| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Center for Experimental Therapeutics and Department of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104; and
Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The importance of CD59 in protecting cells within the vascular space from complement attack is illustrated by the acquired hematological disorder, paroxysmal nocturnal hemoglobinuria (PNH) (9, 10). Due to a defect in GPI anchor biosynthesis, the affected blood cells of PNH patients do not possess CD59 (9, 10, 11, 12) or decay-accelerating factor (DAF), a second GPI-anchored membrane complement inhibitor that acts at the C3 convertase step (9, 10, 13). As a result of DAF and CD59 deficiencies, affected erythrocytes and platelets from these patients are highly sensitive to autologous complement-mediated lysis and activation, and thereby suffer hemolytic anemia and thrombosis (9, 10, 11, 12, 13). Studies on the structure of human CD59 revealed that human CD59 is a single copy gene localized on chromosome 11p13 (14, 15, 16, 17, 18, 19). More recently, CD59 cDNAs from rat, mouse, and pig have been cloned and the encoded proteins functionally characterized (20, 21, 22). The study of animal CD59 has not only facilitated our understanding of the evolution and structure-function relationships of CD59, but also paved the way for establishing appropriate animal models to study the physiological functions of CD59 in vivo. In the case of mouse cd59, a cDNA has been cloned and the corresponding gene has been localized to the region E2-E4 of mouse chromosome 2 (21), a region syntenous with human chromosome 11p13, in which the human CD59 gene has been mapped (19). In an effort to characterize the genomic structure of the mouse cd59, we have identified a second mouse cd59 gene, cd59b. In this study, we describe the cDNA and deduced amino acid sequences of the new gene, the functional characterization of its product as a MAC inhibitor, and the tissue expression patterns of the two mouse cd59 genes.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A full-length mouse cd59a cDNA was amplified by
standard RT-PCR and used as a probe to screen a 129/SV murine 
FixII
genomic library (Stratagene, La Jolla, CA). First-strand cDNA was
synthesized using 20 µg of total liver RNA and oligo(dT) primer, as
previously described (23). Two primers,
5'-AGCACAGTCACTGGCGAT-3' (upstream) and 5'-GAGGCAAGCTCTTACTATAT-3'
(downstream), were designed according to the published cDNA sequence of
mouse cd59a (21). The amplified cDNA (1.25 kb)
was purified on an agarose gel and cloned into the pCR2 vector using
the TA cloning kit (Invitrogen, Carlsbad, CA). The mouse genomic
library was plated and screened according to the manufacturer’s
instruction using 32P-labeled cd59a
cDNA as a probe. Positive clones were purified through secondary and
tertiary screening, and phage DNAs were prepared by the liquid culture
method (24). The phage DNA was digested with
NotI enzyme to release the DNA insert that was subsequently
purified from an agarose gel and cloned into the pBluescript plasmid
vector (Stratagene).
cDNA cloning of cd59b
The following cd59b-specific primers were used to amplify by RT-PCR a 1083-bp cDNA fragment that covered over 80% of the full-length cDNA: 5'-CTGTTTAGACCCGGTTTCTT-3' (P5, upstream), 5'-CCACTATGTAGGTCAGGCT-3' (P6, downstream). The first-strand cDNA used for this reaction was synthesized with total RNAs isolated from the mouse liver. To obtain the remaining 5'-cDNA sequence, the 5'-RACE (rapid amplification of cDNA ends) method (25) was used with a Marathon cDNA amplification kit from Clontech (Palo Alto, CA). The two specific downstream primers used in the 5'-RACE experiment were: 5'-CGGCTACAGCATAGAGACAGGAAT-3' (outside) and 5'-AAGAAACCGGGTCTAAACAG-3' (inside). The full coding region of cd59b was amplified by RT-PCR with the following two primers: 5'-ATGAGAGCTCAGAGGGGA-3' (upstream), 5'-ATCCAGGATGACTTAGAAGCA-3' (downstream). All amplified PCR products were first cloned into the pCR2 vector using the TA cloning kit, and their sequences were determined on an ABI model 373 automatic sequencer using the PRISM labeling kit (Applied Biosystems, Foster City, CA).
Construction of cd59b and cd59a expression plasmids
Both cd59b and cd59a (as a control) were expressed as N-terminal peptide-tagged proteins to facilitate their detection on the cell surface. Initially, the cDNAs (coding region for cd59b and full-length for cd59a (21)) were restriction cut from the pCR2 vector at EcoRI site and subcloned into the pCDNA3 vector at the same site. Subsequently, plasmids encoding cd59b and cd59a proteins containing a FLAG peptide tag (DYKDDDDK) were constructed to help visualize surface expression of the proteins by indirect immunofluorescence using a FLAG-specific Ab. A similar approach involving N-terminal peptide tagging has been successfully used in previous functional studies of human CD59 (26, 27). The FLAG sequence (encoded by a 24-nucleotide sequence GACTACAAGGACGACGATGACAAG) was inserted into the coding region of cd59b or cd59a (after the second amino acid (lysine) in the predicted mature cd59b protein, or after the second amino acid (threonine) in the mature cd59a protein) to yield N-terminal tagged cd59 proteins after cleavage of the signal peptides. Construction of these plasmids was achieved by a two-round PCR method. In the first-round PCR, two separate fragments for cd59b or cd59a were amplified using cd59b or cd59a cDNA in pCDNA3 as a template and the following two pairs of primers: pair 1, T7 (forward) and a cd59b- or cd59a-specific primer containing the FLAG sequence, 5'-TTTGAGcttgtcatcgtcgtccttgtagtcTTTGAGACTAACAGCTGTGGAACA-3' (reverse primer for cd59b, FLAG sequence in lower case) or 5'-TGTGAGcttgtcatcgtcgtccttgtagtcTGTGAGGCTAACAGCTGTGGAACA-3' (reverse primer for cd59a, FLAG sequence in lower case); pair 2, Sp6 (reverse) and a cd59b- or cd59a-specific primer containing the FLAG sequence, 5'-gactacaaggacgacgatgacaagCTCAAATGCTACAACTGTTTAGACCCGGTTTTCT-3' (forward primer for cd59b, FLAG sequence in lower case) or 5'-gactacaaggacgacgatgacaagCTCACATGCTACCACTGTTTCCAACCGGTGGTT-3' (forward primer for cd59a, FLAG sequence in lower case). The two amplified cDNA fragments were purified on a 1% agarose gel. To obtain FLAG-containing cd59b or cd59a cDNA, the purified cDNA fragments were mixed and used in a second-round PCR, with T7 as a forward and Sp6 as a reverse primer. The resulting PCR product was purified, digested with KpnI and NotI, and cloned into KpnI- and NotI-digested pAlter-MAX vector (abbreviated as pAlter below) (Promega, Madison, WI). The recombinant plasmid was confirmed to contain the authentic signal peptide, FLAG, and the correct mouse cd59b or cd59a sequence by sequence analysis before being used in transfection experiment.
Cell transfection experiment
Plasmid containing FLAG-cd59b or FLAG-cd59a, or the control vector (pAlter) was transfected into Chinese hamster ovary cells (CHO; American Type Culture Collection, Bethesda, MD) to assess the MAC-inhibitory activity of the encoded protein. CHO cells were cultured in F12 medium supplemented with 10% FBS, 4 mM glutamine, and 100 U/ml each of penicillin and streptomycin. DNA transfection was conducted using Lipofectamine (Life Technologies, Grand Island, NY) by following the manufacturer’s instructions. To confer G418 resistance, cells were cotransfected with pAlter or pAlter-FLAG-cd59b or cd59a and pCDNA3 (5 µg pAlter or pAlter-FLAG-cd59 plasmid and 100 ng pCDNA3). Two days after transfection, G418 (Life Technologies) was added to the medium (800 µg/ml) to select for transfected cells. Drug-resistant cells began to form small colonies after 2 wk of G418 addition. Individual colonies were picked into a 24-well plate and propagated. Total RNAs were subsequently prepared from the cloned cd59-transfected CHO cells and analyzed by Northern blot analysis to detect cd59b or cd59a mRNA. The clone that contained the highest level of cd59b or cd59a mRNA was chosen for protein expression and MAC-inhibiting activity assays. A drug-resistant clone from pAlter-transfected cells was used as a control in these assays.
Detection of cell surface expression of cd59b and phosphatidylinositol-specific phospholipase C (PIPLC) cleavage experiment
Cell surface expression of cd59b and cd59a in cloned CHO cells was assessed by FACScan analysis using an anti-FLAG mAb. Cells were physically dislodged from the plate in calcium-free PBS (followed by gentle vortex to disperse cell aggregate), washed three times with PBS/BSA (3%), and resuspended at 2 x 106 cells/ml in the same buffer. Cells were incubated with 10 µg/ml anti-FLAG mAb (Sigma, St. Louis, MO; catalogue F-3165) in PBS/BSA (3%) for 30 min at room temperature, washed three times with PBS/BSA (3%) buffer, and incubated for 30 min with a FITC-conjugated rabbit anti-mouse IgG secondary Ab (Sigma; catalogue F-9137). Cells were washed in PBS for three times before being analyzed for fluorescence intensity using a Becton Dickinson FACScan (San Jose, CA). To examine the effect of treatment with PIPLC, cells were washed and resuspended in PBS at 4 x 106 cells/ml. They were then incubated with PIPLC (1 U/ml final concentration; Sigma; catalogue P-8804) for 30 min at 37°C. Cells were washed with PBS/BSA (3%) for three times, stained with anti-FLAG Ab and the secondary Ab, and analyzed by FACScan, as described above.
Functional assays of cd59b
Vector-transfected and FLAG-cd59b- or FLAG-cd59a-transfected CHO cells were tested for their sensitivity to human and mouse complement-mediated lysis. Briefly, cells (2 x 104 cells/well) were seeded in 96-well plates. After reaching 90% confluence, they were loaded with a fluorescent dye, 2',7'-bis-(2-carboxyethyl)-5-(and -6)-carboxyfluorescein, acetoxymethyl ester (BCEF-AM) (Molecular Probes, Eugene, OR), by incubating with 20 µM BCECF-AM at 37°C for 30 min. After washing several times to remove the unincorporated fluorescent dye, the cells were sensitized with 50 µl of an IgG fraction of rabbit anti-hamster lymphocyte (4 mg/ml in HBSS/1% BSA; Intercell Technologies, Hopewell, NJ). The Ab-sensitized cells were then exposed to different concentrations of human or mouse complement in HBSS/1% BSA for 30 min at 37°C. Protection against mouse complement was tested using mouse plasma. Mouse blood was collected by cardiac puncture into EDTA-containing tubes, and plasma was prepared by centrifugation at 3000 rpm on a microcentrifuge. To activate the mouse classical complement pathway, CaCl2 (2 mM final) was added to the assaying wells immediately after mouse plasma addition. At the end of the incubation, the supernatants in the wells were collected to determine the fluorescent dye content as a measure of cell lysis. To the remaining cell pellet, Triton X-100 (1% final concentration) was added to release fluorescent dye in surviving cells. Percentage of complement-mediated cell lysis was calculated by comparing the amount of fluorescent dye released into the supernatant and the total amount of fluorescent dye (supernatant plus cell pellet).
Northern blot analysis
Total RNAs from various mouse tissues were isolated using the Trizol Reagent (Life Technologies). RNA samples (10 µg each lane) were separated on a 1% formaldehyde-agarose gel and transferred onto a nylon membrane (Hybond-N; Amersham, Arlington Heights, IL) via capillary action overnight in 20x SSC. The membrane was cross-linked under UV and hybridized first with a 32P-labeled cd59a probe. After probing with the cd59a probe, the membrane was stripped by boiling in 0.1x SSC-0.1% SDS and rehybridized with a 32P-labeled cd59b-specific probe. The cd59a probe used corresponded to the 5' 370 bp in the cd59a cDNA (21) and was prepared by BamHI digestion of the full-length cDNA. The 124-bp cd59b-specific probe was generated by PCR using the full coding region of cd59b as a template and the following oligonucleotides as primers: 5'-TCCAACTATATTATGAGCCG-3' (upstream, nucleotide 304–323), 5'-TCAATGAGGAAGTTTCTGCG-3' (downstream, nucleotide 408–427). Both cDNA probes were labeled with 32P using random primers. Northern hybridizations were conducted in QuikHyb solution (Stratagene, La Jolla, CA) at 68°C for 1 h. The membrane was washed, first in 2x SSC-0.1% SDS at 55°C for 15 min and then in 0.1x SSC-0.1% SDS at 55°C, and exposed to x-ray film.
Southern blot analysis
Southern hybridization of plasmid and genomic DNAs was conducted using the same general protocol. Plasmid DNAs (1–2 µg DNAs, 10–20 U of restriction enzymes) were digested for 2–3 h. Mouse and rat genomic DNAs were prepared from C57/B6 strain mice and Wistar strain rats, respectively. Human genomic DNA was prepared from liver biopsy samples obtained through the Corporate Human Tissues Network (CHTN; Eastern Division, Philadelphia, PA). Genomic DNAs were digested with different restriction enzymes overnight (3 µg DNAs and 60–90 U of restriction enzyme in 20–30 µl total volume). Samples were electrophoresed on 1% agarose gels and transferred onto nylon membranes (Hybond-N; Amersham) via capillary action in 6x SSC. Membranes were cross-linked under UV and hybridized with the appropriate 32P-labeled probes, as specified. For the genomic Southern blotting, the mouse probe used was an approximately 720-bp PstI-EcoRI fragment corresponding to the 3'-untranslated region of the mouse cd59b cDNA. This cDNA segment is contained within a single exon (exon 4). There is high homology between cd59a and cd59b in this region (95%), and the probe is expected to hybridize to both genes. The rat probe used was a 364-bp fragment (U48255; nucleotide 1029–1392) corresponding to the 3' portion of the rat cd59 cDNA (20). The human probe used was a 373-bp fragment (M34671.1; nucleotide 534–906) corresponding to the 3' portion of the human CD59 cDNA (28). cDNA probes were labeled with 32P using random primers. Southern hybridization was conducted in QuikHyb solution (Stratagene, La Jolla, CA) at 68°C for 1 h. The membrane was washed, first in 2x SSC-0.1% SDS at 55°C for 15 min and then in 0.1x SSC-0.1% SDS at 55°C, and exposed to x-ray film.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Initially, we focused on a 2.2-kb XbaI and a 1.6-kb
XbaI-KpnI restriction fragment. Both fragments
gave positive signals on Southern blot analysis. The sequences of these
fragments were determined after subcloning into the P-Bluescript
plasmid vector. A 79-bp region with 100% homology to the published
mouse cd59a cDNA sequence (21) was identified
from the 2.2-kb XbaI fragment (Table I
). Based on the known genomic structure
of human CD59 (14), it was concluded that this segment
represented exon 2 of the mouse cd59 gene. Unexpectedly,
sequence analysis of the 1.6-kb XbaI-KpnI
fragment failed to identify a consensus sequence with the published
mouse cd59a cDNA (21). Instead, a 102-bp
segment showing a high degree of homology (86% identity) with the
cd59a cDNA was located (Table I). This result suggested that
our cd59 genomic clone represented either a separate CD59
gene or a pseudogene.
|
). By analogy with the human CD59
genomic structure (14), it was concluded that this
PstI-HindIII fragment corresponded to exon 4 of
mouse cd59. Together, the above results identified three
putative mouse cd59 exons (2, 3, 4). Exon 2 was
identical to and exons 3 and 4 had high homology with the
cd59a cDNA sequence (Table I) (21).
To determine whether the partially characterized cd59
genomic fragment represented a functional cd59 gene or a
cd59 pseudogene, RT-PCR was performed to detect mRNA
potentially transcribed from this gene. Two specific oligonucleotide
primers (P5 and P6) were designed based on the putative exonic
sequences. Because the sequences of these two primers were not present
in the previously characterized cd59a cDNA
(21), they were not expected to amplify the known
cd59a cDNA. A 1083-bp cDNA fragment was amplified using
first-strand cDNAs synthesized from the mouse liver. The cDNA was
cloned and sequence analysis showed that it corresponded to the 3'-cDNA
of a new mouse cd59 gene, referred to below as
cd59b (the previously characterized mouse cd59
gene is referred to as cd59a). Subsequently, 5'-RACE was
performed to amplify a 199-bp cDNA, corresponding to the remaining 5'
sequence of cd59b. The full-length cd59b sequence
was obtained from these two overlapping cDNA clones (Fig. 1). All putative exonic sequences (exons
2, 3, and 4) determined from genomic DNA clones could be located within
the full-length cDNA (Fig. 1). There is a high degree of homology
between cd59a and cd59b, except at the extreme
end of the 5'-untranslated region. The most 5' regions in the two
cd59 cDNAs (63 bp in cd59a, 78 bp in
cd59b) are divergent and are encoded by nonhomologous exons
(exon 1).
|
).
Alignment with the amino acid sequence of cd59a showed a
63% sequence identity. Noticeably, there is a high degree of homology
between cd59a and cd59b at both the N-terminal
and C-terminal end (Fig. 2). These
regions are likely to represent signal peptides (N-terminal signal
peptide for protein trafficking and C-terminal GPI anchor attachment
signal peptide). Hydrophobicity analysis revealed these areas to be
highly hydrophobic (Fig. 2B). Comparison of the amino acid
sequence of cd59b with that of human and rat CD59 showed
that cd59b has a slightly higher homology with the human and
the rat homologue (44% and 68%, respectively) than does
cd59a (41% and 59%, respectively).
|
shows that both
FLAG-tagged cd59b and cd59a were expressed on the
surface of CHO cells transfected with FLAG-cd59-containing
plasmids. In contrast, no FLAG expression was detected on pAlter
vector-transfected CHO cells. Furthermore, after PIPLC treatment, both
FLAG-cd59b and FLAG-cd59a were removed from the
cell surface, suggesting that cd59b, like cd59a,
is a GPI-anchored membrane protein. To determine whether
cd59b encodes a protein with MAC-inhibiting activity, the
sensitivity of vector or FLAG-cd59b-transfected CHO cells to
human and mouse complement-mediated lysis was compared. Fig. 4 shows that cd59b- and
cd59a-expressing CHO cells were significantly more resistant
than vector-transfected CHO cells to human and mouse
complement-mediated lysis. This result established that
cd59b is functionally active as a MAC inhibitor.
|
|
A). In addition, there was a
0.6-kb transcript that was detectable in all tissues, but more abundant
in the testis and the heart (Fig. 5A). In contrast, when a
cd59b-specific probe was used on the same blot, abundant
cd59b mRNAs (mainly 0.5-kb, also a 2.7-kb species) were
detected only in the testis and not in any other tissues (Fig. 5B). Thus, the two cd59 genes appear to be
differentially expressed in these tissues.
|
). This result confirmed the existence
of two separate mouse cd59 genes, as established above. In
contrast to the two gene patterns observed in the mouse genomic
Southern blot analysis, only one band was observed with each enzyme in
the Southern blot analysis of rat and human genomic DNAs (Fig. 6). The
only exception was with human DNA digested with the enzyme
PstI (Fig. 6). This was due to the presence of a
PstI restriction enzyme site within the human CD59 cDNA
probe used (28). These data suggest that the rat and human
genomes contain only one CD59 gene.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A mouse homologue of human CD59 (cd59a) has previously been
characterized (21). In this study, we have identified a
second mouse CD59 gene (cd59b) that is structurally related
to cd59a but seems to be regulated differently. One complete
exon (putative exon 2) of cd59b is 100% identical to
cd59a, whereas another exon (putative exon 3) shares 86%
identity with cd59a (Table I). By analogy of the human CD59
genomic structure (14), the remaining cd59b
cDNA sequence is likely to be contained in two additional exons (exons
1 and 4). The putative exon 4 of cd59b is 84% identical to
cd59a, whereas exon 1 has no homology at all with
cd59a. These data suggested that exons 2–4 are homologous
between the two cd59 genes, whereas exon 1 in the two genes
is not related. The existence of two distinct but homologous
cd59 genes in the mouse is further supported by data of
Southern blot analysis of mouse genomic DNA (Fig. 6). Two separate
bands were detected on Southern blot analysis with four different
restriction enzymes (Fig. 6).
Based on hydrophobicity analysis and consensus GPI anchor
attachment residues (32), we predict that the last 20 aa
in cd59b will be removed in the mature protein, with
Ser109 being the residue for GPI anchor
attachment (Fig. 2). The N-terminal 24 aa in cd59a and
cd59b are identical (Fig. 2). Assuming that the first 23
residues correspond to a signal peptide that is cleaved in the mature
protein as proposed for cd59a (21), the mature
cd59b protein should consist of 86 aa, 11 aa residues longer
than the predicted length of mature cd59a (21).
The extra amino acids are located primarily at the C terminus,
immediately above the putative GPI anchor (Fig. 2). This region has
been proposed to provide a stalk between the GPI anchor and the
globular CD59 protein and is thought to have little functional
relevance (21). In cell transfection experiments using
N-terminal peptide-tagged protein constructs, expression of
cd59b and cd59a was detected on the cell surface
of transfected CHO cells. Furthermore, we demonstrated that
cd59b, like cd59a, was susceptible to PIPLC
cleavage from the cell surface (Fig. 3). Finally, we showed that in a
cell lysis test, CHO cells expressing cd59b were
significantly more resistant than vector-transfected cells to human or
mouse complement-mediated killing (Fig. 4). Together, these results
established that cd59b is a GPI-anchored membrane protein
and is functionally active as a MAC inhibitor.
Contrary to a previous study in which cd59a message was
detected by RT-PCR in most mouse tissues but could not be detected by
Northern blot analysis in any of the tissues examined
(21), our Northern blot analysis showed prominent
cd59a expression in the mouse heart, kidney, liver, and lung
(Fig. 5). In contrast to this wider tissue distribution pattern of
cd59a, cd59b mRNAs were only detected by Northern
blot in the mouse testis. Interestingly, the predominant form of
cd59b mRNA in the testis is a 0.5-kb species. This is
substantially shorter than the full-length cd59b cDNA
sequence deduced from two overlapping cDNA clones generated by RT-PCR
(Fig. 1). It is possible that this shortened form of cd59b
mRNA derived from the use of an alternative polyadenylation site.
Examination of the 3'-untranslated sequence of the full-length
cd59b cDNA identified a putative polyadenylation site
(AATAAA, underlined in Fig. 1) approximately 100 bp downstream of the
translation stop codon.
The identification of a second mouse cd59 gene
prompted us to investigate whether there might also be two CD59 genes
in the rat or in the human. Southern blot analysis with a panel of six
different restriction enzymes confirmed the existence of two mouse
cd59 genes, but suggested that only one CD59 gene is likely
to exist in the rat or in the human (Fig. 6). The findings of two mouse
cd59 genes and the testis-specific expression of
cd59b are reminiscent of mouse daf (33, 34). DAF is a single copy gene both in the human (35, 36) and in the rat (37), whereas two daf
genes have been identified in the mouse (33, 34). One
mouse gene encodes a GPI-anchored daf protein
(GPI-daf), and the other encodes a transmembrane form of
daf (TM-daf). Like cd59b, the
TM-daf gene is expressed exclusively in the mouse testis
(33, 34). The two mouse daf genes are believed
to have arisen by gene duplication (33). This mechanism of
evolution may apply also to the two mouse cd59 genes.
The prominent expression of cd59b in the mouse testis suggests that cd59b may play an important role in male reproduction. Although it is not yet known within which compartment of the mouse testis cd59b is expressed, immunohistochemical and Western blotting studies using mAbs against human CD59 have revealed that CD59 is expressed abundantly on mature human sperm and on differentiating spermatocyte (condensing spermatids) (38, 39, 40). It has also been demonstrated in vitro that Ab neutralization of CD59 rendered human sperm susceptible to MAC-induced damage, as indicated by increased immobility and membrane permeability (39). Since functional complement components are abundant in the female reproductive tract (41, 42), it has been speculated that CD59 may be involved in protecting the sperm from complement-mediated damage that might be initiated by anti-sperm Abs present in the female reproductive tract (38, 39, 40). With the identification of cd59b, this hypothesis, as well as the precise pattern of CD59 distribution within the testis and the possible roles of CD59 in other aspects of testicular function can be addressed using the mouse as an animal model.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Wen-Chao Song, Established Investigator of the American Heart Association, Center for Experimental Therapeutics, University of Pennsylvania School of Medicine, 1351 BRBII/III, 421 Curie Blvd., Philadelphia, PA 19104.
3 Abbreviations used in this paper: MAC, membrane attack complex; CHO, Chinese hamster ovary; DAF, decay-accelerating factor; PIPLC, phosphatidylinositol-specific phospholipase C; PNH, paroxysmal nocturnal hemoglobinuria; RACE, rapid amplification of cDNA ends.
Received for publication September 24, 1999. Accepted for publication June 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  X. Zhou, W. Hu, and X. Qin The Role of Complement in the Mechanism of Action of Rituximab for B-Cell Lymphoma: Implications for Therapy Oncologist, September 1, 2008; 13(9): 954 - 966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. S. Bora, S. Kaliappan, P. Jha, Q. Xu, B. Sivasankar, C. L. Harris, B. P. Morgan, and P. S. Bora CD59, a Complement Regulatory Protein, Controls Choroidal Neovascularization in a Mouse Model of Wet-Type Age-Related Macular Degeneration J. Immunol., February 1, 2007; 178(3): 1783 - 1790. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. D. Kim, T. Miwa, and W.-C. Song Retrovirus-Mediated Over-Expression of Decay-Accelerating Factor Rescues Crry-Deficient Erythrocytes from Acute Alternative Pathway Complement Attack J. Immunol., October 15, 2006; 177(8): 5558 - 5566. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Fritzinger, D. M. Toney, R. C. MacLean, and F. Marciano-Cabral Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody Infect. Immun., February 1, 2006; 74(2): 1189 - 1195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Qin, M. Dobarro, S. J. Bedford, S. Ferris, P. V. Miranda, W. Song, R. T. Bronson, P. E. Visconti, and J. A. Halperin Further Characterization of Reproductive Abnormalities in mCd59b Knockout Mice: A Potential New Function of mCd59 in Male Reproduction J. Immunol., November 15, 2005; 175(10): 6294 - 6302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Qin, A. Goldfine, N. Krumrei, L. Grubissich, J. Acosta, M. Chorev, A. P. Hays, and J. A. Halperin Glycation Inactivation of the Complement Regulatory Protein CD59: A Possible Role in the Pathogenesis of the Vascular Complications of Human Diabetes Diabetes, October 1, 2004; 53(10): 2653 - 2661. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Baalasubramanian, C. L. Harris, R. M. Donev, M. Mizuno, N. Omidvar, W.-C. Song, and B. P. Morgan CD59a Is the Primary Regulator of Membrane Attack Complex Assembly in the Mouse J. Immunol., September 15, 2004; 173(6): 3684 - 3692. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jasinski, P. Pantazopoulos, R. P. Rother, N. van Rooijen, W.-C. Song, H. Molina, and M. Bessler A novel mechanism of complement-independent clearance of red cells deficient in glycosyl phosphatidylinositol-linked proteins Blood, April 1, 2004; 103(7): 2827 - 2834. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamada, T. Miwa, J. Liu, M. Nangaku, and W.-C. Song Critical Protection from Renal Ischemia Reperfusion Injury by CD55 and CD59 J. Immunol., March 15, 2004; 172(6): 3869 - 3875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Lin, D. J. Salant, H. Meyerson, S. Emancipator, B. P. Morgan, and M. E. Medof Respective Roles of Decay-Accelerating Factor and CD59 in Circumventing Glomerular Injury in Acute Nephrotoxic Serum Nephritis J. Immunol., February 15, 2004; 172(4): 2636 - 2642. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Inoue, M. Ikawa, T. Nakanishi, M. Matsumoto, M. Nomura, T. Seya, and M. Okabe Disruption of Mouse CD46 Causes an Accelerated Spontaneous Acrosome Reaction in Sperm Mol. Cell. Biol., April 1, 2003; 23(7): 2614 - 2622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Pflugh, S. E. Maher, and A. L. M. Bothwell Ly-6 Superfamily Members Ly-6A/E, Ly-6C, and Ly-6I Recognize Two Potential Ligands Expressed by B Lymphocytes J. Immunol., November 1, 2002; 169(9): 5130 - 5136. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Miwa, L. Zhou, B. Hilliard, H. Molina, and W.-C. Song Crry, but not CD59 and DAF, is indispensable for murine erythrocyte protection in vivo from spontaneous complement attack Blood, May 15, 2002; 99(10): 3707 - 3716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Holt, M. Botto, A. E. Bygrave, S. M. Hanna, M. J. Walport, and B. P. Morgan Targeted deletion of the CD59 gene causes spontaneous intravascular hemolysis and hemoglobinuria Blood, July 15, 2001; 98(2): 442 - 449. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
