigen recognition and peptide-mediated immunotherapy in autoimmune disease. Immunol. Rev. 118:37.[Medline]
  53. Sette, A., S. Buus, S. Colon, C. Miles, H. Grey. 1988. I-Ad-binding peptides derived from unrelated protein antigens share a common structural motif. J. Immunol. 141:45.[Abstract]
  54. Sette, A., S. Buus, S. Colon, C. Miles, H. Grey. 1989. Structural analysis of peptides capable of binding more than one Ia antigen. J. Immunol. 142:35.[Abstract]
  55. Daniel, D., D. R. Wegmann. 1996. Protection of nonobese diabetic mice from diabetes by intranasal or subcutaneous administration of insulin peptide B-(9-23). Proc. Natl. Acad. Sci. USA 93:956.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
R. Arakaki, A. Nagaoka, N. Ishimaru, A. Yamada, S. Yoshida, and Y. Hayashi
Role of Plasmacytoid Dendritic Cells for Aberrant Class II Expression in Exocrine Glands from Estrogen-Deficient Mice of Healthy Background
Am. J. Pathol., May 1, 2009; 174(5): 1715 - 1724.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
N. Ishimaru, R. Arakaki, S. Yoshida, A. Yamada, S. Noji, and Y. Hayashi
Expression of the retinoblastoma protein RbAp48 in exocrine glands leads to Sjogren's syndrome-like autoimmune exocrinopathy
J. Exp. Med., November 24, 2008; 205(12): 2915 - 2927.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Tian, M. J. I. Ansari, J. Paez-Cortez, J. Bagley, J. Godwin, M. Donnarumma, M. H. Sayegh, and J. Iacomini
Induction of Robust Diabetes Resistance and Prevention of Recurrent Type 1 Diabetes Following Islet Transplantation by Gene Therapy
J. Immunol., November 15, 2007; 179(10): 6762 - 6769.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
A. Gardiner, K. A. Richards, A. J. Sant, and L. S. Arneson
Conformation of MHC class II I-Ag7 is sensitive to the P9 anchor amino acid in bound peptide
Int. Immunol., September 1, 2007; 19(9): 1103 - 1113.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. G. Levisetti, A. Suri, S. J. Petzold, and E. R. Unanue
The Insulin-Specific T Cells of Nonobese Diabetic Mice Recognize a Weak MHC-Binding Segment in More Than One Form
J. Immunol., May 15, 2007; 178(10): 6051 - 6057.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. J. Mellanby, C. H. Koonce, A. Monti, J. M. Phillips, A. Cooke, and E. K. Bikoff
Loss of Invariant Chain Protects Nonobese Diabetic Mice against Type 1 Diabetes
J. Immunol., December 1, 2006; 177(11): 7588 - 7598.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. R. Bill, D. G. Mack, M. T. Falta, L. A. Maier, A. K. Sullivan, F. G. Joslin, A. K. Martin, B. M. Freed, B. L. Kotzin, and A. P. Fontenot
Beryllium Presentation to CD4+ T Cells Is Dependent on a Single Amino Acid Residue of the MHC Class II {beta}-Chain
J. Immunol., November 15, 2005; 175(10): 7029 - 7037.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. S. Smith, T. Patterson, and M. E. Pauza
Transgenic Ly-49A Inhibits Antigen-Driven T Cell Activation and Delays Diabetes
J. Immunol., April 1, 2005; 174(7): 3897 - 3905.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. J. Carven, S. Chitta, I. Hilgert, M. M. Rushe, R. F. Baggio, M. Palmer, J. E. Arenas, J. L. Strominger, V. Horejsi, L. Santambrogio, et al.
Monoclonal Antibodies Specific for the Empty Conformation of HLA-DR1 Reveal Aspects of the Conformational Change Associated with Peptide Binding
J. Biol. Chem., April 16, 2004; 279(16): 16561 - 16570.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Zavala-Ruiz, E. J. Sundberg, J. D. Stone, D. B. DeOliveira, I. C. Chan, J. Svendsen, R. A. Mariuzza, and L. J. Stern
Exploration of the P6/P7 Region of the Peptide-binding Site of the Human Class II Major Histocompatability Complex Protein HLA-DR1
J. Biol. Chem., November 7, 2003; 278(45): 44904 - 44912.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M.-H. Jang, N. P. Seth, and K. W. Wucherpfennig
Ex Vivo Analysis of Thymic CD4 T Cells in Nonobese Diabetic Mice with Tetramers Generated from I-Ag7/Class II-Associated Invariant Chain Peptide Precursors
J. Immunol., October 15, 2003; 171(8): 4175 - 4186.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. Jaeckel, L. Klein, N. Martin-Orozco, and H. von Boehmer
Normal Incidence of Diabetes in NOD Mice Tolerant to Glutamic Acid Decarboxylase
J. Exp. Med., June 16, 2003; 197(12): 1635 - 1644.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Cantu III, K. Benlagha, P. B. Savage, A. Bendelac, and L. Teyton
The Paradox of Immune Molecular Recognition of {alpha}-Galactosylceramide: Low Affinity, Low Specificity for CD1d, High Affinity for {alpha}{beta} TCRs
J. Immunol., May 1, 2003; 170(9): 4673 - 4682.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Suri, J. J. Walters, O. Kanagawa, M. L. Gross, and E. R. Unanue
Specificity of peptide selection by antigen-presenting cells homozygous or heterozygous for expression of class II MHC molecules: The lack of competition
PNAS, April 29, 2003; 100(9): 5330 - 5335.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
S. E. Starwalt, E. L. Masteller, J. A. Bluestone, and D. M. Kranz
Directed evolution of a single-chain class II MHC product by yeast display
Protein Eng. Des. Sel., February 1, 2003; 16(2): 147 - 156.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sidney, M.-F. del Guercio, S. Southwood, and A. Sette
The HLA Molecules DQA1*0501/B1*0201 and DQA1*0301/B1*0302 Share an Extensive Overlap in Peptide Binding Specificity
J. Immunol., November 1, 2002; 169(9): 5098 - 5108.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. V. Tarbell, M. Lee, E. Ranheim, C. C. Chao, M. Sanna, S.-K. Kim, P. Dickie, L. Teyton, M. Davis, and H. McDevitt
CD4+ T Cells from Glutamic Acid Decarboxylase (GAD)65-specific T Cell Receptor Transgenic Mice Are Not Diabetogenic and Can Delay Diabetes Transfer
J. Exp. Med., August 19, 2002; 196(4): 481 - 492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Wen, F. S. Wong, R. Sherwin, and C. Mora
Human DQ8 Can Substitute for Murine I-Ag7 in the Selection of Diabetogenic T Cells Restricted to I-Ag71
J. Immunol., April 1, 2002; 168(7): 3635 - 3640.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Suri, I. Vidavsky, K. van der Drift, O. Kanagawa, M. L. Gross, and E. R. Unanue
In APCs, the Autologous Peptides Selected by the Diabetogenic I-Ag7 Molecule Are Unique and Determined by the Amino Acid Changes in the P9 Pocket
J. Immunol., February 1, 2002; 168(3): 1235 - 1243.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
F. Monneaux, H. Dumortier, G. Steiner, J.-P. Briand, and S. Muller
Murine models of systemic lupus erythematosus: B and T cell responses to spliceosomal ribonucleoproteins in MRL/Faslpr and (NZB NZW)F1 lupus mice
Int. Immunol., September 1, 2001; 13(9): 1155 - 1163.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. Kelemen, D. R. Wegmann, and J. C. Hutton
T-Cell Epitope Analysis on the Autoantigen Phogrin (IA-2{beta}) in the Nonobese Diabetic Mouse
Diabetes, August 1, 2001; 50(8): 1729 - 1734.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stratmann, T.
Right arrow Articles by Teyton, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stratmann, T.
Right arrow Articles by Teyton, L.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Diabetes Type 1


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS