|
|
||||||||



*
Immunology Program, Memorial Sloan-Kettering Cancer Center, and
Joan and Sanford Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021; and
Department of Microbiology and Immunology, University of Maryland School of Medicine, Baltimore, MD 21201
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
mutant thymocytes arrest
at the CD4+8+
(double-positive (DP)) stage of development (3), and
TCR-
gene recombination occurs in DP cells (7). Taken
together, these types of studies implicate TCR gene recombination and
expression in the induction of thymocyte differentiation. In addition to a proposed role in differentiation, pre-TCR expression has recently been implicated in the induction of mitogenesis in cells at the DN to DP transition (8, 9, 10). In these studies it was shown that the blast component of cells undergoing TCR-ß recombination is enriched in cells with in-frame rearrangements, and that this blast population is reduced in cells that cannot express TCR-ß. These findings have been interpreted to show that pre-TCR expression induces mitogenesis at the DN to DP transition. However, it is important to note that these findings, as well as those correlating pre-TCR expression with differentiation, can be equally well explained by proposing that expression of this receptor is required for the survival of cells undergoing blast transition at the DP stage, but does not play a direct role in their differentiation or proliferation. In the experiments presented here we test this latter hypothesis. We found that control of mitogenesis and differentiation occur independently of TCR-ß gene recombination and pre-TCR expression, suggesting that the pre-TCR serves to mediate a classical cell survival/cell death checkpoint during T cell development.
| Materials and Methods |
|---|
|
|
|---|
Wild-type C57BL/6 mice, p53-deficient mice (C57BL/6J-Trp53tm1Tyj), and TCR-ß-deficient mice (C57BL/6J-Tcrbtm1 Mom) were initially obtained from The Jackson Laboratory (Bar Harbor, ME); RAG-2-deficient mice (B6.SJL-ptprca) were initially obtained from Taconic Farms (Germantown, NY). Mice used in these studies were bred under specific pathogen-free conditions at the Memorial Sloan-Kettering Cancer Center (New York, NY). Mice were generally used at 46 wk of age. For the establishment of stable bone marrow chimeras, mice were given a sublethal dose (6 Gy) of irradiation, followed by i.v. administration of a mixture of RAG-2-deficient and normal marrow (4:1 ratio). Chimeras were allowed to recover for 23 mo before analysis.
Flow cytometric analysis and cell sorting
Enrichment and cell sorting were performed as previously described (8). Purified thymocyte populations were DN3, CD4-8-24+25+44low and pre-DP, CD4low8low24+25-44low. Lymph node B cells were identified as being CD24+. Analysis of DNA content was generally performed as previously described (8), except for analysis of proliferative status in bone marrow chimeras. In this case, chimeric thymuses were first depleted of CD4+8+ cells, followed by staining for CD90.2(Thy-1.2)-FITC, CD25-PE, and CD44-CyChrome. Stained cells were fixed in formaldehyde followed by permeabilization with detergent, and DNA content was analyzed using DAPI fluorescence on an LSR two-laser cytometer (Becton Dickinson, Mountain View, CA). Cell cycle distributions were confirmed using two standard algorithms (Watson and Dean-Jett-Fox), and the average values are presented.
Genomic DNA preparation and Southern blotting
Genomic DNA was prepared in low melting point agarose as
previously described (7). Purified DNA was digested with
ApaLI and SacI, followed by electrophoresis in
0.8% agarose and transfer to nylon membranes. Probe 5'Dß1 (460 bp)
was synthesized by amplification of C57BL/6 kidney DNA using the
following primers (5'-3'): forward, gagggatccaccgttctaagaagt; and
reverse, ggcggatcctcccataggtcta. The DNA loading probe is an intronic
sequence located 3' of the C
locus as previously described
(7). Quantitation of gene rearrangement was performed as
previously described (7); in the present case,
percent hybridization was calculated by the formula
([Xt
(Cg/Ct)]/(Xg)
x 100, where C represents the intensity of the DNA loading
band, X represents 5'Dß1 intensity, and g or
t represents germline or thymocyte samples,
respectively.
| Results |
|---|
|
|
|---|
TCR-ß recombination initiates in DN3 cells
(CD4-8-25+44low)
(6, 7), and only cells that make in-frame TCR-ß joints
are found in the proliferating DP compartment (pre-DP,
CD4low8low25-44low)
(8, 11, 12). Cells with in-frame TCR-ß joints are also
enriched in the blast component of DN3 cells (9), leading
to the widely held conclusion that TCR-ß/pre-TCR induces
proliferation as well as differentiation at this stage
(13). If in-frame TCR-ß recombination is a prerequisite
for proliferation and transition to the DP stage, then the amount of
V-DJß gene rearrangement must be similar in blast DN3 and early DP
cells. Previous data from our laboratory suggested that this was not
the case (8). However, analysis of the complete sequence
of the TCR-ß locus (GenBank accession no. AE000663-665) reveals that
the excised products of most V-DJß rearrangements (26 of a possible
28) could not be distinguished from chromosomal DNA using the previous
strategy. Because the stability of these excised products
(14) could have caused them to influence our measurements,
a method was devised to discriminate between target sequences on
chromosomal DNA and those on extrachromosomal products of V-DJß
recombination. This approach exploits the de novo formation of a novel
ApaLI site after religation of recombination signal
sequences (RSS) in excised recombination products (15) and
is depicted in Fig. 1
. A probe
hybridizing upstream of Dß1 (designated 5'Dß1) recognizes a 4.7-kb
fragment after ApaLI/SacI digestion of
unrearranged (germline) DNA. Partial (D-J) rearrangements between Dß1
and any member of the Jß1 cluster (Jß 1.1-1.6) yields six
progressively shorter fragments corresponding to deletion of the
intervening DNA, but still flanked by germline
ApaLI/SacI sites. Partial rearrangements between
Dß1 and the second Jß cluster (Jß 2.1-2.7) yield fragments larger
than the germline ApaLI/SacI fragment. Most
importantly, rearrangement of any Vß to Dß1 results in the
production of a nongermline-encoded fragment, flanked by the
germline-encoded ApaLI site upstream (ApaLI
151353; Fig. 1
) and by a newly formed ApaLI site downstream
(ApaLI de novo) of the probe site. Because this band is only
present after V-DJß recombination, the levels of unrearranged vs
rearranged TCR-ß loci in DN3 thymocytes can be unambiguously assessed
using this assay.
|
4-fold higher than our previous estimate of
complete rearrangements (8), reflecting the inability of
the former approach to discriminate target sequences persisting on
extrachromosomal circles, as described above. Nonetheless, large DN3
cells were found to differ substantially from early DP cells that have
surpassed the ß-selection point (11). Most informative
is the clear presence of germline TCR-ß genes in both small and large
DN3 cells, which becomes nearly undetectable in post-ß-selection
pre-DP (Fig. 1Mitogenic activity in DN cells does not correlate with the frequency of pre-TCR expression
To further assess the role of TCR-ß in the mitogenic process, we
analyzed the proliferative status of thymocytes from mice lacking one
or both TCR-ß alleles (2). DN3 cells from normal mice
(two intact TCR-ß alleles) have a 56% probability of generating a
productive (in-frame) TCR-ß gene (reviewed in Ref. 17),
while the probability of success in mice with a single allele
(F1[wild-type x homozygous mutant]) is reduced
to 33%. If DN3 proliferation correlates with productive gene
recombination (9), a decrease in the proportion of cells
with productive rearrangements should lead to a corresponding decrease
in the proliferative index. Thus, the DN3 population from mice with a
single TCR-ß allele should have a 40% reduction in blast cells
(33/56%) over that in mice with two alleles. However, the data in Fig. 2
clearly show that proliferative indexes
are indistinguishable in DN3 cells from these two types of mice
(p > 0.5, by Students t test for
independent samples). In contrast, homozygous mutant mice (0%
probability of successful recombination) show substantially reduced
levels of proliferation, consistent with previously published results
(8, 9, 10). With respect to this latter difference, it is
important to note that in addition to the absence of TCR proteins, a
large number of other components are absent from homozygous mutant
thymuses. For instance, also missing are defined cortical and medullary
zones and most of their respective cellular and interstitial elements,
including DP and SP cells, the interdependent nonlymphoid stroma
(18), and all the factors produced by these cells
(cytokines, extracellular matrix proteins, etc.). In virtually all
developing tissues and organisms, such spatial and contextual
interactions are absolutely critical for the success of normal
proliferation and differentiation. In the experiments described in the
next sections we show that the presence of a normal thymic
microenvironment is essential for the regulation of cell proliferation
during T cell development, while the pre-TCR is dispensable for this
process.
|
It is intuitive that the presence of a normal thymus is
indispensable for normal lymphopoiesis and homeostasis. Consequently,
it is also predictable that gross disruption of thymic architecture and
composition could result in numerous secondary effects on these
processes. Decreased proliferation in TCR-deficient thymocytes is
generally interpreted to mean that pre-TCR signals are required to
induce proliferation. This conclusion is based on the assumption that
the responses to pre-TCR deficiency are completely cell autonomous.
However, given the severe disruptions in thymic composition that result
from TCR deficiency, it is likely that cells derived from mutant
thymuses may experience numerous secondary effects. To distinguish cell
autonomous, pre-TCR-mediated influences from the secondary effects of
thymic dysplasia, chimeric mice were constructed using RAG-2-deficient
bone marrow transplanted into normal Thy-1 congenic recipients
(B6.PL-Thy1a). After a return to steady state
(>6 wk), thymuses from such mice contained normal numbers and
proportions of cells as well as defined cortical and medullary regions
(data not shown). A substantial proportion of DN cells from such mice
were RAG-deficient cells (Thy-1.2+; Fig. 3
A) that had developed in an
otherwise normal environment. The presence of DN3 blasts was analyzed
in the RAG-deficient thymocytes from such chimeras vs those derived
from dysplastic RAG-deficient hosts (Fig. 3
B). As previously
reported (8, 9, 10), DN3 thymocytes from RAG-deficient hosts
showed a reduction in the number of blast cells, as well as an overall
decrease in cell size, compared with wild-type controls (Fig. 3
B, artificial mixture). However, RAG-deficient DN3 cells
developing in a normal (chimeric) thymic environment showed essentially
no differences in either overall size or blast cell proportion controls
(Fig. 3
B, chimeric mixture). The proliferative status of
RAG-deficient blast cells is further characterized by the data
presented in Fig. 3
C, which show that cell cycle
distribution (DNA content) is restored to nearly normal levels when
such cells develop in a normal thymus. Together with the data in Figs. 1
and 2
, these findings show that reduced proliferation in
TCR-deficient DN3 cells does not directly reflect lack of signaling
through the pre-TCR, but, rather, is a secondary effect of
disrupted organ development. These findings further imply that the
signals that regulate proliferation of DN thymocytes derive from the
cellular constituents that comprise a normal thymus, from their
organization, or (most likely) from both.
|
As outlined in the introduction, pre-TCR-induced signaling late in
DN development is thought to induce both differentiation into the DP
stage and sustained proliferative expansion of the early DP pool. The
data presented in
Figs. 13![]()
![]()
show that DN proliferation does not
require pre-TCR expression, but, rather, is induced by non-TCR-mediated
influences originating from a normal thymic microenvironment. To
determine whether pre-TCR is required for the induction of
proliferation in the early DP pool, we evaluated proliferative indexes
in thymocytes from RAG-2/p53 double-mutant mice. It has been shown that
thymocytes from such mice are able to progress to the DP stage despite
the absence of pre-TCR expression, although DP cells do not
accumulate in normal numbers (19), suggesting that
p53-inducible genes may be involved in the elimination of cells with
sterile TCR-ß gene rearrangements. Thus, in addition to showing that
the absence of cell death is sufficient to allow DN cells to
differentiate into DP, this model provides an opportunity to evaluate
mitogenesis at the DN/DP transition in the absence of TCR-mediated
signals. The results of such an analysis are shown in Fig. 4
. As was the case for normal thymocytes
(8), transition from the DN to the DP stage is associated
with a 3-fold increase in the mitogenic index in RAG-2/p53-deficient
thymocytes. This up-regulation of mitogenic activity was not associated
with cellular transformation due to p53 deficiency, because mature DP
cells (CD4high8high)
withdraw from the cell cycle normally in these mice (Fig. 4
B). This experiment shows that, similar to our findings
with DN cells (
Figs. 13![]()
![]()
), pre-TCR expression is not required for
proliferative expansion in early DP cells
(CD4low8low25-44low).
Together, the data presented in
Figs. 14![]()
![]()
![]()
show that control of
mitogenic activity in DN cells, in DP cells, and at the DN/DP
transition occurs independently of TCR-ß gene recombination and
pre-TCR expression and requires as yet undefined signals from the
thymic microenvironment. The inability of RAG-2/p53-deficient DP
thymocytes to accumulate in substantial numbers (Fig. 4
A)
(19) further suggests that although the absence of p53
activity may be sufficient to permit the transient survival of cells at
the DN/DP transition, pre-TCR expression is required for prolonged
survival at the DP stage of development, consistent with the findings
of others (20).
|
| Discussion |
|---|
|
|
|---|
The uncoupling of proliferation and differentiation from pre-TCR
signaling raises the question of the functional role of this molecule.
One interpretation that can reconcile the findings presented in this
manuscript with all previously published data (2, 3, 4, 5, 8, 9, 10) is that the pre-TCR fulfills a classical
developmental checkpoint role in thymocytes at the DN/DP transition. In
this model, DN3 blasts would include two distinct populations of cells.
One population would be dividing, nondifferentiating cells that
proliferate to expand the precursor pool (i.e., self-replicating cell
division). These may include cells with D-J rearrangements only, as
well as cells with a single V-DJ-rearranged allele (in-frame or
out-of-frame). The quantitative data presented in Fig. 1
D
together with the findings of others (reviewed in Ref. 16)
suggest that DN3 cells probably only undergo one such self-replicating
cell division before differentiating into the DP stage. The remaining
DN3 blasts would represent proliferating cells that have been induced
to differentiate into the DP stage. At this point, cells that have made
productive TCR-ß gene rearrangements and express the pre-TCR would
possess a full complement of biochemical signals, thus allowing them to
survive, continue proliferating, and replenish the DP compartment.
Cells with out-of-frame rearrangements would simultaneously receive the
same mitogenic and differentiative signals, but would fail to survive
this process due to the absence of required (i.e., pre-TCR) gene
products. Consequently, when analyzed by PCR using primers for Vß and
Jß regions (9) DN3 blasts would be enriched for cells
with in-frame rearrangements, because cells with two sterile alleles
would be eliminated. One appealing aspect of such a model is that it
eliminates the need for an active cell fate decision, i.e., cell death
vs differentiation into DP. Instead, all cells receive the same
stimuli, with proliferation and DP development as the outcome in cells
that express the pre-TCR vs inappropriate mitogenesis, failed
differentiation, and cell death in its absence. For this purpose, we
believe it is revealing to consider nonproductive TCR-ß gene
rearrangements as what they are in a broader context, i.e., frameshift
mutations leading to the production of sterile alleles. At any locus
encoding a required gene product, such a mutation would likewise lead
to aborted differentiation (cell death). However, it is unlikely that
developmental arrest due to mutation of, for instance, a structural
gene would be interpreted as evidence that the corresponding protein
induces differentiation or proliferation. Rather, the presence of a
large variety of essential gene products, including the pre-TCR on
immature thymocytes, is required at various stages of development for
the differentiation process to be successful.
Characterization of pre-TCR expression as a developmental checkpoint
obligates redefinition of the authentic mediators of the
differentiative and proliferative processes. Our present data (Fig. 3
)
show that such signals require the presence of normal thymic anatomy
and cellularity, although the precise identities of such signals remain
undefined. Potential clues may be derived from the secondary lymphoid
system, where the differentiation of naive T cells into functional
effectors apparently involves multiple categories of non-TCR-related
signals, including cytokines, chemokines, adhesion molecules, and
integrins, as well as changes in tissue localization and distribution.
Because many such regulatory components display stratified distribution
in the thymus (21, 22, 23, 24, 25, 26, 27, 28, 29, 30), it is reasonable to postulate that
they may play a role in primary lymphoid tissues as well. Further
characterization of such molecules and their stage-specific effects on
developing thymocytes therefore represents a considerable resource for
future studies of the control of thymocyte differentiation and
homeostasis.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Howard T. Petrie, Memorial Sloan-Kettering Cancer Center, Box 341, 1275 York Avenue, New York, NY 10021. ![]()
3 Current address: Department of Pathology, Cornell University Medical School, New York, NY 10021. ![]()
4 Abbreviations used in this paper: DN, double negative; DP, double positive; RAG, recombinase-activating gene; RSS, recombination signal sequence. ![]()
Received for publication November 27, 1999. Accepted for publication July 5, 2000.
| References |
|---|
|
|
|---|
and ß block thymocyte development at different stages. Nature 360:225.[Medline]
ß-expressing cells. Science 256:1448.
ß T cell development in the thymus of normal and genetically altered mice. Curr. Opin. Immunol. 9:263.[Medline]
locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol. Cell. Biol. 16:609.[Abstract]
and ß gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Medline]
4ß1 integrin in murine thymocytes. J. Immunol. 159:2259.This article has been cited by other articles:
![]() |
S. V. Outram, A. L. Hager-Theodorides, D. K. Shah, N. J. Rowbotham, E. Drakopoulou, S. E. Ross, B. Lanske, J. T. Dessens, and T. Crompton Indian hedgehog (Ihh) both promotes and restricts thymocyte differentiation Blood, March 5, 2009; 113(10): 2217 - 2228. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Lo, H. Zhou, C. Fearns, R. A. Reisfeld, Y. Yang, and J.-D. Lee Tid1 Is Required for T Cell Transition from Double-Negative 3 to Double-Positive Stages J. Immunol., May 15, 2005; 174(10): 6105 - 6112. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Balciunaite, R. Ceredig, and A. G. Rolink The earliest subpopulation of mouse thymocytes contains potent T, significant macrophage, and natural killer cell but no B-lymphocyte potential Blood, March 1, 2005; 105(5): 1930 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Yui and E. V. Rothenberg Deranged Early T Cell Development in Immunodeficient Strains of Nonobese Diabetic Mice J. Immunol., November 1, 2004; 173(9): 5381 - 5391. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Laurent, N. Bosco, P. N. Marche, and R. Ceredig New insights into the proliferation and differentiation of early mouse thymocytes Int. Immunol., August 1, 2004; 16(8): 1069 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ciofani, T. M. Schmitt, A. Ciofani, A. M. Michie, N. Cuburu, A. Aublin, J. L. Maryanski, and J. C. Zuniga-Pflucker Obligatory Role for Cooperative Signaling by Pre-TCR and Notch during Thymocyte Differentiation J. Immunol., May 1, 2004; 172(9): 5230 - 5239. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Renno, A. Wilson, C. Dunkel, I. Coste, K. Maisnier-Patin, A. Benoit de Coignac, J.-P. Aubry, R. K. Lees, J.-Y. Bonnefoy, H. R. MacDonald, et al. A Role for CD147 in Thymic Development J. Immunol., May 15, 2002; 168(10): 4946 - 4950. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Lacorazza, H. E. Porritt, and J. Nikolich-Zugich Dysregulated Expression of Pre-T{alpha} Reveals the Opposite Effects of Pre-TCR at Successive Stages of T Cell Development J. Immunol., November 15, 2001; 167(10): 5689 - 5696. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. H. Kline, T. A. Hayden, and P. Riegert The Initiation of B Cell Clonal Expansion Occurs Independently of Pre-B Cell Receptor Formation J. Immunol., November 1, 2001; 167(9): 5136 - 5142. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. Lind, S. E. Prockop, H. E. Porritt, and H. T. Petrie Mapping Precursor Movement through the Postnatal Thymus Reveals Specific Microenvironments Supporting Defined Stages of Early Lymphoid Development J. Exp. Med., July 16, 2001; 194(2): 127 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. H. Kabra, C. Kang, L. C. Hsing, J. Zhang, and A. Winoto T cell-specific FADD-deficient mice: FADD is required for early T cell development PNAS, May 22, 2001; 98(11): 6307 - 6312. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |