The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Soilleux, E. J.
Right arrow Articles by Trowsdale, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soilleux, E. J.
Right arrow Articles by Trowsdale, J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
The Journal of Immunology, 2000, 165: 2937-2942.
Copyright © 00 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: DC-SIGN; a Related Gene, DC-SIGNR; and CD23 Form a Cluster on 19p131 ,2

Elizabeth J. Soilleux3, Roland Barten and John Trowsdale

Immunology, Department of Pathology, Cambridge University, Cambridge, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DC-SIGN is a C-type lectin, expressed on a dendritic cell subset. It is able to bind ICAM3 and HIV gp120 in a calcium-dependent manner. Here we report the genomic organization of DC-SIGN and map it to chromosome 19p13 adjacent to the C-type lectin CD23 (Fc{epsilon}RII). We also report a novel, closely linked gene, DC-SIGNR, which shows 73% identity to DC-SIGN at the nucleic acid level and a similar genomic organization. Proteins encoded by both genes have tracts of repeats of 23 aa, predicted to form a coiled coil neck region. They also possess motifs that are known to bind mannose in a calcium-dependent fashion. We show concomitant expression of the two genes in endometrium, placenta, and stimulated KG1 cells (phenotypically similar to monocyte-derived dendritic cells). The existence of a DC-SIGN-related gene calls for reinterpretation of the HIV data to consider possible DC-SIGN/DC-SIGNR hetero-oligomerization.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DC-SIGN, originally described in 1992 as a C-type lectin able to bind the HIV surface protein, gp120 (1), has been shown to be important for efficient infection with HIV (2). The DC-SIGN molecule is used by HIV to attach to dendritic cells in the genitourinary tract and rectum (3). EGTA and mannan can inhibit this binding (2). Geitjenbeek et al. (2) suggest that dendritic cells then carry HIV particles to lymph nodes, where the infection of T lymphocytes via receptors such as CD4 and CCR5 may occur. DC-SIGN also binds the highly glycosylated molecule, ICAM3, found on T lymphocytes, enhancing the interaction of dendritic cells with T lymphocytes (3). A partial cDNA of a second, closely related gene was identified in 1999 by Yokoyama-Kobayashi et al. (4). In this study we investigated the mapping, genomic organization, and expression of DC-SIGN and a closely related gene, DC-SIGNR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PCR and cloning of full genes and cDNAs

End primers (DC-SIGN-F (CTAAAGCAGGAGTTCTGGAC), DC-SIGN-R (CTAAAGGTCGAAGGATGGAG), DC-SIGNR-F (AACATCTGGGGACAGCG), and DC-SIGNR-R (GCAGTTACAACATTTACCACTT)) were designed from published cDNA sequences (1, 4). Genes were amplified from genomic DNA using the Promega Taq DNA polymerase system (Promega, Southampton, U.K.), dNTPs (2.0 mM), magnesium (2.0 mM), and cycle conditions of 92°C for 1 min, 60°C for 1 min, and 72°C for 2–6 min. PCR products were cloned with a TOPO-XL cloning kit (Invitrogen, San Diego, CA). cDNAs representing the entire coding region were cloned from placental cDNA as described above. Clones were sequenced as described previously (5). Predicted protein sequences were analyzed using Pix (http://menu.hgmp.mrc.ac.uk/menu-bin/Pix/) and ExPasy (http://www.expasy.ch/).

Mapping of the genes

Mapping was conducted by PCR using a radiation hybrid panel (HGMP-MRC) (6). A 366-bp sequence-tagged site from exon 4 of DC-SIGN was amplified as described with primers Lizol88 (CGCGATCTACCAGAACCTG) and Lizol91 (TCCTGGTAGATCTCCTGCAT). The map position was analyzed with the RhYme program (http://menu.hgmp.mrc.ac.uk/menu-bin/RHyME/).

P1 artificial chromosome (PAC)4 identification

Gridded human RPCI 1–5 PAC libraries (7) were hybridized for 20 h with 50 ng of [{alpha}-32P]dCTP-labeled full-length DC-SIGN cDNA. Membranes were washed to a stringency of 1 x SSC/0.1% SDS at 65°C and exposed to x-ray film at -70°C for 24 h (8, 9, 10). Positive clones were provided by the Human Genome Mapping Project Resource Center. DNA was extracted using standard techniques (9). PAC DNA (150 ng) was digested with NotI (New England Biolabs, Beverly, MA) and separated on a pulse-field gel, with ramped switch times from 1–13 s at 200 V for 16 h. PCR screening confirmed the presence of DC-SIGN, DC-SIGNR, or CD23 on the PACs. Results were confirmed by sequencing (5).

DNA blot analysis

PAC DNA (20 µg) was digested with the restriction enzymes EcoRI (New England Biolabs) and PstI (New England Biolabs), followed by electrophoresis on 0.8% agarose-TBE gel. DNA was transferred to a Hybond N+ nylon membrane. Membranes were prehybridized for 1 h in hybridization buffer (0.001 M EDTA, 0.5 M sodium phosphate (pH 7.2), and 7% SDS). Fifty nanograms of a 140-bp probe across exon 5 of DC-SIGN was labeled with [{alpha}-32P]dCTP and hybridized for 18 h at 65°C (7). Membranes were washed to a stringency of 0.1% SSC with 0.1% SDS at 65°C and exposed to Biomax MR film (Eastman Kodak, Rochester, NY) for 12 h.

Cell culture and cDNA

Human YT, U937, Ind, 293T, and HCMED1-E6, were cultured in RPMI 1640, 10% FCS, 100 U/ml penicillin, and 100 U/ml streptomycin. Human Jurkat, T47D, MRC5, and C33a were cultured in DMEM, 10% FCS, 100 U/ml penicillin/streptomycin, and 2 mM L-glutamine. HT29 cells were cultured in DMEM/F12 (1/1), 10% FCS, and 100 U/ml penicillin/streptomycin. KG1 cells were cultured in IMDM, 20% FCS, 100 mM L-glutamine, and 100 U/ml penicillin/streptomycin and stimulated with PMA (10 ng/ml) and ionomycin (100 ng/ml; Sigma, St. Louis, MO) (11). Langerhans-type dendritic cells (12, 13) were donated by Paul Lehner (Cambrdige University, Cambridge, U.K.). Total RNA was isolated using th RNA-easy minikit (Qiagen, Crawley, U.K.). Placental and endometrial cDNA were donated by Amanda Evans (Cambridge University). Monocyte-derived dendritic cell cDNA (14) was donated by Jason Caulfield (Kings College, London, U.K.).

RT-PCR

First-strand cDNA was prepared using polyT and the Superscript kit (Life Technologies, Paisley, U.K.). cDNA synthesis was controlled using GAPDH primers (forward, ACCACAGTCCATGCCATCAC; reverse, TCCACCACCCTGTTGCTGTA). PCR for DC-SIGN and DC-SIGNR was performed with: DC-SIGN: Lizol125, TGCAACTCCTCTCCTTCAC; Lizol202, CTTTGCAGGCGGTGAT; and DC-SIGNR: Lizol126, TGCAACTCCTCTCCTTCAT; Lizol201, CTGGCAGGCGGTGAC. PCR conditions were 92°C for 1 min, 61°C for 1 min, and 72°C for 2 min for 35 cycles, with magnesium at 1.5 mM. PCR was controlled using DC-SIGN and DC-SIGNR cDNA clones. PCR products were sequenced (5).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning and sequencing of cDNAs

Using the GenBank database sequence for DC-SIGN (1) and a closely related partial cDNA sequence, AB015629 (4), end primers were designed, and full-length cDNAs were cloned from human placenta. Comparison of our full-length AB015629 clone, now termed DC-SIGNR, with the previously published sequence revealed two extra exons. Additionally a 330-bp 3' intron (Fig. 4GoA) previously described in AB015629 cDNA had been spliced out of our cDNA.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. A, DC-SIGN and DC-SIGNR gene structures. These were assembled by comparison of the full genomic sequence of DC-SIGN and partial sequence of DC-SIGNR. The two genes have very similar gene structures, except for the presence of an additional 3' untranslated exon of DC-SIGNR. This is present in cDNA. Sequence data across intron 2 of DC-SIGNR are incomplete. Sizes are shown in nucleotides. CYT, cytoplasmic domain; TM, transmembrane domain. Note that in the previously published partial DC-SIGNR cDNA sequence AB015629 (4 ), intron 7 had not been spliced out of the 3' untranslated region. B, Intron-exon boundaries of DC-SIGN and DC-SIGNR. All intron-exon boundaries follow the ag/gt rule. Initiating ATGs are underlined. 5' and 3' untranslated regions are shown in italics. Exons are written in capital letters. Introns are written in lower case letters. AG/GT splice donor and acceptor sites are shown in bold type. DC-SIGN has a short 3' untranslated region, encoded by only one exon and consisting of 59 bases, while the DC-SIGNRs 289-bp 3' untranslated region is encoded by two exons.

 
Both DC-SIGN and DC-SIGNR DNA sequences encode type II integral membrane proteins. The two genes show 73% identity at the nucleic acid level and 77% identity at the amino acid level. Predicted protein sequences from the full-length cDNAs are compared in Fig. 1Go. The cytoplasmic tails of both genes contained a di-leucine motif, which is a recognized internalization sequence (15). Exon 2 of DC-SIGN, but not that of DC-SIGNR, encodes a YXXL motif, as a further potential internalization signal (16). The putative transmembrane domains of DC-SIGN and DC-SIGNR consist of approximately 18 and 22 aa, respectively. An N-linked glycosylation sequence is found immediately after the transmembrane domains of both molecules (17), followed by a neck, encoded by a single exon, containing seven repeats of the 23 aa sequence KAAVGELxEKSKxQEIYQELTxL. The carbohydrate recognition domains (CRDs) are encoded by three separate exons, as described for CD23 (18) and the asialoglycoprotein receptors (19). These CRDs contain all the residues previously shown to be required for calcium-dependent binding of mannose (Fig. 2Go) (20).



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 1. Alignment of the predicted proteins, DC-SIGN and DC-SIGNR. The predicted proteins show 77% identity at the amino acid level. Potential N-linked glycosylation sites (NXT/S) (17 ) and possible cytoplasmic functional motifs (LL, di-leucine motif; YXXL, potential internalization motif) (16 23 24 ) are annotated. The beginning of each of the following is marked as follows: C, cytoplasmic domain; Tm, transmembrane domain; NR, neck repeats (boxed); CRD, carbohydrate recognition domains (bold type). In the previously published partial DC-SIGNR cDNA sequence (AB015629) (4 ), intron 7 had not been spliced out of the 3' untranslated region, and exons 2 and 6 were absent (sequences: 1, DC-SIGN; 2, DC-SIGNR).

 


View larger version (105K):
[in this window]
[in a new window]
 
FIGURE 2. Aligment of carbohydrate recognition domains of DC-SIGN and DC-SIGNR with other C-type lectins. Residues conserved among C-type lectins are shown in dark gray. H, hydrophobic; A, aliphatic; C, cysteine; G, glycine; E, glutamic acid; W, tryptophan; {phi}, aromatic amino acid. Residues involved in calcium-dependent binding of carbohydrates (+) are shown in light gray. Those in the region marked +P++ determine the carbohydrate binding specificity. EDN mediates mannose/acetylglucosamine binding and QPD glucose/galactose specificity (31 ). DC-SIGN and DC-SIGNR possess all the residues required for calcium-dependent binding of mannose. Rat and mouse CD23 also contain these residues, although they are also able to bind protein (32 ). Human CD23 contains the majority of these motifs (18 ). NK cell lectins and proteins that bind N-acetylglucosamine and galactose via a conserved QPD motif, such as the asialoglycoprotein receptors (20 ), are shown for comparison. *, cysteine residues usually conserved in NK cell receptors (31 ). Accession numbers are as follows: human DC-SIGN, M98457; human DC-SIGNR, AF245219; human DCIR, CAB54001; MBP (human mannose binding protein precursor) (NP 000233); human mincle, BAA83755.1; ASGPR-1 (human asialoglycoprotein receptor-1), NP 00162; ASGPR-2 (human asialoglycoprotein receptor-2), CAA38997; murine CD23, P20693; rat CD23, S34198; human CD23, A10542; human Lox-1, CAB38175; human CD69, NP 001772; human CD94, BAA24450; human NKG2A, AAD03419; human NKG2D, CAA38652; human Ly49L, AAD44160; chicken hepatic lectin 17.5(I50146); chicken B-lectin, CAA18960.

 
Mapping of DC-SIGN and DC-SIGNR

Mapping of DC-SIGN and DC-SIGNR was conducted by performing PCR across exon 4 of DC-SIGN on a radiation hybrid panel (HGMP) (6). Results were consistent with a localization on chromosome 19p13.3. The RPCI PAC libraries (7) were screened with a probe consisting of the full-length sequence of DC-SIGN. DC-SIGN and DC-SIGNR were found on overlapping PACs, the sizes of which were determined by pulse field gel electrophoresis (Fig. 3Go). PACs were screened by PCR using exon primers for DC-SIGN and DC-SIGNR as well as CD23, a C-type lectin known to map to 19p13 (21), revealing the gene order shown in Fig. 3Go. The smallest PAC containing DC-SIGN, DC-SIGNR, and CD23 has an insert size of 105 kbp. These data concur with preliminary high throughput genomic sequence data from The Lawrence Livermore center and with the localization of the CD23 gene (18). Therefore, these three C-type lectin genes, which have analogous genomic structures (see below), form a tight cluster on human chromosome 19p13. We probed the PAC clones to search for additional related genes using an exon 5 probe from DC-SIGN, which shows 93% identity to exon 5 of DC-SIGNR and <25% identity to CD23 at the nucleic acid level. Only two equimolar bands corresponding to DC-SIGN and DC-SIGNR were obtained on the PACs already identified (Fig. 3Go). Although we cannot rule out the presence of further closely related genes elsewhere in the genome, no additional EST sequences are currently identifiable, and high throughput genomic sequence data have revealed no evidence for this. It is therefore most likely that only two genes exist in the DC-SIGN family at 19p13.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 3. A, Alignment of PAC clones hybridizing with DC-SIGN. The RPCI 1–5 PAC libraries were screened with the full-length cDNA for DC-SIGN. Subsequent PCR confirmed that seven PACs contained DC-SIGNR, of which six contained DC-SIGN and three contained CD23 by PCR, consistent with the gene order shown. The smallest PACs containing all three genes are 105 kb. PAC sizes are as follows: 1098P12, 105 kb; 84B17, 105 kb; 1191N20, 110 kb; 362C12, 97 kb; 1103M8, 100 kb; 729E9, 108 kb; 765L11, 108 kb. B, Southern blot of PACs. A 300-bp probe was used to a conserved region using primers flanking exon 5 of the DC-SIGN gene. Digestion of all the DC-SIGNR-positive PACs was conducted with EcoRI and PstI, which did not cut within the probe sequence. There was no evidence for additional closely related genes on these PACs.

 
Gene structure of DC-SIGN and DC-SIGNR

The complete genes for DC-SIGN and DC-SIGNR were cloned by PCR from genomic DNA derived from a B cell lymphoma line and sequenced. Coding regions were predicted by alignment to the sequences obtained from placental cDNA. Both genomic sequences showed 100% identity to the corresponding cDNAs over the coding regions. Exon/intron structures of the two genes are shown in Fig. 4Go. All intron-exon boundaries follow the ag/gt rule (Fig. 4Go). The genes have very similar structures, except that DC-SIGNR has a longer 3' untranslated region, spanning two exons, compared with one in DC-SIGN. DC-SIGNR also contains an insert of approximately 1400 bp between exons 2 and 3, making intron 2 approximately 2000 bp, compared with 626 bp in DC-SIGN.

Expression pattern

Tissue specificity of expression was investigated by RT-PCR using gene-specific primers for DC-SIGN and DC-SIGNR (Fig. 5Go). In agreement with previous results (3), expression of DC-SIGN was restricted to endometrium, placenta, and stimulated KG1 cells (phenotypically similar to myeloid dendritic cells) (11). Although DC-SIGNR showed a lower level of expression, it was consistently detected in placenta with a very low level of expression in endometrium and stimulated KG1 cells. Cultured dendritic cells with a Langerhans cell-type phenotype (22) were negative for both molecules. We demonstrated a low level of expression of both DC-SIGN and DC-SIGNR by RT-PCR from monocyte-derived dendritic cells (data not shown) and subsequently cloned full-length cDNAs corresponding to both transcripts.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 5. DC-SIGN and DC-SIGNR gene-specific RT-PCR. Expression of DC-SIGN was restricted to placenta, endometrium, and stimulated KG1 cells (which are phenotypically similar to myeloid dendritic cells) (11 ) in agreement with previous results (3 ). Although DC-SIGNR expression was lower, it was consistently detected in placenta with very low expression in the endometrium and stimulated KG1 cells. Cultured dendritic cells with a Langerhans cell-type phenotype (22 ) were negative for both molecules. A, DC-SIGN; B, DC-SIGNR; C, GAPDH. Lane 1, U937 (monocyte cell line); lane 2, Jurkat (T cell line); lane 3, NKL (NK cell line); lane 4, YT (NK/T cell line); lane 5, Ind (B cell line); lane 6, peripheral blood leukocytes; lane 7, T47D (breast carcinoma line); lane 8, HT29 (colon carcinoma line); lane 9, MRC5 (fibroblast line); lane 10, C33a (E6-transformed keratinocyte line); lane 11, 293T (embryonic kidney cell line); lane 12, HVMED-E6 (E6 transformed vascular smooth muscle cell line); lane 13, term placenta; lane 14, endometrium; lane 15, PMA/ionomycin-stimulated KG1 cells; lane 16, Langerhans-type dendritic cells; lane 17, DC-SIGN cloned cDNA; lane 18, DC-SIGNR cloned cDNA; lane 19; water; lane 20, genomic DNA.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study describes the comparative sequences, genomic organization, mapping to chromosome 19p13, and expression analysis of two related C-type lectin genes, DC-SIGN and a novel, closely related gene, DC-SIGNR. These two genes and CD23, the low affinity receptor for IgE, are all encoded within a 105-kb region of 19p13. The DC-SIGN, DC-SIGNR, and CD23 genes all possess CRDs encoded by three separate exons. The close linkage and similar gene structures suggest that these three genes may have arisen via duplication of an ancestral gene.

The cytoplasmic tails of both DC-SIGN and DC-SIGNR contain di-leucine motifs, which may mediate internalization, thus indicating that these molecules may act as carbohydrate receptors (Fig. 1Go) (23). However, work by Geijtenbeek et al. suggests that endocytosis via DCSIGN is extremely inefficient in dendritic cells (2). A YXXL motif in the cytoplasmic tail of DC-SIGN (Fig. 1Go) may provide a further internalization motif (16) or, alternatively, a site for tyrosine phosphorylation (24).

CD23 has a neck consisting of three leucine-rich repeats in man and two in rat and mouse. This forms an {alpha}-helical coiled coil structure, which mediates trimerization (25, 26). Each of the repeat units is 21 aa long and is encoded by a separate exon. This contrasts with DC-SIGN and DC-SIGNR, which each have 7 repeats of a 23-aa sequence, encoded by a single exon (Fig. 4Go). There is very high sequence identity between the repeat units, within each protein, and between DC-SIGN and DC-SIGNR (Fig. 1Go). By analogy to other lectin receptors, such as the asialoglycoprotein receptors and CD23 (26, 27, 28, 29), we suggest that this domain could mediate oligomerization, forming an {alpha}-helical coiled coil. Oligomerization may serve to increase the avidity of ligand binding. The human asialoglycoprotein receptors, H1 and H2, have similar coiled coil neck structures and have been shown to form noncovalently associated heterotetramers with a stoichiometry of 2:2 (28). Like DC-SIGN and DC-SIGNR, the H1 and H2 genes are linked, but are found on chromosome 17p (30).

The sequences of the CRDs of DC-SIGN and DC-SIGNR show greatest identity to the human asialoglycoprotein receptors (41 and 34% at the amino acid level, respectively) and rat CD23 (both 33% at the amino acid level; Fig. 2Go). Consistent with previous work (1, 2, 3), DC-SIGN, shows features of a mannose binding lectin, as opposed to the features of a protein-binding NK cell lectin (Fig. 2Go) (31). DC-SIGNR, shows 77% identity to DC-SIGN at the amino acid level and also possesses all the residues shown to be required for the binding of mannose (Fig. 2Go) (31). The high level of homology between DC-SIGN and DC-SIGNR and their concomitant expression in placenta, endometrium, and a subset of dendritic cells suggest that DC-SIGNR may function in a similar manner to DC-SIGN, binding HIV gp120, ICAM-3 and perhaps other mannosylated proteins. Although it has been shown that the binding of DC-SIGN to ICAM3 and gp120 can be inhibited by mannan (1, 3) and may therefore not involve direct protein-protein interactions, the presence of the residues required for mannose binding must be interpreted cautiously. These residues are largely conserved in human CD23 and are completely conserved in murine and rat CD23 (Fig. 2Go), although the primary ligand of these molecules is thought to be IgE (18). Data suggest that mannose can partially inhibit the binding of human CD23 to certain of its ligands (32, 33). Therefore, DC-SIGN and DC-SIGNR may also bind a protein ligand, and experiments are underway to investigate this possibility.

The existence of a DC-SIGN-related gene (DC-SIGNR) with a similar pattern of expression is intriguing. Besides the formation of homo-oligomers, it is possible that hetero-oligomers of the two polypeptides may form, as described for the human asialoglycoprotein receptors (28). Given the heterogeneity of dendritic cell phenotypes (34), further investigation of the differential expression patterns of the two genes across these phenotypes and at different anatomical sites is warranted. A further question is posed by the high level of expression in placenta, which may not be accounted for entirely by the presence of cells with a dendritic cell phenotype. The expression of DC-SIGN or DC-SIGNR on placenta may provide the key to explaining the mechanism of vertical transmission of HIV and may therefore give valuable insights into its prevention.


    Acknowledgments
 
We acknowledge Mary Carrington and Kurt Drickamer for helpful discussion. We thank Amanda Evans, Jason Caulfield, Paul Macary, and Paul Lehner for provision of DNA, and Rachel Allen for careful reading of the manuscript.


    Footnotes
 
1 This work was supported by grants from the Wellcome Trust, the Medical Research Council, a Medical Research Council Clinical Training Fellowship (to E.J.S.), and the Sackler Foundation (to E.J.S.). Back

2 The following accession numbers have been deposited in GenBank: AF209479 (DC-SIGN gene), AF209480 (DC-SIGNR gene, exons 1 and 2), AF209481 (DC-SIGNR gene, exons 3–8), and AF245219 (DC-SIGNR cDNA). Back

3 Address correspondence and reprint requests to Dr. Elizabeth J. Soilleux, Department of Pathology, Cambridge University, Tennis Court Road, Cambridge, U.K. CB2 1QP. Back

4 Abbreviations used in this paper: PAC, P1 artificial chromosome; CRD, carbohydrate recognition domain. Back

Received for publication May 31, 2000. Accepted for publication July 12, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Curtis, B. M., S. Scharnowske, A. J. Watson. 1992. Sequence and expression of a membrane-associated C-type lectin that exhibits CD4-independent binding of human immunodeficiency virus envelope glycoprotein gp120. Proc. Natl. Acad. Sci. USA 89:8356.[Abstract/Free Full Text]
  2. Geijtenbeek, T. B. H., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. F. van Duijnhoven, J. Middel, I. L. M. H. A. Cornelissen, H. S. L. M. Nottet, V. N. KewalRamani, D. R. Littman, et al 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100:587.[Medline]
  3. Geijtenbeek, T. B. H., R. Torensma, S. J. van Vliet, G. C. F. van Duijnhoven, G. J. Adema, Y. van Kyook, D. G. Figdor. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575.[Medline]
  4. Yokoyama-Kobayashi, M., T. Yamaguchi, S. Sekine, S. Kato. 1999. Selection of cDNAs encoding putative type II membrane proteins on the cell surface from a human full-length cDNA bank. Gene 228:161.[Medline]
  5. Wilson, M. J., M. Torkar, J. Trowsdale. 1997. Genomic organization of a human killer cell inhibitory receptor gene. Tissue Antigens 49:574.[Medline]
  6. Gyapay, G., K. Schmitt, C. Fizames, H. Jones, N. Vega-Czarny, D. Spillett, D. Muselet, J. F. Prud’Homme, C. Dib, C. Auffray, et al 1996. A radiation hybrid map of the human genome. Hum. Mol. Genet. 5:339.[Abstract/Free Full Text]
  7. Ioannou, P. A., P. J. de Jong. 1996. Construction of bacterial artificial chromosome libraries using the modified P1 (PAC) system. N. C. Dracopoli, and J. L. Haines, and B. R. Korf, and D. T. Moir, and C. C. Morton, and C. E. Seidman, and J. G. Seidman, and D. R. Smith, eds. In Current Protocols in Human Genetics Vol. 5:5.15. John Wiley & Sons, New York.
  8. Feinberg, A. P., B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6.[Medline]
  9. Sambrook, J., E. F. Fritch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Vol. 1. N. Ford, C. Nolan, M. Ferguson, and M. Ockler, eds. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  10. Ioannou, P. A., C. T. Amemiya, J. Garnes, P. M. Kroisel, H. Shizuya, C. Chen, M. A. Batzer, P. J. de Jong. 1994. A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nat. Genet. 6:84.[Medline]
  11. St. Louis, D. C., J. B. Woodcock, G. Fransozo, P. J. Blair, L. M. Carlson, M. Murillo, M. R. Wells, A. J. Williams, D. S. Smoot, S. Kaushal, et al 1999. Evidence for distinct intracellular signaling pathways in CD34+ progenitor to dendritic cell differentiation from a human cell line model. J. Immunol. 162:3237.[Abstract/Free Full Text]
  12. Strobl, H., C. Bello-Fernandez., E. Riedl, W. F. Pickl, O. Majdic, S. D. Lyman, W. Knapp. 1997. flt3 ligand in cooperation with transforming growth factor-beta1 potentiates in vitro development of Langerhans-type dendritic cells and allows single-cell dendritic cell cluster formation under serum-free conditions. Blood 90:1425.[Abstract/Free Full Text]
  13. Gatti, E., M. A. Velleca, B. C. Biedermann, W. Ma, J. Unternaehrer, M. W. Ebersold, R. Medzhitov, J. S. Pober, I. Mellman. 2000. Large-scale culture and selective maturation of human Langerhans cells from granulocyte colony-stimulating factor-mobilized CD34+ progenitors. J. Immunol. 164:3600.[Abstract/Free Full Text]
  14. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J. Exp. Med. 179:1109.-1118. [Abstract/Free Full Text]
  15. Trowbridge, I. S.. 1991. Endocytosis and signals for internalization. Curr. Opin. Cell Biol. 3:634.[Medline]
  16. Trowbridge, I. S., J. F. Collawn, C. R. Hopkins. 1993. Signal-dependent membrane protein trafficking in the endocytic pathway. Annu. Rev. Cell Biol. 9:129.
  17. Lanctot, P. M., P. C. Leclerc, E. Escher, R. Leduc, G. Guillemette. 1999. Role of N-glycosylation in the expression and functional properties of human AT1 receptor. Biochemistry 38:8621.[Medline]
  18. Suter, U., R. Bastos, H. Hofstetter. 1987. Molecular structure of the gene and the 5'-flanking region of the human lymphocyte immunoglobulin E receptor. Nucleic Acids Res. 15:7295.[Abstract/Free Full Text]
  19. Bezouska, K., G. V. Crichlow, J. M. Rose, M. E. Taylor, K. Drickamer. 1991. Evolutionary conservation of intron position in a subfamily of genes encoding carbohydrate-recognition domains. J. Biol. Chem. 266:11604.[Abstract/Free Full Text]
  20. Drickamer, K.. 1992. Engineering galactose-binding activity into a C-type mannose-binding protein. Nature 360:183.[Medline]
  21. Lopez-Cabrera, M., A. G. Santis, E. Fernandez-Ruiz, R. Blacher, F. Esch, P. Sanchez-Mateos, F. Sanchez-Madrid. 1993. Molecular cloning, expression, and chromosomal localization of the human earliest lymphocyte activation antigen AIM/CD69, a new member of the C-type animal lectin superfamily of signal-transmitting receptors. J. Exp. Med. 178:537.[Abstract/Free Full Text]
  22. Herbst, B., G. Kohler, A. Mackensen, H. Veelken, A. Lindemann. 1998. GM-CSF promotes differentiation of a precursor cell of monocytes and Langerhans-type dendritic cells from CD34+ haemopoietic progenitor cells. Br. J. Haematol. 101:231.[Medline]
  23. Francis, M. J., E. E. Jones, E. R. Levy, R. L. Martin, S. Ponnambalam, A. P. Monaco. 1999. Identification of a di-leucine motif within the C terminus domain of the Menkes disease protein that mediates endocytosis from the plasma membrane. J. Cell Sci. 112:1721.[Abstract]
  24. Bates, E. E., N. Fournier, E. Garcia, J. Valladeau, I. Durand, J. J. Pin, S. M. Zurawski, S. Patel, J. S. Abrams, S. Lebecque, et al 1999. APCs express DCIR, a novel C-type lectin surface receptor containing an immunoreceptor tyrosine-based inhibitory motif. J. Immunol. 163:1973.[Abstract/Free Full Text]
  25. Beavil, R. L., P. Graber, N. Aubonney, J. Y. Bonnefoy, H. J. Gould. 1995. CD23/Fc{epsilon}RII and its soluble fragments can form oligomers on the cell surface and in solution. Immunology 84:202.[Medline]
  26. Dierks, S. E., W. C. Bartlett, R. L. Edmeades, H. J. Gould, M. Rao, D. H. Conrad. 1993. The oligomeric nature of the murine Fc{epsilon}RII/CD23: implications for function. J. Immunol. 150:2372.[Abstract]
  27. Beavil, A. J., R. L. Edmeades, H. J. Gould, B. J. Sutton. 1992. {alpha}-Helical coiled-coil stalks in the low-affinity receptor for IgE (Fc{epsilon}RII/CD23) and related C-type lectins. Proc. Natl. Acad. Sci. USA 89:753.[Abstract/Free Full Text]
  28. Bider, M. D., J. M. Wahlberg, R. A. Kammerer, M. Spiess. 1996. The oligomerization domain of the asialoglycoprotein receptor preferentially forms 2:2 heterotetramers in vitro. J. Biol. Chem. 271:31996.[Abstract/Free Full Text]
  29. Hoppe, H. J., K. B. Reid. 1994. Trimeric C-type lectin domains in host defence. Structure 2:1129.[Medline]
  30. Maglott, D. R., K. S. Katz, H. Sicotte, K. D. Pruitt. 2000. NCBI’s LocusLink and Ref. Seq. Nucleic Acids Res. 28:126.
  31. Weis, W. I., M. E. Taylor, K. Drickamer. 1998. The C-type lectin superfamily in the immune system. Immunol. Rev. 163:19.[Medline]
  32. Bajorath, J., A. Aruffo. 1996. Structure-based modeling of the ligand binding domain of the human cell surface receptor CD23 and comparison of two independently derived molecular models. Protein Sci. 5:240.[Medline]
  33. Richardson, D. R., K. Cameron, B. Robinson, K. J. Turner. 1993. The mechanisms of IgE uptake by human alveolar macrophages and a human B-lymphoblastoid cell line (Wil-2wt). Immunology 79:305.[Medline]
  34. Hart, D. N.. 1997. Dendritic cells: unique leukocyte populations which control the primary immune response. Blood 90:3245.[Free Full Text]



This article has been cited by other articles:


Home page
GlycobiologyHome page
H. Takagi, M. Numazaki, T. Kajiwara, Y. Abe, M. Ishii, C. Kato, and N. Kojima
Cooperation of specific ICAM-3 grabbing nonintegrin-related 1 (SIGNR1) and complement receptor type 3 (CR3) in the uptake of oligomannose-coated liposomes by macrophages
Glycobiology, March 1, 2009; 19(3): 258 - 266.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
H Li, N L-S Tang, P K-S Chan, C-Y Wang, D S-C Hui, C Luk, R Kwok, W Huang, J J-Y Sung, Q-P Kong, et al.
Polymorphisms in the C-type lectin genes cluster in chromosome 19 and predisposition to severe acute respiratory syndrome coronavirus (SARS-CoV) infection
J. Med. Genet., November 1, 2008; 45(11): 752 - 758.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K.-F. Kong, K. Delroux, X. Wang, F. Qian, A. Arjona, S. E. Malawista, E. Fikrig, and R. R. Montgomery
Dysregulation of TLR3 Impairs the Innate Immune Response to West Nile Virus in the Elderly
J. Virol., August 1, 2008; 82(15): 7613 - 7623.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Q. Wang and S. Pang
An intercellular adhesion molecule-3 (ICAM-3) -grabbing nonintegrin (DC-SIGN) efficiently blocks HIV viral budding
FASEB J, April 1, 2008; 22(4): 1055 - 1064.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
S. Meyer, B. Tefsen, A. Imberty, R. Geyer, and I. van Die
The C-type lectin L-SIGN differentially recognizes glycan antigens on egg glycosphingolipids and soluble egg glycoproteins from Schistosoma mansoni
Glycobiology, October 1, 2007; 17(10): 1104 - 1119.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Malcherek, L. Mayr, P. Roda-Navarro, D. Rhodes, N. Miller, and J. Trowsdale
The B7 Homolog Butyrophilin BTN2A1 Is a Novel Ligand for DC-SIGN
J. Immunol., September 15, 2007; 179(6): 3804 - 3811.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Dominguez-Soto, L. Aragoneses-Fenoll, E. Martin-Gayo, L. Martinez-Prats, M. Colmenares, M. Naranjo-Gomez, F. E. Borras, P. Munoz, M. Zubiaur, M. L. Toribio, et al.
The DC-SIGN-related lectin LSECtin mediates antigen capture and pathogen binding by human myeloid cells
Blood, June 15, 2007; 109(12): 5337 - 5345.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. J. Bahlis, A. M. King, D. Kolonias, L. M. Carlson, H. Y. Liu, M. A. Hussein, H. R. Terebelo, G. E. Byrne Jr, B. L. Levine, L. H. Boise, et al.
CD28-mediated regulation of multiple myeloma cell proliferation and survival
Blood, June 1, 2007; 109(11): 5002 - 5010.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y.-P. Shih, C.-Y. Chen, S.-J. Liu, K.-H. Chen, Y.-M. Lee, Y.-C. Chao, and Y.-M. A. Chen
Identifying Epitopes Responsible for Neutralizing Antibody and DC-SIGN Binding on the Spike Glycoprotein of the Severe Acute Respiratory Syndrome Coronavirus.
J. Virol., November 1, 2006; 80(21): 10315 - 10324.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
E. Falkowska, R. J. Durso, J. P. Gardner, E. G. Cormier, R. A. Arrigale, R. N. Ogawa, G. P. Donovan, P. J. Maddon, W. C. Olson, and T. Dragic
L-SIGN (CD209L) isoforms differently mediate trans-infection of hepatoma cells by hepatitis C virus pseudoparticles
J. Gen. Virol., September 1, 2006; 87(9): 2571 - 2576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Guo, C. E. Atkinson, M. E. Taylor, and K. Drickamer
All but the Shortest Polymorphic Forms of the Viral Receptor DC-SIGNR Assemble into Stable Homo- and Heterotetramers
J. Biol. Chem., June 16, 2006; 281(24): 16794 - 16798.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
I. Caminschi, A. J Corbett, C. Zahra, M. Lahoud, K. M Lucas, M. Sofi, D. Vremec, T. Gramberg, S. Pohlmann, J. Curtis, et al.
Functional comparison of mouse CIRE/mouse DC-SIGN and human DC-SIGN
Int. Immunol., May 1, 2006; 18(5): 741 - 753.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. W. Davis, H.-Y. Nguyen, S. L. Hanna, M. D. Sanchez, R. W. Doms, and T. C. Pierson
West Nile Virus Discriminates between DC-SIGN and DC-SIGNR for Cellular Attachment and Infection
J. Virol., February 1, 2006; 80(3): 1290 - 1301.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Dakappagari, T. Maruyama, M. Renshaw, P. Tacken, C. Figdor, R. Torensma, M. A. Wild, D. Wu, K. Bowdish, and A. Kretz-Rommel
Internalizing Antibodies to the C-Type Lectins, L-SIGN and DC-SIGN, Inhibit Viral Glycoprotein Binding and Deliver Antigen to Human Dendritic Cells for the Induction of T Cell Responses
J. Immunol., January 1, 2006; 176(1): 426 - 440.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Granelli-Piperno, A. Pritsker, M. Pack, I. Shimeliovich, J.-F. Arrighi, C. G. Park, C. Trumpfheller, V. Piguet, T. M. Moran, and R. M. Steinman
Dendritic Cell-Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin/CD209 Is Abundant on Macrophages in the Normal Human Lymph Node and Is Not Required for Dendritic Cell Stimulation of the Mixed Leukocyte Reaction
J. Immunol., October 1, 2005; 175(7): 4265 - 4273.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. G. Hibbert, P. Teriete, G. J. Grundy, R. L. Beavil, R. Reljic, V. M. Holers, J. P. Hannan, B. J. Sutton, H. J. Gould, and J. M. McDonnell
The structure of human CD23 and its interactions with IgE and CD21
J. Exp. Med., September 19, 2005; 202(6): 751 - 760.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. J. Cejas, L. M. Carlson, D. Kolonias, J. Zhang, I. Lindner, D. D. Billadeau, L. H. Boise, and K. P. Lee
Regulation of RelB Expression during the Initiation of Dendritic Cell Differentiation
Mol. Cell. Biol., September 1, 2005; 25(17): 7900 - 7916.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. J. Cejas, L. M. Carlson, J. Zhang, S. Padmanabhan, D. Kolonias, I. Lindner, S. Haley, L. H. Boise, and K. P. Lee
Protein Kinase C {beta}II Plays an Essential Role in Dendritic Cell Differentiation and Autoregulates Its Own Expression
J. Biol. Chem., August 5, 2005; 280(31): 28412 - 28423.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Fernandez, S. Alonso, I. Valera, A. G. Vigo, M. Renedo, L. Barbolla, and M. S. Crespo
Mannose-Containing Molecular Patterns Are Strong Inducers of Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Macrophages
J. Immunol., June 15, 2005; 174(12): 8154 - 8162.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. de la Rosa, M. Yanez-Mo, R. Samaneigo, D. Serrano-Gomez, L. Martinez-Munoz, E. Fernandez-Ruiz, N. Longo, F. Sanchez-Madrid, A. L. Corbi, and P. Sanchez-Mateos
Regulated recruitment of DC-SIGN to cell-cell contact regions during zymosan-induced human dendritic cell aggregation
J. Leukoc. Biol., May 1, 2005; 77(5): 699 - 709.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. A. Snyder, J. Ford, P. Torabi-Parizi, J. A. Arthos, P. Schuck, M. Colonna, and P. D. Sun
Characterization of DC-SIGN/R Interaction with Human Immunodeficiency Virus Type 1 gp120 and ICAM Molecules Favors the Receptor's Role as an Antigen-Capturing Rather than an Adhesion Receptor
J. Virol., April 15, 2005; 79(8): 4589 - 4598.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. L. Rogers, T. W. Gobel, B. C. Viertlboeck, S. Milne, S. Beck, and J. Kaufman
Characterization of the Chicken C-Type Lectin-Like Receptors B-NK and B-lec Suggests That the NK Complex and the MHC Share a Common Ancestral Region
J. Immunol., March 15, 2005; 174(6): 3475 - 3483.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Modis, S. Ogata, D. Clements, and S. C. Harrison
Variable Surface Epitopes in the Crystal Structure of Dengue Virus Type 3 Envelope Glycoprotein
J. Virol., January 15, 2005; 79(2): 1223 - 1231.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Lanoue, M. R. Clatworthy, P. Smith, S. Green, M. J. Townsend, H. E. Jolin, K. G.C. Smith, P. G. Fallon, and A. N.J. McKenzie
SIGN-R1 Contributes to Protection against Lethal Pneumococcal Infection in Mice
J. Exp. Med., December 6, 2004; 200(11): 1383 - 1393.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. A. Jeffers, S. M. Tusell, L. Gillim-Ross, E. M. Hemmila, J. E. Achenbach, G. J. Babcock, W. D. Thomas Jr., L. B. Thackray, M. D. Young, R. J. Mason, et al.
CD209L (L-SIGN) is a receptor for severe acute respiratory syndrome coronavirus
PNAS, November 2, 2004; 101(44): 15748 - 15753.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. Encabo, P. Solves, E. Mateu, P. Sepulveda, F. Carbonell-Uberos, and M. D. Minana
Selective Generation of Different Dendritic Cell Precursors from CD34+ Cells by Interleukin-6 and Interleukin-3
Stem Cells, September 1, 2004; 22(5): 725 - 740.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Van Liempt, A. Imberty, C. M. C. Bank, S. J. Van Vliet, Y. Van Kooyk, T. B. H. Geijtenbeek, and I. Van Die
Molecular Basis of the Differences in Binding Properties of the Highly Related C-type Lectins DC-SIGN and L-SIGN to Lewis X Trisaccharide and Schistosoma mansoni Egg Antigens
J. Biol. Chem., August 6, 2004; 279(32): 33161 - 33167.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Shiina, S. Shimizu, K. Hosomichi, S. Kohara, S. Watanabe, K. Hanzawa, S. Beck, J. K. Kulski, and H. Inoko
Comparative Genomic Analysis of Two Avian (Quail and Chicken) MHC Regions
J. Immunol., June 1, 2004; 172(11): 6751 - 6763.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Engering, S. J. van Vliet, K. Hebeda, D. G. Jackson, R. Prevo, S. K. Singh, T. B. H. Geijtenbeek, H. van Krieken, and Y. van Kooyk
Dynamic Populations of Dendritic Cell-Specific ICAM-3 Grabbing Nonintegrin-Positive Immature Dendritic Cells and Liver/Lymph Node-Specific ICAM-3 Grabbing Nonintegrin-Positive Endothelial Cells in the Outer Zones of the Paracortex of Human Lymph Nodes
Am. J. Pathol., May 1, 2004; 164(5): 1587 - 1595.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Liu, L. Tang, G. Zhang, H. Wei, Y. Cui, L. Guo, Z. Gou, X. Chen, D. Jiang, Y. Zhu, et al.
Characterization of a Novel C-type Lectin-like Gene, LSECtin: DEMONSTRATION OF CARBOHYDRATE BINDING AND EXPRESSION IN SINUSOIDAL ENDOTHELIAL CELLS OF LIVER AND LYMPH NODE
J. Biol. Chem., April 30, 2004; 279(18): 18748 - 18758.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. J.-Y. Ploquin, O. M. Diop, N. Sol-Foulon, L. Mortara, A. Faye, M. A. Soares, E. Nerrienet, R. Le Grand, Y. Van Kooyk, A. Amara, et al.
DC-SIGN from African Green Monkeys Is Expressed in Lymph Nodes and Mediates Infection in trans of Simian Immunodeficiency Virus SIVagm
J. Virol., January 15, 2004; 78(2): 798 - 810.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. R. Taylor, G. D. Brown, J. Herre, D. L. Williams, J. A. Willment, and S. Gordon
The Role of SIGNR1 and the {beta}-Glucan Receptor (Dectin-1) in the Nonopsonic Recognition of Yeast by Specific Macrophages
J. Immunol., January 15, 2004; 172(2): 1157 - 1162.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Cambi, F. de Lange, N. M. van Maarseveen, M. Nijhuis, B. Joosten, E. M.H.P. van Dijk, B. I. de Bakker, J. A.M. Fransen, P. H.M. Bovee-Geurts, F. N. van Leeuwen, et al.
Microdomains of the C-type lectin DC-SIGN are portals for virus entry into dendritic cells
J. Cell Biol., January 5, 2004; 164(1): 145 - 155.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. B. Klimstra, E. M. Nangle, M. S. Smith, A. D. Yurochko, and K. D. Ryman
DC-SIGN and L-SIGN Can Act as Attachment Receptors for Alphaviruses and Distinguish between Mosquito Cell- and Mammalian Cell-Derived Viruses
J. Virol., November 15, 2003; 77(22): 12022 - 12032.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Frison, M. E. Taylor, E. Soilleux, M.-T. Bousser, R. Mayer, M. Monsigny, K. Drickamer, and A.-C. Roche
Oligolysine-based Oligosaccharide Clusters: SELECTIVE RECOGNITION AND ENDOCYTOSIS BY THE MANNOSE RECEPTOR AND DENDRITIC CELL-SPECIFIC INTERCELLULAR ADHESION MOLECULE 3 (ICAM-3)-GRABBING NONINTEGRIN
J. Biol. Chem., June 20, 2003; 278(26): 23922 - 23929.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. Trumpfheller, C. G. Park, J. Finke, R. M. Steinman, and A. Granelli-Piperno
Cell type-dependent retention and transmission of HIV-1 by DC-SIGN
Int. Immunol., February 1, 2003; 15(2): 289 - 298.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Lin, F. Baribaud, J. Romano, R. W. Doms, and J. A. Hoxie
Identification of gp120 Binding Sites on CXCR4 by Using CD4-Independent Human Immunodeficiency Virus Type 2 Env Proteins
J. Virol., December 20, 2002; 77(2): 931 - 942.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Lin, G. Simmons, S. Pohlmann, F. Baribaud, H. Ni, G. J. Leslie, B. S. Haggarty, P. Bates, D. Weissman, J. A. Hoxie, et al.
Differential N-Linked Glycosylation of Human Immunodeficiency Virus and Ebola Virus Envelope Glycoproteins Modulates Interactions with DC-SIGN and DC-SIGNR
J. Virol., December 20, 2002; 77(2): 1337 - 1346.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. P. A. MacDonald, D. J. Munster, G. J. Clark, A. Dzionek, J. Schmitz, and D. N. J. Hart
Characterization of human blood dendritic cell subsets
Blood, December 15, 2002; 100(13): 4512 - 4520.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. A. Bashirova, L. Wu, J. Cheng, T. D. Martin, M. P. Martin, R. E. Benveniste, J. D. Lifson, V. N. KewalRamani, A. Hughes, and M. Carrington
Novel Member of the CD209 (DC-SIGN) Gene Family in Primates
J. Virol., December 6, 2002; 77(1): 217 - 227.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. B. H. Geijtenbeek, P. C. Groot, M. A. Nolte, S. J. van Vliet, S. T. Gangaram-Panday, G. C. F. van Duijnhoven, G. Kraal, A. J. M. van Oosterhout, and Y. van Kooyk
Marginal zone macrophages express a murine homologue of DC-SIGN that captures blood-borne antigens in vivo
Blood, September 26, 2002; 100(8): 2908 - 2916.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. Denda-Nagai, N. Kubota, M. Tsuiji, M. Kamata, and T. Irimura
Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens
Glycobiology, July 1, 2002; 12(7): 443 - 450.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. B. H. Geijtenbeek, A. Engering, and Y. van Kooyk
DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology
J. Leukoc. Biol., June 1, 2002; 71(6): 921 - 931.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Higashi, K. Fujioka, K. Denda-Nagai, S.-i. Hashimoto, S. Nagai, T. Sato, Y. Fujita, A. Morikawa, M. Tsuiji, M. Miyata-Takeuchi, et al.
The Macrophage C-type Lectin Specific for Galactose/N-Acetylgalactosamine Is an Endocytic Receptor Expressed on Monocyte-derived Immature Dendritic Cells
J. Biol. Chem., May 31, 2002; 277(23): 20686 - 20693.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Wu, T. D. Martin, R. Vazeux, D. Unutmaz, and V. N. KewalRamani
Functional Evaluation of DC-SIGN Monoclonal Antibodies Reveals DC-SIGN Interactions with ICAM-3 Do Not Promote Human Immunodeficiency Virus Type 1 Transmission
J. Virol., May 13, 2002; 76(12): 5905 - 5914.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. B. H. Geijtenbeek, G. C. F. van Duijnhoven, S. J. van Vliet, E. Krieger, G. Vriend, C. G. Figdor, and Y. van Kooyk
Identification of Different Binding Sites in the Dendritic Cell-specific Receptor DC-SIGN for Intercellular Adhesion Molecule 3 and HIV-1
J. Biol. Chem., March 22, 2002; 277(13): 11314 - 11320.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. J. Soilleux, L. S. Morris, G. Leslie, J. Chehimi, Q. Luo, E. Levroney, J. Trowsdale, L. J. Montaner, R. W. Doms, D. Weissman, et al.
Constitutive and induced expression of DC-SIGN on dendritic cell and macrophage subpopulations in situ and in vitro
J. Leukoc. Biol., March 1, 2002; 71(3): 445 - 457.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Wu, A. A. Bashirova, T. D. Martin, L. Villamide, E. Mehlhop, A. O. Chertov, D. Unutmaz, M. Pope, M. Carrington, and V. N. KewalRamani
Rhesus macaque dendritic cells efficiently transmit primate lentiviruses independently of DC-SIGN
PNAS, January 24, 2002; (2002) 32654399.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Valladeau, V. Clair-Moninot, C. Dezutter-Dambuyant, J.-J. Pin, A. Kissenpfennig, M.-G. Mattei, S. Ait-Yahia, E. E. M. Bates, B. Malissen, F. Koch, et al.
Identification of Mouse Langerin/CD207 in Langerhans Cells and Some Dendritic Cells of Lymphoid Tissues
J. Immunol., January 15, 2002; 168(2): 782 - 792.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Lee, G. Leslie, E. Soilleux, U. O'Doherty, S. Baik, E. Levroney, K. Flummerfelt, W. Swiggard, N. Coleman, M. Malim, et al.
cis Expression of DC-SIGN Allows for More Efficient Entry of Human and Simian Immunodeficiency Viruses via CD4 and a Coreceptor
J. Virol., December 15, 2001; 75(24): 12028 - 12038.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
H. Feinberg, D. A. Mitchell, K. Drickamer, and W. I. Weis
Structural Basis for Selective Recognition of Oligosaccharides by DC-SIGN and DC-SIGNR
Science, December 7, 2001; 294(5549): 2163 - 2166.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Lin, B. Lee, B. S. Haggarty, R. W. Doms, and J. A. Hoxie
CD4-Independent Use of Rhesus CCR5 by Human Immunodeficiency Virus Type 2 Implicates an Electrostatic Interaction between the CCR5 N Terminus and the gp120 C4 Domain
J. Virol., November 15, 2001; 75(22): 10766 - 10778.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Baribaud, S. Pohlmann, T. Sparwasser, M. T. Y. Kimata, Y.-K. Choi, B. S. Haggarty, N. Ahmad, T. Macfarlan, T. G. Edwards, G. J. Leslie, et al.
Functional and Antigenic Characterization of Human, Rhesus Macaque, Pigtailed Macaque, and Murine DC-SIGN
J. Virol., November 1, 2001; 75(21): 10281 - 10289.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Pohlmann, G. J. Leslie, T. G. Edwards, T. Macfarlan, J. D. Reeves, K. Hiebenthal-Millow, F. Kirchhoff, F. Baribaud, and R. W. Doms
DC-SIGN Interactions with Human Immunodeficiency Virus: Virus Binding and Transfer Are Dissociable Functions
J. Virol., November 1, 2001; 75(21): 10523 - 10526.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. G. Turville, J. Arthos, K. Mac Donald, G. Lynch, H. Naif, G. Clark, D. Hart, and A. L. Cunningham
HIV gp120 receptors on human dendritic cells
Blood, October 15, 2001; 98(8): 2482 - 2488.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. G. Park, K. Takahara, E. Umemoto, Y. Yashima, K. Matsubara, Y. Matsuda, B. E. Clausen, K. Inaba, and R. M. Steinman
Five mouse homologues of the human dendritic cell C-type lectin, DC-SIGN
Int. Immunol., October 1, 2001; 13(10): 1283 - 1290.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. J. Soilleux and N. Coleman
Langerhans cells and the cells of Langerhans cell histiocytosis do not express DC-SIGN
Blood, September 15, 2001; 98(6): 1987 - 1988.
[Full Text] [PDF]


Home page
J. Virol.Home page
S. Pöhlmann, F. Baribaud, B. Lee, G. J. Leslie, M. D. Sanchez, K. Hiebenthal-Millow, J. Münch, F. Kirchhoff, and R. W. Doms
DC-SIGN Interactions with Human Immunodeficiency Virus Type 1 and 2 and Simian Immunodeficiency Virus
J. Virol., May 15, 2001; 75(10): 4664 - 4672.
[Abstract] [Full Text]


Home page
JEMHome page
A. A. Bashirova, T. B.H. Geijtenbeek, G. C.F. van Duijnhoven, S. J. van Vliet, J. B.G. Eilering, M. P. Martin, L. Wu, T. D. Martin, N. Viebig, P. A. Knolle, et al.
A Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Nonintegrin (DC-SIGN)-related Protein Is Highly Expressed on Human Liver Sinusoidal Endothelial Cells and Promotes HIV-1 Infection
J. Exp. Med., March 12, 2001; 193(6): 671 - 678.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Pohlmann, E. J. Soilleux, F. Baribaud, G. J. Leslie, L. S. Morris, J. Trowsdale, B. Lee, N. Coleman, and R. W. Doms
DC-SIGNR, a DC-SIGN homologue expressed in endothelial cells, binds to human and simian immunodeficiency viruses and activates infection in trans
PNAS, February 27, 2001; 98(5): 2670 - 2675.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mummidi, G. Catano, L. Lam, A. Hoefle, V. Telles, K. Begum, F. Jimenez, S. S. Ahuja, and S. K. Ahuja
Extensive Repertoire of Membrane-bound and Soluble Dendritic Cell-specific ICAM-3-grabbing Nonintegrin 1 (DC-SIGN1) and DC-SIGN2 Isoforms. INTER-INDIVIDUAL VARIATION IN EXPRESSION OF DC-SIGN TRANSCRIPTS
J. Biol. Chem., August 24, 2001; 276(35): 33196 - 33212.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Mitchell, A. J. Fadden, and K. Drickamer
A Novel Mechanism of Carbohydrate Recognition by the C-type Lectins DC-SIGN and DC-SIGNR. SUBUNIT ORGANIZATION AND BINDING TO MULTIVALENT LIGANDS
J. Biol. Chem., July 27, 2001; 276(31): 28939 - 28945.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Wu, A. A. Bashirova, T. D. Martin, L. Villamide, E. Mehlhop, A. O. Chertov, D. Unutmaz, M. Pope, M. Carrington, and V. N. KewalRamani
Rhesus macaque dendritic cells efficiently transmit primate lentiviruses independently of DC-SIGN
PNAS, February 5, 2002; 99(3): 1568 - 1573.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Soilleux, E. J.
Right arrow Articles by Trowsdale, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soilleux, E. J.
Right arrow Articles by Trowsdale, J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS