| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Partners AIDS Research Center and
Massachusetts General Hospital Cancer Center, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02129; and
Universitaets Spital Zurich, University of Zurich, Zurich, Switzerland
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-herpesvirus associated with Kaposi’s sarcoma,
primary effusion lymphoma, and Castleman’s disease. We reasoned that
CTL responses may provide host defense against this virus, and
consequently, KSHV may have evolved strategies to evade the
CTL-mediated immune surveillance. In this study six B cell lines
latently infected with KSHV were found to express reduced levels of HLA
class I surface molecules compared with B cell lines transformed by the
related -herpesvirus EBV. KSHV-infected cells also required higher
concentrations of soluble peptides to induce efficient CTL-mediated
lysis than control cell lines and were unable to process and/or present
intracellularly expressed Ag. Incubation of the KSHV-infected cell
lines with high concentrations of soluble HLA class I binding peptides
did not restore the deficient HLA class I surface expression. To assess
the underlying mechanisms of these phenomena, TAP-1 and TAP-2 gene
expression was analyzed. While no attenuation in TAP-2 expression was
observed, TAP-1 expression was significantly reduced in all KSHV cell
lines compared with that in controls. These results indicate that KSHV
can modulate HLA class I-restricted Ag presentation to CTL, which may
allow latently infected cells to escape CTL recognition and persist in
the infected host. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
KSHV is a member of the 2-herpesvirus family and has been shown to
be closely related to herpesvirus saimiri, rhesus monkey rhadinovirus,
and EBV (8, 9, 10). Seroepidemiologic data have associated
KSHV with Kaposi’s sarcoma (KS), multicentric Castleman’s disease,
and primary effusion lymphomas (11), and virus-specific T
cell responses in KSHV-infected individuals have recently been
described (12, 13). The relationship between the degree of
immunosuppression and the occurrence of KSHV-associated
diseases suggests that T cell-mediated immune surveillance of KSHV may
play an important role in virus control (14, 15, 16, 17). As
a consequence, KSHV may be under significant immune pressure in healthy
individuals and may have developed strategies to evade immune
surveillance, especially the surveillance by CD8+
CTL (4).
Here we investigate the ability of KSHV to modulate HLA class I surface expression and HLA class I Ag processing/presentation in latently infected cells. Six KSHV-infected cell lines, obtained from primary effusion lymphomas from three HIV-1-infected and three HIV-1-negative individuals, were tested for HLA class I surface expression, and their sensitivity to CTL-mediated lysis was assessed. Analyses of surface HLA class I stabilization by soluble peptides, processing and presentation of intracellularly expressed Ag, and TAP-1/TAP-2 gene expression patterns indicate a mechanism(s) by which KSHV may mediate immune regulatory effects.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
KSHV-infected cell lines and EBV-transformed B lymphoblastoid cell lines were obtained from American Type Culture Collection (Manassas, VA) or generated in our laboratory and were maintained as previously described (18). PCR-based HLA typing of the cell lines was performed by the Massachusetts General Hospital HLA-typing laboratory, and molecular HLA-A2 subtyping was performed as described previously (19). The KSHV-infected, EBV-negative cell line VG-1 and the autologous EBV-transformed control cell line B301 were derived from a cardiac transplant patient of Haitian descent who developed KS and a primary effusion lymphoma (20). The presence or absence of the KSHV and EBV genomes in these cell lines was determined by nested PCR using primers located in the ORF26 region of KSHV (8) and EBNA-3A of EBV type 1 and type 2 (21). PCR analysis demonstrated that all the control EBV-transformed B cell lines were KSHV negative.
FACS analysis of HLA class I expression
HLA class I surface expression was analyzed using an FITC-labeled mAb (W6/32) specific for HLA class I obtained from PharMingen (San Diego, CA). Staining was performed as described previously (22). The TAP-deficient T2 cell line and its parental TAP-expressing cell line T1 (23) as well as VG-1 and B301 cells were used for an HLA class I cell surface stabilization assay (22, 24). The cells were incubated with the HLA-A*0201 binding peptide SL9 (HIV-1 Gag, p17 aa 77–85, SLYNTVATL) at concentrations from 8 to 220 µg/ml for 4 h or were incubated at 26°C overnight and then stained for HLA class I cell surface expression using mAb W6/32 (22). The experiments were conducted in duplicate and included Ig control staining as well as cells that were incubated without peptide.
Synthetic peptides and recombinant vaccinia virus constructs
The ability to present viral epitopes for CTL-mediated lysis was determined using virus-specific CTL clones and synthetic viral peptides. Peptide SLYNTVATL (SL9, HIV-1 p17, aa 77–85) was previously found to be the immunodominant HLA-A*0201-restricted, optimal CTL epitope in HIV-1 infection (19, 25). The 126E epitope is derived from HIV-1 envelope protein (557–565, RAIEAQQHL) and is restricted by HLA-B51 (26). These epitopes are also expressed by the recombinant vaccinia virus (VV) constructs, vp141 and vpe11, respectively. In addition, an hepatitis C virus (HCV)-derived, HLA-A*0201-restricted epitope located in HCV NS5B (ALYDVVTKL) was included in these analyses (27).
Cytotoxicity assays and peptide titrations
CTL-mediated killing of 51Cr-labeled KSHV-infected and uninfected control target cells was tested in standard 51Cr release assays using varying E:T cell ratios as previously described (19). In one set of experiments KSHV-infected cell lines and uninfected control cell lines were labeled with 51Cr, pulsed with peptide (200 µg/ml) for 90 min, washed three times, and used as targets for CTL clones. For the peptide titration experiments, the peptides were titrated directly into the assays at final concentrations ranging from 100 µg/ml to 10 pg/ml and incubated with previously 51Cr-labeled target cells alone for 45 min before addition of the effector cells. Specific CTL clones were used at the indicated E:T cell ratios, and the assays were run for 4 h at 37°C.
Semiquantitative RT-PCR for TAP1 and TAP2
Total RNA was isolated from the KSHV- and EBV-infected control B cell lines using RNA STAT-60 (Tel-Test, Friendswood, TX) as recommended by the manufacturer. Five micrograms of RNA was used to generate cDNA using the Superscript preamplification kit (Life Technologies, Gaithersburg, MD). Following termination of the RT, the RNA was digested with 2 U of RNase H (Life Technologies) at 37°C for 30 min, and the cDNA was purified using a Qiaquick PCR purification column (Qiagen, Chatsworth, CA). PCR reaction conditions were as follows: 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.001% (w/v) gelatin, 0.5 U AmpliTaq Gold (Perkin-Elmer, Norwalk, CT), 0.4 mM dNTP, 0.1 µM of each primer, and 1.5 µl of 1/10 diluted cDNA/25 µl of reaction. The following primers were used: TAP1–5', CGCCTCTCGCTGTTCCTG; TAP1–3', GAGTTGACTGCATAGGCCACA; TAP2–5', CACGGCTGAGCTCGGATACCAC; TAP2–3', CAGCTCAGCATCAGCATCTGC; GAPDH-5', CATAGTGGGGTGGTGAATAC; and GAPDH-3', CCCAATACGACCAAATCTAA. The positions of these primers were chosen to rule out potential artifacts due to the presence of genomic DNA in the RNA preparation (28). Cycle numbers were optimized to be in the exponential phase of the PCR amplification. PCR conditions were as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 50°C for 1 min, and 72°C for 2 min; and 72°C for 10 min for all three primer pairs. Products were visualized on a 2% (w/v) agarose gel and stained with ethidium bromide. Pictures were taken with Polaroid type 665 film (Polaroid, Bedford, MA). Negatives were scanned using an HP 6200C/6250C scanner (Hewlett-Packard, Palo Alto, CA), and bands were quantitated using National Institutes of Health Image software (http://rsb.info.nih.gov/nih-image). Each gel was analyzed three times for calculation of the TAP/GAPDH ratios. Statistical analysis used two-sided Student’s t test and was based on four and three independent experiments for TAP-1 and TAP-2, respectively.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human herpesviruses such as EBV and CMV have been shown to
profoundly affect the recognition of virus-infected cells by HLA class
I-restricted, CD8+ CTL. To investigate whether
KSHV also has the potential ability to impair CTL recognition, latently
KSHV-infected cells were assessed for their HLA class I surface
expression and the ability to process and present Ag. Five
KSHV-infected cell lines obtained from American Type Culture Collection
and one cell line (designated VG-1) established in our laboratory
(Table I
) were examined by FACS analysis
for cell surface HLA class I expression. The mean fluorescence
intensity of stained cells was compared with the intensity of HLA class
I stained B cells transformed by the closely related -herpesvirus
EBV. In all cases, KSHV-infected cell lines expressed consistently
lower levels of surface HLA class I than BLCL controls (Fig. 1). The most profound down-regulation of
HLA class I expression was observed in the VG-1 cell line, which
exhibited <10% of the FACS intensity seen in the autologous,
KSHV-negative, EBV-positive cell line B301. The consistently lower HLA
class I surface expression by KSHV-infected cell lines was not affected
by EBV coinfection, as the dually infected BC-1 and BC-2 cell lines
showed class I levels comparable to those in KSHV-infected,
EBV-negative cell lines.
|
|
To test whether the reduced HLA class I surface expression on
latently KSHV-infected cell lines decreases their susceptibility to
CTL-mediated lysis, HLA-A*0201-expressing cell lines were pulsed with a
high concentration of the soluble, HLA-A*0201-restricted, HIV-1
Gag-derived SL9 peptide (200 µg/ml) and incubated with an SL9
peptide-specific CTL clone. All the HLA-A*0201-expressing cell lines
were killed by this CTL clone, whereas HLA-A*0201-negative cell lines
(BCBL-1) and HLA-A*0201-positive cell lines pulsed with control
peptides were not lysed (Fig. 2). The
same was seen when the HLA-B51-expressing BCBL-1 cell line was pulsed
with an HLA-B51-restricted CTL epitope and incubated with a
peptide-specific, HLA-B51-restricted CTL clone (data included in Fig. 4). Since the CTL clones used in these studies can be inhibited by
EGTA, indicating that they may lyse target cells by the perforin
pathway (29) (C. Brander, unpublished observations), these
data suggest that latently KSHV-infected cell lines are susceptible to
perforin mediated lysis, at least when high concentrations of soluble
peptides are used.
|
|
show that the control target
cells (B301, 115, 161j, and LWS) were readily lysed by peptide-specific
CTL at low peptide concentrations. The peptide concentrations required
for half-maximal lysis of the control targets varied significantly in
these assays, most likely reflecting different peptide and TCR
affinities (19). In contrast, the KSHV-infected cell lines
were either weakly killed at highest peptide concentrations (Fig. 3, A and B) or reached only lower levels of maximal
killing compared with the control cell lines despite similar peptide
concentrations required for half-maximal lysis (Fig. 3, C
and D). These results demonstrate that KSHV-infected cells
can be killed by CTL, but that they present soluble antigenic peptide
less efficiently than KSHV-negative B-LCL, indicating that the
decreased HLA class I expression has functional consequences at
limiting peptide concentrations.
|
The decreased surface expression of class I molecules by
KSHV-infected cells may have multiple causes, including deficient TAP
function or impaired Ag-processing capacity which, alone or in concert,
may limit the peptide supply to the endoplasmic reticulum (ER) and
thereby reduce the transport rate of HLA class I molecules to the cell
surface (3). To investigate possible defects in the
Ag-processing machinery in KSHV-positive cell lines, the cell lines
were infected with a recombinant VV construct to express viral Ag
intracellularly and were analyzed for the presentation of antigenic
peptide on HLA class I. Specifically, the HLA-B51-matched BCBL-1
(KSHV-positive) and EBV LWS (KSHV-negative) cell lines were infected
either with the VV construct vpe-11 expressing the HIV-1 envelope
protein or with a control VV construct (VV-NYCBH) and were subsequently
tested for recognition by the HLA-B51-restricted CTL clone SE7,
specific for the envelope-derived peptide 126E. Fig. 4
A demonstrates that EBV LWS
control cells were efficiently killed when presenting the HIV-1
envelope-derived 126E peptide, either added as a soluble peptide or
expressed by the vpe-11 VV construct. EBV LWS cells without the peptide
or infected with the control VV construct were not killed. In contrast,
BCBL-1 cells were lysed only when pulsed with the soluble peptide, but
not when infected with the vpe-11 VV construct.
These experiments were also performed with cell lines expressing the
HLA-A*0201 allele, including the KSHV+ VG-1 and
BC-1 cell lines, a negative control cell line (the TAP-deficient T2
cell line), and positive control cell lines B301, 221L, and the
TAP-expressing T1 cell line (23). These cell lines were
infected with a control VV construct (NYCBH) or an HIV-1 Gag-expressing
VV construct (VV-vp141) and used as targets in cytotoxicity assays
together with CTL clones specific for the HIV-1 Gag-derived,
HLA-A*0201-restricted SL9 peptide. An aliquot of target cells was
removed before 51Cr labeling and stained for
intracellular HIV-1 Gag expression to demonstrate successful infection
with the VV constructs. The KSHV-infected cell lines VG-1 and BC-1 as
well as the TAP-deficient cell line T2 were not killed after infection
with the Gag-expressing VV construct vp141 (Fig. 4B),
whereas control cell lines were lysed. The simultaneous FACS analyses
showed that at least BC-1 cells expressed the VV-encoded Gag protein in
amounts comparable to control cell lines T1, 221L, and B301, which were
readily killed (Fig. 5). No specific
killing was observed for the TAP-deficient T2 cell line, although it
expressed significant amounts of p24. The expression of p24 in VG-1
cells was weak, making it difficult to interpret the relative
contribution of low Ag concentration (Fig. 5) and reduced HLA class I
expression (Fig. 1) to the absence of cell killing.
|
Up-regulation of HLA class I surface expression by incubation with
soluble peptides and IFN-
Several mechanisms of viral evasion from CTL recognition have been described (3, 4). These include impaired assembly and transport of HLA class I molecules, but many of these strategies also involve the TAP-mediated translocation of processed peptide into the ER (6, 7, 30, 31, 32). Retention of HLA class I molecules in the ER and rapid degradation of HLA class I heavy chain mediated by viral proteins have been described previously (6, 30, 31, 32, 33). Alternatively, impaired TAP function can be achieved by reduced TAP expression (34) or physical blockade of the TAP molecule (31, 32). Subsequently, if no processed peptide is transported into the ER, as is the case in the TAP-deficient T2 cell line (35), the few class I molecules that reach the cell surface are empty and decay rapidly. However, they can be stabilized when HLA class I binding peptides are added at high concentration or when the cells are incubated at reduced temperature (24).
To investigate the potential contribution of such a mechanism(s) to
immune evasion by KSHV, several hypothesis were tested: KSHV-infected
cells were incubated with IFN- to up-regulate HLA class I gene
expression; HLA class I stabilization assays were performed to see
whether empty HLA class I molecules reach the cell surface, and TAP1
and TAP-2 gene expression was assessed in a semiquantitative
approach.
To test whether IFN- treatment of VG-1 cells (the KSHV-infected cell
line with the most profound HLA down-regulation) could restore surface
HLA class I expression, these cells were incubated with IFN- for
72 h and analyzed by FACS for surface HLA class I expression. A
consistent 3-fold increase in HLA class I staining was observed for
IFN--treated VG-1 cells (data not shown), suggesting that in VG-1
cells at least a partial restoration of HLA class I surface expression
can be achieved by IFN- treatment.
To indirectly assess TAP function in these cells, VG-1 and the
TAP-deficient T2 cells were either incubated with high concentrations
of the HLA-A*0201-binding SL9 peptide at reduced (26°C) temperature
for 4 h or were kept overnight at 26°C and analyzed by FACS for
surface HLA class I expression (22, 24). T2 cells showed a
peptide concentration-dependent increase in HLA class I surface
expression, but this treatment had no effect on the class I expression
by VG-1 cells (Fig. 6). Overnight
incubation at 26°C was also ineffective in up-regulating class I
expression on VG-1 (data not shown). These data demonstrate that VG-1
cells differ from T2 cells as they do not transport unstable HLA class
I molecules to the surface, suggesting that if TAP function is involved
in the reduced HLA class I expression on KSHV-infected cells, it is not
the only factor responsible for this effect.
|
). TAP-1 gene expression was
significantly lower in the KSHV-infected cells than in the five cell
lines transformed with the related -herpesvirus EBV
(p = 0.0005, average of four independent
experiments, by Student’s t test). TAP-1/GAPDH ratios
ranged from 0.95 to 2.18 (average, 1.37 ± 0.4) in the KSHV cell
lines compared with a range of 2.33 to 2.80 (average, 2.51 ±
0.17) for the EBV-transformed control cell lines. TAP-2 gene expression
did not vary significantly between the different cell types
(p = 0.8), and the ratios were similar for KSHV
cell lines (average, 1.13 ± 0.5) and the EBV cell lines
(1.28 ± 0.55). TAP-2/GAPDH ratios were determined from three
independent experiments, and the TAP-deficient T2 cell line was
included in all experiments as a negative control and did not show any
PCR amplification products for TAP-1 or TAP-2. These data indicate that
TAP-1 gene expression is reduced in KSHV-infected cells, which may be
part of the KSHV-mediated immune modulation.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-herpesvirus, EBV; 2) are subject to CTL-mediated cell lysis, but
require high peptide concentrations to trigger lysis; and 3) have
impaired ability to process/present intracellularly expressed Ag. The
mechanism(s) responsible for the reduced class I expression and
impaired Ag processing involves in part deficient TAP-1 expression, but
may well be multifactorial and may include the synthesis or maturation
of HLA class I molecules. Reduced HLA class I surface expression by virus-infected cells has been described for a number of viruses, including human herpesviruses (2). The mechanisms leading to this reduction are variable, but often involve the assembly, peptide loading, and transport of HLA class I molecules. These mechanisms may be an adaptive response to the host immune response and allow the virus to evade tight immune surveillance to persist in the host (2). Although clinical evidence suggests that KSHV is under immune pressure, no reports have been published to date that describe immune evasion strategies in latently KSHV-infected cell lines.
We analyzed six KSHV-transformed cell lines by FACS and found low
levels of HLA class I expressed on the cell surface. Comparison was
made to EBV-transformed B cell lines, as both viruses are
-herpesviruses, and revealed this to be significant. Unfortunately,
there are currently no applicable models to study in vitro KSHV
infection of cells, and thus direct comparison of the same cell line
pre- and postinfection with KSHV could not be made. Nevertheless, for
one KSHV cell line generated in our laboratory (VG-1), an autologous
EBV-transformed B cell line was available (B301). The comparison of
these two cell lines showed marked differences in HLA class I surface
expression (Fig. 1), for which individual genetic differences can be
ruled out. Furthermore, cell lines coinfected with KSHV and EBV (BC-1
and BC-2) reveal degrees of HLA down-regulation similar to EBV-negative
KSHV-infected cell lines, suggesting that EBV coinfection does not
revert the KSHV-mediated defect in HLA class I surface expression.
Latent KSHV-infected cell lines were subsequently used to investigate whether the reduced HLA class I expression had functional consequences for CTL-mediated lysis. Although all cell lines tested were killed by CTL, they all required much higher concentrations of soluble peptide to achieve efficient lysis than are typically observed (19). Although peptide- and clone-dependent differences in the half-maximal lysis were observed, the use of different peptides and various CTL clones rules out that the observed differences between KSHV and EBV cell lines were due to peptide- or clone-specific effects.
When Ag was expressed intracellularly instead of added as soluble peptide, KSHV and EBV cell lines differed even more dramatically in their susceptibility to CTL-mediated lysis. None of the three KSHV cell lines tested was able to process and present intracellular Ag for CTL-mediated lysis, which was in strong contrast to the control EBV cell lines, which were all readily killed by Ag-specific CTL. These results suggest that Ag processing by the proteasome, translocation of the processed peptide into the ER, or assembly and maturation of the HLA class I molecules could be defective. Alternatively, the synthesis of HLA class I molecules could be abrogated in KSHV-infected cells. However, semiquantitative RT-PCR analysis for HLA-A, -B, and -C alleles revealed no differences between KSHV- and EBV-transformed B cell lines (T. Suscovich et al., manuscript in preparation).
To further define the immune modulatory mechanism(s) employed by KSHV,
the effects of IFN- and high concentrations of soluble peptide on
surface HLA class I expression were studied. The IFN- treatment of
VG-1 cells, but not B301 control cells, led to a 3-fold increase in HLA
class I surface expression. These data suggest that the expression of
HLA class I, TAP-1, or any other component of the HLA class I Ag
processing pathway was at least partly restored upon IFN- treatment,
leading to enhanced assembly, peptide loading, and export of HLA class
I molecules. In addition, IFN- could have a direct or indirect
anti-viral effect and change KSHV gene expression, reverting the
KSHV-mediated effect. Further investigation of gene expression patterns
will be necessary to understand the IFN--mediated effect on HLA
class I expression. Furthermore, additional analyses will be required
to investigate whether all HLA class I alleles are subject to
KSHV-mediated down-regulation or whether HLA-C and HLA-E alleles, which
are the primary regulatory molecules for NK cell activity, remain
stably expressed at the cell surface (36).
The incubation of VG-1 cells with high concentrations of soluble, HLA-A*0201 binding peptide or the incubation of these cells at reduced temperature failed to enhance surface HLA class I expression. This is in contrast to the TAP-deficient T2 cell line, which transports empty class I molecules to the cell surface where soluble peptide or reduced temperature can stabilize them, leading to enhanced HLA class I surface expression (22, 24). These findings indicate that in VG-1 cells, no significant amounts of empty HLA class I molecules reach the cell surface. This also suggests that peptide loading of class I molecules, and therefore TAP function, may not be the sole factor leading to the reduced HLA class I expression observed in these cells. However, reduced TAP function could contribute to impaired assembly of class I molecules by limiting the supply of processed Ag. Similar mechanisms have been reported for other herpesviruses, which have been shown to modulate Ag processing at several critical steps by partly redundant mechanisms (2). It is therefore possible that KSHV can impair multiple levels of the HLA class I Ag presentation pathway by modulating the assembly and transport of HLA class I molecules and efficient TAP function.
TAP function can be limited by several mechanisms, including steric hindrance or reduced TAP gene expression (1, 37). We therefore analyzed the TAP expression in KSHV-infected cell lines and compared TAP/GAPDH mRNA levels in these cells to the TAP/GAPDH ratios in EBV-transformed B cell lines. TAP-1 expression was significantly reduced in KSHV cell lines, whereas TAP-2 expression was unaltered. The magnitude of differences in TAP-1 expression was 2- to 3-fold between the two cell types, similar to what was observed after IL-10 treatment of murine tumor cells and to what is known to result in negative functional consequences on Ag presentation (38). No difference between EBV-positive (BC-1, BC-2) and EBV-negative KSHV cell lines was observed with regard to TAP-1 expression, arguing against an effect of coinfection with EBV as an explanation for the observed phenomenon. Rather, it is reasonable to hypothesize that KSHV is directly responsible for altered TAP-1 levels.
The basis for differences in expression of TAP and HLA class I molecules between KSHV cell lines is at present unknown. It is possible that epidemiologically different KSHV strains may use distinct immune modulatory mechanisms. For instance, the unusual phenotype of VG-1, which was derived from a non-AIDS patient of Haitian descent, may be characteristic of certain KSHV strains. Or alternatively molecular attenuation of viral gene products capable of affecting Ag presentation accounts for such differences. The latent membrane protein-1 (LMP-1) gene product of EBV, for example, has been described to restore HLA class I Ag expression in type III Burkitt’s lymphoma cells (39, 40, 41). Finally, since KSHV does not encode homologues to proteins in CMV and EBV that are known to interfere with HLA class I-restricted Ag processing, entirely novel mechanisms may be used by KSHV. Focusing on unique KSHV-derived coding sequences in Ag-processing/presentation assays may yield insights into unique viral strategies for eluding host defense.
|
Footnotes |
|---|
2 C.B. and T.S. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. David T. Scadden, AIDS Research Center, Massachusetts General Hospital, 149 13th Street, #5212, Boston, MA 02129.
4 Abbreviations used in this paper: KSHV, Kaposi’s sarcoma-associated herpes virus; KS, Kaposi’s sarcoma; VV, vaccinia virus; ER, endoplasmic reticulum; HCV, hepatitis C virus.
Received for publication April 10, 2000. Accepted for publication May 23, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  H. R. Hensler, G. Rappocciolo, C. R. Rinaldo, and F. J. Jenkins Cytokine production by human herpesvirus 8-infected dendritic cells J. Gen. Virol., January 1, 2009; 90(1): 79 - 83. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Lan, S. C. Verma, M. Murakami, B. Bajaj, R. Kaul, and E. S. Robertson Kaposi's sarcoma herpesvirus-encoded latency-associated nuclear antigen stabilizes intracellular activated Notch by targeting the Sel10 protein PNAS, October 9, 2007; 104(41): 16287 - 16292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lambert, M. Gannage, A. Karras, M. Abel, C. Legendre, D. Kerob, F. Agbalika, P.-M. Girard, C. Lebbe, and S. Caillat-Zucman Differences in the frequency and function of HHV8-specific CD8 T cells between asymptomatic HHV8 infection and Kaposi sarcoma Blood, December 1, 2006; 108(12): 3871 - 3880. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. R. Rezaee, C. Cunningham, A. J. Davison, and D. J. Blackbourn Kaposi's sarcoma-associated herpesvirus immune modulation: an overview J. Gen. Virol., July 1, 2006; 87(7): 1781 - 1804. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Ribechini, C. Fortini, M. Marastoni, S. Traniello, S. Spisani, P. Monini, and R. Gavioli Identification of CD8+ T Cell Epitopes within Lytic Antigens of Human Herpes Virus 8 J. Immunol., January 15, 2006; 176(2): 923 - 930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Lan, D. A. Kuppers, S. C. Verma, N. Sharma, M. Murakami, and E. S. Robertson Induction of Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen by the Lytic Transactivator RTA: a Novel Mechanism for Establishment of Latency J. Virol., June 15, 2005; 79(12): 7453 - 7465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Lan, D. A. Kuppers, and E. S. Robertson Kaposi's Sarcoma-Associated Herpesvirus Reactivation Is Regulated by Interaction of Latency-Associated Nuclear Antigen with Recombination Signal Sequence-Binding Protein J{kappa}, the Major Downstream Effector of the Notch Signaling Pathway J. Virol., March 15, 2005; 79(6): 3468 - 3478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Tomescu, W. K. Law, and D. H. Kedes Surface Downregulation of Major Histocompatibility Complex Class I, PE-CAM, and ICAM-1 following De Novo Infection of Endothelial Cells with Kaposi's Sarcoma-Associated Herpesvirus J. Virol., September 1, 2003; 77(17): 9669 - 9684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Aoki, G. M. Feldman, and G. Tosato Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma Blood, February 15, 2003; 101(4): 1535 - 1542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Li, T. Komatsu, B. J. Dezube, and K. M. Kaye The Kaposi's Sarcoma-Associated Herpesvirus K12 Transcript from a Primary Effusion Lymphoma Contains Complex Repeat Elements, Is Spliced, and Initiates from a Novel Promoter J. Virol., October 25, 2002; 76(23): 11880 - 11888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Aoki, R. Yarchoan, K. Wyvill, S.-i. Okamoto, R. F. Little, and G. Tosato Detection of viral interleukin-6 in Kaposi sarcoma-associated herpesvirus-linked disorders Blood, April 1, 2001; 97(7): 2173 - 2176. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
)
or with (
) 200 µg/ml of the HIV envelope-derived peptide 126E or
were infected with control NYCBH (
