|
|
||||||||
ß Repertoires and Differential Distribution in Lymphoid Tissues1

*
Unité de Biologie Moléculaire du Gène, Institut National de la Santé et de la Recherche Médicale Unité 277, and Institut Pasteur, Paris, France; and the
Unité du Développement des Lymphocytes, Institut Pasteur, Paris, France
| Abstract |
|---|
|
|
|---|
14
chain paired to rearranged Vß2, Vß7, Vß8.1, Vß8.2, or Vß8.3
ß-chains and the other exhibiting unskewed
- and ß-chains. The
proportion of these subgroups varies from about 100:0 in thymus, 80:20
in liver, and 50:50 in spleen to 20:80% in bone marrow, respectively.
Finally, further heterogeneity in the tissue-derived DN NKT cells was
discovered by sequencing extensively Vß8.2-Jß2.5 rearrangements in
individual mice. Despite a few recurrences in TCR sequences, we found
that each population exhibits its own and broad TCRß
diversity. | Introduction |
|---|
|
|
|---|
14J
15 TCR
-chain with
TCRß-chains predominantly skewed toward Vß8.2 chains (1, 2, 3, 6, 7, 8). In contrast to conventional T cells, which recognize
peptides presented by polymorphic MHC molecules, most NKT cells are
restricted by a monomorphic MHC class I molecule, CD1d (4, 9, 10), and a sugar moiety of glycolipids bound to CD1d molecules
triggers their activation (11, 12, 13, 14, 15, 16, 17).
A recent study has pointed out the different tissular segregation of
two NKT cell types (18). One cell type is CD1d restricted,
is present in all lymphoid organs, and has a CD4+
or DN phenotype. Its development is mainly thymus dependent. The second
one, enriched in spleen and bone marrow, has a
CD8+ or DN phenotype, is not CD1d restricted, and
develops independently of the thymus. It was further shown that thymus
and liver, which are enriched in absolute numbers of CD1d-dependent
CD4+ and DN NKT cells, are also enriched in NKT
cells with a low expression of NK receptors (Ly-49A and DX5), a
memory/activated phenotype
(CD62L-CD69+), and a TCR
repertoire characterized by an overrepresentation of
Vß8.2+ chains and an under-representation of
four
-chains other than the invariant V
14 one
(18, 19, 20). Conversely, spleen and bone marrow, which are
enriched in absolute numbers of CD1d-independent
CD4+, DN, and CD8+ NKT
cells, are also enriched in NKT cells with a higher expression of NK
receptors, a "naive" phenotype
(CD62L+CD69-), and a less
skewed TCR repertoire (18, 19, 20). Previous work have
suggested that tissue-specific and/or cell type-specific ligands could
be responsible for the distinct TCR reactivities of CD1d-restricted DN
NKT cell hybridomas, derived from different tissues (9, 10, 21, 22). Because the V
14J
15 invariant rearrangement is
generated at random (8), its expression by an important
fraction of NKT cells suggests that some selective pressure is exerted
on the TCR of these cells.
This tissue heterogeneity of NKT cells led us to examine in more
detail, in individual mice, the TCR chain components expressed by the
DN NKT cell subpopulation of various tissue localizations. Due to the
small number of NKT cells recovered from an individual organ and the
lack of many anti-TCR-Vß- and anti-TCR-V
-specific Abs, a
powerful RT-PCR technique was used to quantify the Vß usage and the
V
14 invariant chain expression by thymic, hepatic, splenic, and bone
marrow DN NKT cells of individual mice. We found that DN NKT cells
localized in different tissues display polyclonal and different TCR
repertoires and further demonstrated that these differences reflect the
coexistence of two subgroups of DN NKT cells, the proportion of which
varies depending on the tissue. DN NKT cells of subgroup I express
exclusively the invariant V
14 chain paired with Vß2, Vß7,
Vß8.1, Vß8.2, and Vß8.3 chains and represent
100, 80, 50, and
20% of DN NKT cells in thymus, liver, spleen, and bone marrow,
respectively. In contrast, DN NKT cells of subgroup II express other
TCR
-chains paired with unbiased Vß chains. To further
characterize the various DN NKT cell populations, we extensively
sequenced the Vß8.2-Jß2.5 rearrangements and found that each tissue
contains DN NKT cells with a unique TCRß diversity.
| Materials and Methods |
|---|
|
|
|---|
Female 8- to 12-wk-old C57BL/6 mice used for this study were purchased from IFFA-Credo (lArbresle, France). They were maintained under specific pathogen-free conditions.
Cell preparation
Single-cell suspensions were prepared from thymus, liver, spleen, and bone marrow (femur, tibia). Hepatic leukocytes were recovered from PBS-perfused liver, as described elsewhere (23). After a preincubation step with the 2.4G2 mAb, thymic and hepatic cells were incubated with biotinylated anti-CD8, whereas splenic and bone marrow cells were incubated with biotinylated anti-CD8, anti-CD19, anti-MacI, and anti-GR1 mAbs. After four washes, streptavidin-conjugated beads (Dynal, Oslo, Norway) were added, and the depletion was performed according the procedure described in the Dynal manual. Depleted cell suspensions were recovered after 10 washes.
Antibodies
Anti-Fc
III/II receptors (2.4G2), PE-anti-NK1.1 (PK136),
FITC-anti-TCRß (H57-597), biotinylated and
allophycocyanin-anti-CD4 (RM4-5), biotinylated anti-Ly-6G
(RB6-8C5), biotinylated anti-CD19 (1D3), biotinylated
anti-CD11b (M1/70), biotinylated anti-CD62L (MEL-14) mAbs, and
streptavidin-allophycocyanin were purchased from PharMingen (San Diego,
CA). Biotinylated anti-CD8 (CT-CD8a) and streptavidin-tricolor were
from Caltag (South San Francisco, CA), and streptavidin red 613 was
from Life Technologies (Gaithersburg, MD).
Flow cytometry
After incubation with the 2.4G2 mAb, depleted cell suspensions were stained with anti-NK1.1, anti TCRß, anti-CD4, and anti-CD62L (for the four-color cell sorting) mAbs for 30 min on ice. After four washes, cells were incubated with streptavidin conjugate for 15 min, washed, and resuspended in PBS, 1% FCS. The three-color and four-color cell sortings were performed on a FACStarPlus (Becton Dickinson, Mountain View, CA) and an Epics-Elite ESP (Beckman Coulter, Fullerton, CA), respectively.
RNA extraction and cDNA synthesis
Total RNA from sorted DN NKT cells was extracted and reverse-transcribed using the avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim, Mannheim, Germany), as previously described (24).
Primers
Vß-specific primers, with the exception of Vß8.2, have been
described elsewhere (25). The Vß8.2-specific primer was
TTCATATGGTGCTGGCAGCACT, and the labeled Cß-specific primer was
6-carboxyfluorescein (FAM)-CTTGGGTGGAGTCACATTTCTC. V
-specific
primers, with the exception of V
9, V
15, and V
14,
have been described previously (26). V
9-, V
15-, and
V
14-specific primers were ACACCGTTGTTAAAGGCACC,
GAGCCAAAGACTTATAGTTTT, and CTAAGCACAGCACGCTGCACA, respectively.
The labeled C
-specific primer was FAM-ACACAGCAGGTTCTGGGTTC.
Primers for CD3
were 5'-primer GCCTCAGAAGCATGATAAGC and 3'-primer
CCTTGGCCTTCCTATTCTTG, the one used for run-off reactions being
3'-FAM-CCCAGAGTGATACAGATGTC. The Jß2.5-specific primer was
GAGCCGAGGAGCACAATCTCC.
Semiquantitative PCR and immunoscope analysis of the TCR repertoire
The number of CD3
copies contained in each cDNA sample was
quantified as follows. We used a plasmid bearing a 4-bp deleted
CD3
-specific sequence which can be amplified by the CD3
-specific
primers. From 106 to 102
copies of the plasmid were mixed to 1 µl of cDNA sample, and a
40-cycle competitive PCR was performed using the unlabeled CD3
primers in a final volume of 25 µl. One microliter of the latter PCR
was submitted to two cycles of run-off reaction, using the FAM-labeled
CD3
primer. Resulting fluorescent PCR products were loaded on a 6%
polyacrylamide gel and run on a automated sequencer (Applied
Biosystems, Foster City, CA). The exact number of CD3
copies
contained in each cDNA sample was determined using the immunoscope
software (24, 27). Semiquantitative analyses of the
TCR
ß repertoires were conducted as follows. cDNA containing
104 copies of CD3
-specific cDNAs were
subjected to 31 PCR cycles using either a Vß-specific primer and the
Cß-fluorescent primer, or a V
-specific primer and the
C
-fluorescent primer. Under such conditions, exponential PCRs were
generated for all V-C combinations. The latter were run on an automated
sequencer. The CDR3 length of PCR products and their fluorescence
intensity were determined with the immunoscope software. When working
on unprimed and polyclonal T cell populations, the CDR3 size
distribution of each V-C-specific PCR product adopts a Gaussian-like
distribution, composed of six to eight peaks separated by three
nucleotides, because they derive from in-frame mRNAs. The area of peaks
is proportional to the intensity of fluorescent band and thus to the
initial amount of TCR transcripts. The percentage of fluorescence
intensity of a given V-C combination was determined as the ratio of the
area of all peaks generated in a single V-C PCR product to areas of all
V-C-generated peaks in the T cell population.
Cloning and sequencing of the Vß8.2-Jß2.5 rearrangements
For each sample, an amount of cDNA containing 2 x
104 copies of CD3
was amplified using Vß8.2-
and Jß2.5-specific primers with 5 U Pfu DNA polymerase
(Stratagene, La Jolla, CA) in the suppliers buffer. PCR products were
ethanol precipitated and cloned in the PCR-Blunt II-Topo vector from
the Zero Blunt TOPO PCR Cloning Kit (Invitrogen, Carlsbad, CA),
following the manufacturers instructions. Transformation of TOP10 One
Shot-competent cells by the previous ligation products and sequencing
of cloned Vß8.2-Jß2.5 rearrangements were performed as described
(28). The error rate of sequences, consistent with the
experimental procedure, as calculated on Vß8.2 and the Jß2.5
germline sequences, was 10-4
mutations/nucleotide.
| Results |
|---|
|
|
|---|
To address the question of whether DN NKT express distinct
repertoires depending on the tissue they colonize,
NK1.1+
TCRßintCD4-CD8-
cells were sorted (>99% pure) from thymus, liver, spleen, and bone
marrow of individual mice (Fig. 1
). RNA
was extracted from a defined number of cells in each population, and
the TCR-Vß usage was measured by a semiquantitative RT-PCR procedure
combined to the immunoscope technology, as described in Materials
and Methods. Compared with conventional T cells, DN NKT cells from
thymus and liver preferentially, although not exclusively, use Vß2,
Vß7, Vß8.1, Vß8.2, and Vß8.3 segments (Fig. 2
). The latter are found in similar
proportion in the two organs (Table I
).
In spleen, the Vß usage of DN NKT cells is less skewed than in thymus
and liver (Fig. 2
), Vß7, Vß8.2, and Vß8.3 still being
over-represented (Table I
). Bone marrow-derived DN NKT cells display a
Vß usage similar to that of conventional T cells (Fig. 2
), the only
noticeable difference being an over-representation of Vß7 and Vß8.2
chains (Table I
).
|
|
|
14 invariant chain by DN NKT
cells from various tissues
All NKT cells do not express the invariant V
14 chain (7, 8, 14, 21). It was thus necessary to determine the proportion of
V
14 invariant chain-bearing cells in the sorted DN subpopulations.
Because the anti-V
14 Ab does not recognize all
V
14+ NKT cells (Ref. 7 and data
not shown), it precludes this investigation by flow cytometry; we thus
used the same semiquantitative RT-PCR approach as above to analyze
V
14 transcripts in DN NKT cells.
In thymus, liver, spleen, and bone marrow, the V
14C
immunoscope
profiles of DN NKT cells display a single 10-aa CDR3 length peak (Fig. 3
A) which was further
identified to the V
14J
15 invariant rearrangement (data not
shown). This, incidentally, confirms the purity of sorted DN NKT cells
because conventional T cells show a polyclonal V
14C
profile with
several CDR3 size peaks (Fig. 3
A). Quantification of the
invariant rearrangement by RT-PCR revealed, however, significant
differences between tissues (Fig. 3
B). Relative to the same
number of TCR transcripts, expression was highest in thymus and liver,
intermediate in spleen, and low in bone marrow. This observation
implies that either all DN NKT cells express the V
14 invariant
rearrangement, albeit at different levels, or that
V
14+ cells are mixed with variable amounts of
V
14- cells. Because ß-chain expression, as
measured by flow cytometry analysis, was similar in all cases, we
favored the latter hypothesis. Because thymic DN NKT cells were
reported to express almost exclusively the invariant V
14 chain
(2), a reasonable assumption is that thymus, liver,
spleen, and bone marrow might contain
0, 20, 50, and 80% of
V
14- DN cells, respectively.
|
The fraction of cells overexpressing Vß2, Vß7, Vß8.1,
Vß8.2, and Vß8.3 segments in the various tissues closely correlates
with the proportion of putative V
14+ cells,
suggesting the existence of two subgroups of DN NKT cells with distinct
TCR repertoires. Thus, and since, consistent with a recent study
(18), we found that the percentage of
CD62L- DN NKT cells varies in different tissues
(99% in thymus, 96% in liver, 50% in spleen, and 40% in bone
marrow; data not shown), in a way reminiscent of the
V
14+ cell proportions, we purposefully
compared the Vß and V
usages of CD62L- and
CD62L+ DN NKT cells.
Because the small numbers of thymic and hepatic
CD62L+ DN NKT cells hinder analyses of their
repertoire, we focused on spleen that contains comparable numbers of
CD62L- and CD62L+ as well
as V
14+ and V
14- DN
NKT cells. To obtain a sufficient number of cells, 95% pure splenic
CD62L- and CD62L+ DN NKT
cells were isolated from three spleens, and the V segment usage of
their TCR chains was analyzed semiquantitatively.
CD62L- cells displayed a TCR-Vß usage strongly
biased toward Vß2, Vß7, Vß8.1, Vß8.2, and Vß8.3 segments
(Fig. 4
A, left) and
expressed almost exclusively the invariant V
14 chain (Fig. 4
B, left). In contrast,
CD62L+ cells had an unbiased Vß usage (Fig. 4
A, right), and TCR
-chains distinct from the
invariant V
14 chain (Fig. 4
B, right).
Remarkably, the V
14 invariant chain with a 10-aa-long CDR3 region is
the unique V
14-C
rearrangement of CD62L-
DN NKT cells, as disclosed by immunoscope profile (Fig. 4
C,
left). The rare V
14-C
rearrangements detected in the
CD62L+ population are polyclonal because several
CDR3 lengths were observed (Fig. 4
C, right).
Therefore, splenic DN NKT cells contain two subgroups: subgroup I cells
of CD62L- phenotype use the invariant V
14
chain associated with Vß2, Vß7, Vß8.1, Vß8.2, and Vß8.3
chains; and subgroup II cells of CD62L+ phenotype
express unbiased TCR
- and ß-chains.
|
The respective proportions of V
14+ and
V
14- cells in thymus, liver, spleen, and bone
marrow, are 100:0, 80:20, 50:50, and 20:80, respectively. Thus, we took
into account the aforementioned proportions to determine whether the
coexistence in different proportions of the two subgroups of DN NKT
cells, as defined on the basis of their TCR repertoire, underlies the
distinct Vß usages found in the various tissues.
In view of the Vß usage obtained in Fig. 4
and the assumed relative
tissue distribution of the two subgroups, we calculated a TCR-Vß
usage for each tissue and compared it with the one experimentally
obtained and depicted in Fig. 2
. Fig. 5
shows that for each tissue, the calculated TCR-Vß usage of DN NKT
cells closely matches the experimental one. It is highly likely,
therefore, that thymus contains only subgroup I DN NKT cells whereas
liver, spleen, and bone marrow harbor 80:20, 50:50, and 20:80 mixtures
of subgroups I and II, respectively. Although all splenic
CD62L- DN NKT cells express the invariant V
14
chain, in liver and bone marrow the proportion of
CD62L- DN NKT cells is higher than the
V
14+ cell proportion. Hence, subgroup I cells,
as defined on the basis of their TCR components, do not represent all
of the CD62L- DN NKT cells in the latter
tissues.
|
We next investigated the polyclonality of DN NKT cell
TCRß-chains in individual mice. The standard polyclonality of
conventional T cells is reflected into Gaussian-like CDR3 size
distributions for every analyzed VßCß or VßJß immunoscope
profile. Representative profiles obtained for Vß segments either
predominantly used by subgroup I (Vß2 and Vß8.2) or used by
subgroup II (Vß5.1 and Vß12) DN NKT cells are shown in Fig. 6
. In all mice, VßCß combinations
displayed a Gaussian-like distribution (Fig. 6
and data not shown). The
analysis of Vß8.2-bearing cells was further refined by measuring the
Jß usage (which showed a bias in favor of Jß2.1, Jß2.5, and
Jß2.7 in all cases; data not shown). The 12 Vß8.2Jß immunoscope
profiles were Gaussian-like as well. Thus, in both subgroups and in all
tissues, DN NKT cells were polyclonal. We never detected a clonal
expansion that would show a higher CDR3 size peak over the Gaussian
polyclonal background.
|
It was of interest to determine whether various tissues share
identical DN NKT cells. We sequenced a large number of ß-chain
rearrangements among the Vß8.2-Jß2.5 combination, most expressed
within the V
14+ subgroup. cDNAs were prepared
from thymic, hepatic, splenic, and bone marrow-derived DN NKT cells
purified from an individual mouse, and Vß8.2-Jß2.5 PCRs were
performed on identical amounts of cDNA, containing 2 x
104 copies of CD3
transcripts (about one-tenth
of the total cDNA). The resulting PCR products were cloned in
Escherichia coli and sequenced until approaching
saturation.
From the number of sequences found once, twice, or more, it is possible
to extrapolate and calculate the likely number of distinct sequences
present in a given sample, known as maximum likelihood estimate (MLE)
(29, 30). As shown in Table II
, for each sample, >250 sequences were
needed to approach a plateau. MLE values in the same range as in Table II
were found in DN NKT cells from identical tissues of other mice
(data not shown). Because thymic DN NKT cells are a homogeneous
population of subgroup I cells, it is possible to provide an estimate
of their Vß repertoire size. About 50% of thymic DN NKT cells use
the Vß8.2 segment (Ref. 18 and data not shown), and the
frequency of Jß2.5 usage among Vß8.2 rearrangements in the latter
population, as determined by immunoscope analysis (data not shown), is
13%. Their Vß repertoire size can thus be calculated as the
number of distinct Vß8.2-Jß2.5 sequences (MLE value in Table II
)
divided by (frequency of Vß segment x frequency of Jß
segment). The result of this calculation gives an estimate of 3.2
x 103 distinct TCRß rearrangements for 2
x 105 purified thymic DN NKT cells, each
rearrangement being thus shared by 60 thymic DN NKT cells. In
comparison, 2645 naive T splenocytes share a given TCRß
rearrangement that can associate with at least two distinct V
chains
(31). Hence, the average size of DN NKT cell clones is
close to that of conventional T cells.
|
Shared nucleotide and amino acid Vß8.2-Jß2.5 sequences in an individual animal between tissue-derived DN NKT cells
Table III
shows that 6 distinct
nucleotide sequences were shared between thymus and liver, 9 between
thymus and spleen, and 8 between liver and spleen of 151, 182, and 248
distinct sequences in thymus, liver, and spleen, respectively (Table II
). None was found between bone marrow (84 distinct sequences, Table II
) and thymus, and only one was found between bone marrow and liver or
spleen. Translation of CDR3 nucleotide sequences revealed a greater
recurrence at the amino acid level (Table III
). Two amino acid
sequences, 8- and 9-aa-long CDR3, were common to thymus, liver, and
spleen, and several others found in two of the three organs. As for
bone marrow, only two and three sequences were common to, respectively,
thymus and liver, and seven to the spleen. The amino acid CDR3
sequences that originate from distinct nucleotide sequences are
indicated in Table III
. Their relatively high number among recurrent
sequences suggests that a selection takes place at the protein
level.
|
To determine whether identical sequences would be found in other animals, we analyzed thymic and hepatic DN NKT cells from a second mouse, splenic and bone marrow DN NKT cells from a third mouse (data not shown). Eight, 10, 13, and 2 amino acid sequences, mostly encoded by different nucleotide sequences, were recurrent to thymi, livers, spleens, and bone marrows, respectively. Some of them were encoded in a given organ by two distinct nucleotide sequences. These observations show that the Vß8.2-Jß2.5 repertoire of DN NKT cells irrespective of the tissue localization displays a large individual variability, as has already been described for conventional T cells (32).
| Discussion |
|---|
|
|
|---|
In thymus, liver, spleen, and bone marrow,
100, 80, 50, and 20% of
DN NKT cells expressing the invariant V
14 chain were, respectively,
observed. The skewing in the TCR-Vß usage toward Vß2, Vß7,
Vß8.1, Vß8.2, and Vß8.3 segments of each tissue-derived
population decreased in proportion to V
14 expression. The latter
correlation was suggestive of the existence of two distinct subgroups,
one expressing a TCR biased for both chains and the other expressing an
unbiased TCR. Because CD62L- and
CD62L+ DN NKT cells segregate in these tissues in
proportions reminiscent of the V
14+ and
V
14- populations, particularly in spleen, the
V
and Vß usages of splenic CD62L- and
CD62L+ DN NKT cells were analyzed.
CD62L- DN NKT cells were found to express
exclusively the invariant V
14 chain associated with Vß2, Vß7,
Vß8.1, Vß8.2, or Vß8.3 chains, whereas
CD62L+ cells express TCR
-chains other than
V
14, associated with unbiased TCR ß-chains. We further
demonstrated that subgroup I DN NKT cells, as defined by the expression
of a biased TCR repertoire, and subgroup II DN NKT cells, as defined by
the expression of an unbiased TCR repertoire, coexist in thymus, liver,
spleen, and bone marrow in proportions close to 100:0, 80:20, 50:50,
and 20:80, respectively.
The above findings are consistent with several observations reported by
other groups : DN NKT cells were recently found to be diminished in
J
281-/- mice by
90, 75, 40, and 6080%
in thymus, liver, spleen, and bone marrow, respectively (19, 20). In sharp contrast to CD1-/- mice in
which DN NKT cells express an unbiased TCR
ß repertoire, DN NKT
cells from J
281-/- mice express, exclusively
in thymus and liver, a TCR
ß repertoire which is biased toward the
single TCR ß-chain (18). These thymic and hepatic cells
are therefore likely to be selected by CD1d molecules in
J
281-/- mice, being otherwise not selected
in C57BL/6 animals in which they display a TCR repertoire highly skewed
for both TCR chains (subgroup I DN NKT cells), as shown in the present
work. Hence, thymus and liver of C57BL/6 mice might comprise a
percentage of V
14+ DN NKT cells that is
slightly higher than that deduced from residual DN NKT cells of
J
281-/- mice. The overexpression of
Vß8.2+ chains and the low expression of non
V
14 TCR
-chains which were observed on thymic and hepatic DN
NKT cells by flow cytometry suggested that the majority of these cells
were harboring a TCR repertoire biased for both chains
(18), which was confirmed by our data. However, the bias
toward Vß8.2+ chain expression simultaneously
with an important expression of TCR
-chains other than V
14 by
splenic and bone marrow DN NKT cells was interpreted as the existence,
in these tissues, of cells bearing a TCR repertoire in which only the
ß-chain is biased (18). In view of our results, the flow
cytometry stainings of Eberl et al. can be
reinterpreted as reflecting the tissue-variable mixture of subgroups I
and II of DN NKT cells that we identified, rather than the existence of
DN NKT cells biased either for both TCR chains, in thymus and liver, or
for the single TCR ß-chain, in spleen and bone marrow.
All DN NKT cells display a memory phenotype because they bear high
levels of the CD44 molecule. However, Oehen et al. (33)
reported that only conventional memory T cells having down-regulated
the CD62L molecule display an immediate effector function and suggested
that chronic Ag activation is required to maintain CD62L at low levels.
It is possible that this correlation also applies to NKT cells because
they participate in the very early stages of immune responses
(34, 35, 36) and produce high levels of cytokines within few
hours after TCR engagement (31, 34, 35, 37, 38). Thus,
subgroup I DN NKT cells
(V
14+CD62L-) may be
subject to a chronic activation in all tissues. In spleen, all subgroup
II cells are CD62L+, hence, likely not
chronically stimulated. In liver and bone marrow, DN NKT cells comprise
higher numbers of CD62L- than
V
14+ cells, meaning that their
CD62L- population has not only subgroup I cells
but also subgroup II cells. Therefore, liver and bone marrow
environments may deliver stimulatory signals both to subgroup I and
subgroup II cells. Furthermore, there is a good relevance between the
differential ability of DN NKT cells from various tissues to secrete
rapidly cytokines and their phenotype of effector and/or resting memory
cells in these tissues (19). Overall, CD62L is
differentially expressed by subgroup II cells depending on the tissue,
which strongly suggest that the two subgroups may be regulated by
distinct sets of ligands. Our work also reveals that
CD62L- DN NKT cells are more heterogeneous than
their CD4+ counterpart because the latter has
been recently demonstrated to exhibit a TCR biased for both chains
whatever their tissue localization (18).
CD4+ and DN NKT cells which develop in
CD1d-/- mice have been shown to display an
unbiased TCR repertoire (18). This observation has led to
the hypothesis that CD1d-dependent and -independent NKT cell
populations could be distinguished from each other by the expression of
a biased and an unbiased TCR repertoire, respectively. However, all
tissues comprise about 70% of CD1d-restricted DN NKT cells
(18) whereas the two subgroups segregate differently. No
strict correlation can be thus established between subgroup I and II DN
NKT cells, and CD1d restriction in wild-type mice. In particular,
subgroup II DN NKT cells are likely a mixture of CD1d-dependent and
-independent cells, in spleen and bone marrow of wild-type mice.
Moreover, on immunoscope analysis, the TCR ß-chains expressed by both
DN NKT cell subgroups displayed Gaussian-like distributions with
respect to the CDR3 length, which is indicative of a considerable DN
NKT cell TCRß diversity and of the absence of clonally expanded
cells. These observations indicate that a wide range of TCR
- and
ß-chains allow the recognition of CD1d molecules and suggest that
homeostasis is maintained, despite the activated phenotype of DN NKT
cells but consistent with their being nonaggressive in the mouse, by
inhibitory mechanisms of their effector functions (probably involving
Ly-49 molecules).
The tissue heterogeneity of the DN NKT cells was further shown by the
extensive sequencing of Vß8.2-Jß2.5 rearrangements of thymic,
hepatic, splenic, and bone marrow populations purified from an
individual mouse, because we found that each tissue-derived population
shared only a few nucleotide and amino acid sequences with the others.
This observation is consistent with two non-mutually exclusive
hypotheses: either a tissue-specific selection of DN NKT cell TCR
occurs; or DN NKT cells are subject to continuous fluxes between
tissues. Previous work reported that when challenged with distinct
CD1d+ cell types, CD1d-restricted NKT cell
hybridomas with different TCRs display their own autoreactivity
patterns independently of the level of CD1d expression, even when they
share same
-chain and Vß segment (21, 22), and that
the reactivity of one of two NKT cell hybrids bearing the V
14
invariant chain but different Vß-chains requires CD1d trafficking to
endosomal compartments (22). Moreover, the composition of
hybridoma TCR chains appeared to be critical in the recognition of
-galactosylceramide (14), a synthetic glycolipid
capable of eliciting in vivo and in vitro NKT cell responses (11, 14, 34, 35, 36) and a recent study suggested that oligoclonal
expanded NKT cells can discriminate between distinct
glycosylphosphatidylinositol Ags (15). These studies,
which emphasize on one hand the NKT cell reactivity to endogenous and
cell type specific-ligands and on the other hand the role of NKT cell
TCR in the recognition of glycolipid Ags, argue in favor of a TCR
tissue-specific selection.
Vß8.2Jß2.5 rearrangements are predominantly used by subgroup I cells and consistent with the proportion of this subgroup in the various tissues, the highest occurrence of common sequences was observed among thymic, hepatic, and splenic DN NKT cells. Moreover, it is a very unlikely event to find T cells with identical nucleotide TCRß rearrangement and which developed from different precursors. Therefore, because thymus comprises almost exclusively subgroup I cells, the nucleotide recurrence of the latter populations show that at least some subgroup I DN NKT cells share a common precursor.
The present report thus demonstrate: 1) that DN NKT cells comprise two
subgroups of cells: subgroup I, which expresses the invariant V
14
chain in association with Vß2, Vß7, Vß8.1, Vß8.2, and Vß8.3
chains, and subgroup II, which express other
-chains paired with
unskewed ß-chains; 2) that the proportion of subgroup I and subgroup
II DN NKT cells is about 100:0 in thymus, 80:20 in liver, 50:50 in
spleen, and 20:80 in bone marrow; 3) that in all tissues, both
subgroups are polyclonal; and 4) that DN NKT cells from each tissue
express a large individual TCR Vß8.2Jß2.5 sequence diversity.
During the past years, many studies have focused on NKT cell
involvement, mainly through their cytokine production, in rejection
of tumors (39, 40), autoimmune diseases
(41, 42, 43), and infectious processes (15, 44, 45). Bone marrow DN NKT cells have been recently implicated in
the IL4-mediated suppression of acute graft vs host disease
(46). Another study reports that insulin-dependent
diabetes mellitus in nonobese diabetic mice is in part related to a
dysfunction of IL12-mediated IFN-
secretion by TCR-stimulated NKT
cells and that cytokine production by TCR-stimulated NKT cells of
distinct tissue localization is heterogeneous (42).
Because CD4 vs DN NKT cell proportions and subgroup I vs subgroup
II DN NKT cell proportions vary depending on the tissue, it will be of
interest to determine the cytokines produced by these respective NKT
cell subpopulations on TCR engagement and to determine whether all
these NKT cell subpopulations are identically implicated in the various
immune responses. Lastly, almost complete disappearance of
CD4+ NKT cells was observed in liver of
LFA-1-deficient mice (47), the residual NKT cells being
thus likely of DN phenotype (48). It is intriguing that in
the latter, residual NKT cells do not display the Ly-49 phenotype of
liver but instead that of splenic wild-type NKT cells. Whether these
cells belong to subgroup I and/or subgroup II DN NKT cells is an
interesting question to be addressed. Overall, this report and those of
others contribute to a better definition of NKT cell subpopulations and
thus should help to unravel their respective functions in homeostasis
and immunopathology.
|
| Acknowledgments |
|---|
plasmid; and M.-C. Gendron for the four-color cell
sorting. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Irina Apostolou, Unité de Biologie Moléculaire du Gène, Institut National de la Santé et de la Recherche Médicale Unité 277, and Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris cedex 15, France, ![]()
3 Abbreviations used in this paper: DN, double negative; CDR3, complementarity-determining region 3; MLE, maximum likelihood estimate; FAM, 6-carboxyfluorescein; int, intermediate. ![]()
Received for publication November 8, 1999. Accepted for publication June 7, 2000.
| References |
|---|
|
|
|---|
chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.
ß+ cells in the liver of mice. J. Exp. Med. 180:699.
14+ TCR
chain in NK1.1+ T cell populations. Int. Immunol. 7:1157.
14-J
281 rearrangements in NK1+ T cells. Eur. J. Immunol. 27:1576.[Medline]
14 NKT cells by glycosylceramides. Science 278:1626.
-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.
-galactosylceramide specifically stimulates V
14+ NK T lymphocytes. J. Immunol. 161:3271.
-galactosylceramides and their effects on the immune system and CD1 molecules. J. Med. Chem. 42:1836.[Medline]
- or IL-12-treated mice: a major role for bone marrow in NKT cell homeostasis. Immunity 9:345.[Medline]
ller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor ß chain vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.
ß TCR repertoire of naive
mouse splenocytes. J. Immunol. 165:5782.
-galactosylceramide directs conventional T cells to the acquisition of a Th2 phenotype. J. Immunol. 163:2373.
-galactosylceramide polarizes CD1-reactive NK T cells towards Th2 cytokine synthesis. Eur. J. Immunol. 29:2014.[Medline]
-galactosylceramide. J. Immunol. 163:2387.
-galactosylceramide demonstrates its immunopotentiating effect by inducing interleukin IL-12 production by dendritic cells and IL-12 receptor expression on NKT cells. J. Exp. Med. 189:1121.
14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.
14 NKT cells. Proc. Natl. Acad. Sci. USA 95:5690.
ß-T cell receptor TCR+ CD4-CD8- (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic NOD/Lt mice by the influence of interleukin IL-4 and/or IL-10. J. Exp. Med. 187:1047.
secretion of peripheral natural killer T cells in nonobese diabetic mice suggest new pathogenic mechanisms for insulin-dependent diabetes mellitus. J. Exp. Med. 190:963.
14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
-producing CD4+ natural killer T cells by Mycobacterium bovis bacillus Calmette-Guérin. Eur. J. Immunol. 29:650.[Medline]
ß+ cell development: evidence that liver NK1.1+TCR
ß+ cells originate from multiple pathways. J. Immunol. 162:3753.This article has been cited by other articles:
![]() |
T. Demoulins, A. Abdallah, N. Kettaf, M.-L. Baron, C. Gerarduzzi, D. Gauchat, S. Gratton, and R.-P. Sekaly Reversible Blockade of Thymic Output: An Inherent Part of TLR Ligand-Mediated Immune Response J. Immunol., November 15, 2008; 181(10): 6757 - 6769. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ferreira, A. Furmanski, M. Millrain, I. Bartok, P. Guillaume, R. Lees, E. Simpson, H. R. MacDonald, and J. Dyson TCR-{alpha} CDR3 Loop Audition Regulates Positive Selection J. Immunol., August 15, 2006; 177(4): 2477 - 2485. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kawachi, J. Maldonado, C. Strader, and S. Gilfillan MR1-Restricted V{alpha}19i Mucosal-Associated Invariant T Cells Are Innate T Cells in the Gut Lamina Propria That Provide a Rapid and Diverse Cytokine Response J. Immunol., February 1, 2006; 176(3): 1618 - 1627. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Stewart, M. J. Smyth, G. J. P. Fernando, I. H. Frazer, and G. R. Leggatt Inhibition of Early Tumor Growth Requires J{alpha}18-positive (Natural Killer T) Cells Cancer Res., June 15, 2003; 63(12): 3058 - 3060. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sidobre, O. V. Naidenko, B.-C. Sim, N. R. J. Gascoigne, K. C. Garcia, and M. Kronenberg The V{alpha}14 NKT Cell TCR Exhibits High-Affinity Binding to a Glycolipid/CD1d Complex J. Immunol., August 1, 2002; 169(3): 1340 - 1348. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Laloux, L. Beaudoin, C. Ronet, and A. Lehuen Phenotypic and Functional Differences Between NKT Cells Colonizing Splanchnic and Peripheral Lymph Nodes J. Immunol., April 1, 2002; 168(7): 3251 - 3258. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mempel, C. Ronet, F. Suarez, M. Gilleron, G. Puzo, L. Van Kaer, A. Lehuen, P. Kourilsky, and G. Gachelin Natural Killer T Cells Restricted by the Monomorphic MHC Class 1b CD1d1 Molecules Behave Like Inflammatory Cells J. Immunol., January 1, 2002; 168(1): 365 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Exley, S. M. A. Tahir, O. Cheng, A. Shaulov, R. Joyce, D. Avigan, R. Sackstein, and S. P. Balk Cutting Edge: A Major Fraction of Human Bone Marrow Lymphocytes Are Th2-Like CD1d-Reactive T Cells That Can Suppress Mixed Lymphocyte Responses J. Immunol., November 15, 2001; 167(10): 5531 - 5534. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 5, 2001; (2001) 221445298. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ronet, M. Mempel, N. Thieblemont, A. Lehuen, P. Kourilsky, and G. Gachelin Role of the Complementarity-Determining Region 3 (CDR3) of the TCR-{{beta}} Chains Associated with the V{{alpha}}14 Semi-Invariant TCR {{alpha}}-Chain in the Selection of CD4+ NK T Cells J. Immunol., February 1, 2001; 166(3): 1755 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Laouini, A. Casrouge, S. Dalle, F. Lemonnier, P. Kourilsky, and J. Kanellopoulos V{beta} T Cell Repertoire of CD8+ Splenocytes Selected on Nonpolymorphic MHC Class I Molecules J. Immunol., December 1, 2000; 165(11): 6381 - 6386. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gilleron, C. Ronet, M. Mempel, B. Monsarrat, G. Gachelin, and G. Puzo Acylation State of the Phosphatidylinositol Mannosides from Mycobacterium bovis Bacillus Calmette Guerin and Ability to Induce Granuloma and Recruit Natural Killer T Cells J. Biol. Chem., September 7, 2001; 276(37): 34896 - 34904. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 23, 2001; 98(22): 12636 - 12641. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |