|
|
||||||||


*
Departments of Internal Medicine, Pulmonary and Critical Care Medicine,
Infectious Diseases, and
Physiology and Pharmacology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157
| Abstract |
|---|
|
|
|---|
-D-mannopyranoside BSA,
also induced an increase in cPLA2 activity in BMMC.
sPLA2 receptor ligands induced the phosphorylation of
p44/p42 mitogen-activated protein kinase. Additionally, an inhibitor of
p44/p42 mitogen-activated protein kinase (PD98059) significantly
inhibited sPLA2-induced cPLA2 activation and AA
release. sPLA2 receptor ligands also increased Ras
activation while an inhibitor of tyrosine phosphorylation (herbimycin)
inhibited the increase in cPLA2 activation and AA release.
Addition of partially purified sPLA2 from BMMC enhanced
cPLA2 activity and AA release. Similarly, overexpression of
mouse groups IIA or V PLA2 in BMMC induced an increase in
AA release. These data suggest that sPLA2 mediate the
selective release of AA by binding to cell surface receptors and then
inducing signal transduction events that lead to cPLA2
activation. | Introduction |
|---|
|
|
|---|
To date, most of the biological activities of sPLA2 have been attributed to its enzymatic capacity to hydrolyze membrane phospholipids. However, several findings have been difficult to reconcile merely based on this characteristic. For example, Nair and colleagues demonstrated that intradermal injection of inactivated sPLA2 (no hydrolytic activity) causes similar phenotypic changes in skin to those observed with injection of fully active sPLA2 (37). Similarly, others have shown that the physiologic actions of sPLA2 are not due to hydrolytic activity (38, 39). We have demonstrated that very low concentrations (low nanomolar) of certain sPLA2 isotypes cause the selective release of AA (but not other more abundant fatty acids) from mast cells (bone marrow-derived mast cells (BMMC) and CFTL-15) and THP-1 cells (40). Several lines of evidence suggest that this response is not mediated by the capacity of sPLA2 to hydrolyze membrane phospholipids but by specific binding of sPLA2 to cell surface receptors.
In the last 10 years, different subtypes of membrane receptors for sPLA2 have been identified in a variety of cell types by determining their affinities for various types of sPLA2 (41, 42). Work by Arita and colleagues described the existence of a specific receptor family termed PLA2-I that is abundant in brain and several other tissues and has high affinity for the binding of pancreatic-type sPLA2 (41). More recently, receptors have been divided into two classes termed N-type receptors and M-type receptors. Lambeau and colleagues report that a major difference between N- and M-type receptors is their capacity to bind group III PLA2 (bee venom) (42). For example, the N-type receptor associates very tightly with both group IB PLA2 and group III PLA2, while the rabbit muscle M-type receptor tightly binds groups IB and IIA PLA2 but does not associate with group III PLA2 (42). However, recent studies suggest that binding specificity may also depend on species or the glycosylation patterns of sPLA2 isotypes or receptors (43, 44, 45).
M-type receptors have been cloned and sequenced and their structure shown to be homologous to the macrophage mannose receptor. Little is currently known about the signal transduction pathway that is initiated after occupancy of either the mannose or the sPLA2 receptor. It is known that binding of group IB sPLA2 to N-type receptor is calcium independent while the mannose receptor requires calcium for binding. Occupancy of the mannose receptor is also associated with tyrosine phosphorylation, while addition of group IBs PLA2 has been suggested to affect cell proliferation and AA release via its capacity to activate mitogen-activated protein kinase (MAPK) (46, 47, 48). The current study has focused on signal transduction events that are closely associated with AA mobilization induced by sPLA2 in mast cells. These experiments reveal that addition of sPLA2 isotypes to mast cells is associated with the activation and membrane translocation of group IV PLA2 (cPLA2).
| Materials and Methods |
|---|
|
|
|---|
Octadeuterated (5,6,8,9,11,12,14,15-2H) ([2H8]) AA and trideuterated ([2H3]) stearic acid (SA) were purchased from Biomol Research Laboratory (Plymouth Meeting, PA). Essentially fatty acid-free human serum albumin (HSA), group IB PLA2 (Naja naja) group III PLA2 (bee venom), essential and nonessential amino acids, mouse IgE anti-dinitrophenol (IgE anti-DNP), heat-inactivated FBS, calcium ionophore A23187, DTT, pertussis toxin (PTX), herbimycin, and phosphoinositide 3'-kinase (PI3-K) inhibitor, LY294002, were purchased from Sigma (St. Louis, MO). 1-Palmitoyl-2-[1-14C-]arachidonoyl-sn-glycero-3-phosphocholine (55.6 mCi/mmol) was purchased from Amersham (Arlington Heights, IL). Phospho-p44/p42 MAPK (T202/Y204) E10 mAb and p44/p42 MAPK mAb were purchased from New England Biolabs (Beverly, MA). MAPK-specific inhibitor (PD 98059) was purchased from Calbiochem (La Jolla, CA). RPMI 1640 cell culture media and HBSS were obtained from Life Technologies (Grand Island, NY). HRP-conjugated goat IgG fraction to guinea pig IgG was purchased from Cappel (West Chester, PA). Guinea pig polyclonal Ab raised against purified rabbit M-type 180-kDa sPLA2 receptor and cDNA (5.6 kb) of the same receptor in pBluescript vector were obtained from Dr. Gerard Lambeau (Centre National de la Recherche Scientifique-Institut de Pharmacologie Moleculaire et Cellulaire, Valbonne, France). Mouse groups IIA and V PLA2 vectors were obtained from Dr. B. Kennedy (Merck Frost, West Point, PA) and Dr. J. Arm (Harvard Medical School, Boston, MA), respectively. Enzyme immunoassay kit for detection of PGD2 and thromboxane (TX) B2 were purchased from Cayman Chemical (Ann Arbor, MI).
Mast cell culture and activation
BMMC were obtained from CBA/J mice (The Jackson Laboratory, Bar Harbor, ME) and grown in RPMI 1640 culture medium (Life Technologies) containing 10% (v/v) FCS, 50 µM 2-ME, 2 mM L-glutamine, 1% (v/v) penicillin/streptomycin, and 0.1% gentamicin. The culture medium was supplemented twice a week with 50% WEHI supernatant fluid as a source of IL-3. After 3 wk of culture, BMMC (viability >98% determined by trypan blue exclusion) were used for activation and transfection studies.
BMMC were removed from culture media and washed (three times) using
HBSS containing 0.25 mg/ml HSA. Cells were counted and resuspended in
HBSS containing calcium at 5 x 106
cells/assay. BMMC that had been sensitized with the optimum amount of
IgE anti-DNP (0.5 µg/ml) were stimulated with 2 µg/ml Ag
(DNP-HSA), 50 µM
p-amino-phenyl-
-D-mannopyranoside
BSA (APMP-BSA), and different concentrations of
sPLA2 (0100 nM) for 5 min or with 100 nM
sPLA2 for different periods of time at 37°C
(40). A total of 100 nM sPLA2 is the
maximum amount of ligand that induced the selective release of AA from
BMMC (40). For MAPK inhibitory studies, BMMC were
incubated with vehicle alone (DMSO) or with 50 µM MAPK-specific
inhibitor (PD 98059) for 10 min at 37°C before cell activation with
sPLA2 for different periods of time indicated in
the figure legends. To determine the signal transduction events
upstream of MAPK, BMMC were incubated with tyrosine kinase inhibitor (5
µM herbimycin A), PI3-K inhibitor (25 µM LY 294002), or with the
heterodimeric G-protein modulator (0.5 µg/ml PTX) for 30 min before
stimulating with sPLA2 for 1 min. The
concentrations of herbimycin A and PTX used have been shown to inhibit
sPLA2-induced calcium mobilization
(49). The concentrations of PD98059 and LY294002 were the
recommended doses prescribed by the technical bulletin from the
manufacturer (New England Biolabs). In all cases, the time of
incubation of BMMC with inhibitors were chosen such that there was no
change in cell viability determined by trypan blue exclusion. The
effects of inhibitors were monitored using 100 nM group IB
PLA2, a concentration of ligand that has
previously been shown to induce maximal and selective release of AA
from BMMC (40). At the end of the stimulation period,
cells were removed from supernatant fluids by centrifugation (400
x g for 5 min). After the addition of four volumes of
ethanol to the supernatant fluid, the mole quantities of fatty acids
were determined by negative ion-chemical ionization gas
chromatography/mass spectroscopy (NICI-GC/MS) as described below.
Overexpression of sPLA2 receptor in mast cells
sPLA2 M-type receptor cDNA was isolated from the pBluescript vector by digestion using XbaI followed by partial digestion using EcoRI. The 5.6-kb product was purified using a 1% agarose gel and asymmetrically subcloned into a mammalian expression vector (pCMV5 vector) provided by Dr. Zheng Cui (Wake Forest University School of Medicine, Winston-Salem, NC). Large quantities of the resulting plasmid (pCMV5/sPLA2R) were obtained by transforming competent Escherichia coli followed by extraction and purification using the Wizard Plus plasmid purification system from Promega (Madison, WI). Before transfection studies were performed, the authenticity of pCMV5/sPLA2R was determined by restriction mapping using EcoRI. Before transfection, mast cells were initially placed in fresh culture media for 24 h. Subsequently, mast cells (4 x 107cells/ml) were transfected by electroporation. Briefly, 0.25 ml of cell suspension was incubated with nothing (control), with 15 µg pCMV5, or with pCMV5/sPLA2R and placed on ice for 10 min. Electroporation was performed using a Bio-Rad Gene Pulser (Richmond, CA) with voltage and capacitance set at 270 V and 960 µF, respectively. Cells were then dispersed in 10 ml of BMMC media supplemented with stem cell factor (100 ng/ml) or with IL-3 (10 ng/ml). A total of 6575% of cells were recovered 48 h after transfection, and the viability of these cells was >90% as determined by trypan blue exclusion. The expression of sPLA2 receptors was monitored at different time points after transfection by Western blot analysis as described below. Transfected and control cells were sensitized with 0.5 µg/ml IgE anti-DNP. Transfected BMMC were stimulated with 2 µg/ml Ag (DNP-HSA) or group IB PLA2 as described above, and mole quantities of fatty acids or prostanoids released into supernatant fluids were determined as described below.
Determination of sPLA2 receptor expression by Western blot analysis
Amounts of sPLA2 receptor expressed in mast cells were determined using cell lysates from 1 x 106 cells. Lysates were obtained by incubating BMMC in lysis buffer (100 mM Tris-HCl, pH 7.5, containing 0.1 M NaCl, 2 mM EDTA, 1% Nonidet P-40, 1 mM Na2VO3, 50 mM NaF, 0.1 mM N-tosyl-L-phenylalanine chloromethyl ketone, 0.1 mM quercetin, 1 mM PMSF, 1 µg/ml aprotinin, and 1 µg/ml leupeptin) for 10 min on ice. After removal of nuclei by centrifugation, SDS-PAGE and Western blot analysis was performed. Briefly, extracts were mixed with an equal volume of 2x loading buffer (0.125 M Tris, pH 6.8, 4% SDS, 20% glycerol, and 10% mercaptoethanol, 0.05% bromophenol blue) and boiled for 5 min. Proteins were separated by SDS-PAGE on a 420% polyacrylamide gel. Separated proteins were transferred onto polyvinylidene difluoride (PVDF) membranes, and the blots were incubated overnight with an anti-sPLA2 receptor Ab. Detection of the sPLA2 receptor was accomplished using HRP-conjugated goat IgG fraction to guinea pig IgG from Cappel and SuperSignal CL-HRP enhanced chemiluminescent substrate system from Pierce (Rockford, IL).
Quantitation of free fatty acids in supernatant fluids
[2H8]AA (100 ng) and [2H3]SA, as internal standards, were added to the ethanol extracts of supernatant fluids from Ag-stimulated, sPLA2-stimulated, and control cells. Fatty acids were then converted to pentafluorobenzylesters, and the mole quantities of free fatty acids was determined by NICI-GC/MS using a Hewlett-Packard model 5989 instrument (Palo Alto, CA) (40). Carboxylate anions (m/z) at 279, 281, 286, 303, and 311 for linoleic acid (LA), oleic acid (OA), [2H3]SA, AA, and [2H8]AA, respectively, were monitored.
Quantitation of eicosanoids in supernatant fluids
After stimulation of BMMC, PGB2 (250 ng) was added to ethanol extracts of supernatant fluids as an internal standard, and the samples were concentrated under a stream of nitrogen. Mole quantities of PGD2 and TXB2 were determined using an enzyme immunoassay kit (Cayman Chemical) following the protocol provided by the manufacturer. Amounts of leukotrienes (LT) were determined by reversed-phase HPLC as previously described (31). Briefly, samples were suspended in 30% methanol in water and injected onto an Ultrasphere ODS column (2.1 x 250 mm; Supelco, Bellefonte, PA) that had been conditioned in a solvent that consisted of methanol/water/phosphoric acid (550:450:0.2 v/v, pH 5.7). The solvent was delivered at a flow rate of 0.4 ml/min, and products were monitored (270 and 206 nm) using an Hewlett-Packard diode array detection system. After 5 min, eicosanoids were eluted from the column by increasing the amount of methanol to 100% over 50 min. Mole quantities of LT were determined by UV spectroscopy.
Determination of cPLA2 activity in cytosol and membrane fractions
After stimulation of BMMC with sPLA2 receptor ligands, cells were washed (two times) with HBSS containing 0.25 mg/ml HSA and 5 mM DTT. Cells were then suspended at 1 x 107 cells/ml in sonication buffer (10 mM HEPES, pH 7.4, containing 80 mM KCl, 1 mM EDTA, 1 mM EGTA, 40 µg/ml leupeptin, 25 µg/ml pepstatin, 1 mM PMSF, 10 mM NaF, 0.2 mM Na2VO3, and 4 mM DTT). Sonication (2 x 5 s) was performed using a probe sonicator (Heat System, Farmingdale, NY) at a power setting of 2 and 10% output. Cytosolic and membrane fractions were obtained after ultracentrifugation (100,000 x g for 1 h) and were maintained in sonication buffer containing 20% glycerol. Protein content of fractions was determined using the Coomassie Plus protein assay reagent (Pierce). cPLA2 activity was determined using 400 pmol sonicated vesicles of 1-palmitoyl-2-[1-14C-] arachidonoyl-sn-glycero-3-phosphocholine as substrate and protein from cytosolic (50 µg) or membrane fractions (100 µg). cPLA2 activity was initiated by the addition of substrate to fractions that had been preincubated for 15 min at 37°C in an assay mixture that contained 5 mM DTT. This preincubation was necessary for eliminating residual sPLA2 activity. Reactions were stopped by extracting lipids using the method of Bligh and Dyer (50). 1-Palmitoyl-2-[1-14C-]arachidonoyl-sn-glycero-3-phosphocholine and free fatty acid fractions were isolated by TLC on silica gel G developed in hexane/ethyl ether/formic acid (90:60:6 v/v) (31).
For size-exclusion chromatography (SEC), 300 µg of protein from cytosolic fractions of unstimulated and sPLA2-stimulated cells were loaded onto a Superose 12 column (Pharmacia, Piscataway, NJ), and proteins were eluted with 10 mM HEPES (pH 7.4) containing 80 mM KCl, 1 mM EDTA, 1 mM PMSF, and 1% glycerol at 0.4 ml/min. Fractions (1 min) were collected, and cPLA2 activity was determined using 100-µl aliquots of each fraction. Elution times for known protein standards (Bio-Rad) were obtained and used to calculate the molecular masses of the active fractions.
Western analysis of cPLA2 in cytosol and membrane fractions
Cytosolic and membrane fractions were prepared from BMMC that had been stimulated with sPLA2 receptor ligands as described above. Proteins in membrane fractions were concentrated by precipitation using 4 volumes of ethanol at -20°C. Equal amounts of cytosolic or membrane proteins were mixed with an equal volume of 2x SDS-PAGE loading buffer and then boiled for 5 min. Proteins were then separated on a 420% Tris/glycine polyacrylamide gel. Proteins were transferred onto PVDF membranes, and the blots were blocked using 5% nonfat milk in PBS containing 0.05% Tween (PBS-T) for 1 h. Blots were subsequently incubated with anti-cPLA2 Ab (1 µg/ml) in PBS-T containing 1% nonfat milk overnight. After washing with PBS-T (three times, 10 min), the blots were incubated with anti-rabbit IgG conjugated to HRP. Immunodetection was accomplished using the SuperSignal enhanced chemiluminescence reagents (Pierce).
Determination of MAPK activation
After BMMC stimulation with 100 nM group IB PLA2 for different periods of time, reactions were stopped using 4 volumes of ice-cold HBSS. Cell pellets were obtained after centrifugation and suspended in 50 µl lysis buffer. Protein amounts in lysates were determined using the Coomassie protein assay reagent as described above. Equal amounts of proteins (10 µg/lane) were mixed with 2x SDS-PAGE loading, and samples were boiled for 5 min. Proteins were separated by SDS-PAGE on a 420% polyacrylamide gel. Separated proteins were transferred onto PVDF membranes, and the blots were blocked with 5% nonfat milk in PBS-T (0.05%) for 1 h. The membranes were then incubated with p44/p42 MAPK Ab or phospho-MAPK Ab at dilutions of 1:1000 in PBS-T containing 5% nonfat milk. Detection of MAPK or phospho-MAPK was accomplished using an anti-rabbit Ab linked to HRP and SuperSignal CL-HRP enhanced chemiluminescent substrate system (Pierce). X-ray films were scanned for densitometry using an Image Master software system (Pharmacia) that was coupled to a Sharp JX 32F6 scanner (Mahwah, NJ).
Determination of Ras activation by affinity precipitation/immunoblotting
Ras activation was determined using the Ras activation kit
(Upstate Biotechnology, Lake Placid, NY). Briefly, nonstimulated or
group IB PLA2-stimulated BMMC were incubated in
lysis/wash buffer (25 mM HEPES, pH 7.5, containing 0.15 M NaCl, 1%
Igepal CA-630, 10 mM MgCl2, 1 mM EDTA, 10 µg/ml
leupeptin, 10 µg/ml aprotinin, 25 mM NaF, 1 mM
Na2VO3, and 2% glycerol). Raf-1 Ras Assay Reagent
Agarose conjugate (10 µl) was added to cell lysates (1 mg total
protein) in 1 ml lysis buffer, and the mixture was gently rocked at
4°C for 30 min. The Agarose bead was then collected by
microcentrifugation (14,000 x g, 5 s), washed
(three times) using lysis buffer, and then resuspended in 2x SDS-PAGE
buffer. Proteins were separated using a 420% Tris/glycine
polyacylamide gel and then transferred to PVDF membranes.
Immunodetection was accomplished using 1 µg/ml
-Ras clone RAS10 Ab
(overnight, 4°C) and goat anti-mouse HRP-conjugated IgG (Bio-Rad)
at 1:5000 for 1.5 h at room temperature as primary and secondary
Abs, respectively. Detection of the activated Ras was accomplished
using SuperSignal CL-HRP enhanced chemiluminescent substrate system
(Pierce).
Partial purification of endogenous sPLA2
sPLA2 was extracted from 1.5 x
109 BMMC using 0.18 M
H2SO4 overnight at 4°C.
The acid extract was then concentrated by ethanol precipitation and
sPLA2 isolated by SEC using 0.1 M
Na2SO4, 0.1 M
KH2PO4, pH 7.0, as the
elution buffer at 0.5 ml/min. SEC was performed using an Altex
Spherogel-TSK 3000SW column (7.5 mm internal diameter x 30 cm, Beckman
Coulter, Fullerton, CA). Protein elution was monitored by UV at 280 nm,
fractions (0.5 ml) were collected, and the sPLA2
activity was determined (31). The active fraction eluted
from the SEC column with a molecular mass of
14 kDa, and this
procedure increased the sp. act. from 1.5 pmol/mg/min (acid extract) to
65 pmol/mg/min (active fraction from SEC). The active fraction was used
to stimulate mast cells using protein concentrations ranging from 0 to
20 µg/ml.
Overexpression of mouse group IIA PLA2 or group V PLA2 in BMMC
Mouse group IIA PLA2 cDNA in a mammalian expression vector pSG5 or mouse group V PLA2 cDNA in pcDNA3.1 were isolated from transformed competent E. coli using the Wizard Plus plasmid purification system (Promega). Before transfection studies were performed, the authenticity of the plasmids was determined by restriction mapping using EcoRI (group IIA PLA2) or by PCR using the following primer pair for mouse group V PLA2: 5' primer, GATGAAGGGTCTCCTCACACTG; 3' primer, TAAGCAGAGGAAGTTGGGGTAA from Gene Bank, accession no. AF162713.1). Transfection was performed by electroporation as described above for the sPLA2 receptor. The expression of sPLA2 was monitored at different time points after transfection by activity measurements in the culture medium. Mole quantities of fatty acids released into supernatant fluids were determined by NICI-GC/MS.
Data analysis
All data are expressed as means ± SEM of separate experiments. Statistics (p values) were obtained from Students t test for paired samples. Asterisks denote p < 0.05.
| Results |
|---|
|
|
|---|
Our previous studies revealed that certain
sPLA2 isotypes selectively release AA from cells
(BMMC, CFTL-15, and THP-1) that contain sPLA2
receptors (40) To further examine the requirement of
sPLA2 receptors in the selective release of AA
from mast cells, the sPLA2 receptor was
overexpressed in BMMC. BMMC transfected with a plasmid containing the
cDNA of the M-type sPLA2 receptor, but not
control vector, expressed large quantities of a 180-kDa protein that
was recognized by specific Abs for the sPLA2
receptor (Fig. 1
A).
|
40% of the total cellular AA. This is likely the maximal
amount of AA that can be released from the cell.
During mast cell stimulation with Ag, endogenous
PLA2 is rapidly released into supernatant fluid
and competes with group IB PLA2 for the same
binding sites (31, 40). To determine whether this
sPLA2 induced AA release by binding to cell
surface receptors, receptor-overexpressing cells were stimulated with
Ag and AA release was monitored. Fig. 1
C shows that Ag
induced the release of AA in all three conditions (control, pCMV5, or
pCMV5/sPLA2R). However, Ag induced an
8-fold
higher release of AA from cells overexpressing the
sPLA2 receptor.
The role of sPLA2 receptors in eicosanoid formation by stimulated mast cells was also examined. Mock-transfected cells formed PGD2 (16.5 pmol/5 x 106cell) and TXB2 (15.8 pmol/5 x 106) upon stimulation with 10 nM group IB PLA2 for 5 min. Cells overexpressing sPLA2 receptor formed more PGD2 (51.3 pmol/5 x 106 cells) and TXB2 (25.7 pmol/5 x 106 cells) than mock-transfected cells. Similarly, Ag stimulation induced more PGD2 and TXB2 formation in cells overexpressing sPLA2 receptors than control or mock-transfected cells (data not shown). In contrast, levels of LTB4 were not altered when mock-transfected cells (5.8 ± 0.8 pmol/5 x 106 BMMC, n = 3) or receptor-overexpressing cells (4.9 ± 1.4 pmol/5 x 106 BMMC, n = 3) were stimulated with group IB PLA2. In agreement with our previous studies, LTC4 was not detected by reversed-phase HPLC in the supernatant fluid when BMMC were stimulated with sPLA2 for 5 min (31). Taken together, these data suggest that sPLA2 receptor expression plays a role in the selective mobilization of AA and the formation of prostanoids when mast cells are stimulated with low nanomolar amounts of group IB PLA2. The failure of sPLA2 to increase LTB4 may be due to its incapacity to activate 5-LO in mast cells (31). Additionally, sPLA2 mobilizes AA from mainly phosphatidylethanolamine, a pool that is not readily used for leukotriene biosynthesis in mast cells (51).
Activation of cPLA2 by sPLA2 receptor ligands
A potential mechanism by which sPLA2
receptor ligands may induce the selective release of AA from mast cells
is via cPLA2 activation. To test this hypothesis,
BMMC were treated with group IB PLA2, and the
activity of cPLA2 was determined in cytosolic and
membrane fractions. In control cells, >95% of
cPLA2 activity was located in the cytosol. After
addition of different concentrations of group IB
PLA2, there was a significant increase (2-fold at
100 nM sPLA2) in cPLA2
activity in the cytosolic fraction (Fig. 2
A). Additionally, incubation
of BMMC with group IB PLA2 resulted in a marked
increase (>5- to 15-fold) in membrane-associated
cPLA2 activity (Fig. 2
B). To assure
that the change in cytosolic activity was attributable to
cPLA2, cytosolic proteins were separated by gel
filtration chromatography, and PLA2 activities
were assayed in 1-min fractions. SEC using a Pharmacia Superose 12
column (0.4 ml/min) indicated that the activity from cytosolic
fractions obtained from untreated or group IB
PLA2-treated BMMC eluted at a time (3638 min)
that corresponded to a protein of
100 kDa.
|
We have previously shown that APMP-BSA, a noncatalytic ligand of the sPLA2 receptor, induced the selective release of AA from BMMC (40). To determine whether cPLA2 activation was required for the selective release of AA, we examined the effects of APMP-BSA on cPLA2 activity in BMMC. Incubation of BMMC with APMP-BSA resulted in an increase cPLA2 activity in homogenates from 12.5 ± 0.6 (basal activity) to 14.5 ± 0.4 (p < 0.05), 21.6 ± 4.8 (p < 0.05), and 20.4 ± 4.9 pmol/mg/min (n = 4), after 1, 2, and 5 min, respectively. These data revealed that sPLA2 receptor occupancy alone and not catalytic activity is sufficient in inducing cPLA2 activation in BMMC.
sPLA2 receptor occupancy and MAPK activation
MAPK (p44/p42) has been shown to be responsible for
cPLA2 phosphorylation in some cells (52, 53). To determine whether the activation of
cPLA2 and subsequent selective release of AA by
sPLA2 may be mediated by MAPK pathways, we
examined MAPK activation using a selective phospho p44/p42 Ab. As shown
in Fig. 3
A (upper
panel), BMMC express both isoforms of MAPK (p44 and p42) and
p44/p42 are constitutively phosphorylated in unstimulated BMMC (Fig. 3
A, lane 1, middle panel). After
incubation of BMMC with group IB PLA2, there was
transient phosphorylation 44/p42 MAPK (Fig. 3
A, middle
panel). Maximum phosphorylation (
2.5- and 1.5-fold for p44 and
p42 MAPK, respectively) occurred within 0.52 min after stimulation
with group IB PLA2 (Fig. 3
A,
lower panel).
|
2.5- and 1.4-fold for p44 and p42, respectively) occurred within
12 min after stimulation of BMMC with APMP-BSA (Fig. 3Decrease in cPLA2 activation and AA release by MAPK inhibitor
Another set of experiments used a p44/p42 MAPK inhibitor (PD98059)
to examine whether MAPK phosphorylation played a role in
cPLA2 activation and the selective release of AA
from BMMC stimulated with group IB PLA2. PD98059
significantly attenuated the increase in cPLA2
activity induced by group IB PLA2 (Fig. 4
A). In addition, PD98059
inhibited AA release from BMMC stimulated with group IB
PLA2 (Fig. 4
B). These data suggest
that p44/p42 MAPK phosphorylation and cPLA2
activation are involved in the selective release of AA when mast cells
are incubated with group IB PLA2.
|
The activation of Ras by growth factor receptors or tyrosine
kinases has been shown to result in the recruitment of cRAF, and
activation of extracellular signal-regulated kinase/MAPK cascade
(54, 55). To determine whether the activation of
cPLA2 by sPLA2 is mediated
via tyrosine kinase and Ras activation, we examined the effects of
group IB PLA2 on Ras activation after BMMC had
been incubated with or without tyrosine kinase inhibitor. As shown in
Fig. 5
A, group IB
sPLA2 enhanced Ras activation in BMMC. Ras
activation was attenuated by pretreatment of BMMC with tyrosine kinase
inhibitor (herbimycin). Likewise, herbimycin inhibited cPLA2
activation by group IB PLA2-stimulated BMMC (Fig. 5
B). Herbimycin also suppressed
sPLA2-induced AA release from 582.2 ± 57.8
to 426.2 ± 42.4 pmol/5 x 106 BMMC (n =
4, p < 0.05). To examine other upstream signal
transduction events that might link the sPLA2
receptor to cPLA2 activation,
cPLA2 activity and AA release were monitored in
BMMC stimulated with group IB PLA2 in the
absence or presence of inhibitors of PI3-K or GTP-coupled
receptors. cPLA2 activity induced by
sPLA2 (68.1 ± 5.1 pmol/mg/min,
n = 4) was not influenced by an inhibitor of PI3-K
(LY294002, 58.1 ± 5.6 pmol/mg/min, n = 4) or PTX
(59.2 ± 6.4 pmol/mg/min, n = 4) that uncouples
membrane-bound receptors from GTP. Likewise,
sPLA2-induced AA release (1293.8 ± 84
pmol/5 x 106 BMMC) was not influenced by
pretreatment of BMMC with LY294002 (1345.6 ± 89.7 pmol/5 x
106 BMMC) or by PTX (1464.3 ± 69.4
pmol/5 x 106 BMMC). These data suggest that
tyrosine phosphorylation is upstream of Ras activation and appears to
be a major signal that links sPLA2 receptors to
cPLA2 activation in mast cells.
|
Recently, BMMC have been shown to contain primarily group IIA and
group V sPLA2 (56). To determine
whether endogenous sPLA2 might act in an
autocrine fashion to activate cPLA2 and induce AA
release, BMMC were incubated with different concentrations of a
sPLA2-enriched extract. As shown in Table I
, endogenous sPLA2
induced an increase in cPLA2 activity in BMMC.
Furthermore, endogenous sPLA2 released AA from
BMMC (Table I
). In contrast, levels of other unsaturated fatty acids
(LA and OA) were not influenced when BMMC were incubated with partially
purified endogenous sPLA2 (Table I
). To further
test the hypothesis that group IIA or group V
PLA2 play key roles in AA release, these
sPLA2 isotypes were overexpressed in BMMC (Fig. 6
A). BMMC expressing both
isotypes release more AA into supernatant fluids than mock-transfected
cells (Fig. 6
B). Taken together, these data suggest that
endogenous sPLA2 can function in an autocrine
fashion to activate cPLA2 and enhance AA release
from BMMC.
|
|
| Discussion |
|---|
|
|
|---|
Our previous results indicate that some sPLA2 isotypes induce the selective release of AA from certain cells (BMMC, THP-1, and CFTL-15) but not from HL-60 cells. Interestingly, sPLA2 isotypes can induce the selective release of AA from cells only if these cells express the sPLA2 receptor (40). The current study suggests that the selective release of AA from mast cells is initiated by the binding of sPLA2 to its receptor. Over the past decade, sPLA2 receptors have been described based on binding properties, tissue distribution, or species distribution (42, 43). A cloned sPLA2 receptor termed M-type has homology with the macrophage mannose receptor and DEC-205 of dendrites, suggesting that these proteins may belong to a new class of receptors that possess Ag-recognition properties. Although several biological functions have been attributed to the occupancy of the sPLA2 receptor, the molecular events responsible have not been elucidated.
The current study suggests that sPLA2 receptor occupancy is linked to cPLA2 activation, hence the selective release of AA and the formation of prostanoids by low nanomolar concentrations of sPLA2. Our previous study showed that APMP-BSA, a sPLA2 receptor agonist that has no hydrolytic activity, also induces the selective release of AA from cells expressing the sPLA2 receptor (40). This observation raised the interesting possibility that binding alone (without hydrolytic activity) is sufficient to release AA from cells. For binding to a receptor to be sufficient to induce the selective release of AA, there must be recruitment of another hydrolytic activity within cells that hydrolyzes AA from membrane phospholipids. An ideal candidate for such an activity is group IV PLA2 (cPLA2) because it has been shown to selectively mobilize AA from a number of mammalian cells. cPLA2 is activated by calcium-dependent translocation of the enzyme from a cytosolic location to perinuclear membranes, and this event is dependent on a calcium binding (CALB) domain (57, 58, 59). An important role for cPLA2 in AA metabolism has recently been demonstrated in BMMC obtained from cPLA2-deficient mice (60). In these studies, mast cells from cPLA2 knockout mice do not display immediate or delayed AA metabolism. The current study shows that sPLA2 induces a rapid increase in cPLA2 activity within mast cells. Importantly, there is also a shift in the localization of cPLA2 from predominantly a cytosolic location to a membrane location. This movement of cPLA2 to a membrane fraction is hypothesized to facilitate hydrolysis by placing the enzyme with its phospholipid substrate. Finally, a noncatalytic ligand of the sPLA2 receptor also increased cPLA2 activity in BMMC. Together these data suggest that the selective release of AA from mast cells by sPLA2 receptor ligands is due to the recruitment of cPLA2.
It has been suggested that sPLA2 can affect cell proliferation and AA release via its capacity to activate MAPK (46, 47, 48). The current study has focused on proximal signal transduction events that are closely associated with AA mobilization and metabolism. As mentioned above, AA release in many cells is due to the activation and translocation of cPLA2 to a membrane location, and this process is often accompanied by phosphorylation of cPLA2 by MAPK. p42/p44 MAPK initially appeared to be the major enzymes responsible for cPLA2 phosphorylation (52). However, other kinase pathways have also been shown to activate cPLA2 (61, 62). In fact, in stimulated platelets, inhibitor studies suggest that p38 kinase rather than extracellular signal-related kinases are responsible for cPLA2 phosphorylation (63). In contrast, studies using these same inhibitors show that p44/p42 MAPK and not p38 kinase are involved in AA release from mast cells (64). The current study shows that during sPLA2 receptor occupancy, there is transient phosphorylation of p44 and p42 MAPKs. Moreover, incubation of mast cells with a selective p44/p42 MAPK inhibitor (PD98059) significantly blocked cPLA2 activation and AA release from BMMC in response to sPLA2. Because PD98059 only partially reversed cPLA2 activation, it is likely that other signal transduction pathways or communication between various pathways occur in activated mast cells (64).
Whereas cPLA2 activation has been linked to various MAPKs in many cell types, there is paucity of information regarding upstream signals that link sPLA2 receptor activation to MAPK and cPLA2. In human astrocytoma cells, sPLA2-induced cPLA2 activation has been shown to be insensitive to PTX. In contrast, sPLA2-induced calcium release is sensitive to PTX, caffeine, and herbimycin (49). In lung cancer cells, cPLA2 has been recognized as a Ras-inducible regulator of eicosanoid biosynthesis (65). Therefore, there are several potential pathways that link receptor occupancy to cPLA2 activity within cells. The current data suggest that tyrosine kinase plays a role in sPLA2-induced cPLA2 activation. Importantly, Ras activation was also implicated in the sPLA2 receptor-mediated activation of cPLA2. Further evidence for a role in tyrosine kinase/Ras activation is shown by the attenuation of sPLA2-induced Ras activation by herbimycin. Together, these data provide evidence that binding of sPLA2 to a receptor initiates several critical molecular events including the activation of tyrosine kinase, Ras, and p44/p42 MAPK. This sequence of molecular events is one potential mechanism by which sPLA2 induces cPLA2 activation and the selective release of AA.
Recent studies have identified groups IIA and V sPLA2 as the major sPLA2 isotypes found in mast cells (31, 35, 56). Consequently, it was important to determine whether endogenous sPLA2 isotypes within mast cells can mobilize AA by activating cPLA2. Our data suggest sPLA2 extracted from mast cells induced cPLA2 activation and the selective release of AA. Likewise, overexpression of groups IIA or V sPLA2 in mast cells resulted in an increase in AA release. These data suggest that sPLA2 isotypes in mast cells can act on sPLA2 receptors in an autocrine fashion during mast cell activation.
Overall, our data suggest that the physiologic roles of sPLA2 may not only be mediated by the hydrolytic effects of this family of enzymes on phospholipids and cellular membranes, but also by their capacity to bind to cell surface receptors. Upon receptor binding, sPLA2 induces a signal transduction pathway that leads to cPLA2 activation and AA release. Further studies will be necessary to determine the signal transduction pathways that are associated with other sPLA2-induced biological activities.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alfred N. Fonteh, Department of Internal Medicine, Section on Pulmonary and Critical Care Medicine, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1054. ![]()
3 Abbreviations used in this paper: PLA2, phospholipase A2; sPLA2, secretory PLA2; cPLA2, cytosolic PLA2, LT, leukotriene; HSA, human serum albumin; MAPK, mitogen-activated protein kinase; NICI-GC/MS, negative ion chemical ionization gas chromatography/mass spectrometry; [2H8], octadeuterated; [2H3], tritradeuterated; LA, linoleic acid; OA, oleic acid; AA, arachidonic acid; SA, stearic acid; APMP-BSA, p-amino-phenyl-
-D-mannopyranoside BSA; BMMC, bone marrow-derived mast cells; DNP, dinitrophenol; PTX, pertussis toxin; PI3-K, phosphoinositide 3'-kinase; TX, thromboxane; PVDF, polyvinylidene difluoride; SEC, size-exclusion chromatography. ![]()
Received for publication March 6, 2000. Accepted for publication June 20, 2000.
| References |
|---|
|
|
|---|
administration and during lethal bacteremia. Blood 86:1027.
-1 activation and Ca2+ mobilization in the human astrocytoma cell line 1321N1 by a mechanism independent of its catalytic activity. Biochem. Biophys. Res. Commun. 260:99.[Medline]
and release of arachidonic acid in mast cells: indications of communication between p38 and p42 MAP kinases. J. Biol. Chem. 272:13397.This article has been cited by other articles:
![]() |
N. M. Munoz, A. Y. Meliton, J. P. Arm, J. V. Bonventre, W. Cho, and A. R. Leff Deletion of Secretory Group V Phospholipase A2 Attenuates Cell Migration and Airway Hyperresponsiveness in Immunosensitized Mice J. Immunol., October 1, 2007; 179(7): 4800 - 4807. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Culver and S. M. Laster Adenovirus Type 5 Exerts Multiple Effects on the Expression and Activity of Cytosolic Phospholipase A2, Cyclooxygenase-2, and Prostaglandin Synthesis J. Immunol., September 15, 2007; 179(6): 4170 - 4179. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kikawada, J. V. Bonventre, and J. P. Arm Group V secretory PLA2 regulates TLR2-dependent eicosanoid generation in mouse mast cells through amplification of ERK and cPLA2{alpha} activation Blood, July 15, 2007; 110(2): 561 - 567. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Payne, C. A. Oskeritzian, R. Griffiths, P. Subramanian, S. E. Barbour, C. E. Chalfant, S. Milstien, and S. Spiegel The immunosuppressant drug FTY720 inhibits cytosolic phospholipase A2 independently of sphingosine-1-phosphate receptors Blood, February 1, 2007; 109(3): 1077 - 1085. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Munoz, A. Y. Meliton, A. Lambertino, E. Boetticher, J. Learoyd, F. Sultan, X. Zhu, W. Cho, and A. R. Leff Transcellular Secretion of Group V Phospholipase A2 from Epithelium Induces beta2-Integrin-Mediated Adhesion and Synthesis of Leukotriene C4 in Eosinophils J. Immunol., July 1, 2006; 177(1): 574 - 582. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Femling, W. M. Nauseef, and J. P. Weiss Synergy between Extracellular Group IIA Phospholipase A2 and Phagocyte NADPH Oxidase in Digestion of Phospholipids of Staphylococcus aureus Ingested by Human Neutrophils J. Immunol., October 1, 2005; 175(7): 4653 - 4661. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jaulmes, B. Janvier, M. Andreani, and M. Raymondjean Autocrine and Paracrine Transcriptional Regulation of Type IIA Secretory Phospholipase A2 Gene in Vascular Smooth Muscle Cells Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1161 - 1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Harnett, W. Cao, and P. Biancani Signal-Transduction Pathways that Regulate Smooth Muscle Function I. Signal transduction in phasic (esophageal) and tonic (gastroesophageal sphincter) smooth muscles Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G407 - G416. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Offer, S. Yedgar, O. Schwob, M. Krimsky, H. Bibi, A. Eliraz, Z. Madar, and D. Shoseyov Negative feedback between secretory and cytosolic phospholipase A2 and their opposing roles in ovalbumin-induced bronchoconstriction in rats Am J Physiol Lung Cell Mol Physiol, March 1, 2005; 288(3): L523 - L529. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Granata, A. Petraroli, E. Boilard, S. Bezzine, J. Bollinger, L. Del Vecchio, M. H. Gelb, G. Lambeau, G. Marone, and M. Triggiani Activation of Cytokine Production by Secreted Phospholipase A2 in Human Lung Macrophages Expressing the M-Type Receptor J. Immunol., January 1, 2005; 174(1): 464 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W.M Niessen, P. A.J Krijnen, C. A Visser, C. J.L.M Meijer, and C Erik Hack Type II secretory phospholipase A2 in cardiovascular disease: a mediator in atherosclerosis and ischemic damage to cardiomyocytes? Cardiovasc Res, October 15, 2003; 60(1): 68 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. BOILARD, S. G. BOURGOIN, C. BERNATCHEZ, P. E. POUBELLE, and M. E. SURETTE Interaction of low molecular weight group IIA phospholipase A2 with apoptotic human T cells: role of heparan sulfate proteoglycans FASEB J, June 1, 2003; 17(9): 1068 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Triggiani, F. Granata, B. Balestrieri, A. Petraroli, G. Scalia, L. Del Vecchio, and G. Marone Secretory Phospholipases A2 Activate Selective Functions in Human Eosinophils J. Immunol., March 15, 2003; 170(6): 3279 - 3288. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-W. Park, J.-R. Kim, S.-Y. Kim, J.-K. Sonn, O.-S. Bang, S.-S. Kang, J.-H. Kim, and S.-H. Baek Akt as a Mediator of Secretory Phospholipase A2 Receptor-Involved Inducible Nitric Oxide Synthase Expression J. Immunol., February 15, 2003; 170(4): 2093 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fuentes, M. Hernandez, F. J. Fernandez-Aviles, M. S. Crespo, and M. L. Nieto Cooperation Between Secretory Phospholipase A2 and TNF-Receptor Superfamily Signaling: Implications for the Inflammatory Response in Atherogenesis Circ. Res., October 18, 2002; 91(8): 681 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Silliman, E. E. Moore, G. Zallen, R. Gonzalez, J. L. Johnson, D. J. Elzi, X. Meng, K. Hanasaki, J. Ishizaki, H. Arita, et al. Presence of the M-type sPLA2 receptor on neutrophils and its role in elastase release and adhesion Am J Physiol Cell Physiol, October 1, 2002; 283(4): C1102 - C1113. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response J. Immunol., May 1, 2002; 168(9): 4711 - 4720. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Degousee, F. Ghomashchi, E. Stefanski, A. Singer, B. P. Smart, N. Borregaard, R. Reithmeier, T. F. Lindsay, C. Lichtenberger, W. Reinisch, et al. Groups IV, V, and X Phospholipases A2s in Human Neutrophils. ROLE IN EICOSANOID PRODUCTION AND GRAM-NEGATIVE BACTERIAL PHOSPHOLIPID HYDROLYSIS J. Biol. Chem., February 8, 2002; 277(7): 5061 - 5073. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Fonteh, C. R. Marion, B. J. Barham, M. B. Edens, G.-i. Atsumi, J. M. Samet, K. P. High, and F. H. Chilton Enhancement of Mast Cell Survival: A Novel Function of Some Secretory Phospholipase A2 Isotypes J. Immunol., October 15, 2001; 167(8): 4161 - 4171. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Fonteh, T. LaPorte, D. Swan, and M. A. McAlexander A Decrease in Remodeling Accounts for the Accumulation of Arachidonic Acid in Murine Mast Cells Undergoing Apoptosis J. Biol. Chem., January 5, 2001; 276(2): 1439 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Siegel, L. Sternfeld, A. Gonzalez, I. Schulz, and A. Schmid Arachidonic Acid Modulates the Spatiotemporal Characteristics of Agonist-evoked Ca2+ Waves in Mouse Pancreatic Acinar Cells J. Biol. Chem., May 11, 2001; 276(20): 16986 - 16991. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hernandez, L. Fuentes, F. J. Fernandez Aviles, M. S. Crespo, and M. L. Nieto Secretory Phospholipase A2 Elicits Proinflammatory Changes and Upregulates the Surface Expression of Fas Ligand in Monocytic Cells: Potential Relevance for Atherogenesis Circ. Res., January 11, 2002; 90(1): 38 - 45. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |