HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kim, Y.-M. Articles by Choi, I. Search for Related Content PubMed PubMed Citation Articles by Kim, Y.-M. Articles by Choi, I.

IFN- Up-Regulates IL-18 Gene Expression Via IFN Consensus Sequence-Binding Protein and Activator Protein-1 Elements in Macrophages¹

Laboratory of Immunology, Korea Research Institute of Bioscience and Biotechnology, Yusong, Taejon, Republic of Korea

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Constitutive IL-18 expression is detected from many different cells, including macrophages, keratinocytes, and osteoblasts. It has been known that IL-18 gene expression is regulated by two different promoters (p1 promoter and p2 promoter). When RAW 264.7 macrophages were treated with IFN-, IL-18 gene expression was increased in a dose- and time-dependent manner. IFN- activated the inducible promoter 1, but not the constitutive promoter 2. Mutagenesis studies indicated that an IFN consensus sequence-binding protein (ICSBP) binding site between -39 and -22 was critical for the IFN- inducibility. EMSA using an ICSBP oligonucleotide probe showed that IFN- treatment increased the formation of DNA-binding complex, which was supershifted with anti-IFN regulatory factor-1 Ab and anti-ICSBP Ab. Another element, an AP-1 site between -1120 and -1083, was important. EMSA using an AP-1-specific oligonucleotide demonstrated that IFN- or LPS treatment increased the AP-1-binding activity. The addition of anti-c-Jun Ab or anti-c-Fos Ab to IFN-- or LPS-treated nuclear extracts resulted in the reduction of AP-1 complex or the formation of a supershifted complex. Taken together, these results indicate that IFN- increased IL-18 gene expression via ICSBP and AP-1 elements.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Interferon- is an important regulator in host defenses, in both innate and acquired immunity. It enhances the activities of macrophages and NK cells, the expression of MHC class I and II, and Ig secretion by B cells (1). In monocytes and macrophages, IFN- induces the secretion of IL-1 and TNF-, and the transcription of genes encoding G-CSF and M-CSF (2, 3). It also has antiviral activity and antiproliferative activity on tumor cells (4, 5). IFN- is secreted mostly from T cells or NK cells when they are activated by Ags or mitogens. Among cytokines, IL-12 has been shown to be the major stimulator of IFN- production by T cells (6, 7). In addition, IL-2, TNF-, and IL-1 are known to be costimulators for the induction of IFN- by NK cells (8).

IL-18 was originally known as IFN--inducing factor (9). It induces IFN- production from T cells and NK cells in the presence of IL-12, mitogens, or microbial agents (10, 11, 12). It augments NK activity (13) and enhances FasL on T cells and NK cells (14, 15). It also induces GM-CSF from PBMC (16), and it is a potent coinducer of IL-13 from NK cells and T cells (17). Based on the previous data, it has been noted that IL-18 exerts its actions fully in synergy with IL-12, particularly in the induction of IFN- and Th1 development (10). Both cytokines are produced from activated macrophages, but the induction kinetics is different. IL-12 is readily inducible by mitogens, but constitutive IL-18 expression is detected in macrophages. In addition, IL-18 is processed by caspase-1 to become the active form (18). Expression of IL-18 is relatively ubiquitous, and its expression is detected from macrophages, keratinocytes, osteoblasts, lamina propria mononuclear cells, and some tumor cells (19, 20, 21, 22). Mitogens such as LPS and PMA, and oligodeoxynucleotide CpG motifs have been known to induce IL-18 gene expression (23, 24). Sendai virus also induces IL-18 gene expression from macrophages (25). Recently, we identified the key regulatory elements in IL-18 promoter regions, which is activated by LPS (26). However, little has been known about the regulation of IL-18 gene expression, which would be modulated in cytokine network as seen in other cytokine regulation.

In the present study, we have analyzed the gene expression of IL-18 in macrophages by IFN-. We demonstrate that p1 promoter of two IL-18 promoters is involved in IFN--induced IL-18 gene expression. IFN consensus sequence-binding protein (ICSBP)³ and AP-1 are critical elements for the maximal induction of IL-18 promoter activity by IFN-.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Reagents

Mouse rIFN- was purchased from Genzyme (Cambridge, MA). Bacterial LPS (Escherichia coli serotype 0127:B8), TLC plates (silica gel), and cycloheximide (CHX) were purchased from Sigma (St. Louis, MO). Poly(dI-dC)·poly(dI-dC) and dNTPs were obtained from Pharmacia LKB Biotechnology (Piscataway, NJ). The 1-deoxydichloroacetyl-1-[¹⁴C]chloramphenicol and [-³²P]dCTP were purchased from Amersham (Aylesbury, U.K.). Restriction enzymes, Klenow fragment of DNA polymerase I, BSA, and acetyl-CoA were purchased from Boehringer Mannheim (Mannheim, Germany). The polyclonal Abs against IFN regulatory factor-1 (IRF-1), ICSBP, c-Jun, or c-Fos were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Cell culture

RAW 264.7 mouse macrophage-like cells (TIB71; American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 2 mM L-glutamine, antibiotics (100 U/ml penicillin G and 100 µg/ml streptomycin), and 10% heat-inactivated FBS (Life Technologies, Gaitherburg, MD). Elicited peritoneal macrophages were isolated as described (27). Briefly, BALB/c weighing 20–25 g were injected i.p. with 300 µl of IFA (Sigma). Three days later, the peritoneal cavities were lavaged with DMEM containing 2% FBS to remove the elicited peritoneal macrophages. After two washes, the cells were allowed to adhere to culture dishes for 30–45 min in DMEM containing 2% FBS. The nonadherent cells were washed off, and adherent cells were cultured in the presence or the absence of IFN- or LPS.

Northern blot and RT-PCR analysis for IL-18 mRNA

Total cellular RNA was isolated from RAW 264.7 cells with RNAzolB reagent (Tel-Test, Friendswood, TX), according to the manufacturer’s recommended procedure. RNA samples (20 µg) were size fractionated on 1.2% agarose/formaldehyde gels and transferred to Nylon membranes. The filter was hybridized with radiolabeled mouse IL-18 cDNA probe, washed, and analyzed by autoradiography. IL-18 mRNA expression in peritoneal macrophages was analyzed by RT-PCR, as follows. Total RNA was prepared from the elicited peritoneal macrophages, 3 µg of total RNA was reverse transcribed using M-MLV reverse transcriptase (Promega, Madison, WI), and 1/10 of the reaction was subjected to PCR using the following reactions: 94°C for 1 min, 55°C for 1 min, 72°C for 1 min for 30 cycles in a thermocycler (GeneAmp 9600; Perkin-Elmer, Norwalk, CT). PCR primers for mouse IL-18 and ß-actin are as follows: IL-18 sense primer, 5'-ACTGTACAACCGCAGTAATACGG-3'; IL-18 antisense primer, 5'-AGTGAACATTACAGATTTATCCC-3'; ß-actin sense primer, 5'-GTGGGGCGCCCCAGGCACCA-3'; ß-actin antisense primer, 5'-CTCCTTAATGTCACGCACGATTTC-3'. IL-18 mRNA transcribed from p1 promoter in RAW 264.7 cells was analyzed by RT-PCR with 3 µg of total RNA, as described above. PCR primers are as follows: sense primer, 5'-AAGCCTGCTATAATCCTCAGG-3'; antisense primer, 5'-AGTGAACATTACAGATTTATCCC-3'. The amplification product (one-fifth) was separated electrophoretically on 1.2% agarose gels with ethidium bromide and analyzed by photography.

Plasmid construction

Serially deleted mutants and site-directed mutants in the ICSBP binding site of the mouse IL-18 p1 promoter linked to chloramphenicol acetyltransferase (CAT) reporter gene were described in detail in the previous study (26). Additional deletion mutants (p1-1048, -1083, -1120, and -1340) of p1 promoter were constructed from p1-2686 by the PCR method. Site-directed mutant of AP-1 binding site (p1-m1120 (mAP-1)) of p1 promoter was constructed by PCR mutagenesis. Then all constructs were confirmed by DNA sequencing.

Transient transfection and CAT assay

RAW 264.7 cells were transfected by electrophoration, as we previously described (26). Twenty-four hours later, transfected cells were further treated with IFN- for 20 h, and then harvested. The cells were washed with ice-cold PBS, resuspended in 0.25 M Tris (pH 7.8), and subjected to three cycles of freezing and thawing. Cell lysates were centrifuged, and the supernatant was heated for 10 min to inactivate CAT inhibitors and then centrifuged. The supernatant was assayed for CAT enzyme activity by TLC method (28). To control for differences in the uptake of transfected DNA, cells were cotransfected with 5 µg of pCH110 plasmid (Pharmacia, Piscataway, NJ) for ß-galactosidase assay.

EMSA

Nuclear extracts were prepared from 1 x 10⁷ of RAW 264.7 cells treated with IFN- or LPS for 6 h. To prepare probes for binding of ICSBP and AP-1, single-stranded oligonucleotides were annealed to form the oligomers, and each oligomer was filled with [-³²P]dCTP and the three other nonlabeled dNTPs by the Klenow fragment of DNA polymerase I. The ICSBP and AP-1 binding sites are underlined; mutations are italicized: ICSBP, 5'-GGGGAAGCTTGCTTTCACTTCTCCC-3' and 3'-TTCGAACGAAAGTGAAGAGGGGACAGG-5'; mICSBP, 5'-GGGAAGCTTGCTCCCACTTCTCCC-3' and 3'- TTCGAACGAGGGTGAAGAGGGGACAGG-5'; AP-1, 5'- GGGCTTCCTATGTGTCACTTCCTG-3' and 3'- GAAGGATACACAGTGAAGGACGGG-5'; mAP-1, 5'-GGGCTTCCTATGTGAGTCTTCCTG-3' and 3'-GAAGGATACACTCAGAAGGACGGG-5'. For binding reactions, 7 µg of nuclear extract was incubated with reaction buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol, 2 µg of poly(dI-dC)·poly(dI-dC), and 1 µg of BSA) in the presence or the absence of competitor or Ab for 20 min at room temperature. Then radiolabeled probe (20,000 cpm) was added to the reaction mixture for an additional 10 min at room temperature. The binding products were electrophoresed at 4–5 V/cm on 6% polyacrylamide gel in 0.5x TBE buffer. The gel was dried and analyzed by autoradiography.

Immunoblotting

Nuclear extracts were separated on a 12% SDS-polyacrylamide gel and transferred to Immunobilon P (Millipore, Bedford, MA). The membranes were blocked in TBST-M (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20, 5% milk powder) and incubated with c-Jun (1:1000 in TBST-M)- or c-Fos-specific Abs (1:600 in TBST-M) for 2 h at room temperature, then washed three times in TBST (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20), and incubated with anti-goat rabbit IgG (for c-Jun) or anti-rabbit goat IgG (for c-Fos) for 1 h at room temperature. Expression analysis was performed after washing the membranes several times in TBST by enhanced chemiluminescence (ECL) detection, as described by the manufacturer.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
IFN- up-regulates murine IL-18 gene expression via the activation of p1 promoter

IL-18 functions as an inducer of IFN- production in T cells and NK cells, although it requires costimulators such as IL-12 or mitogens (9, 12). Little has been known yet about the interaction with other cytokines in terms of IL-18 gene expression. In this regard, it may be possible that IL-18 expression is regulated by IFN- in a manner of feedback regulation. To address this possibility, we examined the effect of IFN- on IL-18 mRNA expression by Northern blot. When RAW 264.7 macrophages were treated with various concentrations of IFN- for 9 h (Fig. 1A), there was a dose-dependent increase in IL-18 mRNA expression. The increase in IL-18 mRNA expression was shown apparently at 6–9 h after IFN- treatment and persisted until 24 h (Fig. 1B). To determine whether de novo protein synthesis is required for the expression of IL-18 mRNA by IFN-, the effect of CHX, a protein synthesis inhibitor, on IL-18 mRNA expression was examined. As shown in Fig. 1C, CHX did not block the IFN--induced transcription of IL-18, but in fact it increased IFN-- or LPS-induced IL-18 mRNA expression, suggesting that a repressor factor is involved in the induction or maintenance of IL-18 gene expression in RAW 264.7 cells by IFN- or LPS. To address whether primary macrophages can respond to IFN- to express IL-18 mRNA, peritoneal macrophages were isolated from BALB/c mice injected with IFA for 3 days. Untreated peritoneal macrophages expressed IL-18 mRNA constitutively. When peritoneal macrophages were treated with IFN- (10 U/ml) for 12 h, IL-18 mRNA expression was apparently increased (Fig. 1D). Also, the induction of IL-18 mRNA appeared in LPS (1 µg/ml)-treated peritoneal macrophages. We have shown previously that LPS up-regulates mouse IL-18 gene expression by activating distinct two promoters, p1 promoter located upstream of exon 1 (5'-flanking region) and p2 promoter located upstream of exon 2 (intron 1) (26). To know which promoter is responsible for IFN--mediated IL-18 mRNA expression, RAW 264.7 cells were transiently transfected with p1-2686 construct for p1 promoter and p2-2.3 construct for p2 promoter by electrophoration. Each promoter region showed basal constitutive promoter activity. However, in contrast to the induction of two promoters by LPS, IFN- induced only the promoter activity of the p1-2686 about 2.5-fold, but it had no effect on the promoter activity of the p2-2.3 (Fig. 1E). Furthermore, when IL-18 gene expression by IFN- was quantitatively analyzed in comparison with inducibility of p1-2686 by IFN-, IL-18 gene expression and p1-2686 activity showed the similar IFN--mediated inducibility (Fig. 2). Taken together, these results demonstrate that IFN- induces the increase of IL-18 gene expression by activating p1 promoter.

View larger version (42K): [in this window] [in a new window]   FIGURE 1. Effects of IFN- on IL-18 mRNA expression and the activation of its two promoters in RAW 264.7 macrophages. A, Dose-dependent IL-18 mRNA expression. Twenty micrograms of total RNA (20 µg) from RAW 264.7 cells treated with various concentrations of IFN- for 9 h were used for the analysis of IL-18 by Northern blot analysis. A mouse GAPDH cDNA probe was used as an internal control for RNA loading and transfer. B, Time-dependent IL-18 mRNA expression. RAW 264.7 cells were treated with IFN- (10 U/ml) for various times, and Northern blot analysis was performed as described in Materials and Methods. C, Effects of CHX on IFN-- or LPS-induced IL-18 mRNA expression. RAW 264.7 cells were treated with IFN- (10 U/ml) or LPS (1 µg/ml) in the presence or absence of CHX (1 µg/ml) for 9 h, and Northern blot analysis was performed, as described in Materials and Methods. D, IL-18 mRNA expression in primary peritoneal macrophages. Three micrograms of total RNA from peritoneal macrophages treated with IFN- (10 U/ml) or LPS (1 µg/ml) for 12 h were reverse transcribed and subjected to PCR to quantify the expression of IL-18 mRNA. The amplified products were electrophoresed and photographed. To control for RNA loading and efficiency of reverse transcription, amplification of ß-actin was performed on the same cDNA samples. The result was representative one from three experiments with similar results. E, CAT activity of IL-18 two promoters. RAW 264.7 cells were transfected with a p1 promoter construct (p1-2686) or a p2 promoter construct (p2-2.3), treated with IFN- (10 U/ml) or LPS (1 µg/ml) for 20 h, and assayed for CAT activity. Data represent the percent of acetylation and the mean ± SD of four independent experiments.

View larger version (17K): [in this window] [in a new window]   FIGURE 2. Dose-dependent effects of IFN- on IL-18 mRNA expression and p1 promoter activation. A, Dose-dependent IL-18 mRNA expression driven by p1 promoter activation. Three micrograms of total RNA from RAW 264.7 cells treated with the indicated concentrations of IFN- for 9 h were reverse transcribed and subjected to PCR to quantify the expression of IL-18 mRNA with primers based on exon 1 and exon 7. The amplified products were electrophoresed and photographed (upper). The results are shown as the mean ± SD of relative IL-18 mRNA normalized with ß-actin mRNA from three independent experiments (lower). B, Dose-dependent p1 promoter activation. RAW 264.7 cells were transfected with p1-2686 construct and treated with the indicated concentrations of IFN- for 20 h, and assayed for CAT activity. Data represent the relative percent of acetylation and the mean ± SD of three independent experiments.

Identification of two regions between -1120 and -1083 and -39 and -22 mediating IFN--induced activation of p1 promoter

It has been reported that two regions, -39 to -22 containing the functional ICSBP binding site and -954 to -1528, are critical for p1 promoter activation by LPS (26). As an effort to identify the regulatory elements mediating activation of p1 promoter, a sequence homology search revealed various potential transcription factor binding sites such as an additional ICSBP binding site (-1047 to -1034) and two Ap-1 binding sites (-1081 to -1075 and -1113 to -1107). Based on this observation, additional deletion mutants (p1-1048, -1083, -1120, and -1340) were constructed from p1-2686 by PCR method (Fig. 3A). These CAT constructs were transfected into the RAW 264.7 cells by electrophoration, and the cells were treated with IFN- (10 U/ml) for 20 h. As shown in Fig. 3B, deletion of the region from -2686 to -1120 did not affect the promoter activity significantly. But deletion of the region from -1120 to -1083 resulted in a marked reduction in basal (50% reduction) and IFN--induced (60% reduction) promoter activity, suggesting that this region contains a positive regulatory element for the full activation of p1 promoter. Also, the reduction (60% reduction) of promoter activity induced by IFN- was observed when the region from -39 to -22 was deleted, as seen in the case of LPS treatment (26). These results indicate that the two regions, -39 to -22, containing an ICSBP site, and -1120 to -1083, containing an AP-1 site, are responsible for the IFN- responsiveness as well as the basal transcriptional activity of p1 promoter. In addition to positive elements, there is a possible negative regulatory region from -139 to -438, as described in previous other and our reports (23, 26). In fact, p1-1048 containing two ICSBP is less expressed than p1-139 or p1-39 containing one ICSBP, probably due to negative elements between two regions. More detailed analysis on the possible negative regulatory region is required.

View larger version (19K): [in this window] [in a new window]   FIGURE 3. CAT activity in transfected RAW 264.7 cells with 5' deletion mutants of p1 promoter of IL-18. A, Schematic representation of serially deleted mutants of IL-18 p1 promoter. The putative cis elements on p1 promoter are located as follows: two ICSBP binding sites (-39 to -22 and -1047 to -1034) and two AP-1 binding sites (-1081 to -1075 and -1113 to -1107). B, CAT activity of cells transfected with deletion mutants of p1 promoter. RAW 264.7 cells were transfected with the indicated deletion mutants of p1 promoter, treated with or without IFN- (10 U/ml) for 20 h, and assayed for CAT activity. The results represent the percent of acetylation and the mean ± SD of three independent experiments with similar results.

Functional requirement of the ICSBP binding site in the activation of p1 promoter by IFN-

From the above results, we identified that the region from -39 to -22 containing the ICSBP binding site is involved in the activation p1 promoter by IFN-. For further analysis, 2-bp mutation of the ICSBP binding site (TGCTTTCACTTCTCTGCTCCCACTTCTC) was introduced into p1-39 and p1-2686 plasmids to construct p1-m39 (mICSBP) and p1-m2686 (mICSBP) constructs, respectively (Fig. 4A). These site-directed mutants were then transfected into RAW 264.7 cells, which treated with IFN- (10 U/ml) for 20 h further. As expected, IFN--induced CAT activity of cells transfected with the p1-m39 (mICSBP) was apparently reduced (about 50–60% reduction) compared with that of cells transfected with the wild-type construct (Fig. 4B). In addition, mutation of the ICSBP binding site in the full-length p1 promoter, p1-m2686 (mICSBP), resulted in a significant reduction of IFN--induced CAT activity as well as basal activity compared with the wild-type plasmid, p1-2686. However, another site-directed mutation in upstream ICSBP binding site (-1047 to -1034) did not affect p1 promoter activity (data not shown). These results suggest that the ICSBP binding site in the region from -22 to -39 is a functional element for IFN--induced p1 promoter activation.

View larger version (12K): [in this window] [in a new window]   FIGURE 4. Effects of site-directed mutation within the ICSBP binding site of p1 promoter on promoter activity. A, CAT constructs bearing mutated sequences in the ICSBP binding site of p1 promoter. Italicized bold letters indicate the mutated sequences in the ICSBP binding site. B, RAW 264.7 cells were transfected with the indicated CAT constructs and treated with or without IFN- (10 U/ml) for 20 h, and the levels of CAT activity were measured. The results represent the percent of acetylation and the mean ± SD of three independent experiments.

View larger version (41K): [in this window] [in a new window]   FIGURE 5. Binding of IFN-- or LPS-induced nuclear proteins to the ICSBP binding site of p1 promoter. A, Binding of nuclear proteins to ICSBP binding site-containing probe. EMSA was performed using nuclear extracts from RAW 264.7 cells treated with or without IFN- (50 U/ml) or LPS (1 µg/ml) for 6 h, and oligomers containing the ICSBP binding site. B, Binding specificity. Competition assays were performed with IFN- (50 U/ml)-treated nuclear extracts and oligomers containing the ICSBP binding site in the presence or the absence of a 100-fold molar excess of unlabeled oligomers (wt) or oligomers containing the mutated ICSBP binding site (mt). C, Identification of nuclear proteins. Supershift assays were performed by incubating IFN- (50 U/ml)- or LPS (1 µg/ml)-treated nuclear extracts with 2 µg of Ab specific for ICSBP or IRF-1 before the addition of oligomers containing the ICSBP binding site. The supershifted (arrowhead) and specific protein-DNA (arrow) complexes are indicated. F, free probe.

Abrogation of IFN--induced p1 promoter activation by mutation of AP-1 binding site in the region from -1120 to -1083

The results from Fig. 3 suggest that the region from -1120 to -1083 is involved in IFN--induced transcriptional activity as well as basal transcriptional activity of p1 promoter. This region contained a putative AP-1 binding site (TGTGTCA) that differed by 1 bp from its consensus sequence (TGAGTCA)(30) (Fig. 6>A). To address the role of a putative AP-1 binding site in this region in controlling IFN-- or LPS-induced transcriptional activation of p1 promoter, we constructed a site-directed mutant containing the mutated AP-1 binding site. The mutant construct, p1-m1120 (mAP-1) bearing 3-bp mutated sequences in AP-1 binding site (Fig. 6A), was transfected into RAW 264.7 cells by electroporation. The cells transfected with a plasmid, p1-m1120 (mAP-1), exhibited reduced levels of basal (40–50% reduction) and IFN--induced (50–60% reduction) CAT activity compared with cells transfected with the wild-type construct (p1-1120) (Fig. 6B). Also, the similarly reduced activities were observed in cells transfected with the plasmid p1-1083 lacking the AP-1 binding site. In addition, cells transfected with p1-m1120 (mAP-1) exhibited a reduction (60% reduction) in LPS-induced CAT activity compared with cells transfected with wild-type p1-1120 construct, indicating that the AP-1 binding site functions as an essential element for both IFN-- and LPS-induced p1 promoter activation of IL-18.

View larger version (19K): [in this window] [in a new window]   FIGURE 6. Effects of site-directed mutation in the AP-1 binding site on p1 promoter activity. A, CAT constructs bearing mutated sequences in the AP-1 binding site of p1 promoter. Italicized bold letters indicate the mutated sequences in the AP-1 binding site. B, CAT activity of transfected RAW 264.7 cells. RAW 264.7 cells were transfected with the indicated CAT constructs and treated with or without IFN- (10 U/ml) or LPS (1 µg/ml) for 20 h, and the levels of CAT activity were measured. The results represent the percent of acetylation and the mean ± SD of three independent experiments.

IFN- or LPS increases AP-1 binding to p1 promoter

To further investigate the interaction between the putative AP-1 binding site in the region from -1120 to -1083 and nuclear proteins from untreated, IFN--, or LPS-treated cells, we performed EMSA using a radiolabeled probe containing the putative AP-1 binding site. In unstimulated control cells, there was a moderate level of AP-1 binding (Fig. 7A; arrow). AP-1 activation and binding were increased in nuclear extracts treated with IFN- (50 U/ml). This effect was significantly augmented by the addition of LPS-treated nuclear extracts. Binding specificity of LPS-induced AP-1 binding was determined by competing by the addition of a 100-fold molar excess of p1 promoter fragment itself (wt) and an AP-1 consensus oligonucleotide (AP-1). But an oligomer containing the mutated AP-1 binding site (mt) did not compete completely as the wild-type did (Fig. 7A). This AP-1-binding activity induced by IFN- or LPS was dose dependent (Fig. 7B). When cells were treated with IFN- or LPS, nuclear c-Jun and c-Fos proteins were elevated, as analyzed by immunoblotting (Fig. 7C). In addition, to determine the identity of the IFN-- or LPS-induced DNA-binding proteins that recognize the AP-1-binding sequence, supershift assays were performed with Ab against c-Jun or c-Fos. The addition of c-Jun-specific Ab to IFN-- or LPS-treated nuclear extracts significantly inhibited the protein-DNA complex by immunodepletion, while c-Fos-specific Ab resulted in retardation of protein-DNA complex (Fig. 7D).

View larger version (60K): [in this window] [in a new window]   FIGURE 7. Binding of IFN-- or LPS-induced nuclear proteins to AP-1 binding site of p1 promoter. A, Binding specificity of nuclear proteins to AP-1 binding site-containing probe. Nuclear extracts from RAW 264.7 cells treated with or without IFN- (50 U/ml) or LPS (1 µg/ml) for 6 h were incubated with or without a 100-fold molar excess of unlabeled oligomers (wt), oligomers containing the mutated AP-1 binding site (mt), or AP-1 consensus sequence oligomers (AP-1) before the addition of labeled probes containing the p1 promoter AP-1 binding site. B, Dose-dependent effect of IFN- or LPS on AP-1-binding activity. EMSAs were performed with oligomers containing the p1 promoter AP-1 binding site and nuclear extracts from RAW 264.7 cells treated with the indicated concentrations of IFN- or LPS for 6 h. C, Immunoblot analysis of c-Jun and c-Fos. Nuclear extracts were prepared from RAW 264.7 cells treated with IFN- (50 U/ml) or LPS (1 µg/ml) for 6 h. Each extract (50 µg) was subjected to SDS-PAGE and then to immunoblot with Abs against c-Jun or c-Fos, as described in Materials and Methods. The same blots were subjected to Coomassie staining (CBB) to check the proper loading of nuclear protein. D, Identification of nuclear proteins. Supershift assays were performed by incubating the IFN- (50 U/ml)- or LPS (1 µg/ml)-treated nuclear extracts with 1.5 µg of Ab specific for c-Jun or c-Fos before the addition of labeled probes containing the AP-1 binding site. The supershifted (arrowhead) and specific protein-DNA (arrow) complexes are indicated. F, Free probe; NS, nonspecific binding.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

In this study, we demonstrated another linkage between Th1 or NK cells and macrophages: IFN- produced by activated Th1 or NK cells activates IL-18 gene expression in macrophages. This coactivation mediated by IFN- and IL-18 can augment the efficacy of Th1 or NK cell activation driven by activated macrophages. Meanwhile, a few studies showed that macrophages produced IFN- when they were stimulated with IL-12 (35) or Mycobacterium tuberculosis (36). In addition, it was reported that IFN- itself (37) or combination of IL-12 and IL-18 (38) induced IFN- production from macrophages, demonstrating the unique pathways of autocrine macrophage activation. In this case, IFN--induced IL-18 seems to have a critical role in autocrine activation in addition to paracrine activation of macrophages.

During Th1 development, IL-18 potentiates IL-12-induced Th1 development and synergizes with IL-12 for IFN- production from Th1 cells (10). In addition, IL-18R is expressed in Th1 cells, but not in Th2 cells (39). It is highly possible that the reciprocal up-regulation of IL-18 and IFN- expression exists during Th1 development, as suggested in macrophage activation.

In macrophages, basal level of IL-18 expression is detected. LPS or PMA treatment increases IL-18 expression dose dependently and CHX independently. Promoter analysis demonstrated that IL-18 gene expression is regulated by two independent promoters: p1 promoter, inducible promoter, and p2 promoter, constitutive promoter. Both promoters are TATA less, and IL-18 mRNAs are transcribed from multiple mRNA start sites located at both p1 and p2 promoters (23). In the case of p1 promoter, major start site is defined as position +1, and two minor start sites in -1 position and in -27 position. Recently, we reported that ICSBP element in p1 promoter and PU.1 element in p2 promoter are critical elements for regulating IL-18 promoter activity (26).

IFN- treatment activated p1 promoter, but not p2 promoter (Fig. 1). This is in the same line with previous observations demonstrating that p1 promoter is responsible for inducibility of IL-18 gene expression (23, 26). As seen in the case of LPS treatment, ICSBP binding site (-39 to -22) is a critical element for IFN--induced p1 promoter activation. IFN- induced the binding of ICSBP and IRF-1, but LPS induced only ICSBP binding.

ICSBP is a member of the IRF family that mediates IFN responsiveness for many genes. ICSBP exhibits tissue specificity, in that it is expressed mainly in macrophages and lymphocyte lineages. It has been known as a negative transcriptional regulator in both mouse and human cells (40). However, recent reports demonstrated that ICSBP could function in macrophages as a positive transcriptional activator of its own promoter (41), of IL-12 p40 (42) induction, and of IL-18 promoter (26). ICSBP interacts directly with IRF-1 and IRF-2 via an association domain located near the carboxyl terminus between residues 200 and 377. It has been suggested that ICSBP may have different functions in different immune cells depending on the milieu of IRFs that are associated with it (43).

The regulation of AP-1-binding activity by IFN- is somehow controversial. Lewis et al. (44) reported that IFN- decreased AP-1-binding activity of stromelysin gene in human fibroblasts, but it was reported by Lee et al. (45) that IFN- enhanced AP-1-binding activity of stromelysin-1 gene in human skin fibroblasts. In our study using murine macrophages, IFN- apparently enhanced AP-1-binding complex containing c-Jun and c-Fos, and it also increased the expression of c-Jun and c-Fos in nucleus, as reported before (46). Collectively, based on mutagenesis analysis and EMSA, it indicates that both ICSBP and AP-1 are required for full activation of p1 promoter by IFN- or LPS. Further studies are needed to elucidate the possible functional interaction between these transcription factors in IL-18 gene expression.

Another key modulator in this connection between IFN- and IL-18 would be a potential negative feedback regulator. One of the candidates is NO because it is readily induced by IFN- and/or LPS in macrophages and involves in transcription regulation including inhibition of AP-1 activity (47). In this regard, we tested the effects of inhibitors for NO synthase on IFN--mediated IL-18 gene expression, but they had no effects on it (data not shown). More studies on the negative regulation of IL-18 gene expression are now under investigation.

IL-18 is an important cytokine that is involved in many immune responses such as inflammation, Th development, and antitumor responses. Nothing has been known about the regulation of IL-18 gene expression in a cytokine network. This is the first report demonstrating IL-18 is regulated by a cytokine, a feedback regulation by IFN-, suggesting that the regulation of IL-18 expression is dependent on the local networking of cytokines. Further analysis of this network will elucidate the roles of IL-18 in immune responses and related diseases.

	Footnotes

 
¹ This work was supported by grants from the Highly Advanced National Project (HS2620 and KM1241) from Ministry of Science and Technology, Republic of Korea.

² Address correspondence and reprint requests to Dr. Inpyo Choi, Laboratory of Immunology, Korea Research Institute of Bioscience and Biotechnology, Eoun-Dong 52, Yusong, Taejon 305-333, Republic of Korea.

³ Abbreviations used in this paper: ICSBP, IFN consensus sequence-binding protein; CAT, chloramphenicol acetyltransferase; CHX, cycloheximide; IRF-1, IFN regulatory factor-1.

Received for publication November 12, 1999. Accepted for publication June 23, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular responses to interferon-. Annu. Rev. Immunol. 15:749.[Medline]
2. Gruber, M. F., T. L. Gerrard. 1992. Production of macrophage colony-stimulating factor (M-CSF) by human monocytes is differentially regulated by GM-CSF, TNF, and IFN-. Cell. Immunol. 142:361.[Medline]
3. De Wit, H., W. H. Dokter, M. T. Esselink, M. R. Halie, E. Vellenga. 1993. Interferon- enhances the LPS-induced G-CSF gene expression in human adherent monocytes, which is regulated at transcriptional and posttranscriptional levels. Exp. Hematol. 21:785.[Medline]
4. Nomura, T., K. Yasuda, T. Yamada, S. Okamoto, R. I. Mahato, Y. Watanabe, Y. Takakura, M. Hashida. 1999. Gene expression and antitumor effects following direct interferon (IFN)- gene transfer with naked plasmid DNA and DC-chol liposome complexes in mice. Gene Ther. 6:121.[Medline]
5. Rosenthal, F. M., K. Cronin, R. Bannerji, D. W. Golde, B. Gansbacher. 1994. Augmentation of antitumor immunity by tumor cells transduced with a retroviral vector carrying the interleukin-2 and interferon- cDNAs. Blood 83:1289.[Abstract/Free Full Text]
6. Yssel, H., S. Fasler, J. E. de Vries, R. de Waal Malefyt. 1994. IL-12 transiently induces IFN- transcription and protein synthesis in human CD4⁺ allergen-specific Th2 T cell clones. Int. Immunol. 6:1091.[Abstract/Free Full Text]
7. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
8. Bancroft, G. L., R. D. Schreiber, E. R. Unanue. 1992. Natural immunity, a T cell-independent pathway of macrophage activation, defined in the SCID mouse. Immunol. Rev. 124:5.
9. Okamura, H., K. Nagata, T. Komatsu, T. Tanimoto, Y. Nukata, F. Tanabe, K. Akita, K. Torigoe, T. Okura, S. Fukuda, M. Kurimoto. 1995. A novel costimulatory factor for interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63:3966.[Abstract]
10. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon- production and activates IRAK and NF-B. Immunity 7:571.[Medline]
11. Micallef, M. J., T. Ohtsuki, K. Kohno, F. Tanabe, S. Ushio, M. Namba, T. Tanimoto, K. Torigoe, M. Fujii, M. Ikeda, et al 1996. Interferon--inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon- production. Eur. J. Immunol. 26:1647.[Medline]
12. Okamura, H., S.-I. Kashiwamura, H. Tsutsui, T. Yoshimoto, K. Nakanishi. 1998. Regulation of interferon- production by IL-12 and IL-18. Curr. Opin. Immunol. 10:259.[Medline]
13. Okumara, H., H. Tsutsui, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN- production by T cells. Nature 378:88.[Medline]
14. Dinarello, C. A., D. Novick, A. J. Puren, G. Fantuzzi, L. Shapiro. 1998. Overview of interleukin-18; more than an interferon- inducing factor. J. Leukocyte Biol. 63:658.[Abstract]
15. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, K. Kaneda. 1996. IFN--inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
16. Ushio, S., M. Namba, T. Okura, M. Hattori, Y. Nukada, K. Akita, F. Tanabe, K. Konoshi, M. Micallef, M. Fujii, et al 1996. Cloning of the cDNA for human IFN--inducing factor, expression in Escherichia coli, and studies on the biologic activity of the protein. J. Immunol. 156:4274.[Abstract]
17. Hoshino, T., R. H. Wiltrout, H. A. Young. 1999. IL-18 is a potent coinducer of IL-13 in NK and T cells: a new potential role for IL-18 in modulating the immune response. J. Immunol. 162:5070.[Abstract/Free Full Text]
18. Gu, Y., K. Kuida, H. Tsutsui, G. Ku, K. Hsiao, M. A. Fleming, N. Hayashi, K. Higashino, H. Okamura, K. Nakanishi, et al 1997. Activation of interferon- inducing factor mediated by interleukin-1ß converting enzyme. Science 275:206.[Abstract/Free Full Text]
19. Stoll, S., G. Mueller, M. Kurimoto, J. Saloga, T. Tanimoto, H. Yamauchi, H. Okamura, J. Knop, A. H. Enk. 1997. Production of IL-18 (IFN--inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159:298.[Abstract]
20. Udagawa, N., N. J. Horwood, J. Elliott, A. Mackay, J. Owen, H. Okamura, M. Kurimoto, T. J. Chambers, T. J. Martin, M. T. Gillespie. 1997. Interleukin-18 (IFN--inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colony-stimulating factor and not via interferon- to inhibit osteoblast formation. J. Exp. Med. 185:1005.[Abstract/Free Full Text]
21. Monteleone, G., F. Trapasso, T. Parrello, L. Biancone, A. Stella, R. Iuliano, F. Luzza, A. Fusco, F. Pallone. 1999. Bioactive IL-18 expression is up-regulated in Crohn’s disease. J. Immunol. 163:143.[Abstract/Free Full Text]
22. Pages, F., A. Berger, B. Henglein, B. Piqueras, C. Danel, F. Zinzindihoue, N. Thiounn, P. H. Cugnenc, W. H. Fridman. 1999. Modulation of interleukin-18 expression in human colon carcinoma: consequences for tumor immune surveillance. Int. J. Cancer 84:326.[Medline]
23. Tone, M., S. A. J. Thompson, Y. Tone, P. J. Fairchild, H. Waldmann. 1997. Regulation of IL-18 (IFN--inducing factor) gene expression. J. Immunol. 159:6156.[Abstract]
24. Bohle, B., B. Hahn-Schmid, D. Maurer, D. Kraft, C. Ebner. 1999. Oligodeoxynucleotides containing CpG motifs induce IL-12, IL-18 and IFN- production in cells from allergic individuals and inhibit IgE synthesis in vitro. Eur. J. Immunol. 29:2344.[Medline]
25. Pirhonen, J., T. Sareneva, M. Kurimoto, I. Julkunen, S. Matikainen. 1999. Virus infection activates IL-1ß and IL-18 production in human macrophages by a caspase-1-dependent pathway. J. Immunol. 162:7322.[Abstract/Free Full Text]
26. Kim, Y. M., H. S. Kang, S. G. Paik, K. H. Pyun, K. L. Anderson, B. E. Torbett, I. Choi. 1999. Roles of IFN consensus sequence binding protein and PU.1 in regulating IL-18 gene expression. J. Immunol. 163:2000.[Abstract/Free Full Text]
27. Elhofy, A., K. L. Bost. 1999. Limited interleukin-18 response in Salmonella-infected murine macrophages and in Salmonella-infected mice. Infect. Immun. 67:5021.[Abstract/Free Full Text]
28. Gorman, C. M., L. F. Moffat, B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044.[Abstract/Free Full Text]
29. Eklund, E. A., A. Jalava, R. Kakar. 1998. PU. 1, interferon regulatory factor 1, and interferon consensus sequence-binding protein cooperate to increase gp91^phox expression. J. Biol. Chem. 274:13957.
30. Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, M. Karin. 1987. Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729.[Medline]
31. Lay, J. D., C.-J. Tsao, J.-Y. Chen, M. E. Kadin, I.-J. Su. 1997. Up-regulation of tumor necrosis factor- gene by Epstein-Barr virus and activation of macrophages in Epstein-Barr virus-infected T cells in pathogenesis of hemophagocytic syndrome. J. Clin. Invest. 100:1969.[Medline]
32. Zhang, T., K. Kawakani, M. H. Qureshi, H. Okamura, M. Kurimoto, A. Saito. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of interferon by natural killer cells. Infect. Immun. 65:3594.[Abstract]
33. Kohno, K., J. Kataoka, T. Otsuki, Y. Suemoto, I. Okamoto, M. Usui, M. Ikeda, M. Kurimoto. 1997. IFN--inducing factor (IGIF) is a costimulatory factor on the activation of Th1, but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
34. Jouanguy, E., R. Doffinger, S. Dupuis, A. Pallier, F. Altare, J.-L. Casanova. 1999. IL-12 and IFN- in host defense against mycobacteria and Salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]
35. Puddu, P., P. L. Fantuzzi, P. Borghi, B. Varano, G. Rainaldi, E. Guillemard, W. Malorni, P. Nicaise, S. E. Wolf, F. Belardelli, S. Gessani. 1997. IL-12 induces IFN- expression and secretion in mouse peritoneal macrophages. J. Immunol. 159:3490.[Abstract]
36. Fenton, M. J., M. W. Vermeulen, S. Kim, M. Burdick, R. M. Strieter, H. Kornfeld. 1997. Induction of interferon production in human alveolar macrophages by Mycobacterium tuberculosis. Infect. Immun. 65:5149.[Abstract]
37. Di Marzio, P., P. Puddu, L. Conti, F. Belardelli, S. Gessani. 1994. Interferon- up-regulates its own gene expression in mouse peritoneal macrophages. J. Exp. Med. 179:1731.[Abstract/Free Full Text]
38. Munder, M., M. Mallo, K. Eichmann, M. Modolell. 1998. Murine macrophages secrete interferon upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation. J. Exp. Med. 187:2103.[Abstract/Free Full Text]
39. Xu, D., W. L. Chan, B. P. Leung, D. Hunter, K. Schulz, R. W. Carter, I. B. McInnes, J. H. Robinson, F. Y. Liew. 1998. Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J. Exp. Med. 188:1485.[Abstract/Free Full Text]
40. Weisz, A., P. Marx, R. Sharf, E. Appella, P. H. Driggers, K. Ozato, B.-Z. Levi. 1992. Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes. J. Biol. Chem. 267:25589.[Abstract/Free Full Text]
41. Kantakamalakul, W., A. D. Politis, S. Marecki, T. Sullivan, K. Ozato, M. J. Fenton, S. N. Vogel. 1999. Regulation of IFN consensus sequence binding protein expression in murine macrophages. J. Immunol. 162:7417.[Abstract/Free Full Text]
42. Scharton-Kersten, T., C. Contursi, A. Masumi, A. Sher, K. Ozato. 1997. Interferon consensus sequence binding protein-deficient mice display impaired resistance to intracellular infection due to a primary defect in interleukin 12 p40 induction. J. Exp. Med. 186:1523.[Abstract/Free Full Text]
43. Sharf, R., D. Merara, A. Azriel, A. M. Thornton, K. Ozato, E. F. Petricoin, A. C. Larner, F. Schaper, H. Hauser, B.-Z. Levi. 1997. Phosphorylation events modulate the ability of interferon consensus sequence binding protein to interact with interferon regulatory factors and to bind DNA. J. Biol. Chem. 272:9785.[Abstract/Free Full Text]
44. Lewis, M., E. P. Amento, E. N. Unemori. 1999. Transcriptional inhibition of stromelysin by interferon- in normal human fibroblasts is mediated by the AP-1 domain. J. Cell. Biochem. 72:373.[Medline]
45. Lee, K. S., Y. W. Rhoo, J. Y. Song. 1998. Interferon- up-regulates the stromelysin-1 gene expression by human skin fibroblasts in culture. Exp. Mol. Med. 30:59.[Medline]
46. Rubo, N.. 1999. Interferon- induces the expression of immediate early genes c-fos and c-jun in astrocytes. Immunology 91:560.
47. Nikitovic, D., A. Holmgren, G. Spyrou. 1998. Inhibition of AP-1 DNA binding by nitric oxide involving conserved cyteine residues in Jun and Fos. Biochem. Biophys. Res. Commun. 242:109.[Medline]

This article has been cited by other articles:

				V. Vila-del Sol, C. Punzon, and M. Fresno IFN-{gamma}-Induced TNF-{alpha} Expression Is Regulated by Interferon Regulatory Factors 1 and 8 in Mouse Macrophages J. Immunol., October 1, 2008; 181(7): 4461 - 4470. [Abstract] [Full Text] [PDF]

				Y. J. Kang, J. Chen, M. Otsuka, J. Mols, S. Ren, Y. Wang, and J. Han Macrophage Deletion of p38{alpha} Partially Impairs Lipopolysaccharide-Induced Cellular Activation J. Immunol., April 1, 2008; 180(7): 5075 - 5082. [Abstract] [Full Text] [PDF]

				M. Alter-Koltunoff, S. Goren, J. Nousbeck, C. G. Feng, A. Sher, K. Ozato, A. Azriel, and B.-Z. Levi Innate Immunity to Intraphagosomal Pathogens Is Mediated by Interferon Regulatory Factor 8 (IRF-8) That Stimulates the Expression of Macrophage-specific Nramp1 through Antagonizing Repression by c-Myc J. Biol. Chem., February 1, 2008; 283(5): 2724 - 2733. [Abstract] [Full Text] [PDF]

				J. Kim, Y. Shao, S. Y. Kim, S. Kim, H. K. Song, J. H. Jeon, H. W. Suh, J. W. Chung, S. R. Yoon, Y. S. Kim, et al. Hypoxia-induced IL-18 Increases Hypoxia-inducible Factor-1{alpha} Expression through a Rac1-dependent NF-{kappa}B Pathway Mol. Biol. Cell, February 1, 2008; 19(2): 433 - 444. [Abstract] [Full Text] [PDF]

				N. Dror, N. Rave-Harel, A. Burchert, A. Azriel, T. Tamura, P. Tailor, A. Neubauer, K. Ozato, and B.-Z. Levi Interferon Regulatory Factor-8 Is Indispensable for the Expression of Promyelocytic Leukemia and the Formation of Nuclear Bodies in Myeloid Cells J. Biol. Chem., February 23, 2007; 282(8): 5633 - 5640. [Abstract] [Full Text] [PDF]

				H. Xiong, H. Li, H. J. Kong, Y. Chen, J. Zhao, S. Xiong, B. Huang, H. Gu, L. Mayer, K. Ozato, et al. Ubiquitin-dependent Degradation of Interferon Regulatory Factor-8 Mediated by Cbl Down-regulates Interleukin-12 Expression J. Biol. Chem., June 24, 2005; 280(25): 23531 - 23539. [Abstract] [Full Text] [PDF]

				A. C. Morrison, C. B. Wilson, M. Ray, and P. H. Correll Macrophage-Stimulating Protein, the Ligand for the Stem Cell-Derived Tyrosine Kinase/RON Receptor Tyrosine Kinase, Inhibits IL-12 Production by Primary Peritoneal Macrophages Stimulated with IFN-{gamma} and Lipopolysaccharide J. Immunol., February 1, 2004; 172(3): 1825 - 1832. [Abstract] [Full Text] [PDF]

				M. Alter-Koltunoff, S. Ehrlich, N. Dror, A. Azriel, M. Eilers, H. Hauser, H. Bowen, C. H. Barton, T. Tamura, K. Ozato, et al. Nramp1-mediated Innate Resistance to Intraphagosomal Pathogens Is Regulated by IRF-8, PU.1, and Miz-1 J. Biol. Chem., November 7, 2003; 278(45): 44025 - 44032. [Abstract] [Full Text] [PDF]

				S. Cenci, G. Toraldo, M. N. Weitzmann, C. Roggia, Y. Gao, W. P. Qian, O. Sierra, and R. Pacifici Estrogen deficiency induces bone loss by increasing T cell proliferation and lifespan through IFN-{gamma}-induced class II transactivator PNAS, September 2, 2003; 100(18): 10405 - 10410. [Abstract] [Full Text] [PDF]

				N. Takeda, M. Arima, N. Tsuruoka, S. Okada, M. Hatano, A. Sakamoto, Y. Kohno, and T. Tokuhisa Bcl6 Is a Transcriptional Repressor for the IL-18 Gene J. Immunol., July 1, 2003; 171(1): 426 - 431. [Abstract] [Full Text] [PDF]

				J. A. Gracie, S. E. Robertson, and I. B. McInnes Interleukin-18 J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224. [Abstract] [Full Text] [PDF]

				H. Xiong, C. Zhu, H. Li, F. Chen, L. Mayer, K. Ozato, J. C. Unkeless, and S. E. Plevy Complex Formation of the Interferon (IFN) Consensus Sequence-binding Protein with IRF-1 Is Essential for Murine Macrophage IFN-gamma -induced iNOS Gene Expression J. Biol. Chem., January 17, 2003; 278(4): 2271 - 2277. [Abstract] [Full Text] [PDF]

				Y. Ito, I. Kawamura, C. Kohda, H. Baba, T. Nomura, T. Kimoto, I. Watanabe, and M. Mitsuyama Seeligeriolysin O, a Cholesterol-Dependent Cytolysin of Listeria seeligeri, Induces Gamma Interferon from Spleen Cells of Mice Infect. Immun., January 1, 2003; 71(1): 234 - 241. [Abstract] [Full Text] [PDF]

				J. Pirhonen, S. Matikainen, and I. Julkunen Regulation of Virus-Induced IL-12 and IL-23 Expression in Human Macrophages J. Immunol., November 15, 2002; 169(10): 5673 - 5678. [Abstract] [Full Text] [PDF]

				T. Kuwata, C. Gongora, Y. Kanno, K. Sakaguchi, T. Tamura, T. Kanno, V. Basrur, R. Martinez, E. Appella, T. Golub, et al. Gamma Interferon Triggers Interaction between ICSBP (IRF-8) and TEL, Recruiting the Histone Deacetylase HDAC3 to the Interferon-Responsive Element Mol. Cell. Biol., November 1, 2002; 22(21): 7439 - 7448. [Abstract] [Full Text] [PDF]

				J. C. M. Morel, C. C. Park, K. Zhu, P. Kumar, J. H. Ruth, and A. E. Koch Signal Transduction Pathways Involved in Rheumatoid Arthritis Synovial Fibroblast Interleukin-18-induced Vascular Cell Adhesion Molecule-1 Expression J. Biol. Chem., September 13, 2002; 277(38): 34679 - 34691. [Abstract] [Full Text] [PDF]

				K. A. Gauss, P. L. Bunger, and M. T. Quinn AP-1 is essential for p67phox promoter activity J. Leukoc. Biol., January 1, 2002; 71(1): 163 - 172. [Abstract] [Full Text] [PDF]

				S. Sugawara, A. Uehara, T. Nochi, T. Yamaguchi, H. Ueda, A. Sugiyama, K. Hanzawa, K. Kumagai, H. Okamura, and H. Takada Neutrophil Proteinase 3-Mediated Induction of Bioactive IL-18 Secretion by Human Oral Epithelial Cells J. Immunol., December 1, 2001; 167(11): 6568 - 6575. [Abstract] [Full Text] [PDF]

				R. Vankayalapati, B. Wizel, D. L. Lakey, Y. Zhang, K. A. Coffee, D. E. Griffith, and P. F. Barnes T Cells Enhance Production of IL-18 by Monocytes in Response to an Intracellular Pathogen J. Immunol., June 1, 2001; 166(11): 6749 - 6753. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kim, Y.-M. Articles by Choi, I. Search for Related Content PubMed PubMed Citation Articles by Kim, Y.-M. Articles by Choi, I.