| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Immunology, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Besides CD28, there is a second receptor for the B7 family of proteins called CTLA4 (CD152), which is up-regulated on the surface of T cells following an activation stimulus provided through the TCR and CD28 (6, 7). It is expressed at low levels but has a higher affinity for CD80 and CD86 than CD28. Current evidence from "knockout" mice (8) and in vitro studies (9) suggests that it is involved in suppressing the T cell response, functioning to limit lymphoproliferation (10).
Regions involved in binding to the B7 family have been identified in both CD28 and CTLA4. Of these, the conserved MYPPPY motif (position 97–102 in CTLA4) is perhaps the most important (11, 12), although structural analysis of soluble human CTLA4 indicates that a number of charged residues clustered around this motif may have equal importance for B7 binding (13). A high degree of CTLA4 sequence conservation in these regions forms the basis for considerable interspecies cross-reactivity, although no formal studies have been performed and no attempt to understand the MYPPPY region’s importance in this phenomenon has been made.
Our interest in the development of therapeutic strategies for xenotransplantation has led to the cloning and sequencing of the pig homologue of CTLA4 (pCTLA4).3 Compared with human CTLA4 (hCTLA4), there is a high degree of conservation in the predicted protein sequence, although significantly, leucine is substituted for methionine at position 97 in the MYPPPY motif. Because human and murine CTLA4-Ig have proved promising biological reagents for inhibiting T cell activation in a number of preclinical models (14, 15, 16, 17), and because porcine CD86 is known to costimulate human T cell activation (18, 19, 20), we constructed a fusion protein consisting of the extracellular regions of pCTLA4 linked to the hinge and CH2/CH3 regions of human IgG1 (pCTLA4-Ig). In view of the leucine for methionine substitution at position 97, we explored the possibility that this reagent may have a degree of species specificity. Our results confirm a significant degree of species specificity in the action of pCTLA4-Ig and suggest that it could prove a useful tool for dissecting the mechanisms of CTLA4 binding to B7, as well as a potentially important therapeutic reagent for use in clinical xenotransplantation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human M1 fibroblast cells expressing HLA-DR1 (M1.DR1) (21) were maintained in DMEM (Life Technologies, Paisley, U.K.) supplemented with 10% FCS (Globepharm Limited, Esher, U.K.) and 200 µg/ml G418 (Life Technologies). M1.DR1 cells expressing human CD80 (M1.DR1.hB7.1) (22) or porcine CD86 (M1.DR1.pB7.2) were maintained in DMEM, 10% FCS, 200 µg/ml hygromycin (Roche Diagnostic Systems, Lewes, East Sussex, U.K.), and 200 µg/ml G418. M1.DR1 cells expressing human CD86 (M1.DR1.hB7.2) were cultured in DMEM, 10% FCS, 500 µg/ml Zeocin (Invitrogen, San Diego, CA), and 200 µg/ml G418. F6 transformed porcine endothelial cells expressing HLA-DR1 (F6-DR1) (18) were cultured in DMEM, 10% FCS, 200 µg/ml G418, and MXH (6 µg/ml mycophenolic acid, 250 µg/ml xanthine, and 15 µg/ml hypoxanthine: all reagents from Sigma, Poole, U.K.). Human EBV transformed B cells expressing HLA-DR1 (WS/29), from the 10th International Histocompatibility Workshop, were cultured in RPMI 1640, 10% FCS. All media were supplemented with 2 mM L-glutamine and 100 µg/ml penicillin/streptomycin (both from Life Technologies).
Restriction endonucleases
All restriction enzymes used in this study were purchased from Roche Diagnostic Systems.
Cloning and sequencing of cDNA
For pCTLA4, total RNA was isolated from PHA-activated pig PBMC using TRI reagent (Sigma) and following manufacturer’s instructions. RT-PCR was performed over 35 cycles under the following conditions: melting at 94°C for 1 min, annealing at 58°C for 2 min, extension at 72°C for 3 min and a further 7 min at 72°C. Amplification was performed using Pfu DNA polymerase (Stratagene, La Jolla, CA). The 5' primer was a degenerate sequence based on human, mouse, and cattle CTLA4 and included a restriction site for HindIII. The 3' primer was based on 26 bases conserved across the 3 species with a short sequence containing an EcoRI site. Primer sequences were as follows: 5'-TTGAAGCTTAGCCATGGCTTGCTCTGGA and 3'-TAATGAATTCTCAATTGATGGGAATAAAATAAG. The resulting 700-bp fragment was subcloned into HindIII/EcoRI of pBluescript (Stratagene) and the nucleotide sequence determined using standard T3 and T7 primers.
Human and porcine CD86 were PCR-cloned using primers based on the GenBank sequences (accession nos. L25259 and L76099, respectively). The sequences were found to be identical with previously published data (23, 24). The cDNA for human CD86, within the vector pcDNA3.1Zeo (Invitrogen), was transfected into M1.DR1 cells by calcium phosphate coprecipitation. The cDNA for porcine CD86, within the vector pCIneo (Promega, Southampton, U.K.), was cotransfected with the hygromycin resistance vector pREP 10 (Invitrogen) into M1.DR1 cells using the same method.
Cloning of the extracellular regions of pCTLA4 and construction of pCTLA4-Ig
DNA encoding the hinge CH2 and CH3 regions of human IgG1 (25, 26) was a kind gift from Dr. Clive Landis (Department of Cardiovascular Medicine at Imperial College School of Medicine). This was spliced into the PstI and NotI cloning sites of pBluescript. The extracellular regions of pCTLA4 were PCR-amplified using a sequenced clone of pCTLA4 as a template. The same 5' primer was used as for the full-length sequence. The 3' primer was based on 33 bases coding for 11 amino acids immediately adjacent to the transmembrane region, linked to 15 bases coding for a flexible linker of sequence GlyGlySerGlyGly and a short series encoding a restriction site for PstI. The full sequence was as follows: CGGTTCTGCAGCACCACCGGAGCCACCATCAGAATCTGGGCATGGTTCTGGATCAATGAC. PCR was performed over 30 cycles using the Expand High Fidelity system (Roche Diagnostic Systems). Melting, annealing, and extension were performed at 94°C (1 min), 64°C (2 min), and 72°C (3 min), respectively. The product was cut 5' and 3' with HindIII and PstI and ligated into the cloning site of the IgG-containing pBluescript described above, immediately 5' to the hIgG1 regions. The resulting insert of 1631 bp was sequenced by MWG Biotech (Milton Keynes, U.K.) using standard M13 primers and two internal primers of our own. The sequences of these primers were based on the predicted sequence of the pCTLA4-Ig construct. Sequences were: 5'-CACATGCCCACCGTGCCCAGGTAAG and 3'-GGCCCTCGCACCCCACGGGTCCCAC annealing to pCTLA4-Ig at positions 541–565 and 1009–1033, respectively.
The construct was digested with SalI and NotI and subcloned into mammalian expression vector pCIneo. Chinese hamster ovary (CHO) K1 cells (American Type Culture Collection, Manassas, VA) were transfected with 10 µg of DNA by electroporation at 300 V. They were cultured for 24 h before being selected in medium containing 1 mg/ml G418. Colonies began to appear within a week, and cells were cloned within 2 wk.
Identification of pCTLA4-Ig-secreting CHO K1 clones
Clones were grown to confluence in CHO SFM II medium (Life Technologies) supplemented with 0.5% FCS. Supernatants from clones were con-centrated 5–10 times and probed for the presence of pCTLA4-Ig on a dot blot. Briefly, 2 ml of supernatant per clone was dotted onto a nitrocellulose filter and incubated for 1 h at room temperature. The filter was washed three times in PBS/0.01% Tween 20 and blocked overnight at 4°C with PBS/0.01% Tween 20 and 2% powdered milk. The filter was washed the following day and probed with a mouse anti-human IgG1 polyclonal Ab conjugated to HRP (Binding Site, Birmingham, U.K.). After three additional washes, the filter was incubated with Pierce Supersignal (Pierce and Warriner, Chester, U.K.). Hyperfilm ECL (Amersham Life Science, Little Chalfont, U.K.) was exposed to the blot for 10 s before being developed.
Purification of pCTLA4-Ig
pCTLA4-Ig-secreting clones were grown in multilayer tissue culture flasks (Helena Biosciences, Sunderland, U.K.). Upon reaching confluence, the culture supernatant was harvested and replaced with fresh medium. This medium was left on the cells for 3 days before being harvested. pCTLA4-Ig was purified from both sets of supernatants by incubation with protein G-coated Sepharose beads (Pharmacia Biotech, St. Albans, U.K.). Fusion protein was eluted as per manufacturer’s instructions. The concentration of protein in the eluate was determined by either absorbance at 280 nm or by protein assay (Bio-Rad, Hemel Hempstead, U.K.) following manufacturer’s instructions.
Staining of cell lines with pCTLA4-Ig
Cells at 106/ml were incubated with pCTLA4-Ig, hCTLA4-Ig (R&D Systems, Abingdon, U.K.), murine CTLA4-Ig (R&D Systems), or a human IgG1 control Ab (Sigma) for 45 min on ice. Cells were washed with PBS supplemented with 2% FCS. Sheep anti-human IgG (Fc-specific) FITC (Binding Site) was used as a second layer. Acquisition and analysis were performed on a Coulter EPICS with XL2 software (Coulter, High Wycombe, U.K.). Fluorescence was measured on a log scale, and data were expressed as mean fluorescence intensities.
Purification of CD4+ T cells
Peripheral blood was isolated from healthy volunteers. PBMC were purified by centrifugation through Lymphoprep (Nycomed, Oslo, Norway). After washing in PBS, the PBMC were adhered to plastic for 1 h. Nonadherent cells were gently washed off with warm RPMI 1640/10% FCS and incubated on ice for 20 min with an Ab mixture consisting of L243, a mouse monoclonal specific for HLA-DR; OKT8, a mouse monoclonal specific for human CD8 (both Abs from the American Type Culture Collection); NKH1 (Coulter) and anti-human Ig (Sigma). After this period, the cells were washed to remove excess Ab and incubated with sheep anti-mouse-conjugated Dynabeads (Dynal, Bromborough, U.K.). After two Dynabead depletions with end-over-end rotation, the cells were once more incubated with L243 and OKT8 and treated with rabbit complement (Cedarlane Laboratories, Hornby, Canada) for 45 min.
Proliferation assays
M1.DR1 transfectants, immortalized porcine endothelial cell clones, or human EBV+ B cell lines were treated with 60 µg/ml mitomycin C (Kyowa, Tokyo, Japan) and cultured in 96-well plates (Helena Biosciences) at 5 x 104 per well (105 per well for B cells). A total of 105 CD4+ T cells per well were incubated with the stimulator populations. In some experiments, human or porcine CTLA4-Ig was included in the assay on day 0 (range of concentrations, 0.0048–20 mg/ml). Cells were left in culture for 5 days before being pulsed for 18 h with [3H]thymidine (Amersham Life Science) at 0.5 µCi per well.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
pCTLA4 was amplified by RT-PCR from total RNA as reported above. Eight separate clones were sequenced and found to be identical. The sequence has been submitted to GenBank and has the accession no. AF220248. The degenerate 5' primer overlapped with the signal sequence and the 3' primer was based on a sequence that, whereas conserved in the three species used to design the primer, may not be retained in the pig. Consequently, primer annealing sites were excluded from calculations of homology.
Fig. 1
A shows the predicted
protein sequence of porcine CTLA4 aligned to those from all other
species submitted to GenBank. There is 87.6% homology to human
(27) and 77% to mouse CTLA4 (28). The
intracellular region is completely conserved across all species. Five
conserved extracellular cysteines are also retained in the porcine
sequence. Compared with the human sequence, substitutions occur in the
complementarity-determining region (CDR)-1 and -2-like regions
described by Peach and coworkers (11), as they do in the
sequences from all other species. However, the most interesting
difference between porcine CTLA4 and all other CTLA4s is the
substitution in the CDR3-like region at position 134 (position 97 in
the mature protein) of a leucine for the normally conserved methionine
of the MYPPPY sequence.
|
A single clone, PORC3 was used as a template to generate
pCTLA4-Ig. The extracellular regions of pCTLA4 were amplified as
reported above. These were then spliced into a pBluescript construct
containing hIgG1 constant regions, and sequenced. Fig. 1
B is
a diagram showing the CTLA4 and hIgG1 regions. The pCTLA4 sequence
matched exactly the cDNA cloned in the previous section. The full
construct was then spliced into pCIneo for transfection into
CHO K1 cells. Supernatant from transfected cells was tested by dot
blot, and several clones were found to produce protein-bearing hIgG1-Fc
regions. Supernatant from one clone was used as a source for pCTLA4-Ig.
Stocks of protein were purified, with concentrations ranging from 174
to 320 µg/ml of eluate. Total protein recovered was 
1.3 mg from 1
liter of culture medium. SDS-PAGE conducted under reducing and
nonreducing conditions indicated that the protein was, at 40 kDa, of
a similar size to hCTLA4-Ig and like that protein formed a homodimer
(data not shown).
pCTLA4-Ig and hCTLA4-Ig have similar avidity for porcine CD86; however, pCTLA4-Ig binds poorly to human CD80 and CD86
To investigate whether sequence differences between pig and human CTLA4 could influence binding to pig and human B7, we stained a variety of B7-expressing cell lines with hCTLA4-Ig and pCTLA4-Ig. First, human transformed fibroblasts (M1) expressing HLA-DR1 were transfected with pCD86 or hCD86. M1.DR1 cells expressing hCD80 have already been described (22). Next, pCTLA4-Ig, hCTLA4-Ig, or mCTLA4-Ig were titrated onto each cell population at 1:4 serial dilutions from 80 µg/ml downwards. Control cells from the same background were incubated with a human IgG1 myeloma protein.
Fig. 2 shows representative staining
results for M1.DR1.pB7.2, M1.DR1.hB7.1, and M1.DR1.hB7.2. From Fig. 2A, both human and porcine CTLA4-Ig bound pCD86 to a similar
extent. As expected, hCTLA4-Ig also bound to hCD80 and hCD86 with high
avidity (Fig. 2, B and C). In comparison,
pCTLA4-Ig displayed a poor avidity for hCD80, such that saturation was
never achieved, even with 374 µg/ml pCTLA4-Ig (neat stock) (data not
shown). From this, it is predicted that pCTLA4-Ig will need to be
at a concentration of 1 mg/ml before it fully saturates CD80 on
M1.DR1.hB7.1. This is 1000 times the concentration of hCTLA4-Ig
required to saturate the same receptor. The avidity of pCTLA4-Ig for
CD86 is also clearly weaker than that of hCTLA4-Ig. B7-negative M1.DR1
cells bound neither human nor porcine CTLA4-Ig (data not shown).
|
A). In contrast, mCTLA4-Ig bound better than
pCTLA4-Ig to hCD80 (Fig. 2B) and hCD86 (Fig. 2C).
Murine CTLA4 has a lower homology to human CTLA4 than does porcine
CTLA4 (Fig. 1). In particular, homology to the human sequence within
CDR1 and CDR2-like regions is lower than that of the pCTLA4. However,
the CDR3-like region, including the MYPPPY motif, is fully conserved
between mouse and human. All three sequences share the important
surface residues identified by Metzler et al. (13). Given
these facts, the experiments reported here provide indirect evidence
for the importance of the methionine to leucine substitution at
position 97 in determining the relatively weak binding of pCTLA4-Ig to
human B7.
The transfectants used in these experiments had been selected for B7
expression and consequently expressed supraphysiological levels.
Therefore, in a second series of experiments, HLA-DR1-transfected
porcine endothelial cells (F6-DR1), and a human EBV-transformed
endothelial cell line (WS/29) were used as models of APCs with
"physiological" levels of B7 (10-fold less than the B7
transfectants on direct flow cytometric comparison; data not shown).
The cells were stained in the same fashion as the B7 transfectants. The
results are shown in Fig. 3. hCTLA4-Ig
stained F6-DR1 as efficiently as pCTLA4-Ig (Fig. 3A). In
contrast, pCTLA4-Ig failed to bind to WS/29 (Fig. 3B), even
though this clone expresses both hCD80 and hCD86 as assessed by flow
cytometric analysis (data not shown). This highlights the very low
avidity of pCTLA4-Ig for human B7 ligands.
|
To determine whether the differences in avidity between human and
porcine CTLA4-Ig resulted in functional differences on T cell priming,
we compared human CD4+ T cell responses to the
cell lines described in the presence of human or porcine CTLA4-Ig. The
results are shown in Figs. 4 and 5.
|
|
A). As expected,
hCTLA4-Ig also fully inhibited responses costimulated by hCD80 and
hCD86. However, blocking by pCTLA4-Ig was weak (Fig. 4, B
and C). Minimal inhibition of the response to M1.DR1.hB7.1
was seen only at the highest concentrations used (Fig. 4B)
and no blocking of the response to M1.DR1.hB7.2 was seen (Fig. 4C), even though the highest concentration used in the
proliferation assays gave significant binding to the transfectants
expressing hCD80 and hCD86.
Fig. 5 shows comparable results using WS/29 and F6-DR1 as stimulator
cells. Both human and porcine CTLA4-Ig inhibited the proliferation
response to F6-DR1. However, responses stimulated by WS/29, which could
be effectively blocked by hCTLA4-Ig, showed almost no inhibition with
pCTLA4-Ig. Titration of control human IgG1 into cultures of the above
cells resulted in no inhibitory effect (data not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Analysis of the cDNA and predicted protein sequences revealed considerable identity to the human and murine molecules. However, the normally highly conserved MYPPPY motif, involved in B7 binding, was not fully conserved in the porcine sequence. We found that the methionine at position 97 of the mature peptide was replaced by leucine in the predicted sequence for pCTLA4. To our knowledge, this is the first time the LYPPPY motif has been identified in a CTLA4 sequence, although it has previously been reported in the CD28 sequences of cattle and sheep (29, 30).
This region has been described to be important for binding to B7, although the precise consequence of mutational substitution at position 97 is still unresolved. Morton and colleagues (12) found that a mutation to alanine at position 97 completely abolished binding to CD86, whereas CD80 binding was left intact. In contrast, Peach et al. (11) found that the same mutation resulted in significant loss of binding to CD80. The same group found that alterations in the CDR1-like region could also affect binding to CD80.
More recent analysis of the structure of soluble human CTLA4 revealed that the MYPPPY-CDR3 region was located on the A'GFCC' face of the molecule, named after the ß-strands making up this facet. Mutation of other residues on this facet, besides MYPPPY, resulted in significant loss of binding to CD80, CD86, or both in studies by Metzler et al. (13). Therefore, the B7 binding site on CTLA4 is currently thought to consist of these highly conserved residues on the A'GFCC' face.
Our results, though not directly addressing the role of substitions in these regions, demonstrate that the limited sequence differences in pCTLA4 severely compromise the interactions with human CD80 and CD86 while maintaining apparently normal binding characteristics to porcine CD86. By comparing the binding of murine, human, and pig CTLA4-Ig, we have provided indirect evidence supporting the hypothesis that it is the substitution of leucine at position 97 which results in the weak binding of pCTLA4-Ig to human B7 molecules. There are three factors that point to this substitution as the crucial determinant of this differential binding. First, the leucine at position 97 is the only difference between the CDR3 region sequences of porcine and human or murine CTLA4. Second, the CDR1 and CDR2 region sequences of mCTLA4 are more different to human than pig is to human, but mCTLA4-Ig binds more avidly than pCTLA4-Ig to human CD80 and CD86. Finally, the charged residues on the A'GFCC' face are conserved across all three different species sequences, ruling out differences here as the cause of differential binding.
Interestingly, hCTLA4-Ig was at least as effective as pCTLA4-Ig in binding and inhibiting responses to pCD86. This suggests that leucine at position 97 is not crucial for CTLA4 interaction with pCD86. A full investigation of the possible role of the leucine substition in the abrogation of pCTLA4-Ig binding to human B7, and of the regions important for interaction with CD86, will require mutational analysis of key residues in the pig sequences and the production of mutant pCTLA4-Ig and pCD86 molecules for binding studies.
Besides having academic interest, these results may have therapeutic
implications. The human cell-mediated response is likely to be a major
barrier to the long-term acceptance of porcine xenografts. Perhaps the
first donor cells to be encountered by host T cells entering a
vascularized xenograft will be endothelial cells. Porcine endothelial
cells are constitutively MHC class I+ and express
MHC class II after IFN-
treatment. In addition, pECs constitutively
express B7 (19). Our group and others have found
MHC+, B7-expressing pECs to be efficient
stimulators of human T cell responses (18, 19, 20). The
persistence of endothelial cells within the tissue and their expression
of B7 suggests that porcine xenografts will retain their direct
immunogenicity for the whole period of residency within the
host.
Recent experience of porcine xenograft transplantation into primate recipients indicates that acute T cell-mediated rejection can be prevented, at least in the initial period (2–3 mo) after transplantation, using systemic immunosuppressive drugs (data presented by Imutran at 5th International Congress on Xenotransplantation, Nagoya, Japan, October 1999). However, the immunosuppressive protocols currently employed to prevent rejection of human allografts are clearly inadequate at preventing porcine xenograft rejection: a greater degree of immunosuppression is required, and this is thought to be due to the vigorous anti-pig-specific human T cell response (31, 32). Consequently, safer alternative protocols for suppressing host T cell responses will be needed if clinical xenotransplantation is to match the success of clinical allotransplantation.
Human CTLA4-Ig has successfully inhibited T cell responses in a variety of experimental models, and has been shown to induce long-term donor-specific tolerance to both allo- and xenografts (14, 15, 16, 17). In most of these models, the fusion protein was administered over a short period around the time of transplantation. However, most of the grafts showing enhanced survival will have lost their direct immunogenicity shortly after transplantation due to the migration of passenger leukocytes. In vascularized porcine grafts, where endothelial cells will continue to express B7, there will be no natural means of tolerance induction, and costimulatory blockade may need to be maintained for a substantially longer period to ensure effective suppression of the direct xenoresponse. Such long-term treatment with hCTLA4-Ig may be undesirable, as hCTLA4-Ig has the potential to behave as a systemic immunosuppressant and may block normal host immune interactions. Given the concern about cross-species transmission of pathogens, recipient immune compromise is particularly undesirable. A more acceptable reagent would be graft-specific, targeting only those interactions with the transplanted tissue. Our results suggest that pCTLA4-Ig may be effective in inhibiting direct, graft-specific T cell responses while leaving the normal human T cell response largely intact.
Although more work needs to be done to determine the precise residues of CTLA4 involved in B7 binding, our studies with porcine CTLA4-Ig suggest that a methionine at position 97 in CTLA4 is important for binding to human B7. Because it has a leucine substitution at this position, porcine CTLA4-Ig may be a useful tool to continue investigating these interactions, as well as being a potential therapeutic agent for use in clinical xenotransplantation.
|
Footnotes |
|---|
2 Address correspondence and reprint request to Dr. Anthony Dorling, Department of Immunology, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London, W12 0NN, U.K.
3 Abbreviations used in this paper: pCTLA4, pig homologue of CTLA4; hCTLA4, human CTLA4; CHO, Chinese hamster ovary; CDR, complementarity-determining region.
Received for publication February 3, 2000. Accepted for publication June 21, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  V. Mirenda, D. Golshayan, J. Read, I. Berton, A. N. Warrens, A. Dorling, and R. I. Lechler Achieving Permanent Survival of Islet Xenografts by Independent Manipulation of Direct and Indirect T-Cell Responses Diabetes, April 1, 2005; 54(4): 1048 - 1055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Lan, L. Wang, B. Diouf, H. Eguchi, H. Su, R. Bronson, D. H. Sachs, M. Sykes, and Y.-G. Yang Induction of human T-cell tolerance to porcine xenoantigens through mixed hematopoietic chimerism Blood, May 15, 2004; 103(10): 3964 - 3969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. E. Vincent, C. P. Carrasco, B. Herrmann, B. M. Meehan, G. M. Allan, A. Summerfield, and K. C. McCullough Dendritic Cells Harbor Infectious Porcine Circovirus Type 2 in the Absence of Apparent Cell Modulation or Replication of the Virus J. Virol., December 15, 2003; 77(24): 13288 - 13300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Vasu, A. Wang, S. R. Gorla, S. Kaithamana, B. S. Prabhakar, and M. J. Holterman CD80 and CD86 C domains play an important role in receptor binding and co-stimulatory properties Int. Immunol., February 1, 2003; 15(2): 167 - 175. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or human (
), porcine (
),
or murine CTLA4-Ig (•) were titrated onto M1. DR1.pB7.2
(A), M1. DR1.hB7.1 (B), or M1. DR1.hB7.2
(C). Representative of three analyses.
