| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Schering-Plough Laboratory for Immunological Research, Dardilly, France; and
DNAX Research Institute, Palo Alto, CA 94304
<. >
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Chemokines belong to a family of small proteins that control the migration of certain leukocyte populations (7). In particular, 6Ckine/SLC3 (secondary lymphoid tissue chemokine) is a chemokine that originally was shown to be strongly expressed in secondary lymphoid organs, in particular in high endothelial venules and in the T cell zone of the lymph nodes (8, 9, 10, 11). 6Ckine/SLC has been described as a potent chemotactic factor for dendritic cells (12), a property shared with other chemokines (13, 14, 15). This action of 6Ckine/SLC on dendritic cells is likely mediated through the chemokine receptor CCR7 (16, 17), which is strongly up-regulated during dendritic cell maturation (15). More precisely, 6Ckine/SLC has been shown to be involved in the migration of dendritic cells from the skin into the draining lymph nodes (12, 18), suggesting that 6Ckine/SLC would be active in vivo on dendritic cells of an intermediate stage of maturity after Ag capture (1), on their way to secondary lymphoid organs. 6Ckine/SLC is also a chemotactic factor for T and B cells (19), as well as NK cells (20). Collectively, these data suggest that 6Ckine/SLC may play an important role in the early phases of the immune response, when the encounter between dendritic cells and lymphocytes is required. In fact, mice deficient in the expression of 6Ckine/SLC showed defects in lymphocyte homing and dendritic cell localization (21), and mice lacking the CCR7 receptor also had defects in lymph node architecture (22). Furthermore, it has been very recently shown that 6Ckine/SLC could participate itself in lymphoid tissue development and organization, in a transgenic model where the 6Ckine/SLC gene was expressed in pancreatic islets (23).
In addition to CCR7, the mouse 6Ckine/SLC binds to the chemokine
receptor CXCR3 (24). Ligands for CXCR3, such as the
chemokines IFN-inducible protein 10 (IP-10) and the monokine induced by
IFN-
, Mig, possess angiostatic properties
(25, 26, 27, 28). Indeed, mouse (m) 6Ckine also was reported to
inhibit angiogenesis in a rat corneal micropocket assay
(24).
The potential broad spectrum of actions of 6Ckine/SLC, in the recruitment of dendritic cells and effector cells as well as in the inhibition of angiogenesis, prompted us to analyze its role in antitumor activity. To that aim, we inserted into the mouse colon carcinoma cell line C26 a cDNA coding for the mouse chemokine 6Ckine/SLC.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female BALB/c (H-2d), BALB/c nu/nu, and C57BL/6 (H-2b) mice, 6 to 10 weeks old, were purchased from Charles River (Iffa-Credo, L’Arbresle, France) and maintained in our facilities under standard conditions. Procedures involving animals and their care were conducted in conformity with European Economic Community Council Directive 86/609, OJL 358,1, December 12, 1987.
Tumor cell lines and in vivo procedures
All tumor cell cultures were performed in DMEM (Life
Technologies, Paisley Park, U.K.) supplemented with 10% FCS (Life
Technologies), 1 mM HEPES (Life Technologies), Gentallin
(Schering-Plough, Union, NJ), 2 x 10-5 M
ß2-ME (Sigma, St. Louis, MO). All cell cultures
were performed at 37°C in a humidified incubator with 5%
CO2. The cDNA encoding m6Ckine/SLC was cloned
into the pcDNA3 vector (InVitrogen, Carlsbad, CA) which contains a CMV
promoter. C26 colon carcinoma tumor cells (provided by Mario P.
Colombo, Instituto Nazionale per lo Studio e la Cura dei Tumori, Milan,
Italy) were transfected with this construction using the Fugene reagent
(Roche Molecular Diagnostics, Mannheim, Germany) according to the
manufacturer’s instructions. Single C26 clones expressing m6Ckine/SLC
mRNA (C26-6CK) were obtained after neomycin (Sigma) selection at 800
µg/ml. Tumor cells were injected s.c. in the right flank in 100 µl
DMEM, and tumor growth was monitored by palpation three times a week.
To analyze cell populations in the tumor-draining lymph node,
105 tumor cells were injected in the rear
footpad, and mice were sacrificed at the onset of tumors. For Ab
depletion or neutralization, 0.5 mg anti-CD8 (clone 2.43),
anti-CD4 (GK-1.5), anti-Gr1 (RB6-8C5), anti-IL-4 (11B11),
anti-IFN- (AN18), or rat control (GL113) purified Abs were
injected i.p. in 200 µl PBS 1 day before tumor inoculation, then 0.2
mg Abs were injected after 3 days and once a week (or twice a week for
anti-IL-4 and anti-IFN-) during the course of the
experiment. For NK cell depletion, 10 µl rabbit
anti-asialo-GM1 serum (Wako Pure Chemical Industries,
Richmond, VA) or control rabbit serum (Sigma) were injected twice a
week i.p. starting 1 day before tumor cell inoculation. Cell depletion
was assessed by FACS analysis of the CD4+
(anti-CD4 treatment), CD8+ (anti-CD8
treatment), and
DX5+IL-2Rß+
(anti-asialo-GM1 treatment) spleen cell
compartments.
Immunohistochemistry
Tumors were removed from animals and embedded in OCT compound (Miles Laboratory, Elkhart, IN) before being snap frozen in liquid nitrogen and stored at -80°C until immunohistochemistry procedures. Cryostat sections (5 µm) applied onto glass slides were fixed in acetone and incubated with 1% H2O2 for 10 min at room temperature. Slides were then incubated with the Biotin-block and Avidin-block reagents (both from Vector, Burlingame, CA). All incubations were followed by three 2-min washes in PBS (Life Technologies). Slides were then preincubated for 30 min with a 1/10 dilution of serum from the same species of the secondary Ab (Dako, Glostrup, Denmark). Slides were then incubated sequentially with 5 µg/ml purified CD105 (clone MJ7/18), CD8 (53-5.8), Gr-1 (RB6-8C5), or CD11c (HL3) Abs (all from PharMingen, San Diego, CA), biotinylated secondary Ab (rabbit anti-rat or goat anti-hamster from Vector), streptavidin-alkaline phosphatase or streptavidin-peroxidase (ABC kit from Vector). Enzyme reaction was developed with the corresponding Vector substrate.
Matrigel assay for angiogenesis
Angiogenesis assays were conducted by determining the hemoglobin content of Matrigel (Becton Dickinson, Bedford, MA) pellets containing developing tumors cells in vivo (29, 30). BALB/c mice were injected with 0.5 ml Matrigel mixed with 2 x 105 C26 or C26-6CK cells s.c. in the abdominal midline. After 9 days, Matrigel pellets were removed, the surrounding connective tissue was dissected away, and pellets were liquefied in MatriSperse solution v/v (Becton Dickinson) for 90 min at 4°C. Hemoglobin content was determined by the Drabkin method (reagents from Sigma).
RT-PCR analysis of gene expression
Cell or tumor samples were lysed, and total RNA was extracted
(31) and used for the preparation of first-strand cDNAs.
First-strand cDNAs were prepared after DNase I treatment (in the
presence of RNase inhibitor) of 5 µg total RNA using oligo(dT)
primers (Pharmacia, Uppsala, Sweden) and the Superscript kit. RT-PCR
was performed using the AmpliTaq enzyme and buffer (Perkin-Elmer,
Paris, France), dNTPs at 0.8 mM, and DMSO at a 5% final concentration.
Cycle conditions were 92°C for 1 min, 60°C for 2 min, and 72°C
for 3 min for 28–35 cycles. The following primers were used in this
study. ß2-microglobulin: TAGTCTTCCT GGTGCTTGTC
(5'), TGCTATTTCTTTCTGCGTGC (3'); m6Ckine/SLC:
TGATGACTCTGAGCCTCCTTAGCC (5'), TCAGTTCTCTTGCAGCCCTTGG (3');
perforin: AGCTGAGAAGACCTATCAGG (5'),
GATAAAGTGCGTGCCATAGG (3'); Fas ligand:
CTGGTTGGAATGGGATTAGG (5'), GAGGGATGGA CCTTGAGTG (3'); TNF-
:
GTGGAACTGGCAGAAGAGG (5'), GGAGGGAG AGTAGTCAAGAT (3'); CCR6:
GTTGACCGCAGTCACGAGGAGGA (5'), CAGGATCGTGATGTCTGTGAGCCA (3'); CCR7:
TGTGCTTCAAGA AGGATGTGCG (5'), ACGTAGCGGTCAATGCTGATG (3'); CXCR3:
TTTGACAGAACCTTCCTGCCAG (5'), AAACCCACTGGACAGCAGCATC (3').
Real time quantitative PCR (TaqMan) analysis of CXCR3 and CCR7 mRNA expression
cDNA was diluted to a final concentration of 5 ng/µl; 10 µl cDNA were amplified in the presence of 12.5 µl TaqMan universal master mix (Perkin-Elmer, Foster City, CA), 0.625 µl gene-specific TaqMan probe, 0.5 µl gene-specific forward and reverse primers, and 0.5 µl water. As an internal positive control, 0.125 µl 18S RNA-specific TaqMan probe and 0.125 µl of 18S RNA-specific forward and reverse primers were added to each reaction. Specific primers and probes for CXCR3 and CCR7 were obtained from Perkin-Elmer. Gene-specific probes used FAM as reporter, whereas probes for the internal positive control (18S RNA) were associated with the VIC reporter. Samples underwent the following stages: stage 1, 50°C for 2 min; stage 2, 95°C for 10 min; and stage 3, 95°C for 15 s followed by 60°C for 1 min. Stage 3 was repeated 40 times. Gene-specific PCR products were measured by means of an ABI PRISM 7700 Sequence Detection System (Perkin-Elmer) continuously during 40 cycles. Specificity of primer probe combination was confirmed in cross-reactivity studies performed against plasmids of all known chemokine receptors (CCR1–CCR9, CXCR1–CXCR5, XCR1, CX3CR1). Target gene expression was normalized between different samples based on the values of the expression of the internal positive control.
FACS analysis of tumor-infiltrating leukocytes and lymph node cells
Tumors were surgically removed when reaching an approximate size of 1 cm. The tumor mass was minced into small fragments and incubated in collagenase A (Roche Molecular Biochemicals) solution for 30 min at 37°C under agitation. The suspension was then washed three times in DMEM. In some experiments, an adherence step of 20 h was performed, without any noticeable change in the phenotype of dendritic cells. Single-cell suspensions of draining lymph nodes were also prepared, without the digestion step. Staining of cell suspensions was performed in PBS + 5% FCS. Before incubation with FITC-, biotin- or PE-labeled specific Abs, Fc receptors were blocked using Fc-Block CD16/CD32 Ab (PharMingen). The various Abs (all from PharMingen excepted DEC-205) used in this study were CD4 (clone GK1.5), CD8ß (53–5.8), CD11b (M1/70), CD11c (HL3), CD19 (1D3), CD40 (HM40–3), CD80 (16-10A1), CD86 (GL1), CD54 (3E2), H-2Kd (SF1-1.1), Ia-I-Ad/I-Ed (269), Gr-1 (RB6-8C5), CD3 (145-2C11), CD44 (IM7), CD62L (MEL-14), DEC-205 (NLDC-45 hybridoma from American Type Culture Collection, Manassas, VA). Biotinylated Abs were revealed with PE-streptavidin (Becton Dickinson). Phenotypic parameters were acquired on a FACScan (Becton Dickinson, Mountain View, CA) and analyzed using CellQuest software (Becton Dickinson).
Chemotaxis assay
C26 or C26-6CK cells were cultured at 2 x
105 cells/ml in RPMI + 5% FCS for 48 h, and
culture supernatants were collected to test their activity in migration
assays. Cells used in chemotaxis assays were dendritic cells obtained
after culture of bone marrow cells from BALB/c mice in the presence of
10 ng/ml mGM-CSF (Schering-Plough, Kenilworth, NJ) and 100 U/ml
mTNF- (R&D Systems) for 5 days. Chemotaxis assays were performed in
5-µm-pore Transwells (Costar, Cambridge, MA) for 2 h at 37°C.
Briefly, 600 µl C26 or C26-6CK supernatant in the presence of 10
µg/ml goat IgG or polyclonal anti-m6Ckine neutralizing Ab (R&D
Systems) were placed in the lower chamber, and 2 x
105 dendritic cells were placed in the upper
chamber. Migrated cell were collected, stained for CD11c and CD86
expression, and analyzed by FACS after resuspension in a defined
volume. The number of cells acquired during 2 min was assessed for each
condition and used to determine the relative number of migrated cells
for CD11c and CD86 defined subsets.
Isolation of tumor-infiltrating dendritic cells
Tumor-infiltrating dendritic cells were purified using CD11c+ Microbeads, following the manufacturer’s instructions (MiniMacs, Miltenyi Biotec, Bergisch Gladbach, Germany). The Ab used for purification (clone N-418) is different from the one used for FACS analysis and allows for the analysis of CD11c expression on purified cells (usually 70–80% purity).
Measure of endocytosis using FITC-dextran capture
The procedure for measuring FITC-dextran uptake has been previously described (32). Briefly, purified tumor-infiltrating dendritic cells were resuspended in 10% FCS medium buffered with 25 mM HEPES at 37°C in a water bath or at 4°C for negative control. FITC-dextran was added at the final concentration of 0.1 mg/ml. At different time points, the cells were washed four times with cold PBS containing 1% FCS and 0.01% NaN3. Cells were then stained with CD11c-biotin followed by streptavidin-PE at 4°C and analyzed by flow cytometry.
Mixed leukocyte reaction
For MLR, T lymphocytes were obtained from C57BL/6
(H-2b) mice by depletion of lymph node cell
suspensions with anti-CD19, anti-Ia, anti-CD11b, and
anti-TER-119 Abs followed by anti-rat magnetic beads. T cells
obtained by this method were routinely >98% in purity as assessed by
FACS analysis. Control mature bone marrow-derived dendritic cells were
obtained after culture of bone marrow cells from BALB/c mice in the
presence of 10 ng/ml mGM-CSF (Schering-Plough, Kenilworth, NJ) and 100
U/ml mTNF- (R&D Systems) for 6 days, with the addition of 10 ng/ml
LPS (Sigma) for the last day of culture. Triplicates of 3 x
105 purified T cells were incubated with various
numbers of stimulator cells irradiated at 3000 rad in 200 µl 10% FCS
culture medium in round-bottom 96-well plates (Nunc, Kamstrup, Denmark)
for 5 days at 37°C. The proliferative response was measured by
incorporation of [3H]thymidine (Amersham, Les
Ulis, France) for the last 18 h of culture. In some experiments,
anti-IL-10R Ab (a gift from A. O’Garra, DNAX Research Institute,
Palo Alto, CA) or control GL113 Ab were added during the culture at 10
µg/ml concentration.
Statistical analysis
Statistical analysis of results was performed with Statview
software (Abacus Concepts, Berkeley, CA). The
2 test was used to analyze differences between
percentages of tumor-bearing mice at a given time, the log rank test
was used to analyze curves of tumor development. Student’s
t test was used in other analyses when indicated.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We transfected the m6Ckine/SLC cDNA into the C26 colon carcinoma
cell line and obtained an antibiotic-resistant clone (C26-6CK) that
expresses m6Ckine/SLC mRNA as detected by RT-PCR and protein expression
(Fig. 1
). The supernatant of C26-6CK but
not the one of C26 cells was able to induce the chemotaxis of mouse
bone marrow-derived
CD11c+CD86+ dendritic cells
(Fig. 1B). This specific chemotactic activity was blocked by
a neutralizing anti-m6Ckine polyclonal Ab. There was no difference
in cell growth in vitro between the C26 and C26-6CK lines (data not
shown). Results presented in this report were obtained with the C26-6CK
clone. However, to rule out that the effects were related to a
variation of this clone compared with the parental cell line,
independent of m6Ckine expression, we recently constructed a C26 cell
line expressing m6Ckine/SLC, using a retroviral vector. The
tumorigenicity of this C26-6CK cell line was identical with that of the
C26-6CK clone.
|
C26 and C26-6CK cells were injected s.c. into BALB/c
immunocompetent at different doses (Fig. 2A). At the doses of
104, 5 x 104 cells,
or 5 x 105 cells, the C26-6CK line showed
lower tumorigenicity than the parental cell line (Fig. 2). Moreover, at
a 104 cell dose, mice injected with C26-6CK cells
did not develop tumors. As a control, a C26 tumor cell line transduced
to express ß-galactosidase showed the same tumorigenicity than the
parental tumor (data not shown). At a 5 x
104 cell dose commonly used with the C26 tumor,
that always gives a 100% tumor incidence in our hands, only 55% of
mice developed tumors after injection of C26-6CK cells (Fig. 2A). At this 5 x 104 cell dose,
the difference between the proportions of mice bearing tumors after C26
or C26-6CK cell injection was statistically significant at 45 days
(p < 0.05 by 2 test).
Moreover, log rank analysis of the two tumorigenicity curves showed
that C26-6CK tumors appeared with a significant delay
(p < 0.01) when compared with C26 tumors. In
nude mice, all mice injected with 5 x 104
C26 or C26-6CK cells developed tumors (Fig. 2B, left).
However, the apparition of tumors was also significantly delayed with
C26-6CK cells (p < 0.05 by log rank analysis).
In addition, the tumors recovered at 28 days from nude mice injected
with C26-6CK cells were significantly smaller than those recovered from
mice injected with the parental cell line (p <
0.01 by Student’s t test) (Fig. 2B, right).
These data indicate that m6Ckine/SLC gene transfer into C26 tumor cells
decreases their tumorigenicity, in immunocompetent mice or in the
absence of T cell-mediated immunity.
|
We analyzed the vasculature of C26 and C26-6CK tumors developed in
BALB/c mice using an anti-CD105 Ab in immunohistochemistry. As
shown in Fig. 3A, C26-6CK
tumors had a much lower density of blood vessels than C26 tumors.
Similar results were obtained by staining with an anti-CD31 Ab
(data not shown). To quantitatively examine the angiogenesis induced in
vivo by C26 or C26-6CK tumor cells, Matrigel pellets containing 2
x 105 tumor cells were injected s.c. into BALB/c
mice. After 9 days, the Matrigel pellets were recovered, and their
hemoglobin content was measured, as a representation of angiogenesis
(Fig. 3B). m6Ckine/SLC gene transfer significantly inhibited
angiogenesis induced by the C26 tumor cell line
(p < 0.05 by Student’s t
test).
|
We analyzed the phenotype of leukocyte population infiltrating C26
and C26-6CK tumors by immunohistochemistry (Fig. 4A) or FACS analysis after
collagenase digestion (Fig. 4B), 20–30 days after tumor
cell injection. Compared with C26, C26-6CK tumors were characterized by
a rich infiltrate of
CD11b+CD11c+ (presumably
dendritic cells) and
CD11b+Gr1+ cells as well as
by a significant increase in CD8ß+ cells (Fig. 4). The tumor-infiltrating leukocytes, including dendritic cells, did
not show any particular localization within the tumor in contrast with
some human cancers (33, 34), although they were absent
from highly necrotic areas and could sometimes form foci at the
vicinity of blood vessels (data not shown). After FACS sorting and
May-Grunwald-Giemsa (MGG) staining, CD11b+Gr1+
cells were identified as polymorphonuclear neutrophils (data not
shown). Further characterization of the
CD11b+CD11c+ and
CD8ß+ cells will be shown later in this report.
There was no increase of CD4+ T cells, which
represented in both cases <0.5% of the tumor suspension and no
significant differences in the percentage of
CD11c-CD11b+
monocyte/macrophages (data not shown). Furthermore, in either C26 or
C26-6CK tumors, we did not detect any CD19+ B
cells (data not shown).
|
Mouse 6Ckine/SLC binds both CCR7 (16, 17) and CXCR3
(24) receptors. To analyze the contribution of these
receptors to the cellular infiltration in C26-6CK tumors, we performed
real time kinetic RT-PCR on cDNA prepared from C26 and C26-6CK tumors,
with 18S mRNA expression as internal control. As shown in Fig. 5, there was no significant change in
CXCR3 mRNA expression between C26 and C26-6CK tumors, whereas CCR7 mRNA
expression was dramatically increased in C26-6CK tumors when compared
with C26 tumors.
|
To determine the relative contribution of particular leukocyte
subsets or cytokines to the tumor growth delay observed in C26-6CK vs
C26 tumors, we injected mice with depleting or neutralizing Abs during
tumor challenge, as indicated in Materials and Methods. Abs
depleting CD4+ or Gr1+
cells, or neutralizing IFN- or IL-4 had no significant effect (data
not shown). On the contrary, an Ab depleting CD8+
T cells significantly (p < 0.05) increased the
tumorigenicity of C26-6CK tumors (Fig. 6A). The same Ab treatment had
no significant effect on the growth of C26 tumors. By FACS analysis,
CD8+ cells infiltrating C26-6CK tumors expressed
CD3 and CD44 but not CD62L, suggesting an effector- or memory-type T
cell phenotype (Fig. 6C). These CD8+ T
cells, after isolation by FACS sorting to >98% purity, expressed
perforin and Fas ligand mRNA, a feature of cytotoxic T cells. They also
expressed CCR7, albeit at low levels, but not CXCR3 mRNA (Fig. 6B), suggesting again that interactions with CCR7 were
involved in their recruitment. Finally, besides anti-CD8 treatment,
anti-asialo-GM1 treatment also significantly
(p < 0.05) increased the tumorigenicity of
C26-6CK cells (Fig. 7). We did not find,
however, a significant infiltration of
DX5+IL-2Rß+ NK cells at
the time we collected C26-6CK tumors. Collectively, these data suggest
that both CD8+T cells and NK cells participate in
the reduced tumorigenicity of C26-6CK cells.
|
|
The high number of dendritic cells infiltrating C26-6CK tumors
allowed for their isolation using CD11c-coated magnetic beads (Fig. 8A). Most
CD11c+ cells recovered from C26-6CK tumors had a
dendritic morphology as seen after MGG staining (Fig. 8B).
Moreover, RT-PCR analysis showed that dendritic cells purified from
C26-6CK tumors expressed both CCR6 and CCR7 mRNA and relatively low
levels of CXCR3 mRNA, resembling immature bone marrow-derived dendritic
cells, whereas mature dendritic cells expressed CCR7 but not CCR6 mRNA
(Fig. 8C). FACS analysis after immunostaining of
CD11c-enriched suspensions revealed that these C26-6CK
tumor-infiltrating dendritic cells have an immature phenotype (Fig. 9A); they express low levels
of surface MHC class II molecules and virtually no CD40, CD86, and
CD8 (Fig. 9A), as well as low levels of CD54, CD80, and
DEC-205 (data not shown).
|
|
The high number of dendritic cells in C26-6CK tumors could be due to a direct recruitment via m6Ckine/SLC. Conversely, m6Ckine/SLC expression could prevent dendritic cells from emigrating outside the tumor. We injected 105 C26 or C26 tumor cells in the rear footpad of mice and analyzed dendritic cells in the popliteal draining lymph node (three determinations from pools of two mice). We found no significant difference between the number of dendritic cells in mice injected with C26 cells (10.24 ± 2.01 x 104 CD11c+ cells per lymph node) compared with mice injected with C26-6CK cells (13.44 ± 1.77 x 104 CD11c+ cells per lymph node). In addition, the expression of CD40, CD80, CD86, and MHC class II in lymph node dendritic cells was similar in both cases (data not shown).
Functional status of C26-6CK tumor-infiltrating dendritic cells
C26-6CK tumor-infiltrating dendritic cells were very efficient at
taking up dextran-FITC at 37°C but not at 4°C (Fig. 9
B),
indicating a high capacity for receptor-mediated endocytosis
(32), a characteristic of immature dendritic cells.
Because immature dendritic cells are poor stimulators of naive T cells
(1), we analyzed the capacity of dendritic cells from
C26-6CK tumors to stimulate T cells in a MLR. We found that dendritic
cells from C26-6CK tumors were poor stimulators in MLR, when compared
with in vitro bone marrow-derived mature dendritic cells (Fig. 9C). Although the absence of CD86 expression by itself could
explain a lower stimulatory capacity, it is possible that factors
produced by contaminating macrophages or other cells in our dendritic
cell preparation could interfere during the MLR. In particular, we
ruled out a contribution of IL-10, because the addition of an
anti-IL-10R Ab had no effect on the MLR, compared with a control Ab
(data not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To date, the known angiostatic chemokines structurally belong to the CXC family (26). Thus, 6Ckine/SLC is the first example of a CC chemokine that has angiostatic properties. Moreover, it has not been proved that the angiostatic properties of IP-10 and Mig are mediated through CXCR3. The fact that m6Ckine both binds to CXCR3 and has angiostatic properties is a strong support for a role of CXCR3 in the control of angiogenesis. Of importance, the human 6Ckine/SLC protein does not bind to CXCR3 (44). The introduction of the human 6Ckine/SLC gene into tumors shall define the effect of 6Ckine/SLC on tumor development in the absence of CXCR3-mediated effects.
C26-6CK tumors were characterized by a much richer leukocyte infiltrate than C26 tumors. The strong induction of CCR7 vs CXCR3 mRNA expression in C26-6CK tumors suggests that interactions with CCR7 rather than with CXCR3 were responsible for leukocyte recruitment. It is possible, however, that CXCR3 and CCR7 expression on leukocytes would be differentially regulated within the tumor milieu after recruitment, for example, by m6Ckine/SLC-induced down-regulation, as it has been shown for CCR2 (reduced expression) vs CCR1 and CCR5 (normal expression) in tumor-infiltrating monocytes compared with blood monocytes (45). The CCR7 receptor is particularly resistant to ligand-induced down-regulation (46). C26-6CK tumors were infiltrated by granulocytes. There are no reports of a chemotactic activity of 6Ckine/SLC on granulocytes. It is possible that the pattern of in vivo chemokine responsiveness of granulocyte subpopulations may be different from what is generally observed in vitro (47). Alternatively, m6Ckine/SLC gene transfer may induce secondary mediators that would recruit granulocytes within the tumor. Although in some experimental models granulocyte infiltration was shown to be responsible for decreased tumorigenicity after cytokine gene transfer (48, 49), in our model, similarly to other models (50), granulocyte infiltration was not found to play a significant role.
Although we did not observe mature NK cells within the tumor, we found that anti-asialo-GM1 treatment increased the tumorigenicity of C26-6CK tumor cells, supporting a role for NK cells in this system. NK cells have been shown to respond to CCR7 ligands 6Ckine/SLC and macrophage inflammatory protein-3ß/EBI-1 ligand chemokine in vitro (20) and, recently, the introduction of the macrophage inflammatory protein-3ß/EBI-1 ligand chemokine in a mouse breast cancer cell line was shown to trigger NK cell-mediated tumor rejection (58). However, we were unable to detect mature NK cells within C26-6CK tumors. Further studies, notably using mice expressing NK1.1- and NK-dependent tumor models, will clarify the role of NK cells in m6Ckine/SLC-transduced tumors.
A significant recruitment of CD8+ T cells was observed in C26-6CK tumors, and the decreased tumorigenicity of the C26-6CK cell line compared with the parental cell line was partially reverted by anti-CD8 Ab treatment. These results point to a role for CD8+ T cells in tumor growth delay. The CD8+ tumor-infiltrating T lymphocytes expressed perforin and Fas ligand mRNA, suggesting potential cytotoxic functions. However, their cytotoxic activity remains to be tested. These CD8+ T cells also expressed CCR7 at the mRNA level. Recently, the expression of CCR7 in circulating naive and memory T cell subsets has been analyzed (51, 52). Although naive and effector memory T cells do not express CCR7, a circulating subset of T cells called central memory T cells expresses CCR7 and can differentiate into effector cells (52). According to these observations, m6Ckine/SLC expression in the C26 tumor could promote the recruitment of this intermediate type of T cells, although we do not have clear evidence for that at the present time. CD4+ T cells were rare in C26-6CK tumors. In vitro, 6Ckine/SLC has been shown to be a chemotactic factor for CD4+ T cells (17, 19). The condition of m6Ckine/SLC expression in the tumor, the lack of expression of necessary molecules in the tumor blood vessels or a rapid cell death after recruitment may explain this discrepancy between in vitro and in vivo results.
The recruitment of cytotoxic CD8+ T cells within
C26-6CK tumors strongly suggests a priming of the immune system against
the tumor. Indeed, C26-6CK tumors were also characterized by a rich
infiltrate of dendritic cells, a cell type that plays a major role in
triggering antitumor immune responses through the presentation of tumor
Ags to naive T cells (1). Dendritic cells from C26-6CK
tumors were presumably of myeloid origin
(CD11b+CD8-) as opposed
to a described CD8+ subset of dendritic cells
of lymphoid origin (53). These dendritic cells had an
immature phenotype, for example, lacking expression of CD86. They also
expressed a chemokine receptor pattern similar to mouse immature bone
marrow-derived dendritic cells. They were functionally immature, very
efficient for Ag capture but poor stimulators in an allogenic MLR
reaction. It is therefore possible that the dendritic cells recruited
in C26-6CK tumors represent an intermediate stage of maturation. This
hypothesis is supported by the fact that m6Ckine/SLC is expressed in
vivo in lymphatic vessels in the dermis (18). Because
dendritic cells that enter lymphatic vessels have not undergone
complete maturation (1), they could represent a target
population for m6Ckine/SLC in vivo. The high expression of
costimulatory molecules observed for 6Ckine-responding cells in vitro
or ex vivo may be related to cell culture or cell manipulation
(12). Conversely, the expression of costimulatory
molecules on C26-6CK tumor-infiltrating dendritic cells may be blocked
or down-regulated within the C26 tumor environment. To support this
hypothesis, it has been proposed that inhibition of dendritic cell
function would be a mechanism by which tumors could escape immune
surveillance (54, 55, 56).
Despite a strong recruitment of dendritic cells and a significant growth delay of C26-6CK tumors compared with parental tumors, we did not observe regression once tumors were established, suggesting that the antitumor response was not efficient enough. The role of CD8+ T cells in the delayed tumorigenicity of the C26-6CK tumor suggests that, indeed, the priming of the immune response occurred, although we ignore whether it took place within the tumor or in secondary lymphoid organs. Of note, the introduction of the 6Ckine gene into pancreatic islets has been shown to drive the development of an ectopic lymphoid tissue (23). Thus, it seems that in some conditions, 6Ckine by itself could promote the establishment of the complex environment favorable to T cell priming. To explain our data, one hypothesis would be that the expression of m6Ckine/SLC within the C26 tumor prevents dendritic cells from migrating to the draining lymph node and restricts the immune response to the tumor. Dendritic cell populations from draining lymph nodes were not decreased in mice bearing C26-6CK tumors. This could mean that dendritic cells are still able to migrate from the tumor to the lymph node. On the other hand, one could hypothesize that the strong recruitment of dendritic cells within C26-6CK tumors would lead to a similar increase in the draining lymph population, if the trafficking from the tumor to lymph node is not impaired. However, we still lack information to support one hypothesis or the other: 1) we do not know at the present time whether draining lymph nodes contain dendritic cells that have come from the tumors; 2) we do not know what could be the half-life of dendritic cells migrating from the tumor to the lymph node. If these dendritic cells are short-lived, one would not expect a dramatic increase in lymph node dendritic cell number.
Conversely, another hypothesis for a lack of an optimal immune response is that a strong antitumor response depends on the presence of mature but not immature dendritic cells within the tumor, that could support the activation, recruitment, and/or expansion of effector cells at the vicinity of their targets. Interestingly, the gene transfer of both GM-CSF and CD40 ligand (CD154) in the same C26 tumor cell line lad to tumor rejection in a proportion of mice, associated with a rich infiltrate of mature CD86+ dendritic cells as well as CD4+ and CD8+ T cells (57). In humans, mature but not immature dendritic cells have been observed in contact with T cells within human breast tumors, suggesting an ongoing immune response (33). Thus, an activation/maturation signal such as CD154, delivered to dendritic cells within the tumor, may be necessary for an efficient immune response. We will introduce the CD154 gene into the C26-6CK tumor cell line to test this hypothesis.
To conclude, our experimental approach of transducing the m6Ckine/SLC gene into C26 tumor cells has provided information on the biology of this chemokine in vivo, including its angiostatic properties and its ability to induce dendritic cell recruitment. Future experiments will define the value of m6Ckine/SLC gene transfer, as well as other dendritic cell-specific chemokine genes, in other tumor models, as well as the requirement for dendritic cell activation signals to achieve strong antitumor immunity in these models.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alain P. Vicari, Laboratoire de Recherches Immunologiques, Schering-Plough, 27, chemin des Peupliers, B.P. 11, 69571 Dardilly Cedex, France.
3 Abbreviations used in this paper: SLC, secondary lymphoid tissue chemokine; m-, mouse (murine); IP-10, IFN-inducible protein 10; Mig, monokine induced by IFN-; MGG, May-Grunwald-Giemsa.<. >
Received for publication February 17, 2000. Accepted for publication June 6, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
affect tumorigenicity and response to IL-12 therapy and angiogenesis. Immunity 9:25.[Medline]
in human neutrophils. J. Immunol. 162:474.. Proc. Natl. Acad. Sci. USA 90:2774.This article has been cited by other articles:
|
|
 |
|
  F. M. Speetjens, P. J.K. Kuppen, M. H. Sandel, A. G. Menon, D. Burg, C. J.H. van de Velde, R. A.E.M. Tollenaar, H. J.G.M. de Bont, and J. F. Nagelkerke Disrupted Expression of CXCL5 in Colorectal Cancer Is Associated with Rapid Tumor Formation in Rats and Poor Prognosis in Patients Clin. Cancer Res., April 15, 2008; 14(8): 2276 - 2284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-m. Liang, C.-p. Zhong, R.-x. Sun, B.-b. Liu, C. Huang, J. Qin, S. Zhou, J. Shan, Y.-k. Liu, and S.-l. Ye Local Expression of Secondary Lymphoid Tissue Chemokine Delivered by Adeno-Associated Virus within the Tumor Bed Stimulates Strong Anti-Liver Tumor Immunity J. Virol., September 1, 2007; 81(17): 9502 - 9511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hojo, K. Koizumi, K. Tsuneyama, Y. Arita, Z. Cui, K. Shinohara, T. Minami, I. Hashimoto, T. Nakayama, H. Sakurai, et al. High-Level Expression of Chemokine CXCL16 by Tumor Cells Correlates with a Good Prognosis and Increased Tumor-Infiltrating Lymphocytes in Colorectal Cancer Cancer Res., May 15, 2007; 67(10): 4725 - 4731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Thanarajasingam, L. Sanz, R. Diaz, J. Qiao, L. Sanchez-Perez, T. Kottke, J. Thompson, J. Chester, and R. G. Vile Delivery of CCL21 to Metastatic Disease Improves the Efficacy of Adoptive T-Cell Therapy Cancer Res., January 1, 2007; 67(1): 300 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. V. Shurin, R. Ferris, I. L. Tourkova, L. Perez, A. Lokshin, L. Balkir, B. Collins, G. S. Chatta, and M. R. Shurin Loss of New Chemokine CXCL14 in Tumor Tissue Is Associated with Low Infiltration by Dendritic Cells (DC), while Restoration of Human CXCL14 Expression in Tumor Cells Causes Attraction of DC Both In Vitro and In Vivo J. Immunol., May 1, 2005; 174(9): 5490 - 5498. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Xiang, N. Mizutani, Y. Luo, C. Chiodoni, H. Zhou, M. Mizutani, Y. Ba, J. C. Becker, and R. A. Reisfeld A DNA Vaccine Targeting Survivin Combines Apoptosis with Suppression of Angiogenesis in Lung Tumor Eradication Cancer Res., January 15, 2005; 65(2): 553 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Chun, C.-C. Yin, J.-Z. Song, M.-X. Liu, J.-H. Piao, Q. Lin, X.-B. Wang, and H.-L. Huang Soluble Expression of Recombinant Human Secondary Lymphoid Chemokine (SLC) in E. coli and Research on Its In Vitro and In Vivo Bioactivity J. Biochem., December 1, 2004; 136(6): 769 - 776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Treilleux, J.-Y. Blay, N. Bendriss-Vermare, I. Ray-Coquard, T. Bachelot, J.-P. Guastalla, A. Bremond, S. Goddard, J.-J. Pin, C. Barthelemy-Dubois, et al. Dendritic Cell Infiltration and Prognosis of Early Stage Breast Cancer Clin. Cancer Res., November 15, 2004; 10(22): 7466 - 7474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-F. He, G.-M. Zhang, X.-H. Wang, H. Zhang, Y. Yuan, D. Li, and Z.-H. Feng Blocking Programmed Death-1 Ligand-PD-1 Interactions by Local Gene Therapy Results in Enhancement of Antitumor Effect of Secondary Lymphoid Tissue Chemokine J. Immunol., October 15, 2004; 173(8): 4919 - 4928. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Bonnotte, M. Crittenden, N. Larmonier, M. Gough, and R. G. Vile MIP-3{alpha} Transfection into a Rodent Tumor Cell Line Increases Intratumoral Dendritic Cell Infiltration but Enhances (Facilitates) Tumor Growth and Decreases Immunogenicity J. Immunol., October 15, 2004; 173(8): 4929 - 4935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Lavergne, C. Combadiere, M. Iga, A. Boissonnas, O. Bonduelle, M. Maho, P. Debre, and B. Combadiere Intratumoral CC Chemokine Ligand 5 Overexpression Delays Tumor Growth and Increases Tumor Cell Infiltration J. Immunol., September 15, 2004; 173(6): 3755 - 3762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Zafiropoulos, N Crikas, A M Passam, and D A Spandidos Significant involvement of CCR2-64I and CXCL12-3a in the development of sporadic breast cancer J. Med. Genet., May 1, 2004; 41(5): e59 - e59. [Full Text] [PDF]
|
|
|
|
 |
|
 K.-i. Oonakahara, W. Matsuyama, I. Higashimoto, M. Kawabata, K. Arimura, and M. Osame Stromal-Derived Factor-1{alpha}/CXCL12-CXCR 4 Axis Is Involved in the Dissemination of NSCLC Cells into Pleural Space Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 671 - 677. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-C. Yang, S. Hillinger, K. Riedl, L. Zhang, L. Zhu, M. Huang, K. Atianzar, B. Y. Kuo, B. Gardner, R. K. Batra, et al. Intratumoral Administration of Dendritic Cells Overexpressing CCL21 Generates Systemic Antitumor Responses and Confers Tumor Immunity Clin. Cancer Res., April 15, 2004; 10(8): 2891 - 2901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Guiducci, E. Di Carlo, M. Parenza, M. Hitt, M. Giovarelli, P. Musiani, and M. P. Colombo Intralesional Injection of Adenovirus Encoding CC Chemokine Ligand 16 Inhibits Mammary Tumor Growth and Prevents Metastatic-Induced Death after Surgical Removal of the Treated Primary Tumor J. Immunol., April 1, 2004; 172(7): 4026 - 4036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Tolba, W. J. Bowers, J. Muller, V. Housekneckt, R. E. Giuliano, H. J. Federoff, and J. D. Rosenblatt Herpes Simplex Virus (HSV) Amplicon-mediated Codelivery of Secondary Lymphoid Tissue Chemokine and CD40L Results in Augmented Antitumor Activity Cancer Res., November 15, 2002; 62(22): 6545 - 6551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Vicari, C. Chiodoni, C. Vaure, S. Ait-Yahia, C. Dercamp, F. Matsos, O. Reynard, C. Taverne, P. Merle, M. P. Colombo, et al. Reversal of Tumor-induced Dendritic Cell Paralysis by CpG Immunostimulatory Oligonucleotide and Anti-Interleukin 10 Receptor Antibody J. Exp. Med., August 19, 2002; 196(4): 541 - 549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. Christopherson II, J. J. Campbell, J. B. Travers, and R. A. Hromas Low-Molecular-Weight Heparins Inhibit CCL21-Induced T Cell Adhesion and Migration J. Pharmacol. Exp. Ther., July 1, 2002; 302(1): 290 - 295. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Luther, A. Bidgol, D. C. Hargreaves, A. Schmidt, Y. Xu, J. Paniyadi, M. Matloubian, and J. G. Cyster Differing Activities of Homeostatic Chemokines CCL19, CCL21, and CXCL12 in Lymphocyte and Dendritic Cell Recruitment and Lymphoid Neogenesis J. Immunol., July 1, 2002; 169(1): 424 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Robertson Role of chemokines in the biology of natural killer cells J. Leukoc. Biol., February 1, 2002; 71(2): 173 - 183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. Christopherson II, J. J. Campbell, and R. A. Hromas Transgenic overexpression of the CC chemokine CCL21 disrupts T-cell migration Blood, December 15, 2001; 98(13): 3562 - 3568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sharma, M. Stolina, L. Zhu, Y. Lin, R. Batra, M. Huang, R. Strieter, and S. M. Dubinett Secondary Lymphoid Organ Chemokine Reduces Pulmonary Tumor Burden in Spontaneous Murine Bronchoalveolar Cell Carcinoma Cancer Res., September 1, 2001; 61(17): 6406 - 6412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Hjelmström Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines J. Leukoc. Biol., March 1, 2001; 69(3): 331 - 339. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, C26 tumors; 
, C26-6CK tumors. Results are expressed
as the percentage of cells with the indicated phenotype among the total
cell suspension. Results are expressed as the mean percentage of at
least 8 individual determinations ± SEM. Some of the individual
determinations represented pools of 5–8 tumors. Statistical analysis
(Student’s t test): *, p < 0.
05; **, p < 0. 001).<. >
). Representative of three experiments. C,
Stimulation of allogeneic T cells by irradiated CD11c-enriched C26-6CK
tumor-infiltrating dendritic cells (