|
|
||||||||
CUTTING EDGE |
Immunology, Department of Pathology, Cambridge University, Cambridge, United Kingdom
| Abstract |
|---|
|
|
|---|
RII). We also report a novel,
closely linked gene, DC-SIGNR, which shows 73% identity
to DC-SIGN at the nucleic acid level and a similar
genomic organization. Proteins encoded by both genes have tracts of
repeats of 23 aa, predicted to form a coiled coil neck region. They
also possess motifs that are known to bind mannose in a
calcium-dependent fashion. We show concomitant expression of the two
genes in endometrium, placenta, and stimulated KG1 cells
(phenotypically similar to monocyte-derived dendritic cells). The
existence of a DC-SIGN-related gene calls for
reinterpretation of the HIV data to consider possible DC-SIGN/DC-SIGNR
hetero-oligomerization. | Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
End primers (DC-SIGN-F (CTAAAGCAGGAGTTCTGGAC), DC-SIGN-R (CTAAAGGTCGAAGGATGGAG), DC-SIGNR-F (AACATCTGGGGACAGCG), and DC-SIGNR-R (GCAGTTACAACATTTACCACTT)) were designed from published cDNA sequences (1, 4). Genes were amplified from genomic DNA using the Promega Taq DNA polymerase system (Promega, Southampton, U.K.), dNTPs (2.0 mM), magnesium (2.0 mM), and cycle conditions of 92°C for 1 min, 60°C for 1 min, and 72°C for 26 min. PCR products were cloned with a TOPO-XL cloning kit (Invitrogen, San Diego, CA). cDNAs representing the entire coding region were cloned from placental cDNA as described above. Clones were sequenced as described previously (5). Predicted protein sequences were analyzed using Pix (http://menu.hgmp.mrc.ac.uk/menu-bin/Pix/) and ExPasy (http://www.expasy.ch/).
Mapping of the genes
Mapping was conducted by PCR using a radiation hybrid panel (HGMP-MRC) (6). A 366-bp sequence-tagged site from exon 4 of DC-SIGN was amplified as described with primers Lizol88 (CGCGATCTACCAGAACCTG) and Lizol91 (TCCTGGTAGATCTCCTGCAT). The map position was analyzed with the RhYme program (http://menu.hgmp.mrc.ac.uk/menu-bin/RHyME/).
P1 artificial chromosome (PAC)4 identification
Gridded human RPCI 15 PAC libraries (7) were
hybridized for 20 h with 50 ng of
[
-32P]dCTP-labeled full-length
DC-SIGN cDNA. Membranes were washed to a stringency of
1 x SSC/0.1% SDS at 65°C and exposed to x-ray film at -70°C
for 24 h (8, 9, 10). Positive clones were provided by
the Human Genome Mapping Project Resource Center. DNA was extracted
using standard techniques (9). PAC DNA (150 ng) was
digested with NotI (New England Biolabs, Beverly, MA) and
separated on a pulse-field gel, with ramped switch times from 113 s
at 200 V for 16 h. PCR screening confirmed the presence of
DC-SIGN, DC-SIGNR, or CD23 on the PACs. Results
were confirmed by sequencing (5).
DNA blot analysis
PAC DNA (20 µg) was digested with the restriction enzymes
EcoRI (New England Biolabs) and PstI (New England
Biolabs), followed by electrophoresis on 0.8% agarose-TBE gel. DNA was
transferred to a Hybond N+ nylon membrane.
Membranes were prehybridized for 1 h in hybridization buffer
(0.001 M EDTA, 0.5 M sodium phosphate (pH 7.2), and 7% SDS). Fifty
nanograms of a 140-bp probe across exon 5 of DC-SIGN was
labeled with [
-32P]dCTP and hybridized for
18 h at 65°C (7). Membranes were washed to a
stringency of 0.1% SSC with 0.1% SDS at 65°C and exposed to Biomax
MR film (Eastman Kodak, Rochester, NY) for 12 h.
Cell culture and cDNA
Human YT, U937, Ind, 293T, and HCMED1-E6, were cultured in RPMI 1640, 10% FCS, 100 U/ml penicillin, and 100 U/ml streptomycin. Human Jurkat, T47D, MRC5, and C33a were cultured in DMEM, 10% FCS, 100 U/ml penicillin/streptomycin, and 2 mM L-glutamine. HT29 cells were cultured in DMEM/F12 (1/1), 10% FCS, and 100 U/ml penicillin/streptomycin. KG1 cells were cultured in IMDM, 20% FCS, 100 mM L-glutamine, and 100 U/ml penicillin/streptomycin and stimulated with PMA (10 ng/ml) and ionomycin (100 ng/ml; Sigma, St. Louis, MO) (11). Langerhans-type dendritic cells (12, 13) were donated by Paul Lehner (Cambrdige University, Cambridge, U.K.). Total RNA was isolated using th RNA-easy minikit (Qiagen, Crawley, U.K.). Placental and endometrial cDNA were donated by Amanda Evans (Cambridge University). Monocyte-derived dendritic cell cDNA (14) was donated by Jason Caulfield (Kings College, London, U.K.).
RT-PCR
First-strand cDNA was prepared using polyT and the Superscript kit (Life Technologies, Paisley, U.K.). cDNA synthesis was controlled using GAPDH primers (forward, ACCACAGTCCATGCCATCAC; reverse, TCCACCACCCTGTTGCTGTA). PCR for DC-SIGN and DC-SIGNR was performed with: DC-SIGN: Lizol125, TGCAACTCCTCTCCTTCAC; Lizol202, CTTTGCAGGCGGTGAT; and DC-SIGNR: Lizol126, TGCAACTCCTCTCCTTCAT; Lizol201, CTGGCAGGCGGTGAC. PCR conditions were 92°C for 1 min, 61°C for 1 min, and 72°C for 2 min for 35 cycles, with magnesium at 1.5 mM. PCR was controlled using DC-SIGN and DC-SIGNR cDNA clones. PCR products were sequenced (5).
| Results |
|---|
|
|
|---|
Using the GenBank database sequence for DC-SIGN
(1) and a closely related partial cDNA sequence, AB015629
(4), end primers were designed, and full-length cDNAs were
cloned from human placenta. Comparison of our full-length AB015629
clone, now termed DC-SIGNR, with the previously published sequence
revealed two extra exons. Additionally a 330-bp 3' intron (Fig. 4
A) previously described in AB015629 cDNA had been spliced
out of our cDNA.
|
|
|
Mapping of DC-SIGN and DC-SIGNR was conducted by performing PCR
across exon 4 of DC-SIGN on a radiation hybrid panel (HGMP)
(6). Results were consistent with a localization on
chromosome 19p13.3. The RPCI PAC libraries (7) were
screened with a probe consisting of the full-length sequence of
DC-SIGN. DC-SIGN and DC-SIGNR were found on overlapping PACs, the sizes
of which were determined by pulse field gel electrophoresis (Fig. 3
). PACs were screened by PCR using exon
primers for DC-SIGN and DC-SIGNR as well as CD23, a C-type lectin known
to map to 19p13 (21), revealing the gene order shown in
Fig. 3
. The smallest PAC containing DC-SIGN, DC-SIGNR, and CD23 has an
insert size of 105 kbp. These data concur with preliminary high
throughput genomic sequence data from The Lawrence Livermore center and
with the localization of the CD23 gene (18). Therefore,
these three C-type lectin genes, which have analogous genomic
structures (see below), form a tight cluster on human chromosome 19p13.
We probed the PAC clones to search for additional related genes
using an exon 5 probe from DC-SIGN, which shows 93% identity to exon 5
of DC-SIGNR and <25% identity to CD23 at the nucleic acid level. Only
two equimolar bands corresponding to DC-SIGN and DC-SIGNR were obtained
on the PACs already identified (Fig. 3
). Although we cannot rule out
the presence of further closely related genes elsewhere in the genome,
no additional EST sequences are currently identifiable, and high
throughput genomic sequence data have revealed no evidence for this. It
is therefore most likely that only two genes exist in the DC-SIGN
family at 19p13.
|
The complete genes for DC-SIGN and DC-SIGNR were cloned by
PCR from genomic DNA derived from a B cell lymphoma line and sequenced.
Coding regions were predicted by alignment to the sequences obtained
from placental cDNA. Both genomic sequences showed 100% identity to
the corresponding cDNAs over the coding regions. Exon/intron structures
of the two genes are shown in Fig. 4
. All
intron-exon boundaries follow the ag/gt rule (Fig. 4
). The genes have
very similar structures, except that DC-SIGNR has a longer 3'
untranslated region, spanning two exons, compared with one in DC-SIGN.
DC-SIGNR also contains an insert of approximately 1400 bp between exons
2 and 3, making intron 2 approximately 2000 bp, compared with 626 bp in
DC-SIGN.
Expression pattern
Tissue specificity of expression was investigated by RT-PCR using
gene-specific primers for DC-SIGN and DC-SIGNR
(Fig. 5
). In agreement with previous
results (3), expression of DC-SIGN was
restricted to endometrium, placenta, and stimulated KG1 cells
(phenotypically similar to myeloid dendritic cells) (11).
Although DC-SIGNR showed a lower level of expression, it was
consistently detected in placenta with a very low level of expression
in endometrium and stimulated KG1 cells. Cultured dendritic cells with
a Langerhans cell-type phenotype (22) were negative for
both molecules. We demonstrated a low level of expression of both
DC-SIGN and DC-SIGNR by RT-PCR from monocyte-derived dendritic cells
(data not shown) and subsequently cloned full-length cDNAs
corresponding to both transcripts.
|
| Discussion |
|---|
|
|
|---|
The cytoplasmic tails of both DC-SIGN and DC-SIGNR contain di-leucine
motifs, which may mediate internalization, thus indicating that these
molecules may act as carbohydrate receptors (Fig. 1
) (23).
However, work by Geijtenbeek et al. suggests that endocytosis via
DCSIGN is extremely inefficient in dendritic cells (2). A
YXXL motif in the cytoplasmic tail of DC-SIGN (Fig. 1
) may provide a
further internalization motif (16) or, alternatively, a
site for tyrosine phosphorylation
(24).
CD23 has a neck consisting of three leucine-rich repeats in man and two
in rat and mouse. This forms an
-helical coiled coil structure,
which mediates trimerization (25, 26). Each of the repeat
units is 21 aa long and is encoded by a separate exon. This contrasts
with DC-SIGN and DC-SIGNR, which each have 7
repeats of a 23-aa sequence, encoded by a single exon (Fig. 4
). There
is very high sequence identity between the repeat units, within each
protein, and between DC-SIGN and DC-SIGNR (Fig. 1
). By analogy to other lectin receptors, such as the
asialoglycoprotein receptors and CD23 (26, 27, 28, 29), we suggest
that this domain could mediate oligomerization, forming an
-helical
coiled coil. Oligomerization may serve to increase the avidity of
ligand binding. The human asialoglycoprotein receptors, H1 and H2, have
similar coiled coil neck structures and have been shown to form
noncovalently associated heterotetramers with a stoichiometry of 2:2
(28). Like DC-SIGN and DC-SIGNR, the
H1 and H2 genes are linked, but are found on chromosome 17p
(30).
The sequences of the CRDs of DC-SIGN and DC-SIGNR
show greatest identity to the human asialoglycoprotein receptors (41
and 34% at the amino acid level, respectively) and rat CD23 (both 33%
at the amino acid level; Fig. 2
). Consistent with previous work
(1, 2, 3), DC-SIGN, shows features of a mannose
binding lectin, as opposed to the features of a protein-binding NK cell
lectin (Fig. 2
) (31). DC-SIGNR, shows 77%
identity to DC-SIGN at the amino acid level and also
possesses all the residues shown to be required for the binding of
mannose (Fig. 2
) (31). The high level of homology between
DC-SIGN and DC-SIGNR and their concomitant
expression in placenta, endometrium, and a subset of dendritic cells
suggest that DC-SIGNR may function in a similar manner to DC-SIGN,
binding HIV gp120, ICAM-3 and perhaps other mannosylated proteins.
Although it has been shown that the binding of DC-SIGN to ICAM3 and
gp120 can be inhibited by mannan (1, 3) and may therefore
not involve direct protein-protein interactions, the presence of the
residues required for mannose binding must be interpreted cautiously.
These residues are largely conserved in human CD23 and are completely
conserved in murine and rat CD23 (Fig. 2
), although the primary ligand
of these molecules is thought to be IgE (18). Data suggest
that mannose can partially inhibit the binding of human CD23 to certain
of its ligands (32, 33). Therefore, DC-SIGN and DC-SIGNR
may also bind a protein ligand, and experiments are underway to
investigate this possibility.
The existence of a DC-SIGN-related gene (DC-SIGNR) with a similar pattern of expression is intriguing. Besides the formation of homo-oligomers, it is possible that hetero-oligomers of the two polypeptides may form, as described for the human asialoglycoprotein receptors (28). Given the heterogeneity of dendritic cell phenotypes (34), further investigation of the differential expression patterns of the two genes across these phenotypes and at different anatomical sites is warranted. A further question is posed by the high level of expression in placenta, which may not be accounted for entirely by the presence of cells with a dendritic cell phenotype. The expression of DC-SIGN or DC-SIGNR on placenta may provide the key to explaining the mechanism of vertical transmission of HIV and may therefore give valuable insights into its prevention.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 The following accession numbers have been deposited in GenBank: AF209479 (DC-SIGN gene), AF209480 (DC-SIGNR gene, exons 1 and 2), AF209481 (DC-SIGNR gene, exons 38), and AF245219 (DC-SIGNR cDNA). ![]()
3 Address correspondence and reprint requests to Dr. Elizabeth J. Soilleux, Department of Pathology, Cambridge University, Tennis Court Road, Cambridge, U.K. CB2 1QP. ![]()
4 Abbreviations used in this paper: PAC, P1 artificial chromosome; CRD, carbohydrate recognition domain. ![]()
Received for publication May 31, 2000. Accepted for publication July 12, 2000.
| References |
|---|
|
|
|---|
. J. Exp. Med. 179:1109.-1118.
RII and its soluble fragments can form oligomers on the cell surface and in solution. Immunology 84:202.[Medline]
RII/CD23: implications for function. J. Immunol. 150:2372.[Abstract]
-Helical coiled-coil stalks in the low-affinity receptor for IgE (Fc
RII/CD23) and related C-type lectins. Proc. Natl. Acad. Sci. USA 89:753.This article has been cited by other articles:
![]() |
N. P. Y. Chung, S. K. J. Breun, A. Bashirova, J. G. Baumann, T. D. Martin, J. M. Karamchandani, J. W. Rausch, S. F. J. Le Grice, L. Wu, M. Carrington, et al. HIV-1 Transmission by Dendritic Cell-specific ICAM-3-grabbing Nonintegrin (DC-SIGN) Is Regulated by Determinants in the Carbohydrate Recognition Domain That Are Absent in Liver/Lymph Node-SIGN (L-SIGN) J. Biol. Chem., January 15, 2010; 285(3): 2100 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-F. Lin, L.-X. Xiang, Q.-L. Wang, W.-R. Dong, Y.-F. Gong, and J.-Z. Shao The DC-SIGN of Zebrafish: Insights into the Existence of a CD209 Homologue in a Lower Vertebrate and Its Involvement in Adaptive Immunity J. Immunol., December 1, 2009; 183(11): 7398 - 7410. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takagi, M. Numazaki, T. Kajiwara, Y. Abe, M. Ishii, C. Kato, and N. Kojima Cooperation of specific ICAM-3 grabbing nonintegrin-related 1 (SIGNR1) and complement receptor type 3 (CR3) in the uptake of oligomannose-coated liposomes by macrophages Glycobiology, March 1, 2009; 19(3): 258 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Li, N L-S Tang, P K-S Chan, C-Y Wang, D S-C Hui, C Luk, R Kwok, W Huang, J J-Y Sung, Q-P Kong, et al. Polymorphisms in the C-type lectin genes cluster in chromosome 19 and predisposition to severe acute respiratory syndrome coronavirus (SARS-CoV) infection J. Med. Genet., November 1, 2008; 45(11): 752 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-F. Kong, K. Delroux, X. Wang, F. Qian, A. Arjona, S. E. Malawista, E. Fikrig, and R. R. Montgomery Dysregulation of TLR3 Impairs the Innate Immune Response to West Nile Virus in the Elderly J. Virol., August 1, 2008; 82(15): 7613 - 7623. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang and S. Pang An intercellular adhesion molecule-3 (ICAM-3) -grabbing nonintegrin (DC-SIGN) efficiently blocks HIV viral budding FASEB J, April 1, 2008; 22(4): 1055 - 1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Meyer, B. Tefsen, A. Imberty, R. Geyer, and I. van Die The C-type lectin L-SIGN differentially recognizes glycan antigens on egg glycosphingolipids and soluble egg glycoproteins from Schistosoma mansoni Glycobiology, October 1, 2007; 17(10): 1104 - 1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Malcherek, L. Mayr, P. Roda-Navarro, D. Rhodes, N. Miller, and J. Trowsdale The B7 Homolog Butyrophilin BTN2A1 Is a Novel Ligand for DC-SIGN J. Immunol., September 15, 2007; 179(6): 3804 - 3811. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dominguez-Soto, L. Aragoneses-Fenoll, E. Martin-Gayo, L. Martinez-Prats, M. Colmenares, M. Naranjo-Gomez, F. E. Borras, P. Munoz, M. Zubiaur, M. L. Toribio, et al. The DC-SIGN-related lectin LSECtin mediates antigen capture and pathogen binding by human myeloid cells Blood, June 15, 2007; 109(12): 5337 - 5345. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Bahlis, A. M. King, D. Kolonias, L. M. Carlson, H. Y. Liu, M. A. Hussein, H. R. Terebelo, G. E. Byrne Jr, B. L. Levine, L. H. Boise, et al. CD28-mediated regulation of multiple myeloma cell proliferation and survival Blood, June 1, 2007; 109(11): 5002 - 5010. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-P. Shih, C.-Y. Chen, S.-J. Liu, K.-H. Chen, Y.-M. Lee, Y.-C. Chao, and Y.-M. A. Chen Identifying Epitopes Responsible for Neutralizing Antibody and DC-SIGN Binding on the Spike Glycoprotein of the Severe Acute Respiratory Syndrome Coronavirus J. Virol., November 1, 2006; 80(21): 10315 - 10324. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Falkowska, R. J. Durso, J. P. Gardner, E. G. Cormier, R. A. Arrigale, R. N. Ogawa, G. P. Donovan, P. J. Maddon, W. C. Olson, and T. Dragic L-SIGN (CD209L) isoforms differently mediate trans-infection of hepatoma cells by hepatitis C virus pseudoparticles J. Gen. Virol., September 1, 2006; 87(9): 2571 - 2576. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Guo, C. E. Atkinson, M. E. Taylor, and K. Drickamer All but the Shortest Polymorphic Forms of the Viral Receptor DC-SIGNR Assemble into Stable Homo- and Heterotetramers J. Biol. Chem., June 16, 2006; 281(24): 16794 - 16798. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Caminschi, A. J Corbett, C. Zahra, M. Lahoud, K. M Lucas, M. Sofi, D. Vremec, T. Gramberg, S. Pohlmann, J. Curtis, et al. Functional comparison of mouse CIRE/mouse DC-SIGN and human DC-SIGN Int. Immunol., May 1, 2006; 18(5): 741 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Davis, H.-Y. Nguyen, S. L. Hanna, M. D. Sanchez, R. W. Doms, and T. C. Pierson West Nile Virus Discriminates between DC-SIGN and DC-SIGNR for Cellular Attachment and Infection J. Virol., February 1, 2006; 80(3): 1290 - 1301. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dakappagari, T. Maruyama, M. Renshaw, P. Tacken, C. Figdor, R. Torensma, M. A. Wild, D. Wu, K. Bowdish, and A. Kretz-Rommel Internalizing Antibodies to the C-Type Lectins, L-SIGN and DC-SIGN, Inhibit Viral Glycoprotein Binding and Deliver Antigen to Human Dendritic Cells for the Induction of T Cell Responses J. Immunol., January 1, 2006; 176(1): 426 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Granelli-Piperno, A. Pritsker, M. Pack, I. Shimeliovich, J.-F. Arrighi, C. G. Park, C. Trumpfheller, V. Piguet, T. M. Moran, and R. M. Steinman Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin/CD209 Is Abundant on Macrophages in the Normal Human Lymph Node and Is Not Required for Dendritic Cell Stimulation of the Mixed Leukocyte Reaction J. Immunol., October 1, 2005; 175(7): 4265 - 4273. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Hibbert, P. Teriete, G. J. Grundy, R. L. Beavil, R. Reljic, V. M. Holers, J. P. Hannan, B. J. Sutton, H. J. Gould, and J. M. McDonnell The structure of human CD23 and its interactions with IgE and CD21 J. Exp. Med., September 19, 2005; 202(6): 751 - 760. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cejas, L. M. Carlson, D. Kolonias, J. Zhang, I. Lindner, D. D. Billadeau, L. H. Boise, and K. P. Lee Regulation of RelB Expression during the Initiation of Dendritic Cell Differentiation Mol. Cell. Biol., September 1, 2005; 25(17): 7900 - 7916. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cejas, L. M. Carlson, J. Zhang, S. Padmanabhan, D. Kolonias, I. Lindner, S. Haley, L. H. Boise, and K. P. Lee Protein Kinase C {beta}II Plays an Essential Role in Dendritic Cell Differentiation and Autoregulates Its Own Expression J. Biol. Chem., August 5, 2005; 280(31): 28412 - 28423. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fernandez, S. Alonso, I. Valera, A. G. Vigo, M. Renedo, L. Barbolla, and M. S. Crespo Mannose-Containing Molecular Patterns Are Strong Inducers of Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Macrophages J. Immunol., June 15, 2005; 174(12): 8154 - 8162. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. de la Rosa, M. Yanez-Mo, R. Samaneigo, D. Serrano-Gomez, L. Martinez-Munoz, E. Fernandez-Ruiz, N. Longo, F. Sanchez-Madrid, A. L. Corbi, and P. Sanchez-Mateos Regulated recruitment of DC-SIGN to cell-cell contact regions during zymosan-induced human dendritic cell aggregation J. Leukoc. Biol., May 1, 2005; 77(5): 699 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Snyder, J. Ford, P. Torabi-Parizi, J. A. Arthos, P. Schuck, M. Colonna, and P. D. Sun Characterization of DC-SIGN/R Interaction with Human Immunodeficiency Virus Type 1 gp120 and ICAM Molecules Favors the Receptor's Role as an Antigen-Capturing Rather than an Adhesion Receptor J. Virol., April 15, 2005; 79(8): 4589 - 4598. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Rogers, T. W. Gobel, B. C. Viertlboeck, S. Milne, S. Beck, and J. Kaufman Characterization of the Chicken C-Type Lectin-Like Receptors B-NK and B-lec Suggests That the NK Complex and the MHC Share a Common Ancestral Region J. Immunol., March 15, 2005; 174(6): 3475 - 3483. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Modis, S. Ogata, D. Clements, and S. C. Harrison Variable Surface Epitopes in the Crystal Structure of Dengue Virus Type 3 Envelope Glycoprotein J. Virol., January 15, 2005; 79(2): 1223 - 1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lanoue, M. R. Clatworthy, P. Smith, S. Green, M. J. Townsend, H. E. Jolin, K. G.C. Smith, P. G. Fallon, and A. N.J. McKenzie SIGN-R1 Contributes to Protection against Lethal Pneumococcal Infection in Mice J. Exp. Med., December 6, 2004; 200(11): 1383 - 1393. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Jeffers, S. M. Tusell, L. Gillim-Ross, E. M. Hemmila, J. E. Achenbach, G. J. Babcock, W. D. Thomas Jr., L. B. Thackray, M. D. Young, R. J. Mason, et al. CD209L (L-SIGN) is a receptor for severe acute respiratory syndrome coronavirus PNAS, November 2, 2004; 101(44): 15748 - 15753. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Van Liempt, A. Imberty, C. M. C. Bank, S. J. Van Vliet, Y. Van Kooyk, T. B. H. Geijtenbeek, and I. Van Die Molecular Basis of the Differences in Binding Properties of the Highly Related C-type Lectins DC-SIGN and L-SIGN to Lewis X Trisaccharide and Schistosoma mansoni Egg Antigens J. Biol. Chem., August 6, 2004; 279(32): 33161 - 33167. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shiina, S. Shimizu, K. Hosomichi, S. Kohara, S. Watanabe, K. Hanzawa, S. Beck, J. K. Kulski, and H. Inoko Comparative Genomic Analysis of Two Avian (Quail and Chicken) MHC Regions J. Immunol., June 1, 2004; 172(11): 6751 - 6763. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Engering, S. J. van Vliet, K. Hebeda, D. G. Jackson, R. Prevo, S. K. Singh, T. B. H. Geijtenbeek, H. van Krieken, and Y. van Kooyk Dynamic Populations of Dendritic Cell-Specific ICAM-3 Grabbing Nonintegrin-Positive Immature Dendritic Cells and Liver/Lymph Node-Specific ICAM-3 Grabbing Nonintegrin-Positive Endothelial Cells in the Outer Zones of the Paracortex of Human Lymph Nodes Am. J. Pathol., May 1, 2004; 164(5): 1587 - 1595. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, L. Tang, G. Zhang, H. Wei, Y. Cui, L. Guo, Z. Gou, X. Chen, D. Jiang, Y. Zhu, et al. Characterization of a Novel C-type Lectin-like Gene, LSECtin: DEMONSTRATION OF CARBOHYDRATE BINDING AND EXPRESSION IN SINUSOIDAL ENDOTHELIAL CELLS OF LIVER AND LYMPH NODE J. Biol. Chem., April 30, 2004; 279(18): 18748 - 18758. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J.-Y. Ploquin, O. M. Diop, N. Sol-Foulon, L. Mortara, A. Faye, M. A. Soares, E. Nerrienet, R. Le Grand, Y. Van Kooyk, A. Amara, et al. DC-SIGN from African Green Monkeys Is Expressed in Lymph Nodes and Mediates Infection in trans of Simian Immunodeficiency Virus SIVagm J. Virol., January 15, 2004; 78(2): 798 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Taylor, G. D. Brown, J. Herre, D. L. Williams, J. A. Willment, and S. Gordon The Role of SIGNR1 and the {beta}-Glucan Receptor (Dectin-1) in the Nonopsonic Recognition of Yeast by Specific Macrophages J. Immunol., January 15, 2004; 172(2): 1157 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cambi, F. de Lange, N. M. van Maarseveen, M. Nijhuis, B. Joosten, E. M.H.P. van Dijk, B. I. de Bakker, J. A.M. Fransen, P. H.M. Bovee-Geurts, F. N. van Leeuwen, et al. Microdomains of the C-type lectin DC-SIGN are portals for virus entry into dendritic cells J. Cell Biol., January 5, 2004; 164(1): 145 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Klimstra, E. M. Nangle, M. S. Smith, A. D. Yurochko, and K. D. Ryman DC-SIGN and L-SIGN Can Act as Attachment Receptors for Alphaviruses and Distinguish between Mosquito Cell- and Mammalian Cell-Derived Viruses J. Virol., November 15, 2003; 77(22): 12022 - 12032. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Frison, M. E. Taylor, E. Soilleux, M.-T. Bousser, R. Mayer, M. Monsigny, K. Drickamer, and A.-C. Roche Oligolysine-based Oligosaccharide Clusters: SELECTIVE RECOGNITION AND ENDOCYTOSIS BY THE MANNOSE RECEPTOR AND DENDRITIC CELL-SPECIFIC INTERCELLULAR ADHESION MOLECULE 3 (ICAM-3)-GRABBING NONINTEGRIN J. Biol. Chem., June 20, 2003; 278(26): 23922 - 23929. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Trumpfheller, C. G. Park, J. Finke, R. M. Steinman, and A. Granelli-Piperno Cell type-dependent retention and transmission of HIV-1 by DC-SIGN Int. Immunol., February 1, 2003; 15(2): 289 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lin, F. Baribaud, J. Romano, R. W. Doms, and J. A. Hoxie Identification of gp120 Binding Sites on CXCR4 by Using CD4-Independent Human Immunodeficiency Virus Type 2 Env Proteins J. Virol., January 15, 2003; 77(2): 931 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lin, G. Simmons, S. Pohlmann, F. Baribaud, H. Ni, G. J. Leslie, B. S. Haggarty, P. Bates, D. Weissman, J. A. Hoxie, et al. Differential N-Linked Glycosylation of Human Immunodeficiency Virus and Ebola Virus Envelope Glycoproteins Modulates Interactions with DC-SIGN and DC-SIGNR J. Virol., January 15, 2003; 77(2): 1337 - 1346. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Bashirova, L. Wu, J. Cheng, T. D. Martin, M. P. Martin, R. E. Benveniste, J. D. Lifson, V. N. KewalRamani, A. Hughes, and M. Carrington Novel Member of the CD209 (DC-SIGN) Gene Family in Primates J. Virol., January 1, 2003; 77(1): 217 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. A. MacDonald, D. J. Munster, G. J. Clark, A. Dzionek, J. Schmitz, and D. N. J. Hart Characterization of human blood dendritic cell subsets Blood, December 15, 2002; 100(13): 4512 - 4520. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. H. Geijtenbeek, P. C. Groot, M. A. Nolte, S. J. van Vliet, S. T. Gangaram-Panday, G. C. F. van Duijnhoven, G. Kraal, A. J. M. van Oosterhout, and Y. van Kooyk Marginal zone macrophages express a murine homologue of DC-SIGN that captures blood-borne antigens in vivo Blood, September 26, 2002; 100(8): 2908 - 2916. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Denda-Nagai, N. Kubota, M. Tsuiji, M. Kamata, and T. Irimura Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens Glycobiology, July 1, 2002; 12(7): 443 - 450. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wu, T. D. Martin, R. Vazeux, D. Unutmaz, and V. N. KewalRamani Functional Evaluation of DC-SIGN Monoclonal Antibodies Reveals DC-SIGN Interactions with ICAM-3 Do Not Promote Human Immunodeficiency Virus Type 1 Transmission J. Virol., June 15, 2002; 76(12): 5905 - 5914. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. H. Geijtenbeek, A. Engering, and Y. van Kooyk DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology J. Leukoc. Biol., June 1, 2002; 71(6): 921 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Higashi, K. Fujioka, K. Denda-Nagai, S.-i. Hashimoto, S. Nagai, T. Sato, Y. Fujita, A. Morikawa, M. Tsuiji, M. Miyata-Takeuchi, et al. The Macrophage C-type Lectin Specific for Galactose/N-Acetylgalactosamine Is an Endocytic Receptor Expressed on Monocyte-derived Immature Dendritic Cells J. Biol. Chem., May 31, 2002; 277(23): 20686 - 20693. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. H. Geijtenbeek, G. C. F. van Duijnhoven, S. J. van Vliet, E. Krieger, G. Vriend, C. G. Figdor, and Y. van Kooyk Identification of Different Binding Sites in the Dendritic Cell-specific Receptor DC-SIGN for Intercellular Adhesion Molecule 3 and HIV-1 J. Biol. Chem., March 22, 2002; 277(13): 11314 - 11320. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Soilleux, L. S. Morris, G. Leslie, J. Chehimi, Q. Luo, E. Levroney, J. Trowsdale, L. J. Montaner, R. W. Doms, D. Weissman, et al. Constitutive and induced expression of DC-SIGN on dendritic cell and macrophage subpopulations in situ and in vitro J. Leukoc. Biol., March 1, 2002; 71(3): 445 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Valladeau, V. Clair-Moninot, C. Dezutter-Dambuyant, J.-J. Pin, A. Kissenpfennig, M.-G. Mattei, S. Ait-Yahia, E. E. M. Bates, B. Malissen, F. Koch, et al. Identification of Mouse Langerin/CD207 in Langerhans Cells and Some Dendritic Cells of Lymphoid Tissues J. Immunol., January 15, 2002; 168(2): 782 - 792. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lee, G. Leslie, E. Soilleux, U. O'Doherty, S. Baik, E. Levroney, K. Flummerfelt, W. Swiggard, N. Coleman, M. Malim, et al. cis Expression of DC-SIGN Allows for More Efficient Entry of Human and Simian Immunodeficiency Viruses via CD4 and a Coreceptor J. Virol., December 15, 2001; 75(24): 12028 - 12038. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Feinberg, D. A. Mitchell, K. Drickamer, and W. I. Weis Structural Basis for Selective Recognition of Oligosaccharides by DC-SIGN and DC-SIGNR Science, December 7, 2001; 294(5549): 2163 - 2166. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lin, B. Lee, B. S. Haggarty, R. W. Doms, and J. A. Hoxie CD4-Independent Use of Rhesus CCR5 by Human Immunodeficiency Virus Type 2 Implicates an Electrostatic Interaction between the CCR5 N Terminus and the gp120 C4 Domain J. Virol., November 15, 2001; 75(22): 10766 - 10778. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Baribaud, S. Pohlmann, T. Sparwasser, M. T. Y. Kimata, Y.-K. Choi, B. S. Haggarty, N. Ahmad, T. Macfarlan, T. G. Edwards, G. J. Leslie, et al. Functional and Antigenic Characterization of Human, Rhesus Macaque, Pigtailed Macaque, and Murine DC-SIGN J. Virol., November 1, 2001; 75(21): 10281 - 10289. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pohlmann, G. J. Leslie, T. G. Edwards, T. Macfarlan, J. D. Reeves, K. Hiebenthal-Millow, F. Kirchhoff, F. Baribaud, and R. W. Doms DC-SIGN Interactions with Human Immunodeficiency Virus: Virus Binding and Transfer Are Dissociable Functions J. Virol., November 1, 2001; 75(21): 10523 - 10526. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Turville, J. Arthos, K. Mac Donald, G. Lynch, H. Naif, G. Clark, D. Hart, and A. L. Cunningham HIV gp120 receptors on human dendritic cells Blood, October 15, 2001; 98(8): 2482 - 2488. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Park, K. Takahara, E. Umemoto, Y. Yashima, K. Matsubara, Y. Matsuda, B. E. Clausen, K. Inaba, and R. M. Steinman Five mouse homologues of the human dendritic cell C-type lectin, DC-SIGN Int. Immunol., October 1, 2001; 13(10): 1283 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Soilleux and N. Coleman Langerhans cells and the cells of Langerhans cell histiocytosis do not express DC-SIGN Blood, September 15, 2001; 98(6): 1987 - 1988. [Full Text] [PDF] |
||||
![]() |
S. Pohlmann, F. Baribaud, B. Lee, G. J. Leslie, M. D. Sanchez, K. Hiebenthal-Millow, J. Munch, F. Kirchhoff, and R. W. Doms DC-SIGN Interactions with Human Immunodeficiency Virus Type 1 and 2 and Simian Immunodeficiency Virus J. Virol., May 15, 2001; 75(10): 4664 - 4672. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Bashirova, T. B.H. Geijtenbeek, G. C.F. van Duijnhoven, S. J. van Vliet, J. B.G. Eilering, M. P. Martin, L. Wu, T. D. Martin, N. Viebig, P. A. Knolle, et al. A Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin (Dc-Sign)-Related Protein Is Highly Expressed on Human Liver Sinusoidal Endothelial Cells and Promotes HIV-1 Infection J. Exp. Med., March 19, 2001; 193(6): 671 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pohlmann, E. J. Soilleux, F. Baribaud, G. J. Leslie, L. S. Morris, J. Trowsdale, B. Lee, N. Coleman, and R. W. Doms DC-SIGNR, a DC-SIGN homologue expressed in endothelial cells, binds to human and simian immunodeficiency viruses and activates infection in trans PNAS, February 27, 2001; 98(5): 2670 - 2675. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mummidi, G. Catano, L. Lam, A. Hoefle, V. Telles, K. Begum, F. Jimenez, S. S. Ahuja, and S. K. Ahuja Extensive Repertoire of Membrane-bound and Soluble Dendritic Cell-specific ICAM-3-grabbing Nonintegrin 1 (DC-SIGN1) and DC-SIGN2 Isoforms. INTER-INDIVIDUAL VARIATION IN EXPRESSION OF DC-SIGN TRANSCRIPTS J. Biol. Chem., August 24, 2001; 276(35): 33196 - 33212. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Mitchell, A. J. Fadden, and K. Drickamer A Novel Mechanism of Carbohydrate Recognition by the C-type Lectins DC-SIGN and DC-SIGNR. SUBUNIT ORGANIZATION AND BINDING TO MULTIVALENT LIGANDS J. Biol. Chem., July 27, 2001; 276(31): 28939 - 28945. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wu, A. A. Bashirova, T. D. Martin, L. Villamide, E. Mehlhop, A. O. Chertov, D. Unutmaz, M. Pope, M. Carrington, and V. N. KewalRamani Rhesus macaque dendritic cells efficiently transmit primate lentiviruses independently of DC-SIGN PNAS, February 5, 2002; 99(3): 1568 - 1573. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |