The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fonteh, A. N.
Right arrow Articles by Chilton, F. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fonteh, A. N.
Right arrow Articles by Chilton, F. H.
The Journal of Immunology, 2000, 165: 2773-2782.
Copyright © 00 by The American Association of Immunologists

Secretory Phospholipase A2 Receptor-Mediated Activation of Cytosolic Phospholipase A2 in Murine Bone Marrow-Derived Mast Cells1

Alfred N. Fonteh2,*, Gen-ichi Atsumi{dagger}, Tiffany LaPorte* and Floyd H. Chilton*,{ddagger}

* Departments of Internal Medicine, Pulmonary and Critical Care Medicine, {dagger} Infectious Diseases, and {ddagger} Physiology and Pharmacology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The current study examined the signal transduction steps involved in the selective release of arachidonic acid (AA) induced by the addition of secretory phospholipase A2 (sPLA2) isotypes to bone marrow-derived mast cells (BMMC). Overexpression of sPLA2 receptors caused a marked increase in AA and PGD2 release after stimulation of BMMC, implicating sPLA2 receptors in this process. The hypothesis that the release of AA by sPLA2 involved activation of cytosolic PLA2 (cPLA2) was next tested. Addition of group IB PLA2 to BMMC caused a transient increase in cPLA2 activity and translocation of this activity to membrane fractions. Western analyses revealed that these changes in cPLA2 were accompanied by a time-dependent gel shift of cPLA2 induced by phosphorylation of cPLA2 at various sites. A noncatalytic ligand of the sPLA2 receptor, p-amino-phenyl-{alpha}-D-mannopyranoside BSA, also induced an increase in cPLA2 activity in BMMC. sPLA2 receptor ligands induced the phosphorylation of p44/p42 mitogen-activated protein kinase. Additionally, an inhibitor of p44/p42 mitogen-activated protein kinase (PD98059) significantly inhibited sPLA2-induced cPLA2 activation and AA release. sPLA2 receptor ligands also increased Ras activation while an inhibitor of tyrosine phosphorylation (herbimycin) inhibited the increase in cPLA2 activation and AA release. Addition of partially purified sPLA2 from BMMC enhanced cPLA2 activity and AA release. Similarly, overexpression of mouse groups IIA or V PLA2 in BMMC induced an increase in AA release. These data suggest that sPLA2 mediate the selective release of AA by binding to cell surface receptors and then inducing signal transduction events that lead to cPLA2 activation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phospholipase A2s (PLA2)3 are a family of enzymes that have the capacity to hydrolyze fatty acids from the sn-2 position of glycerophospholipids (for review, see Ref. 1). Groups I, IIs (IIA, IIC, IID, IIE, IIF), III, V, and X PLA2 are five sets of enzymes in a highly conserved family of secreted or extracellular PLA2 (sPLA2) found in mammals (1, 2, 3, 4, 5, 6). Other nonsecretory PLA2 enzymes include group IV (IVA, IVB, IVC), cytosolic PLA2 (cPLA2); group VI, calcium-independent PLA2; and group VII and group VIII, acetyl hydrolases (1, 7, 8, 9). The secretory family of enzymes has a number of features that distinguish them from other major PLA2 families including a relatively low molecular mass (14–16 kDa), a high disulfide bond content, and a requirement for relatively high concentrations of calcium for catalysis. Many sPLA2s are synthesized as proenzymes that contain signal peptide sequences that facilitate their release from cells. Although sPLA2s have been studied extensively in mammals and in snake venoms, the physiological and pathophysiological roles of these enzymes are still not well known. Inspection of the numerous papers published in the past decade reveal that these sPLA2s have the potential to mediate a wide range of biological activities including 1) potent antibacterial effects (10, 11); 2) a key component in phospholipid digestion; 3) production of lysophospholipids that contribute to electrophysiologic alterations that lead to arrhythmogenesis in the heart or altered airway permeability and surfactant properties in the lung (12, 13, 14, 15); 4) serum markers and potential regulators of severe illnesses such as sepsis, shock, organ injury, and pancreatitis, all of which are linked to the development of adult respiratory distress syndrome and multiple organ failure (16, 17, 18, 19); 5) regulators of platelet aggregation in hemorrhagic diseases (20); 6) proinflammatory components in diseases such as rheumatoid arthritis and asthma (21, 22, 23, 24); 7) markers of cancer, initiators of cell proliferation in cancer cell lines, and a potent modifying locus in intestinal tumorigenesis in mice (25, 26, 27, 28, 29, 30); and 8) enzymatic producers of arachidonic acid (AA) that contribute to eicosanoid generation (31, 32, 33, 34, 35, 36). This daunting list of activities and diseases raises fundamental questions as to whether sPLA2s cause or are merely associated with many of the aforementioned effects. It also raises the important question of how this family of enzymes could influence such a wide range of biological activities.

To date, most of the biological activities of sPLA2 have been attributed to its enzymatic capacity to hydrolyze membrane phospholipids. However, several findings have been difficult to reconcile merely based on this characteristic. For example, Nair and colleagues demonstrated that intradermal injection of inactivated sPLA2 (no hydrolytic activity) causes similar phenotypic changes in skin to those observed with injection of fully active sPLA2 (37). Similarly, others have shown that the physiologic actions of sPLA2 are not due to hydrolytic activity (38, 39). We have demonstrated that very low concentrations (low nanomolar) of certain sPLA2 isotypes cause the selective release of AA (but not other more abundant fatty acids) from mast cells (bone marrow-derived mast cells (BMMC) and CFTL-15) and THP-1 cells (40). Several lines of evidence suggest that this response is not mediated by the capacity of sPLA2 to hydrolyze membrane phospholipids but by specific binding of sPLA2 to cell surface receptors.

In the last 10 years, different subtypes of membrane receptors for sPLA2 have been identified in a variety of cell types by determining their affinities for various types of sPLA2 (41, 42). Work by Arita and colleagues described the existence of a specific receptor family termed PLA2-I that is abundant in brain and several other tissues and has high affinity for the binding of pancreatic-type sPLA2 (41). More recently, receptors have been divided into two classes termed N-type receptors and M-type receptors. Lambeau and colleagues report that a major difference between N- and M-type receptors is their capacity to bind group III PLA2 (bee venom) (42). For example, the N-type receptor associates very tightly with both group IB PLA2 and group III PLA2, while the rabbit muscle M-type receptor tightly binds groups IB and IIA PLA2 but does not associate with group III PLA2 (42). However, recent studies suggest that binding specificity may also depend on species or the glycosylation patterns of sPLA2 isotypes or receptors (43, 44, 45).

M-type receptors have been cloned and sequenced and their structure shown to be homologous to the macrophage mannose receptor. Little is currently known about the signal transduction pathway that is initiated after occupancy of either the mannose or the sPLA2 receptor. It is known that binding of group IB sPLA2 to N-type receptor is calcium independent while the mannose receptor requires calcium for binding. Occupancy of the mannose receptor is also associated with tyrosine phosphorylation, while addition of group IBs PLA2 has been suggested to affect cell proliferation and AA release via its capacity to activate mitogen-activated protein kinase (MAPK) (46, 47, 48). The current study has focused on signal transduction events that are closely associated with AA mobilization induced by sPLA2 in mast cells. These experiments reveal that addition of sPLA2 isotypes to mast cells is associated with the activation and membrane translocation of group IV PLA2 (cPLA2).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Octadeuterated (5,6,8,9,11,12,14,15-2H) ([2H8]) AA and trideuterated ([2H3]) stearic acid (SA) were purchased from Biomol Research Laboratory (Plymouth Meeting, PA). Essentially fatty acid-free human serum albumin (HSA), group IB PLA2 (Naja naja) group III PLA2 (bee venom), essential and nonessential amino acids, mouse IgE anti-dinitrophenol (IgE anti-DNP), heat-inactivated FBS, calcium ionophore A23187, DTT, pertussis toxin (PTX), herbimycin, and phosphoinositide 3'-kinase (PI3-K) inhibitor, LY294002, were purchased from Sigma (St. Louis, MO). 1-Palmitoyl-2-[1-14C-]arachidonoyl-sn-glycero-3-phosphocholine (55.6 mCi/mmol) was purchased from Amersham (Arlington Heights, IL). Phospho-p44/p42 MAPK (T202/Y204) E10 mAb and p44/p42 MAPK mAb were purchased from New England Biolabs (Beverly, MA). MAPK-specific inhibitor (PD 98059) was purchased from Calbiochem (La Jolla, CA). RPMI 1640 cell culture media and HBSS were obtained from Life Technologies (Grand Island, NY). HRP-conjugated goat IgG fraction to guinea pig IgG was purchased from Cappel (West Chester, PA). Guinea pig polyclonal Ab raised against purified rabbit M-type 180-kDa sPLA2 receptor and cDNA (5.6 kb) of the same receptor in pBluescript vector were obtained from Dr. Gerard Lambeau (Centre National de la Recherche Scientifique-Institut de Pharmacologie Moleculaire et Cellulaire, Valbonne, France). Mouse groups IIA and V PLA2 vectors were obtained from Dr. B. Kennedy (Merck Frost, West Point, PA) and Dr. J. Arm (Harvard Medical School, Boston, MA), respectively. Enzyme immunoassay kit for detection of PGD2 and thromboxane (TX) B2 were purchased from Cayman Chemical (Ann Arbor, MI).

Mast cell culture and activation

BMMC were obtained from CBA/J mice (The Jackson Laboratory, Bar Harbor, ME) and grown in RPMI 1640 culture medium (Life Technologies) containing 10% (v/v) FCS, 50 µM 2-ME, 2 mM L-glutamine, 1% (v/v) penicillin/streptomycin, and 0.1% gentamicin. The culture medium was supplemented twice a week with 50% WEHI supernatant fluid as a source of IL-3. After 3 wk of culture, BMMC (viability >98% determined by trypan blue exclusion) were used for activation and transfection studies.

BMMC were removed from culture media and washed (three times) using HBSS containing 0.25 mg/ml HSA. Cells were counted and resuspended in HBSS containing calcium at 5 x 106 cells/assay. BMMC that had been sensitized with the optimum amount of IgE anti-DNP (0.5 µg/ml) were stimulated with 2 µg/ml Ag (DNP-HSA), 50 µM p-amino-phenyl-{alpha}-D-mannopyranoside BSA (APMP-BSA), and different concentrations of sPLA2 (0–100 nM) for 5 min or with 100 nM sPLA2 for different periods of time at 37°C (40). A total of 100 nM sPLA2 is the maximum amount of ligand that induced the selective release of AA from BMMC (40). For MAPK inhibitory studies, BMMC were incubated with vehicle alone (DMSO) or with 50 µM MAPK-specific inhibitor (PD 98059) for 10 min at 37°C before cell activation with sPLA2 for different periods of time indicated in the figure legends. To determine the signal transduction events upstream of MAPK, BMMC were incubated with tyrosine kinase inhibitor (5 µM herbimycin A), PI3-K inhibitor (25 µM LY 294002), or with the heterodimeric G-protein modulator (0.5 µg/ml PTX) for 30 min before stimulating with sPLA2 for 1 min. The concentrations of herbimycin A and PTX used have been shown to inhibit sPLA2-induced calcium mobilization (49). The concentrations of PD98059 and LY294002 were the recommended doses prescribed by the technical bulletin from the manufacturer (New England Biolabs). In all cases, the time of incubation of BMMC with inhibitors were chosen such that there was no change in cell viability determined by trypan blue exclusion. The effects of inhibitors were monitored using 100 nM group IB PLA2, a concentration of ligand that has previously been shown to induce maximal and selective release of AA from BMMC (40). At the end of the stimulation period, cells were removed from supernatant fluids by centrifugation (400 x g for 5 min). After the addition of four volumes of ethanol to the supernatant fluid, the mole quantities of fatty acids were determined by negative ion-chemical ionization gas chromatography/mass spectroscopy (NICI-GC/MS) as described below.

Overexpression of sPLA2 receptor in mast cells

sPLA2 M-type receptor cDNA was isolated from the pBluescript vector by digestion using XbaI followed by partial digestion using EcoRI. The 5.6-kb product was purified using a 1% agarose gel and asymmetrically subcloned into a mammalian expression vector (pCMV5 vector) provided by Dr. Zheng Cui (Wake Forest University School of Medicine, Winston-Salem, NC). Large quantities of the resulting plasmid (pCMV5/sPLA2R) were obtained by transforming competent Escherichia coli followed by extraction and purification using the Wizard Plus plasmid purification system from Promega (Madison, WI). Before transfection studies were performed, the authenticity of pCMV5/sPLA2R was determined by restriction mapping using EcoRI. Before transfection, mast cells were initially placed in fresh culture media for 24 h. Subsequently, mast cells (4 x 107cells/ml) were transfected by electroporation. Briefly, 0.25 ml of cell suspension was incubated with nothing (control), with 15 µg pCMV5, or with pCMV5/sPLA2R and placed on ice for 10 min. Electroporation was performed using a Bio-Rad Gene Pulser (Richmond, CA) with voltage and capacitance set at 270 V and 960 µF, respectively. Cells were then dispersed in 10 ml of BMMC media supplemented with stem cell factor (100 ng/ml) or with IL-3 (10 ng/ml). A total of 65–75% of cells were recovered 48 h after transfection, and the viability of these cells was >90% as determined by trypan blue exclusion. The expression of sPLA2 receptors was monitored at different time points after transfection by Western blot analysis as described below. Transfected and control cells were sensitized with 0.5 µg/ml IgE anti-DNP. Transfected BMMC were stimulated with 2 µg/ml Ag (DNP-HSA) or group IB PLA2 as described above, and mole quantities of fatty acids or prostanoids released into supernatant fluids were determined as described below.

Determination of sPLA2 receptor expression by Western blot analysis

Amounts of sPLA2 receptor expressed in mast cells were determined using cell lysates from 1 x 106 cells. Lysates were obtained by incubating BMMC in lysis buffer (100 mM Tris-HCl, pH 7.5, containing 0.1 M NaCl, 2 mM EDTA, 1% Nonidet P-40, 1 mM Na2VO3, 50 mM NaF, 0.1 mM N-tosyl-L-phenylalanine chloromethyl ketone, 0.1 mM quercetin, 1 mM PMSF, 1 µg/ml aprotinin, and 1 µg/ml leupeptin) for 10 min on ice. After removal of nuclei by centrifugation, SDS-PAGE and Western blot analysis was performed. Briefly, extracts were mixed with an equal volume of 2x loading buffer (0.125 M Tris, pH 6.8, 4% SDS, 20% glycerol, and 10% mercaptoethanol, 0.05% bromophenol blue) and boiled for 5 min. Proteins were separated by SDS-PAGE on a 4–20% polyacrylamide gel. Separated proteins were transferred onto polyvinylidene difluoride (PVDF) membranes, and the blots were incubated overnight with an anti-sPLA2 receptor Ab. Detection of the sPLA2 receptor was accomplished using HRP-conjugated goat IgG fraction to guinea pig IgG from Cappel and SuperSignal CL-HRP enhanced chemiluminescent substrate system from Pierce (Rockford, IL).

Quantitation of free fatty acids in supernatant fluids

[2H8]AA (100 ng) and [2H3]SA, as internal standards, were added to the ethanol extracts of supernatant fluids from Ag-stimulated, sPLA2-stimulated, and control cells. Fatty acids were then converted to pentafluorobenzylesters, and the mole quantities of free fatty acids was determined by NICI-GC/MS using a Hewlett-Packard model 5989 instrument (Palo Alto, CA) (40). Carboxylate anions (m/z) at 279, 281, 286, 303, and 311 for linoleic acid (LA), oleic acid (OA), [2H3]SA, AA, and [2H8]AA, respectively, were monitored.

Quantitation of eicosanoids in supernatant fluids

After stimulation of BMMC, PGB2 (250 ng) was added to ethanol extracts of supernatant fluids as an internal standard, and the samples were concentrated under a stream of nitrogen. Mole quantities of PGD2 and TXB2 were determined using an enzyme immunoassay kit (Cayman Chemical) following the protocol provided by the manufacturer. Amounts of leukotrienes (LT) were determined by reversed-phase HPLC as previously described (31). Briefly, samples were suspended in 30% methanol in water and injected onto an Ultrasphere ODS column (2.1 x 250 mm; Supelco, Bellefonte, PA) that had been conditioned in a solvent that consisted of methanol/water/phosphoric acid (550:450:0.2 v/v, pH 5.7). The solvent was delivered at a flow rate of 0.4 ml/min, and products were monitored (270 and 206 nm) using an Hewlett-Packard diode array detection system. After 5 min, eicosanoids were eluted from the column by increasing the amount of methanol to 100% over 50 min. Mole quantities of LT were determined by UV spectroscopy.

Determination of cPLA2 activity in cytosol and membrane fractions

After stimulation of BMMC with sPLA2 receptor ligands, cells were washed (two times) with HBSS containing 0.25 mg/ml HSA and 5 mM DTT. Cells were then suspended at 1 x 107 cells/ml in sonication buffer (10 mM HEPES, pH 7.4, containing 80 mM KCl, 1 mM EDTA, 1 mM EGTA, 40 µg/ml leupeptin, 25 µg/ml pepstatin, 1 mM PMSF, 10 mM NaF, 0.2 mM Na2VO3, and 4 mM DTT). Sonication (2 x 5 s) was performed using a probe sonicator (Heat System, Farmingdale, NY) at a power setting of 2 and 10% output. Cytosolic and membrane fractions were obtained after ultracentrifugation (100,000 x g for 1 h) and were maintained in sonication buffer containing 20% glycerol. Protein content of fractions was determined using the Coomassie Plus protein assay reagent (Pierce). cPLA2 activity was determined using 400 pmol sonicated vesicles of 1-palmitoyl-2-[1-14C-] arachidonoyl-sn-glycero-3-phosphocholine as substrate and protein from cytosolic (50 µg) or membrane fractions (100 µg). cPLA2 activity was initiated by the addition of substrate to fractions that had been preincubated for 15 min at 37°C in an assay mixture that contained 5 mM DTT. This preincubation was necessary for eliminating residual sPLA2 activity. Reactions were stopped by extracting lipids using the method of Bligh and Dyer (50). 1-Palmitoyl-2-[1-14C-]arachidonoyl-sn-glycero-3-phosphocholine and free fatty acid fractions were isolated by TLC on silica gel G developed in hexane/ethyl ether/formic acid (90:60:6 v/v) (31).

For size-exclusion chromatography (SEC), 300 µg of protein from cytosolic fractions of unstimulated and sPLA2-stimulated cells were loaded onto a Superose 12 column (Pharmacia, Piscataway, NJ), and proteins were eluted with 10 mM HEPES (pH 7.4) containing 80 mM KCl, 1 mM EDTA, 1 mM PMSF, and 1% glycerol at 0.4 ml/min. Fractions (1 min) were collected, and cPLA2 activity was determined using 100-µl aliquots of each fraction. Elution times for known protein standards (Bio-Rad) were obtained and used to calculate the molecular masses of the active fractions.

Western analysis of cPLA2 in cytosol and membrane fractions

Cytosolic and membrane fractions were prepared from BMMC that had been stimulated with sPLA2 receptor ligands as described above. Proteins in membrane fractions were concentrated by precipitation using 4 volumes of ethanol at -20°C. Equal amounts of cytosolic or membrane proteins were mixed with an equal volume of 2x SDS-PAGE loading buffer and then boiled for 5 min. Proteins were then separated on a 4–20% Tris/glycine polyacrylamide gel. Proteins were transferred onto PVDF membranes, and the blots were blocked using 5% nonfat milk in PBS containing 0.05% Tween (PBS-T) for 1 h. Blots were subsequently incubated with anti-cPLA2 Ab (1 µg/ml) in PBS-T containing 1% nonfat milk overnight. After washing with PBS-T (three times, 10 min), the blots were incubated with anti-rabbit IgG conjugated to HRP. Immunodetection was accomplished using the SuperSignal enhanced chemiluminescence reagents (Pierce).

Determination of MAPK activation

After BMMC stimulation with 100 nM group IB PLA2 for different periods of time, reactions were stopped using 4 volumes of ice-cold HBSS. Cell pellets were obtained after centrifugation and suspended in 50 µl lysis buffer. Protein amounts in lysates were determined using the Coomassie protein assay reagent as described above. Equal amounts of proteins (10 µg/lane) were mixed with 2x SDS-PAGE loading, and samples were boiled for 5 min. Proteins were separated by SDS-PAGE on a 4–20% polyacrylamide gel. Separated proteins were transferred onto PVDF membranes, and the blots were blocked with 5% nonfat milk in PBS-T (0.05%) for 1 h. The membranes were then incubated with p44/p42 MAPK Ab or phospho-MAPK Ab at dilutions of 1:1000 in PBS-T containing 5% nonfat milk. Detection of MAPK or phospho-MAPK was accomplished using an anti-rabbit Ab linked to HRP and SuperSignal CL-HRP enhanced chemiluminescent substrate system (Pierce). X-ray films were scanned for densitometry using an Image Master software system (Pharmacia) that was coupled to a Sharp JX 32F6 scanner (Mahwah, NJ).

Determination of Ras activation by affinity precipitation/immunoblotting

Ras activation was determined using the Ras activation kit (Upstate Biotechnology, Lake Placid, NY). Briefly, nonstimulated or group IB PLA2-stimulated BMMC were incubated in lysis/wash buffer (25 mM HEPES, pH 7.5, containing 0.15 M NaCl, 1% Igepal CA-630, 10 mM MgCl2, 1 mM EDTA, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 25 mM NaF, 1 mM Na2VO3, and 2% glycerol). Raf-1 Ras Assay Reagent Agarose conjugate (10 µl) was added to cell lysates (1 mg total protein) in 1 ml lysis buffer, and the mixture was gently rocked at 4°C for 30 min. The Agarose bead was then collected by microcentrifugation (14,000 x g, 5 s), washed (three times) using lysis buffer, and then resuspended in 2x SDS-PAGE buffer. Proteins were separated using a 4–20% Tris/glycine polyacylamide gel and then transferred to PVDF membranes. Immunodetection was accomplished using 1 µg/ml {alpha}-Ras clone RAS10 Ab (overnight, 4°C) and goat anti-mouse HRP-conjugated IgG (Bio-Rad) at 1:5000 for 1.5 h at room temperature as primary and secondary Abs, respectively. Detection of the activated Ras was accomplished using SuperSignal CL-HRP enhanced chemiluminescent substrate system (Pierce).

Partial purification of endogenous sPLA2

sPLA2 was extracted from 1.5 x 109 BMMC using 0.18 M H2SO4 overnight at 4°C. The acid extract was then concentrated by ethanol precipitation and sPLA2 isolated by SEC using 0.1 M Na2SO4, 0.1 M KH2PO4, pH 7.0, as the elution buffer at 0.5 ml/min. SEC was performed using an Altex Spherogel-TSK 3000SW column (7.5 mm internal diameter x 30 cm, Beckman Coulter, Fullerton, CA). Protein elution was monitored by UV at 280 nm, fractions (0.5 ml) were collected, and the sPLA2 activity was determined (31). The active fraction eluted from the SEC column with a molecular mass of ~14 kDa, and this procedure increased the sp. act. from 1.5 pmol/mg/min (acid extract) to 65 pmol/mg/min (active fraction from SEC). The active fraction was used to stimulate mast cells using protein concentrations ranging from 0 to 20 µg/ml.

Overexpression of mouse group IIA PLA2 or group V PLA2 in BMMC

Mouse group IIA PLA2 cDNA in a mammalian expression vector pSG5 or mouse group V PLA2 cDNA in pcDNA3.1 were isolated from transformed competent E. coli using the Wizard Plus plasmid purification system (Promega). Before transfection studies were performed, the authenticity of the plasmids was determined by restriction mapping using EcoRI (group IIA PLA2) or by PCR using the following primer pair for mouse group V PLA2: 5' primer, GATGAAGGGTCTCCTCACACTG; 3' primer, TAAGCAGAGGAAGTTGGGGTAA from Gene Bank, accession no. AF162713.1). Transfection was performed by electroporation as described above for the sPLA2 receptor. The expression of sPLA2 was monitored at different time points after transfection by activity measurements in the culture medium. Mole quantities of fatty acids released into supernatant fluids were determined by NICI-GC/MS.

Data analysis

All data are expressed as means ± SEM of separate experiments. Statistics (p values) were obtained from Student’s t test for paired samples. Asterisks denote p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
sPLA2 receptor expression is linked to the selective release of AA from stimulated BMMC

Our previous studies revealed that certain sPLA2 isotypes selectively release AA from cells (BMMC, CFTL-15, and THP-1) that contain sPLA2 receptors (40) To further examine the requirement of sPLA2 receptors in the selective release of AA from mast cells, the sPLA2 receptor was overexpressed in BMMC. BMMC transfected with a plasmid containing the cDNA of the M-type sPLA2 receptor, but not control vector, expressed large quantities of a 180-kDa protein that was recognized by specific Abs for the sPLA2 receptor (Fig. 1GoA).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. A, sPLA2 receptor expression in BMMC. Untransfected cells (control), mock- (pCMV5), and receptor cDNA-transfected (pCMV5/sPLA2R) BMMC were treated with lysis buffer and SDS loading buffer, and proteins were separated using a 4–20% polyacrylamide gel. sPLA2 receptor expression was determined by immunodetection using anti-rabbit sPLA2 receptor guinea pig polyclonal Ab and peroxidase-conjugated anti-guinea pig IgG. These data are representative of eight separate experiments. B, Release of AA from transfected cells stimulated with group IB PLA2. Untransfected ({square}), mock-transfected BMMC (), or BMMC-overexpressing sPLA2 receptors ({blacksquare}) were incubated with different concentrations of group IB PLA2 for 5 min at 37°C. Cell pellets were removed by centrifugation, and mole quantities of AA in supernatant fluids were determined by NICI-GC/MS. These data are representative of three separate experiments. C, Release of AA from transfected cells stimulated with Ag. BMMC under the same conditions above (B) were sensitized for 24 h and were not stimulated ({square}) or stimulated with Ag ({blacksquare}) for 5 min at 37°C. Cell pellets were removed by centrifugation, and mole quantities of AA in supernatant fluids were determined by NICI-GC/MS. These data are representative of six separate experiments.

 
To examine the relationship between sPLA2 receptor expression and AA release, control, mock-transfected, and receptor-overexpressing BMMC were challenged with different concentrations of group IB PLA2, and the release of AA was monitored by NICI-GC/MS. As shown in Fig. 1GoB, sPLA2 induced the mobilization of AA from control and mock-transfected cells. However, more AA was mobilized from BMMC at all concentrations of sPLA2 in cells overexpressing sPLA2 receptor when compared with control or mock-transfected cells. It is important to note that the amount of AA released by receptor-overexpressing cells after incubation with low concentrations (5–20 nM) of sPLA2 represents ~40% of the total cellular AA. This is likely the maximal amount of AA that can be released from the cell.

During mast cell stimulation with Ag, endogenous PLA2 is rapidly released into supernatant fluid and competes with group IB PLA2 for the same binding sites (31, 40). To determine whether this sPLA2 induced AA release by binding to cell surface receptors, receptor-overexpressing cells were stimulated with Ag and AA release was monitored. Fig. 1GoC shows that Ag induced the release of AA in all three conditions (control, pCMV5, or pCMV5/sPLA2R). However, Ag induced an ~8-fold higher release of AA from cells overexpressing the sPLA2 receptor.

The role of sPLA2 receptors in eicosanoid formation by stimulated mast cells was also examined. Mock-transfected cells formed PGD2 (16.5 pmol/5 x 106cell) and TXB2 (15.8 pmol/5 x 106) upon stimulation with 10 nM group IB PLA2 for 5 min. Cells overexpressing sPLA2 receptor formed more PGD2 (51.3 pmol/5 x 106 cells) and TXB2 (25.7 pmol/5 x 106 cells) than mock-transfected cells. Similarly, Ag stimulation induced more PGD2 and TXB2 formation in cells overexpressing sPLA2 receptors than control or mock-transfected cells (data not shown). In contrast, levels of LTB4 were not altered when mock-transfected cells (5.8 ± 0.8 pmol/5 x 106 BMMC, n = 3) or receptor-overexpressing cells (4.9 ± 1.4 pmol/5 x 106 BMMC, n = 3) were stimulated with group IB PLA2. In agreement with our previous studies, LTC4 was not detected by reversed-phase HPLC in the supernatant fluid when BMMC were stimulated with sPLA2 for 5 min (31). Taken together, these data suggest that sPLA2 receptor expression plays a role in the selective mobilization of AA and the formation of prostanoids when mast cells are stimulated with low nanomolar amounts of group IB PLA2. The failure of sPLA2 to increase LTB4 may be due to its incapacity to activate 5-LO in mast cells (31). Additionally, sPLA2 mobilizes AA from mainly phosphatidylethanolamine, a pool that is not readily used for leukotriene biosynthesis in mast cells (51).

Activation of cPLA2 by sPLA2 receptor ligands

A potential mechanism by which sPLA2 receptor ligands may induce the selective release of AA from mast cells is via cPLA2 activation. To test this hypothesis, BMMC were treated with group IB PLA2, and the activity of cPLA2 was determined in cytosolic and membrane fractions. In control cells, >95% of cPLA2 activity was located in the cytosol. After addition of different concentrations of group IB PLA2, there was a significant increase (2-fold at 100 nM sPLA2) in cPLA2 activity in the cytosolic fraction (Fig. 2GoA). Additionally, incubation of BMMC with group IB PLA2 resulted in a marked increase (>5- to 15-fold) in membrane-associated cPLA2 activity (Fig. 2GoB). To assure that the change in cytosolic activity was attributable to cPLA2, cytosolic proteins were separated by gel filtration chromatography, and PLA2 activities were assayed in 1-min fractions. SEC using a Pharmacia Superose 12 column (0.4 ml/min) indicated that the activity from cytosolic fractions obtained from untreated or group IB PLA2-treated BMMC eluted at a time (36–38 min) that corresponded to a protein of ~100 kDa.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 2. Activation of cPLA2 by sPLA2 receptor occupancy. A, BMMC were incubated without or with different concentrations of group IB PLA2, and cytosolic fractions were prepared as described in Materials and Methods. cPLA2 activity in these cytosolic fractions was determined, and the data were expressed as the amount of radiolabeled substrate hydrolyzed per milligram of protein. These data are the mean ± SEM of five separate experiments performed in duplicates (*, p < 0.05). B, cPLA2 activity in membrane fractions (100 µg of protein) from untreated BMMC or from BMMC treated with different concentrations of group IB PLA2 was determined as described above. These data are the mean ± SEM of four separate experiments (*, p < 0.05). C, Induction of cPLA2 phosphorylation and translocation. BMMC were incubated with 100 nM group IB PLA2 for different periods of time. After SDS-PAGE, the mobility of cPLA2 obtained from the cytosolic fraction was determined by immunodetection and enhanced chemiluminescence (upper panel). Membrane fractions from the same experiment were concentrated, and proteins were separated by SDS-PAGE (lower panel). These data are representative of five separate experiments.

 
cPLA2 activation is accompanied by a characteristic shift in the electrophoretic mobility that is associated with phosphorylation in several stimulated cells. To examine cPLA2 phosphorylation after group IB PLA2 stimulation, SDS-PAGE and immunodetection was performed on BMMC. Fig. 2GoC (upper panel) shows that group IB PLA2 induces a time-dependent decrease in the mobility of cPLA2 in the cytosol fraction. Furthermore, cPLA2 is detected in the membrane fraction within 0.5 min after the addition of group IB PLA2 to BMMC (Fig. 2GoC, lower panel). These data revealed that sPLA2 receptor occupancy on BMMC is accompanied by the rapid activation and phosphorylation of cPLA2 and translocation of the enzyme to membrane fractions.

We have previously shown that APMP-BSA, a noncatalytic ligand of the sPLA2 receptor, induced the selective release of AA from BMMC (40). To determine whether cPLA2 activation was required for the selective release of AA, we examined the effects of APMP-BSA on cPLA2 activity in BMMC. Incubation of BMMC with APMP-BSA resulted in an increase cPLA2 activity in homogenates from 12.5 ± 0.6 (basal activity) to 14.5 ± 0.4 (p < 0.05), 21.6 ± 4.8 (p < 0.05), and 20.4 ± 4.9 pmol/mg/min (n = 4), after 1, 2, and 5 min, respectively. These data revealed that sPLA2 receptor occupancy alone and not catalytic activity is sufficient in inducing cPLA2 activation in BMMC.

sPLA2 receptor occupancy and MAPK activation

MAPK (p44/p42) has been shown to be responsible for cPLA2 phosphorylation in some cells (52, 53). To determine whether the activation of cPLA2 and subsequent selective release of AA by sPLA2 may be mediated by MAPK pathways, we examined MAPK activation using a selective phospho p44/p42 Ab. As shown in Fig. 3GoA (upper panel), BMMC express both isoforms of MAPK (p44 and p42) and p44/p42 are constitutively phosphorylated in unstimulated BMMC (Fig. 3GoA, lane 1, middle panel). After incubation of BMMC with group IB PLA2, there was transient phosphorylation 44/p42 MAPK (Fig. 3GoA, middle panel). Maximum phosphorylation (~2.5- and 1.5-fold for p44 and p42 MAPK, respectively) occurred within 0.5–2 min after stimulation with group IB PLA2 (Fig. 3GoA, lower panel).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 3. p44/p42 MAPK phosphorylation. BMMC were incubated with 100 nM group IB sPLA2 (A) or 50 µM APMP-BSA (B) for different periods of time. Cell lysates were obtained and SDS-PAGE was performed as described in Materials and Methods. p44/p42 MAPK (upper panel) and phospho p44/p42 MAPK (middle panel) levels were determined by immunodetection and enhanced chemiluminescence. Fold increases in p44 ({blacksquare}) and p42 ({square}) MAPK phosphorylation (lower panel) were determined by laser densitometry. These data are representative of five separate experiments.

 
To determine whether catalytic activity is required to induce a signal through the sPLA2 receptor, the effects of a noncatalytic ligand, APMP-BSA, were examined on p44/p42 MAPK phosphorylation. When equal amounts of protein were resolved by SDS-PAGE (Fig. 3GoB, upper panel), APMP-BSA induced a transient increase in p44/p42 MAPK phosphorylation (Fig. 3GoB, middle panel). Maximum phosphorylation (~2.5- and 1.4-fold for p44 and p42, respectively) occurred within 1–2 min after stimulation of BMMC with APMP-BSA (Fig. 3GoB, lower panel).

Decrease in cPLA2 activation and AA release by MAPK inhibitor

Another set of experiments used a p44/p42 MAPK inhibitor (PD98059) to examine whether MAPK phosphorylation played a role in cPLA2 activation and the selective release of AA from BMMC stimulated with group IB PLA2. PD98059 significantly attenuated the increase in cPLA2 activity induced by group IB PLA2 (Fig. 4GoA). In addition, PD98059 inhibited AA release from BMMC stimulated with group IB PLA2 (Fig. 4GoB). These data suggest that p44/p42 MAPK phosphorylation and cPLA2 activation are involved in the selective release of AA when mast cells are incubated with group IB PLA2.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 4. Influence of p44/p42 MAPK inhibitor (PD98059) on cPLA2 activation and AA release. BMMC were preincubated without ({blacksquare}) or with 50 µM MAPK inhibitor PD98059 () for 10 min at 37°C. Subsequently, cells were not stimulated (CT) or stimulated with group IB PLA2 for 5 min. cPLA2 activity (A) and AA (B) released into supernatant fluids were determined as described in Materials and Methods. These data are the mean ± SEM of five separate experiments (*, p < 0.05).

 
Signal transduction and cPLA2 activation

The activation of Ras by growth factor receptors or tyrosine kinases has been shown to result in the recruitment of cRAF, and activation of extracellular signal-regulated kinase/MAPK cascade (54, 55). To determine whether the activation of cPLA2 by sPLA2 is mediated via tyrosine kinase and Ras activation, we examined the effects of group IB PLA2 on Ras activation after BMMC had been incubated with or without tyrosine kinase inhibitor. As shown in Fig. 5GoA, group IB sPLA2 enhanced Ras activation in BMMC. Ras activation was attenuated by pretreatment of BMMC with tyrosine kinase inhibitor (herbimycin). Likewise, herbimycin inhibited cPLA2 activation by group IB PLA2-stimulated BMMC (Fig. 5GoB). Herbimycin also suppressed sPLA2-induced AA release from 582.2 ± 57.8 to 426.2 ± 42.4 pmol/5 x 106 BMMC (n = 4, p < 0.05). To examine other upstream signal transduction events that might link the sPLA2 receptor to cPLA2 activation, cPLA2 activity and AA release were monitored in BMMC stimulated with group IB PLA2 in the absence or presence of inhibitors of PI3-K or GTP-coupled receptors. cPLA2 activity induced by sPLA2 (68.1 ± 5.1 pmol/mg/min, n = 4) was not influenced by an inhibitor of PI3-K (LY294002, 58.1 ± 5.6 pmol/mg/min, n = 4) or PTX (59.2 ± 6.4 pmol/mg/min, n = 4) that uncouples membrane-bound receptors from GTP. Likewise, sPLA2-induced AA release (1293.8 ± 84 pmol/5 x 106 BMMC) was not influenced by pretreatment of BMMC with LY294002 (1345.6 ± 89.7 pmol/5 x 106 BMMC) or by PTX (1464.3 ± 69.4 pmol/5 x 106 BMMC). These data suggest that tyrosine phosphorylation is upstream of Ras activation and appears to be a major signal that links sPLA2 receptors to cPLA2 activation in mast cells.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5. Role of tyrosine phosphorylation in Ras activation and cPLA2 activation. BMMC were preincubated without or with 5 µM herbimycin for 30 min at 37°C. Subsequently, cells were not stimulated or stimulated with 100 nM group IB PLA2 for 1 min. Ras activation was determined by immunopreciptation/Western analysis (A) (representative of three separate experiments). cPLA2 activity (B) without ({blacksquare}) or with () herbimycin was determined as described in Materials and Methods. These data are the mean ± SEM of five separate experiments (*, p < 0.05).

 
Role of endogenous sPLA2 in cPLA2 activation and AA release

Recently, BMMC have been shown to contain primarily group IIA and group V sPLA2 (56). To determine whether endogenous sPLA2 might act in an autocrine fashion to activate cPLA2 and induce AA release, BMMC were incubated with different concentrations of a sPLA2-enriched extract. As shown in Table IGo, endogenous sPLA2 induced an increase in cPLA2 activity in BMMC. Furthermore, endogenous sPLA2 released AA from BMMC (Table IGo). In contrast, levels of other unsaturated fatty acids (LA and OA) were not influenced when BMMC were incubated with partially purified endogenous sPLA2 (Table IGo). To further test the hypothesis that group IIA or group V PLA2 play key roles in AA release, these sPLA2 isotypes were overexpressed in BMMC (Fig. 6GoA). BMMC expressing both isotypes release more AA into supernatant fluids than mock-transfected cells (Fig. 6GoB). Taken together, these data suggest that endogenous sPLA2 can function in an autocrine fashion to activate cPLA2 and enhance AA release from BMMC.


View this table:
[in this window]
[in a new window]
 
Table I. Effects of endogenous sPLA2 on cPLA2 activity and fatty acid releasea

 


View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 6. Overexpression of mouse groups IIA and V PLA2s in BMMC and effects on cPLA2 activity. A, BMMC transfected with vector alone or with vector containing groups IIA PLA2 or V PLA2 cDNA were placed in HBSS buffer for 10 min. sPLA2 activity in supernatant fluid was determined as described in Materials and Methods. These data are expressed as a percentage of activity in vector-transfected BMMC and are the mean ± SEM of four separate experiments (*, p < 0.05). B, BMMC transfected with vector alone, group IIA, or group V PLA2 cDNA were placed in buffer for 10 min at 37°C. Cell pellets were removed by centrifugation, and mole quantities of AA in supernatant fluids were determined by NICI-GC/MS. These data are expressed as a percentage of vector-transfected BMMC and are the mean ± SEM of four separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study suggests that an important link between addition of sPLA2 isotypes to cells and the selective release of AA is the receptor-mediated activation of cPLA2. Furthermore, cPLA2 activation and AA release appear to be mediated, in part, through tyrosine phosphorylation and p44/p42 MAPK activation but not through PI3-K activation or G protein-coupled receptors. Several lines of evidence support this sequence of molecular events: 1) mast cells overexpressing the sPLA2 receptor release more AA and produce more prostanoids than mock-transfected cells; 2) sPLA2 receptor ligands induce a dose- and time-dependent increase in cPLA2 activity; 3) the increase in activity is accompanied by cPLA2 phosphorylation and a shift of the activity from cytosolic to membrane fractions; 4) sPLA2 receptor ligands induce the transient phosphorylation of p44/p42 MAPK; 5) an inhibitor of MAPK phosphorylation (PD98059) significantly attenuates sPLA2-induced activation of cPLA2 and the release of AA; 6) an inhibitor of tyrosine phosphorylation (herbimycin) attenuates cPLA2 activation and AA release; and 7) addition of a sPLA2-enriched extract from mast cells and the overexpression of mouse groups IIA or V sPLA2 in mast cells result in enhanced cPLA2 activation and AA release.

Our previous results indicate that some sPLA2 isotypes induce the selective release of AA from certain cells (BMMC, THP-1, and CFTL-15) but not from HL-60 cells. Interestingly, sPLA2 isotypes can induce the selective release of AA from cells only if these cells express the sPLA2 receptor (40). The current study suggests that the selective release of AA from mast cells is initiated by the binding of sPLA2 to its receptor. Over the past decade, sPLA2 receptors have been described based on binding properties, tissue distribution, or species distribution (42, 43). A cloned sPLA2 receptor termed M-type has homology with the macrophage mannose receptor and DEC-205 of dendrites, suggesting that these proteins may belong to a new class of receptors that possess Ag-recognition properties. Although several biological functions have been attributed to the occupancy of the sPLA2 receptor, the molecular events responsible have not been elucidated.

The current study suggests that sPLA2 receptor occupancy is linked to cPLA2 activation, hence the selective release of AA and the formation of prostanoids by low nanomolar concentrations of sPLA2. Our previous study showed that APMP-BSA, a sPLA2 receptor agonist that has no hydrolytic activity, also induces the selective release of AA from cells expressing the sPLA2 receptor (40). This observation raised the interesting possibility that binding alone (without hydrolytic activity) is sufficient to release AA from cells. For binding to a receptor to be sufficient to induce the selective release of AA, there must be recruitment of another hydrolytic activity within cells that hydrolyzes AA from membrane phospholipids. An ideal candidate for such an activity is group IV PLA2 (cPLA2) because it has been shown to selectively mobilize AA from a number of mammalian cells. cPLA2 is activated by calcium-dependent translocation of the enzyme from a cytosolic location to perinuclear membranes, and this event is dependent on a calcium binding (CALB) domain (57, 58, 59). An important role for cPLA2 in AA metabolism has recently been demonstrated in BMMC obtained from cPLA2-deficient mice (60). In these studies, mast cells from cPLA2 knockout mice do not display immediate or delayed AA metabolism. The current study shows that sPLA2 induces a rapid increase in cPLA2 activity within mast cells. Importantly, there is also a shift in the localization of cPLA2 from predominantly a cytosolic location to a membrane location. This movement of cPLA2 to a membrane fraction is hypothesized to facilitate hydrolysis by placing the enzyme with its phospholipid substrate. Finally, a noncatalytic ligand of the sPLA2 receptor also increased cPLA2 activity in BMMC. Together these data suggest that the selective release of AA from mast cells by sPLA2 receptor ligands is due to the recruitment of cPLA2.

It has been suggested that sPLA2 can affect cell proliferation and AA release via its capacity to activate MAPK (46, 47, 48). The current study has focused on proximal signal transduction events that are closely associated with AA mobilization and metabolism. As mentioned above, AA release in many cells is due to the activation and translocation of cPLA2 to a membrane location, and this process is often accompanied by phosphorylation of cPLA2 by MAPK. p42/p44 MAPK initially appeared to be the major enzymes responsible for cPLA2 phosphorylation (52). However, other kinase pathways have also been shown to activate cPLA2 (61, 62). In fact, in stimulated platelets, inhibitor studies suggest that p38 kinase rather than extracellular signal-related kinases are responsible for cPLA2 phosphorylation (63). In contrast, studies using these same inhibitors show that p44/p42 MAPK and not p38 kinase are involved in AA release from mast cells (64). The current study shows that during sPLA2 receptor occupancy, there is transient phosphorylation of p44 and p42 MAPKs. Moreover, incubation of mast cells with a selective p44/p42 MAPK inhibitor (PD98059) significantly blocked cPLA2 activation and AA release from BMMC in response to sPLA2. Because PD98059 only partially reversed cPLA2 activation, it is likely that other signal transduction pathways or communication between various pathways occur in activated mast cells (64).

Whereas cPLA2 activation has been linked to various MAPKs in many cell types, there is paucity of information regarding upstream signals that link sPLA2 receptor activation to MAPK and cPLA2. In human astrocytoma cells, sPLA2-induced cPLA2 activation has been shown to be insensitive to PTX. In contrast, sPLA2-induced calcium release is sensitive to PTX, caffeine, and herbimycin (49). In lung cancer cells, cPLA2 has been recognized as a Ras-inducible regulator of eicosanoid biosynthesis (65). Therefore, there are several potential pathways that link receptor occupancy to cPLA2 activity within cells. The current data suggest that tyrosine kinase plays a role in sPLA2-induced cPLA2 activation. Importantly, Ras activation was also implicated in the sPLA2 receptor-mediated activation of cPLA2. Further evidence for a role in tyrosine kinase/Ras activation is shown by the attenuation of sPLA2-induced Ras activation by herbimycin. Together, these data provide evidence that binding of sPLA2 to a receptor initiates several critical molecular events including the activation of tyrosine kinase, Ras, and p44/p42 MAPK. This sequence of molecular events is one potential mechanism by which sPLA2 induces cPLA2 activation and the selective release of AA.

Recent studies have identified groups IIA and V sPLA2 as the major sPLA2 isotypes found in mast cells (31, 35, 56). Consequently, it was important to determine whether endogenous sPLA2 isotypes within mast cells can mobilize AA by activating cPLA2. Our data suggest sPLA2 extracted from mast cells induced cPLA2 activation and the selective release of AA. Likewise, overexpression of groups IIA or V sPLA2 in mast cells resulted in an increase in AA release. These data suggest that sPLA2 isotypes in mast cells can act on sPLA2 receptors in an autocrine fashion during mast cell activation.

Overall, our data suggest that the physiologic roles of sPLA2 may not only be mediated by the hydrolytic effects of this family of enzymes on phospholipids and cellular membranes, but also by their capacity to bind to cell surface receptors. Upon receptor binding, sPLA2 induces a signal transduction pathway that leads to cPLA2 activation and AA release. Further studies will be necessary to determine the signal transduction pathways that are associated with other sPLA2-induced biological activities.


    Acknowledgments
 
We are grateful for expert technical assistance by Brooke Barham, Michelle Eden, and Chad Marion. We thank Dr. Zheng Cui (Wake Forest University School of Medicine) for providing the pCMV5 vector and for advice on subcloning the sPLA2 receptor cDNA. We also appreciate the help of Dr. A. Tromboli (Wake Forest University School of Medicine) in determining mole quantities of fatty acids by NICI-GC/MS.


    Footnotes
 
1 This work was supported in part by National Institutes of Health Grants RO1 AI 24985 SI (to A.N.F.) and AI42022 (to F.H.C.). Back

2 Address correspondence and reprint requests to Dr. Alfred N. Fonteh, Department of Internal Medicine, Section on Pulmonary and Critical Care Medicine, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1054. Back

3 Abbreviations used in this paper: PLA2, phospholipase A2; sPLA2, secretory PLA2; cPLA2, cytosolic PLA2, LT, leukotriene; HSA, human serum albumin; MAPK, mitogen-activated protein kinase; NICI-GC/MS, negative ion chemical ionization gas chromatography/mass spectrometry; [2H8], octadeuterated; [2H3], tritradeuterated; LA, linoleic acid; OA, oleic acid; AA, arachidonic acid; SA, stearic acid; APMP-BSA, p-amino-phenyl-{alpha}-D-mannopyranoside BSA; BMMC, bone marrow-derived mast cells; DNP, dinitrophenol; PTX, pertussis toxin; PI3-K, phosphoinositide 3'-kinase; TX, thromboxane; PVDF, polyvinylidene difluoride; SEC, size-exclusion chromatography. Back

Received for publication March 6, 2000. Accepted for publication June 20, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Murakami, M., Y. Nakatani, G. Atsumi, K. Inoue, I. Kudo. 1997. Regulatory functions of phospholipase A2. Crit. Rev. Immunol. 17:225.[Medline]
  2. Dennis, E. A.. 1997. The growing phospholipase A2 superfamily of signal transduction enzymes. Trends Biochem. Sci. 22:1.[Medline]
  3. Tischfield, J. A.. 1997. A reassessment of the low molecular weight phospholipase A2 gene family in mammals. J. Biol. Chem. 272:17247.[Free Full Text]
  4. Cupillard, L., K. Koumanov, M. G. Mattei, M. Lazdunski, G. Lambeau. 1997. Cloning, chromosomal mapping, and expression of a novel human secretory phospholipase A2. J. Biol. Chem. 272:15745.[Abstract/Free Full Text]
  5. Valentin, E., R. S. Koduri, J. C. Scimeca, G. Carle, M. H. Gelb, M. Lazdunski, G. Lambeau. 1999. Cloning and recombinant expression of a novel mouse-secreted phospholipase A2. J. Biol. Chem. 274:19152.[Abstract/Free Full Text]
  6. Suzuki, N., J. Ishizaki, Y. Yokota, K. Higashino, T. Ono, M. Ikeda, N. Fujii, K. Kawamoto, K. Hanasaki. 2000. Structures, enzymatic properties, and expression of novel human and mouse secretory phospholipase A2s. J. Biol. Chem. 275:5785.[Abstract/Free Full Text]
  7. Underwood, K. W., C. Song, R. W. Kriz, X. J. Chang, J. L. Knopf, L. L. Lin. 1998. A novel calcium-independent phospholipase A2, cPLA2-gamma, that is prenylated and contains homology to cPLA2. J. Biol. Chem. 273:21926.[Abstract/Free Full Text]
  8. Pickard, R. T., B. A. Strifler, R. M. Kramer, J. D. Sharp. 1999. Molecular cloning of two new human paralogs of 85-kDa cytosolic phospholipase A2. J. Biol. Chem. 274:8823.[Abstract/Free Full Text]
  9. Larsson Forsell, P. K., B. P. Kennedy, H. E. Claesson. 1999. The human calcium-independent phospholipase A2 gene multiple enzymes with distinct properties from a single gene. Eur. J. Biochem. 262:575.[Medline]
  10. Weinrauch, Y., P. Elsbach, L. M. Madsen, A. Foreman, J. Weiss. 1996. The potent anti-Staphylococcus aureus activity of a sterile rabbit inflammatory fluid is due to a 14-kD phospholipase A2. J. Clin. Invest 97:250.[Medline]
  11. Qu, X. D., R. I. Lehrer. 1998. Secretory phospholipase A2 is the principal bactericide for staphylococci and other Gram-positive bacteria in human tears. Infect. Immun. 66:2791.[Abstract/Free Full Text]
  12. Edelson, J. D., P. Vadas, J. Villar, J. B. Mullen, W. Pruzanski. 1991. Acute lung injury induced by phospholipase A2: structural and functional changes. Am. Rev. Respir. Dis. 143:1102.[Medline]
  13. Chilton, F. H., F. J. Averill, W. C. Hubbard, A. N. Fonteh, M. Triggiani, M. C. Liu. 1996. Antigen-induced generation of lyso-phospholipids in human airways. J. Exp. Med. 183:2235.[Abstract/Free Full Text]
  14. Styles, L. A., C. G. Schalkwijk, A. J. Aarsman, E. P. Vichinsky, B. H. Lubin, F. A. Kuypers. 1996. Phospholipase A2 levels in acute chest syndrome of sickle cell disease. Blood 87:2573.[Abstract/Free Full Text]
  15. Arbibe, L., K. Koumanov, D. Vial, C. Rougeot, G. Faure, N. Havet, S. Longacre, B. B. Vargaftig, G. Bereziat, D. R. Voelker, C. Wolf, L. Touqui. 1998. Generation of lyso-phospholipids from surfactant in acute lung injury is mediated by type-II phospholipase A2 and inhibited by a direct surfactant protein A-phospholipase A2 protein interaction. J. Clin. Invest 102:1152.[Medline]
  16. Hack, C. E., G. J. Wolbink, C. Schalkwijk, H. Speijer, W. T. Hermens, B. H. van den. 1997. A role for secretory phospholipase A2 and C-reactive protein in the removal of injured cells. Immunol. Today 18:111.[Medline]
  17. Kim, D. K., T. Fukuda, B. T. Thompson, B. Cockrill, C. Hales, J. V. Bonventre. 1995. Bronchoalveolar lavage fluid phospholipase A2 activities are increased in human adult respiratory distress syndrome. Am. J. Physiol 269:L109.[Abstract/Free Full Text]
  18. Tong, L. J., L. W. Dong, H. K. Hsu, M. S. Liu. 1998. Phospholipase A2 activities are decreased during early but increased during late phases of sepsis in rat heart. J. Surg. Res. 75:165.[Medline]
  19. Uhl, W., H. J. Schrag, N. Schmitter, J. Aufenanger, T. J. Nevalainen, M. W. Buchler. 1998. Experimental study of a novel phospholipase A2 inhibitor in acute pancreatitis. Br. J. Surg. 85:618.[Medline]
  20. Jansen, P. M., M. A. Boermeester, E. Fischer, I. W. de Jong, P. T. van der, L. L. Moldawer, C. E. Hack, S. F. Lowry. 1995. Contribution of interleukin-1 to activation of coagulation and fibrinolysis, neutrophil degranulation, and the release of secretory-type phospholipase A2 in sepsis: studies in nonhuman primates after interleukin-1{alpha} administration and during lethal bacteremia. Blood 86:1027.[Abstract/Free Full Text]
  21. Bomalaski, J. S., M. A. Clark. 1990. Activation of phospholipase A2 in rheumatoid arthritis. Adv. Exp. Med. Biol. 279:231.[Medline]
  22. Kortekangas, P., H. T. Aro, T. J. Nevalainen. 1994. Group II phospholipase A2 in synovial fluid and serum in acute arthritis. Scand. J. Rheumatol. 23:68.[Medline]
  23. Bowton, D. L., M. C. Seeds, M. B. Fasano, B. Goldsmith, D. A. Bass. 1997. Phospholipase A2 and arachidonate increase in bronchoalveolar lavage fluid after inhaled antigen challenge in asthmatics. Am. J. Respir. Crit. Care Med. 155:421.[Abstract]
  24. Lin, M. K., A. Katz, B. H. van den, B. Kennedy, E. Stefanski, P. Vadas, W. Pruzanski. 1998. Induction of secretory phospholipase A2 confirms the systemic inflammatory nature of adjuvant arthritis. Inflammation 22:161.[Medline]
  25. Kallajoki, M., K. A. Alanen, M. Nevalainen, T. J. Nevalainen. 1998. Group II phospholipase A2 in human male reproductive organs and genital tumors. Prostate 35:263.[Medline]
  26. Yamashita, S., J. Yamashita, M. Ogawa. 1994. Overexpression of group II phospholipase A2 in human breast cancer tissues is closely associated with their malignant potency. Br. J. Cancer 69:1166.[Medline]
  27. Hanada, K., E. Kinoshita, M. Itoh, M. Hirata, G. Kajiyama, M. Sugiyama. 1995. Human pancreatic phospholipase A2 stimulates the growth of human pancreatic cancer cell line. FEBS Lett. 373:85.[Medline]
  28. Kennedy, B. P., C. Soravia, J. Moffat, L. Xia, T. Hiruki, S. Collins, S. Gallinger, B. Bapat. 1998. Overexpression of the nonpancreatic secretory group II PLA2 messenger RNA and protein in colorectal adenomas from familial adenomatous polyposis patients. Cancer Res. 58:500.[Abstract/Free Full Text]
  29. MacPhee, M., K. P. Chepenik, R. A. Liddell, K. K. Nelson, L. D. Siracusa, A. M. Buchberg. 1995. The secretory phospholipase A2 gene is a candidate for the Mom1 locus, a major modifier of ApcMin-induced intestinal neoplasia. Cell 81:957.[Medline]
  30. Praml, C., L. C. Amler, S. Dihlmann, L. H. Finke, P. Schlag, M. Schwab. 1998. Secretory type II phospholipase A2 (PLA2G2A) expression status in colorectal carcinoma derived cell lines and in normal colonic mucosa. Oncogene 17:2009.[Medline]
  31. Fonteh, A. N., D. A. Bass, L. A. Marshall, M. Seeds, J. M. Samet, F. H. Chilton. 1994. Evidence that secretory phospholipase A2 plays a role in arachidonic acid release and eicosanoid biosynthesis by mast cells. J. Immunol. 152:5438.[Abstract]
  32. Barbour, S. E., E. A. Dennis. 1993. Antisense inhibition of group II phospholipase A2 expression blocks the production of prostaglandin E2 by P388D1 cells. J. Biol. Chem. 268:21875.[Abstract/Free Full Text]
  33. III Bingham, C. O., H. M. Murakami, J. E. Fujishima, K. F. Hunt, K. F. Austen, J. P. Arm. 1996. A heparin-sensitive phospholipase A2 and prostaglandin endoperoxide synthase-2 are functionally linked in the delayed phase of prostaglandin D2 generation in mouse bone marrow-derived mast cells. J. Biol. Chem. 271:25936.[Abstract/Free Full Text]
  34. Murakami, M., S. Shimbara, T. Kambe, H. Kuwata, M. V. Winstead, J. A. Tischfield, I. Kudo. 1998. The functions of five distinct mammalian phospholipase A2S in regulating arachidonic acid release: type IIa and type V secretory phospholipase A2S are functionally redundant and act in concert with cytosolic phospholipase A2. J. Biol. Chem. 273:14411.[Abstract/Free Full Text]
  35. Reddy, S. T., M. V. Winstead, J. A. Tischfield, H. R. Herschman. 1997. Analysis of the secretory phospholipase A2 that mediates prostaglandin production in mast cells. J. Biol. Chem. 272:13591.[Abstract/Free Full Text]
  36. Hanasaki, K., T. Ono, A. Saiga, Y. Morioka, M. Ikeda, K. Kawamoto, K. Higashino, K. Nakano, K. Yamada, J. Ishizaki, H. Arita. 1999. Purified group X secretory phospholipase A2 induced prominent release of arachidonic acid from human myeloid leukemia cells. J. Biol. Chem. 274:34203.[Abstract/Free Full Text]
  37. Nair, X., D. Nettleton, D. Clever, K. M. Tramposch, S. Ghosh, R. C. Franson. 1993. Swine as a model of skin inflammation: phospholipase A2-induced inflammation. Inflammation 17:205.[Medline]
  38. Babu, A. S., T. V. Gowda. 1994. Dissociation of enzymatic activity from toxic properties of the most basic phospholipase A2 from Vipera russelli snake venom by guanidination of lysine residues. Toxicon 32:749.[Medline]
  39. Ishizaki, J., J. Kishino, H. Teraoka, O. Ohara, H. Arita. 1993. Receptor-binding capability of pancreatic phospholipase A2 is separable from its enzymatic activity. FEBS Lett. 324:349.[Medline]
  40. Fonteh, A. N., J. M. Samet, M. Surette, W. Reed, F. H. Chilton. 1998. Mechanisms that account for the selective release of arachidonic acid from intact cells by secretory phospholipase A2. Biochim. Biophys. Acta 1393:253.[Medline]
  41. Ohara, O., J. Ishizaki, H. Arita. 1995. Structure and function of phospholipase A2 receptor. Prog. Lipid Res. 34:117.[Medline]
  42. Lambeau, G., M. Lazdunski. 1999. Receptors for a growing family of secreted phospholipases A2. Trends Pharmacol. Sci. 20:162.[Medline]
  43. Cupillard, L., R. Mulherkar, N. Gomez, S. Kadam, E. Valentin, M. Lazdunski, G. Lambeau. 1999. Both group IB and group IIA secreted phospholipases A2 are natural ligands of the mouse 180-kDa M-type receptor. J. Biol. Chem. 274:7043.[Abstract/Free Full Text]
  44. Nicolas, J. P., Y. Lin, G. Lambeau, F. Ghomashchi, M. Lazdunski, M. H. Gelb. 1997. Localization of structural elements of bee venom phospholipase A2 involved in N-type receptor binding and neurotoxicity. J. Biol. Chem. 272:7173.[Abstract/Free Full Text]
  45. Fujita, H., K. Kawamoto, K. Hanasaki, H. Arita. 1995. Glycosylation-dependent binding of pancreatic type I phospholipase A2 to its specific receptor. Biochem. Biophys. Res. Commun. 209:293.[Medline]
  46. Hernandez, M., S. L. Burillo, M. S. Crespo, M. L. Nieto. 1998. Secretory phospholipase A2 activates the cascade of mitogen-activated protein kinases and cytosolic phospholipase A2 in the human astrocytoma cell line 1321N1. J. Biol. Chem. 273:606.[Abstract/Free Full Text]
  47. Kinoshita, E., N. Handa, K. Hanada, G. Kajiyama, M. Sugiyama. 1997. Activation of MAP kinase cascade induced by human pancreatic phospholipase A2 in a human pancreatic cancer cell line. FEBS Lett. 407:343.[Medline]
  48. Kundu, G. C., A. B. Mukherjee. 1997. Evidence that porcine pancreatic phospholipase A2 via its high affinity receptor stimulates extracellular matrix invasion by normal and cancer cells. J. Biol. Chem. 272:2346.[Abstract/Free Full Text]
  49. Hernandez, M., M. J. Barrero, J. Alvarez, M. Montero, C. M. Sanchez, M. L. Nieto. 1999. Secretory phospholipase A2 induces phospholipase C{gamma}-1 activation and Ca2+ mobilization in the human astrocytoma cell line 1321N1 by a mechanism independent of its catalytic activity. Biochem. Biophys. Res. Commun. 260:99.[Medline]
  50. Bligh, E. A., W. T. Dyer. 1959. A rapid method of total lipid extraction and purification. Can. J. Physiol. Pharmacol. 37:911.
  51. Fonteh, A. N., F. H. Chilton. 1993. Mobilization of different arachidonate pools and their roles in the generation of leukotrienes and free arachidonic acid during immunologic activation of mast cells. J. Immunol. 150:563.[Abstract]
  52. Nemenoff, R. A., S. Winitz, N. X. Qian, P. Van, G. L. V, G. L. Johnson, L. E. Heasley. 1993. Phosphorylation and activation of a high molecular weight form of phospholipase A2 by p42 microtubule-associated protein 2 kinase and protein kinase C. J. Biol. Chem. 268:1960.[Abstract/Free Full Text]
  53. Zhang, C., N. Hirasawa, M. A. Beaven. 1997. Antigen activation of mitogen-activated protein kinase in mast cells through protein kinase C-dependent and independent pathways. J. Immunol. 158:4968.[Abstract]
  54. Marais, R., C. J. Marshall. 1996. Control of the ERK MAP kinase cascade by Ras and Raf. Cancer Surv. 27:101.[Medline]
  55. Winston, L. A., T. Hunter. 1995. JAK2, Ras, and Raf are required for activation of extracellular signal-regulated kinase/mitogen-activated protein kinase by growth hormone. J. Biol. Chem. 270:30837.[Abstract/Free Full Text]
  56. III Bingham, C. O., D. S. R. J. Fijneman, R. P. Friend, A. Goddeau, K. F. Rogers, K. F. Austen, J. P. Arm. 1999. Low molecular weight group IIA and group V phospholipase A2 enzymes have different intracellular locations in mouse bone marrow-derived mast cells. J. Biol. Chem. 274:31476.[Abstract/Free Full Text]
  57. Durstin, M., S. Durstin, T. F. Molski, E. L. Becker, R. I. Sha’afi. 1994. Cytoplasmic phospholipase A2 translocates to membrane fraction in human neutrophils activated by stimuli that phosphorylate mitogen-activated protein kinase. Proc. Natl. Acad. Sci. USA 91:3142.[Abstract/Free Full Text]
  58. Glover, S., M. S. de Carvalho, M. T. Bayburt, M. Jonas, E. Chi, C. C. Leslie, M. H. Gelb. 1995. Translocation of the 85-kDa phospholipase A2 from cytosol to the nuclear envelope in rat basophilic leukemia cells stimulated with calcium ionophore or IgE/antigen. [Published erratum appears in 1995 J. Biol. Chem. 270:20870.]. J. Biol. Chem. 270:15359.[Abstract/Free Full Text]
  59. Huwiler, A., G. Staudt, R. M. Kramer, J. Pfeilschifter. 1997. Cross-talk between secretory phospholipase A2 and cytosolic phospholipase A2 in rat renal mesangial cells. Biochim. Biophys. Acta 1348:257.[Medline]
  60. Fujishima, H., R. O. Sanchez Mejia, III C. O. Bingham, B. K. Lam, A. Sapirstein, J. V. Bonventre, K. F. Austen, J. P. Arm. 1999. Cytosolic phospholipase A2 is essential for both the immediate and the delayed phases of eicosanoid generation in mouse bone marrow-derived mast cells. Proc. Natl. Acad. Sci. USA 96:4803.[Abstract/Free Full Text]
  61. Rao, G. N., B. Lassegue, R. W. Alexander, K. K. Griendling. 1994. Angiotensin II stimulates phosphorylation of high-molecular-mass cytosolic phospholipase A2 in vascular smooth-muscle cells. Biochem. J. 299:(Pt 1):197.
  62. Syrbu, S. I., W. H. Waterman, T. F. Molski, D. Nagarkatti, J. J. Hajjar, R. I. Sha’afi. 1999. Phosphorylation of cytosolic phospholipase A2 and the release of arachidonic acid in human neutrophils. J. Immunol. 162:2334.[Abstract/Free Full Text]
  63. Kramer, R. M., E. F. Roberts, S. L. Um, A. G. Borsch-Haubold, S. P. Watson, M. J. Fisher, J. A. Jakubowski. 1996. p38 mitogen-activated protein kinase phosphorylates cytosolic phospholipase A2 (cPLA2) in thrombin-stimulated platelets: evidence that proline-directed phosphorylation is not required for mobilization of arachidonic acid by cPLA2. J. Biol. Chem. 271:27723.[Abstract/Free Full Text]
  64. Zhang, C., R. A. Baumgartner, K. Yamada, M. A. Beaven. 1997. Mitogen-activated protein (MAP) kinase regulates production of tumor necrosis factor-{alpha} and release of arachidonic acid in mast cells: indications of communication between p38 and p42 MAP kinases. J. Biol. Chem. 272:13397.[Abstract/Free Full Text]
  65. Heasley, L. E., S. Thaler, M. Nicks, B. Price, K. Skorecki, R. A. Nemenoff. 1997. Induction of cytosolic phospholipase A2 by oncogenic Ras in human non-small cell lung cancer. J. Biol. Chem. 272:14501.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
N. M. Munoz, A. Y. Meliton, J. P. Arm, J. V. Bonventre, W. Cho, and A. R. Leff
Deletion of Secretory Group V Phospholipase A2 Attenuates Cell Migration and Airway Hyperresponsiveness in Immunosensitized Mice
J. Immunol., October 1, 2007; 179(7): 4800 - 4807.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. A. Culver and S. M. Laster
Adenovirus Type 5 Exerts Multiple Effects on the Expression and Activity of Cytosolic Phospholipase A2, Cyclooxygenase-2, and Prostaglandin Synthesis
J. Immunol., September 15, 2007; 179(6): 4170 - 4179.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Kikawada, J. V. Bonventre, and J. P. Arm
Group V secretory PLA2 regulates TLR2-dependent eicosanoid generation in mouse mast cells through amplification of ERK and cPLA2{alpha} activation
Blood, July 15, 2007; 110(2): 561 - 567.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. G. Payne, C. A. Oskeritzian, R. Griffiths, P. Subramanian, S. E. Barbour, C. E. Chalfant, S. Milstien, and S. Spiegel
The immunosuppressant drug FTY720 inhibits cytosolic phospholipase A2 independently of sphingosine-1-phosphate receptors
Blood, February 1, 2007; 109(3): 1077 - 1085.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. M. Munoz, A. Y. Meliton, A. Lambertino, E. Boetticher, J. Learoyd, F. Sultan, X. Zhu, W. Cho, and A. R. Leff
Transcellular Secretion of Group V Phospholipase A2 from Epithelium Induces beta2-Integrin-Mediated Adhesion and Synthesis of Leukotriene C4 in Eosinophils
J. Immunol., July 1, 2006; 177(1): 574 - 582.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. K. Femling, W. M. Nauseef, and J. P. Weiss
Synergy between Extracellular Group IIA Phospholipase A2 and Phagocyte NADPH Oxidase in Digestion of Phospholipids of Staphylococcus aureus Ingested by Human Neutrophils
J. Immunol., October 1, 2005; 175(7): 4653 - 4661.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Jaulmes, B. Janvier, M. Andreani, and M. Raymondjean
Autocrine and Paracrine Transcriptional Regulation of Type IIA Secretory Phospholipase A2 Gene in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1161 - 1167.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. M. Harnett, W. Cao, and P. Biancani
Signal-Transduction Pathways that Regulate Smooth Muscle Function I. Signal transduction in phasic (esophageal) and tonic (gastroesophageal sphincter) smooth muscles
Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G407 - G416.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Offer, S. Yedgar, O. Schwob, M. Krimsky, H. Bibi, A. Eliraz, Z. Madar, and D. Shoseyov
Negative feedback between secretory and cytosolic phospholipase A2 and their opposing roles in ovalbumin-induced bronchoconstriction in rats
Am J Physiol Lung Cell Mol Physiol, March 1, 2005; 288(3): L523 - L529.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Granata, A. Petraroli, E. Boilard, S. Bezzine, J. Bollinger, L. Del Vecchio, M. H. Gelb, G. Lambeau, G. Marone, and M. Triggiani
Activation of Cytokine Production by Secreted Phospholipase A2 in Human Lung Macrophages Expressing the M-Type Receptor
J. Immunol., January 1, 2005; 174(1): 464 - 474.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. W.M Niessen, P. A.J Krijnen, C. A Visser, C. J.L.M Meijer, and C Erik Hack
Type II secretory phospholipase A2 in cardiovascular disease: a mediator in atherosclerosis and ischemic damage to cardiomyocytes?
Cardiovasc Res, October 15, 2003; 60(1): 68 - 77.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
E. BOILARD, S. G. BOURGOIN, C. BERNATCHEZ, P. E. POUBELLE, and M. E. SURETTE
Interaction of low molecular weight group IIA phospholipase A2 with apoptotic human T cells: role of heparan sulfate proteoglycans
FASEB J, June 1, 2003; 17(9): 1068 - 1080.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Triggiani, F. Granata, B. Balestrieri, A. Petraroli, G. Scalia, L. Del Vecchio, and G. Marone
Secretory Phospholipases A2 Activate Selective Functions in Human Eosinophils
J. Immunol., March 15, 2003; 170(6): 3279 - 3288.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D.-W. Park, J.-R. Kim, S.-Y. Kim, J.-K. Sonn, O.-S. Bang, S.-S. Kang, J.-H. Kim, and S.-H. Baek
Akt as a Mediator of Secretory Phospholipase A2 Receptor-Involved Inducible Nitric Oxide Synthase Expression
J. Immunol., February 15, 2003; 170(4): 2093 - 2099.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Fuentes, M. Hernandez, F. J. Fernandez-Aviles, M. S. Crespo, and M. L. Nieto
Cooperation Between Secretory Phospholipase A2 and TNF-Receptor Superfamily Signaling: Implications for the Inflammatory Response in Atherogenesis
Circ. Res., October 18, 2002; 91(8): 681 - 688.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. C. Silliman, E. E. Moore, G. Zallen, R. Gonzalez, J. L. Johnson, D. J. Elzi, X. Meng, K. Hanasaki, J. Ishizaki, H. Arita, et al.
Presence of the M-type sPLA2 receptor on neutrophils and its role in elastase release and adhesion
Am J Physiol Cell Physiol, October 1, 2002; 283(4): C1102 - C1113.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg
Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response
J. Immunol., May 1, 2002; 168(9): 4711 - 4720.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Degousee, F. Ghomashchi, E. Stefanski, A. Singer, B. P. Smart, N. Borregaard, R. Reithmeier, T. F. Lindsay, C. Lichtenberger, W. Reinisch, et al.
Groups IV, V, and X Phospholipases A2s in Human Neutrophils. ROLE IN EICOSANOID PRODUCTION AND GRAM-NEGATIVE BACTERIAL PHOSPHOLIPID HYDROLYSIS
J. Biol. Chem., February 8, 2002; 277(7): 5061 - 5073.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. N. Fonteh, C. R. Marion, B. J. Barham, M. B. Edens, G.-i. Atsumi, J. M. Samet, K. P. High, and F. H. Chilton
Enhancement of Mast Cell Survival: A Novel Function of Some Secretory Phospholipase A2 Isotypes
J. Immunol., October 15, 2001; 167(8): 4161 - 4171.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Fonteh, T. LaPorte, D. Swan, and M. A. McAlexander
A Decrease in Remodeling Accounts for the Accumulation of Arachidonic Acid in Murine Mast Cells Undergoing Apoptosis
J. Biol. Chem., January 5, 2001; 276(2): 1439 - 1449.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Siegel, L. Sternfeld, A. Gonzalez, I. Schulz, and A. Schmid
Arachidonic Acid Modulates the Spatiotemporal Characteristics of Agonist-evoked Ca2+ Waves in Mouse Pancreatic Acinar Cells
J. Biol. Chem., May 11, 2001; 276(20): 16986 - 16991.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Hernandez, L. Fuentes, F. J. Fernandez Aviles, M. S. Crespo, and M. L. Nieto
Secretory Phospholipase A2 Elicits Proinflammatory Changes and Upregulates the Surface Expression of Fas Ligand in Monocytic Cells: Potential Relevance for Atherogenesis
Circ. Res., January 11, 2002; 90(1): 38 - 45.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fonteh, A. N.
Right arrow Articles by Chilton, F. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fonteh, A. N.
Right arrow Articles by Chilton, F. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS