|
|
||||||||

*
Centre National de la Recherche Scientifique, Unité Mixte de Recherche 8603 Université Paris V, and
Institut National de la Santé et de la Recherche Médicale, Unité 25, Hôpital Necker, Paris, France
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The eosinophil is a terminally differentiated, end-stage granulocyte that comprises <1% of circulating leukocytes (10). Conventionally associated with host defense against parasitic infection, through degranulation and release of toxic proteins, eosinophils also produce a variety of pro- and anti-inflammatory cytokines, growth factors, and chemokines (10, 11, 12, 13). Eosinophils can act as APC (14, 15) and express several important costimulatory molecules (11, 16), indicating that they could modulate adaptive immune responses. Eosinophils marginated in respiratory, gut, and urogenital subepithelium represent 95% of the total population, yet their physiological role is unclear.
In a study of thymic DC populations, identified by coexpression of CD11c with a panel of myeloid markers, we observed a discrete population of CD11b/CD11c double-positive cells localized around the cortico-medullary region (CMR) in young mice. Isolation and further characterization identified these cells as eosinophils. They have an activated phenotype, and their number and distribution vary during thymic ontogeny in a variety of mouse strains. We demonstrate that eosinophils are preferentially recruited during class I-restricted T cell selection and that they express presentation and costimulatory molecules. Our data indicate that the eosinophil is a numerically important member of the thymic microenvironment and imply an immunomodulatory role for eosinophils.
| Materials and Methods |
|---|
|
|
|---|
Male and female C57BL/6 (B6), BALB/c, DBA/2, and CBA mice were bred under specific pathogen-free conditions, which included surveillance for five ectoparasites and 10 endoparasites, in our own facility and used between 1421 days unless stated otherwise. Female I-Aß-/- and ß2-microglobulin (ß2m)-/- mice on a B6 background were also maintained in our facility and used at 24 wk of age. Hemagglutinin-specific (HA) TCR transgenic mice (ABII) on a BALB/c background were class II restricted and provided by A. Sarukhan (Institut National de la Santé et de la Recherche Médicale (INSERM), Unité 373, Institute Necker, Paris, France; Ref. 17). TCR H-Y mice on a Rag-1-/-, Thy 1.1, B6 background were class I restricted and provided by B. Rocha (INSERM 345, Institute Necker) (18). B. Lucas (INSERM, Unité 345, Institute Necker) provided RelB-/- mice on a B6 background (19). Both TCR transgenic and RelB-/- mice were kept under specific pathogen-free conditions at the Faculty of Medicine, Hôpital Necker (Paris, France). Mice were injected i.p., as described previously (20), with 50 nmol of peptide diluted in PBS. Peptide sequences were SFERFEIFPK representing aa 110119 of HA, and KCSRNRQYL, representing acids 738746 of the Y-linked protein Smcy (21) The animal facilities and care followed the norms stipulated by the European Community for the care and use of laboratory animals.
Antibodies
The following affinity-purified mAbs were prepared in the
laboratory unless otherwise stated and titrated by FACS. For depletion,
RA3-6B2 (anti-CD45R; B220) and KT3 (anti-CD3), gifts from P.
Leenen (Erasmus University, Rotterdam, The Netherlands), and Mel 14
(anti-CD62L) and YTS 169.4 (anti- CD8
), gifts from F.
Lepault (Centre National de la Recherche Scientifique, Unité
Mixte de Recherche 8603, Hopital Necker, Paris, France) were used; for
positive selection, biotinylated N418 (anti-CD11c) or M1/70
(anti-CD11b; Mac-1) was used. For cell sorting, PE-conjugated HL3
(anti-CD11c), biotin-conjugated anti-CD44 (PharMingen, San
Diego, CA), and FITC-conjugated 25-7-9
(anti-I-Ab) or 14-4-4S (anti-I-E), gifts
from C. Boitard (INSERM, Unité 342, Hopital Saint Vincent De
Paul, Paris, France), were used. For phenotyping,
anti-CD4-PerCP, CD8
-allo-PE, CD8
-FITC, CD19-PE,
CD11b-PE, CD25-biotin, CD49d, and CD69-biotin CD161-PE were all
purchased from PharMingen. Anti-CD80-PE and CD86-PE (Serotec, Oxford,
U.K.), BM8 (Bachem, Voisins-le Bretonneux, France), FITC-conjugated
RB6-8C5 (anti-Ly-6G, Gr-1), FITC-conjugated F4/80, and 2.4G2
(anti-Fc
RII and III; gift from F. Lepault), and RM153
(anti-CD153/CD30L; gift from K. Okumura) were also used.
Biotin-conjugated 28-8-6
(anti-H-2Kb/H-2Db) was a gift
from B. Rocha. ER-BMDM1 (anti-CD13), NLDC-145 (anti-DEC-205),
ER-HR3, MOMA2, and CDR1, gifts P. Leenen, were used as supernatant
unless specified otherwise. For immunohistochemistry, rabbit
anti-fibronectin and rabbit anti-laminin were obtained from
Novotec (Lyon, France) and rabbit anti-von Willebrand factor was
purchased from Dako (Trappes, France). M1/70 (anti-CD11b/Mac-1) and
FITC-conjugated N418 (anti-CD11c) were prepared in the
laboratory.
Triple immunofluorescent staining
Thymuses were frozen in dry ice-cooled isopentane. Sections were cut at 3 µm and air-dried. Tissues were fixed in acetone kept to -20 C for 10 min, immediately washed in two changes of PBS, then incubated with 1% H2O2 for 15 min. Sections were rinsed in PBS and passed into 100 mM Tris-HCl (pH 7.6), 150 mM NaCl, and 0.05% Tween 20 (TNT) and preincubated for 30 min with blocking buffer (NEN, Paris, France). Primary Abs were optimally diluted in blocking buffer (N418-FITC was diluted 100-fold greater than optimal) and incubated with sections for 30 min at room temperature. In some staining, supernatants were applied undiluted after sections had been briefly rinsed, for a further 30 min. Slides were washed in TNT, incubated with peroxidase-conjugated anti-FITC (F(ab')2; Roche, Meylan, France) for 30 min, and then washed. Sections were then incubated for 5 min with tyramide-FITC (NEN) diluted 1/75 in amplification buffer. After washing with agitation, sections were incubated with swine anti-rabbit conjugated with 7-amino-4-methylcoumarin-3-acetic acid (AMCA; Vector, Burlingame, CA) and donkey anti-rat (The Jackson Laboratory, Bar Harbor, ME) conjugated with Alexas-546 (Molecular Probes, Leiden, The Netherlands) according to the manufacturers instructions. Sections were washed, mounted in PBS, and viewed and photographed on a Leica DM epifluorescent microscope (Deerfield, IL) equipped with narrow band filter sets optimized for Coumarin (AMCA), FITC, and Cy3 (Alexas-546 equivalent).
The specificity of staining was routinely controlled by the omission of primary or secondary Abs or occasionally by the addition of irrelevant Abs. All primary Abs were raised from different species, and all secondary Abs were affinity purified and preabsorbed. Reagent dilutions were adjusted to balance fluorescent intensity and abrogate bleeding across filters. Images were digitally acquired using a 35-mm slide scanner (Eastman Kodak, Rochester, NY), and figures were prepared using Photoshop software (Adobe, San Jose, CA)
Isolation of CD11c+ thymic cells
To enrich the stromal elements of the thymus, a previously described density cut separation procedure was used with several modifications (5). Media were adjusted to be iso-osmotic with mouse serum. Nycodenz (Life Technologies, Cergy-Pontoise, France) was prepared at a density of 1.069 g/cm3 with monovalent salt solution (MSS)-EDTA (168 mM NaCl, 42 mM KCl, 5 mM HEPES, and 5 mM EDTA) as previously described (5).
Thymuses from 1020 young mice were washed and placed in RPMI 1640 supplemented with 5 mM HEPES, 2% FCS, 1 mg/ml collagenase (type III; Life Technologies), and 20 ng/ml DNase (Sigma, St. Quentin Fallavier, France). Tissues were first chopped with fine scissors and continuously agitated with pipetting for 20 min at room temperature. Undigested fragments were removed by unit gravity sedimentation, mechanically dispersed, and recombined before addition of 0.1 M EDTA to break up rosetting. Cells were washed through FCS-EDTA, resuspended in Nycodenz, and centrifuged at 1700 x g. Fifty to 70% of the top layer was taken, diluted 5-fold with MSS supplemented with 5% FCS-EDTA (MSS-FCS-EDTA), and centrifuged. Cells were resuspended in MSS-FCS-EDTA on ice and incubated with the mAbs Mel 14, RA3-6B2, and KT3 for 30 min. After washing, cells were incubated with anti-rat magnetic beads (Dynal, Oslo, Norway) at a cell to bead ratio of 1:6 for 20 min at 4 C with gentle agitation. Bound cells were removed under a magnetic field from the cell suspension, washed, and resuspended in MSS-FCS-EDTA for further selection.
Positive selection of cell populations based on one phenotypic marker was conducted using streptavidin (SA)-conjugated MACS beads (Miltenyi Biotec, Bergisch Gladbach, Germany). Cells resuspended in MSS-FCS-EDTA were incubated with a biotinylated mAb on ice for 30 min. The cells were washed, incubated with SA-magnetic beads for 30 min, washed again, and passed through a MACS Vario column according to the manufacturers instructions. Before placing cells in culture, they were washed extensively in large volumes of EDTA-free full balanced saline solution containing 5% FCS.
Electronic sorting of cells was conducted after negative selection. Cells resuspended in MSS-FCS-EDTA were stained in three colors: anti-I-Ab or I-E-FITC, anti-CD11c-PE, and anti-CD44-b followed by SA-conjugated allo-PE (PharMingen). Cells were first gated based on forward (FSC) and side (SSC) scatter, then on high expression of CD44. Populations were sorted based on their expression of MHC class II and CD11c.
RT-PCR
RT-PCR was conducted using conventional methodology. Briefly,
cells (1 x 106) in suspension were spun
down and resuspended in 200 µl of RNABle (EuroBio, Les Ulis, France).
After separation in the presence of chloroform, the aqueous phase was
precipitated in 2 vol of ethanol and 2 µl of pellet paint
(Novagen, Madison, WI). Samples were resuspended in 20 µl of
sterile RNase-free water. Reverse transcription (avian myeloblastosis
virus, Promega, Charbonnieres, France) was performed on 5 µl of
extract using random hexamer and oligo(dT) primers (Promega). Each
reaction was diluted 10-fold and stored at -20 C before PCR
amplification. For PCR, 5 µl of diluted cDNA was used as a template
in 50-µl reactions under standard thermal cycling
conditions. Reaction products were separated on 1.8%
agarose gels containing 100 ng/ml ethidium bromide. Primers (5' to 3')
were: CD11b: forward, TTACTTGCGACCAGGACAGG; reverse,
CGTTTTCACCATCTTCTTTG (673 bp); DEC-205: forward,
AGCACCGCCTCTTTCACCTG; reverse, TGTCCTCTTTTCCCGTAATG (600 bp); RelB:
forward, CTGCGGGAGGTGGAGGTGAC; reverse, TCGTAGGGTGGCGTTTTGAA (578
bp); IL-1
: forward, CAGTTCTGCCATTGACCATC; reverse,
TCTCACTGAAACTCAGCCGT (218 bp); IL-2: forward, GACACTTGTGCTCCTTGTCA;
reverse, TCAATTCTGTGGCCTGCTTG (227 bp); IL-3: forward, GACCCTC
TCTGAGGAATAAG; reverse, CTCCAGATCGTTAAGGTGGA (232 bp); IL-4:
forward, TCGGCATTTTGAA CGAGGTC; reverse, GAAAAGCCCGAAAGAGTCTC (216 bp);
IL-5: forward, TCACCGAGCTCTGTTGACAA; reverse, CCACACTTCTCTTTTTGGCG
(201 bp); IL-6: forward, GTTCTCTGGGAAATCGTGGA; reverse, TG
TACTCCAGGTAGCTATGG (208 bp); IL-10: forward, AGAGCAAGGCAGTGGAGCAG;
reverse, GGGATGACAGTAGGGGAACC (254 bp); IL-12 p40: forward,
AAGCACGGCAGCAGAAGAATAAA; reverse, CCAACC AAGCAGAAGACAGC (478 bp);
IL-13: forward, GACCCAGAGGATATTGCATG; reverse, CCAGCAAAGTCTGATGTGAG
(214 bp); IL-16: forward, AGGGACAGAACAGGGTGAGA; reverse,
GTGAGGTGGGCAGCAGAGAC (272 bp); GM-CSF: forward,
TGAACCTCCTGGATGACATG; reverse, GTGTTTCACAGTCCGTTTCC (218 bp);
TNF-
: forward, TCTCATCAGTTCTATGGCCC; reverse,
GGGAGTAGACAAGGTACAAC (212 bp); TGF-ß: forward,
ACCGCAACAACGCCATCTAT; reverse, GTAACGCCAGGAATTGTTGC (200 bp); IFN-
:
forward, GCTCTGAGACAATGAACGCT; reverse, AAAGAGATAATCTGGCTCTGC (227
bp); eotaxin: forward, TTCTATTCCTGCTGCTCACG; reverse,
CTGGACCCACTTCTTCTTCTTGG (227 bp); ß2m:
forward, TGACCGGCTTGTATGCTATC; reverse, CAGTGTGAGCCAGGATATAG (222
bp); and major basic protein (MBP; 387 bp) (22).
Culture conditions
Cells were cultured in modified RPMI 1640 iso-osmotic with mouse serum and supplemented with 5 mM HEPES, 10-5 M 2-ME, 1 mM sodium pyruvate, 2 mM glutamine, and 100 U of streptomycin and penicillin. After extensive washing to remove EDTA, cells were dispersed in culture medium containing GM-CSF (20 ng/ml; R&D Systems, Abingdon, U.K.) and cultured at 106 cells/ml in 24- or 96-well plates.
Flow cytometry
For three-color analysis, 106105 cells were stained with FITC-, PE-, and biotin-conjugated mAb in MSS-FCS-EDTA, washed, and incubated with SA-allophycocyanin. Samples were washed in MSS-EDTA and 2% FCS and were analyzed immediately without fixation on a FACScalibur (Becton Dickinson, Mountain View, CA). Data were analyzed with WinMDI software (http://facs.scripps.edu/).
Immunohistochemisty
Tissue sections were fixed and preincubated with H2O2 and blocking buffer as described for immunofluorescent histochemistry. Primary Ab were applied either as supernatant or optimally diluted in blocking buffer and incubated at room temperature for 30 min. Slides were washed in TNT and incubated with peroxidase-conjugated anti-rat IgG or anti-hamster IgG (The Jackson Laboratory) for an additional 30 min. Labeling was visualized with diaminobenzene in the presence of nickel chloride.
TUNEL
Cryostat sections of 4 µm were fixed in 4% paraformaldehyde for 10 min at room temperature, washed in PBS, and permeabilized in ethanol/acetic acid (2/1) for 5 min. Slides were washed in PBS and preincubated in reaction buffer (100 mM sodium cacodylate (pH 6), 1 mM CoCl2, 0.1 mM DTT, and 0.005% BSA) for 10 min at 37 C. Sections were blotted, and reaction buffer containing 20 U of TdT, 20 µM dNTP mix (Promega), and 2 µM digoxigenin-11-dUTP (Roche) was added for 60 min at 37°C. Slides were then passed into 2x SSC for 30 min at 37°C, washed in PBS, and incubated with alkaline phosphatase-conjugated anti-digoxigenin (F(ab')2; Roche) for 30 min. After further washing, slides were placed into substrate buffer (100 mM Tris (pH 9.5), 150 mM NaCl, and 50 mM MgCl2) for 10 min. Sections were then incubated in substrate buffer containing 4.5 µg/ml 4-nitroblue tetrazolium chloride and 3.5 µg/ml 5-bromo-4-chloro-3-indolyl-phosphate and monitored for intensity of staining. Sections were washed in PBS containing 10 mM EDTA and mounted.
Measurement of NADPH oxidase and peroxidase activities
The methodology and reagents were described in detail previously
(23). Briefly, eosinophils were enriched from
monodispersed thymocytes as described above. The Abs NLDC-145
(anti-DEC-205) and YTS 169.4 (anti-CD8
) were added to the
depletion mix, in addition to Mel 14, KT3, and RA3-6B2, to remove DC.
Alternatively, eosinophils and DC were sorted to purity as described
above. After purification steps, all cells were washed extensively in
HBSS without calcium or magnesium, brought to room temperature, and
supplemented with calcium. Basal and PMA-stimulated (27 nM) NADPH
oxidase (O2 oxidoreductase) activities were
measured over 60 min as the luminescence product of
dimethylbiacridinium (lucigenin) reductive deoxygenation. Basal and
PMA-stimulated (2.7 µM) peroxidase
(H2O2 oxidoreductase)
activities were measured as the luminescence product of
luminol-deoxygenation.
| Results |
|---|
|
|
|---|
Triple-labeling immunohistochemical studies were conducted in
14-day-old C57BL/6 mice using a panel of myeloid markers,
anti-CD11c (N418), and either the endothelial marker von Willebrand
factor or fibronectin to stain the extracellular matrix. Fig. 1
, a and b,
illustrates the demarcation between cortical epithelial cells and
medullary CD11c+ DC. At this age, we observed a
striking pattern of staining for anti-CD11b around the CMR and
subcapsular sinus (SS). In triple-labeling experiments most
CD11b+ cells colocalized with
CD11c+ cells, predominately around the CMR but
also in small numbers inside the medulla and cortex (Fig. 1
c, white arrows). However, CD11b+
cells rarely stained for CD11c in the inter- and intralobular septa and
SS. A small number of cells inside the medulla were also single
positive (Fig. 1
c, open arrows). The intensity of CD11c
staining was much lower on CD11b double-positive cells (Fig. 1
, d and e) than on single-positive cells; note also
the alignment of CD11b+ cells at the cortical
face of the CMR. Higher power examination of the CMR (Fig. 1
f) showed
CD11b+/CD11c+ cells
scattered around, but distinct from, a von Willebrand factor-positive
vessel. CD11b single-positive cells were also observed, but were
directly adjacent to the venules in perivascular spaces. The
distribution of
CD11b+/CD11c+ cells
strongly suggests they are part of the tissue parenchyma. Double
labeling with anti-CD11b and anti-fibronectin shows that most
CD11b-positive cells in the CMR and medulla are proximal to, but
distinct from, fibronectin-positive extracellular matrix structures
(Fig. 1
g); a similar pattern of staining was observed for
laminin (not shown). In contrast, the SS (inset) and septa (not shown)
contained CD11b-positive cells embedded in fibronectin-positive
connective tissue. At high power (Fig. 1
h),
CD11b+/CD11c+ cells in the
CMR were heterogeneous in terms of morphology, but appeared
multinucleated in many cases (inset). Staining with myeloid markers,
including the rat anti-mouse macrophage markers ER-HR3 (Fig. 1
i), MOMA2 (Fig. 1
j), F4/80, HR-MP23, BM8, and
MOMA1 (not shown), showed no comparable pattern of labeling to that of
CD11b. To investigate further the phenotypic characteristics of the
CD11b+/CD11c+ population,
we isolated CD11c+ cells from the thymus.
|
To obtain the CD11c+ thymic population,
collagenase-digested tissue was fractionated by density gradient
centrifugation (5), and the low buoyant density fraction
(68% of total) was depleted of Mel 14+
(anti-CD62L), CD3+, and
B220+ (anti-CD45R) cells by magnetic beads
(
60% CD11c+). They could be further enriched
with positively selecting MACS beads or stained in three colors and
electronically sorted for further analysis.
All CD11c+ cells express high levels of CD44
(Fig. 2
) and heat-stable Ag (not shown),
but could be split into two populations based on the level of class II
expression (Fig. 2
b). The population characterized by
intermediate expression of CD11c and low to negative class II,
expressed CD11b and was CD8
-. In contrast,
the class IIhigh population had higher expression
of CD11c and was CD8
+
CD11b-, consistent with the previously reported
phenotype of thymic DC (5). The low buoyant density
depleted thymic cells were electronically sorted as described in
Materials and Methods (Fig. 2
c); the
sorted population was routinely >98% pure on reanalysis. Microscopic
examination of sorted CD11b+ cells after
May-Grünwald Giemsa staining revealed an annular or convoluted
nucleus with a small irregular cytoplasm. The presence of eosinophilic
granules in the cytoplasm identified the CD11b+
cells as eosinophils (Fig. 3
b). Cultured eosinophils were
dependent on GM-CSF in culture. They put out a heterogeneous array of
projections (that could sometimes be observed ex vivo; Fig. 3
c), ranging from thick to thin very long tendril-like
strands, and were actively motile (Fig. 3
d).
|
|
RII, Fc
RIII, CD25, and CD69 was observed consistent with
previously reports of activated eosinophils (22, 25). In
contrast, eosinophils did not express the thymic DC markers DEC-205
(Fig. 4
(Fig. 2
|
Pattern of cytokine expression in sorted thymic eosinophils
Previous studies of eosinophil cytokine expression suggest that
different combinations of cytokines may be linked to activation or
disease states (26). We analyzed total RNA extracted from
populations of eosinophils and DC, sorted to 98% purity (Fig. 2
c), for cytokine transcripts by RT-PCR (Fig. 4
b). A strong signal was present for the
eosinophil-restricted granule component MBP in the
CD11b+/CD11c+
double-positive population. Eosinophils expressed TGF-ß and IL-16
mRNA consistent with their wide distribution among leukocytes.
Detectable mRNA levels of the proinflammatory cytokines, IL-1
, IL-6,
and TNF-
were present as previously reported in activated
eosinophils (14, 15). Expression of eotaxin, IL-2, IL-3,
IL-10, IL-12, IFN-
, GM-CSF, and IL-5 was undetectable. GM-CSF and
IL-5 has been reported to act as autocrine survival and recruitment
factors for activated eosinophils in inflammatory foci
(12). However, thymic eosinophils expressed mRNA for the
closely related Th2 cytokines IL-4 and IL-13. Both are
linked to eosinophil involvement in certain pathologies (27, 28) and are reported to aid recruitment, activation, and
survival (29, 30).
Transcriptional expression of CD11b was readily detectable in both
eosinophils and DC (Fig. 4
b), although low surface
expression is present on a minority of freshly isolated DC (Fig. 2
b) (5). DC, but not eosinophils, express the
scavenger receptor DEC-205, consistent with FACS profiles, and
eosinophils did not express relB, a nuclear protein of restricted
expression that regulates NF-
B activity in DC and medullary
epithelial cells (19).
Basal superoxide anion production by thymic eosinophils
We investigated whether functional activation accompanied the
presence of activation markers. Fig. 5
a shows a representative
experiment in which >60% of depleted cells are eosinophils. The level
of superoxide anion released from total thymocytes, using
lucigenin-amplified chemiluminescence, was marginally above baseline.
In the low buoyant density fraction, there was a log fold increase and
2 log fold increases in the depleted population. The time-dependent
profile of luminescence emission is indicative of NADPH oxidase
activation. The peak level of superoxide anion release in 98% pure
FACS-sorted populations (Fig. 2
c) was not significantly
different after PMA stimulation; however, peroxidase activity was
significantly increased (Fig. 5
b). It has been reported that
eosinophil extravasion can result in heightened superoxide anion
release (31), consistent with our observation that
CD11b+/CD11c+ eosinophils
are inside the tissue parenchyma, and their NAPDH oxidase activity is
maximal under nonstimulated conditions.
|
During the neonatal period, the thymus undergoes expansion as
cells are generated to furnish the adult peripheral T cell pool; new
production is diminished with age, as reflected in shrinking of the
cortex (4). Eosinophil numbers increase sharply during the
neonatal period to reach a maximum at 2 wk of age (Fig. 6
a). At this time point they
are roughly equal in absolute number to DC isolated in tandem. While
the number of DC continues to increase with tissue size, the absolute
number of eosinophils decreases, reflected by a sharp drop in
eosinophil numbers at 28 days of age (Fig. 6
b). Absolute
numbers of eosinophils begin to rise again at 16 wk, corresponding to
the commencement of thymic involution. The localization of eosinophils
also changes during ontogeny. In neonatal animals,
CD11b+/CD11c+ cells are
concentrated at the CMR (Fig. 1
); at latter time points they become
more prominent in the medulla (not shown). No differences were noted in
cell number or phenotype between sexes or among C57BL/6, BALB/c, DBA/2,
and CBA strains of mice. In RelB-/- mice, who
lack thymic medullary epithelial cells and thus fail to form a medulla
(19), few CD11b+ cells were detected
in the thymic parenchyma compared with age-matched
RelB+/- littermates (1.2 ± 0.2 vs
51.7 ± 2.7 cells/mm2, mean ± SEM;
n = 3; p < 0.001, by independent
t test), although they were observed in the SS (not
shown).
|
Given the localization of eosinophils around the CMR, in contact with immature double-positive thymocytes susceptible to negative selection, and their augmented recruitment during the neonatal period, we examined their behavior in a model of acute negative selection. Injection of the cognate peptide into TCR transgenic mice induces prompt apoptosis in thymocytes (20, 32, 33, 34). While at later time points thymic atrophy can be linked to peripheral activation (32, 33), initially cell death is due to peptide presentation within the thymus (33, 34). Recently it was observed that peptide injection into a class I-restricted TCR transgenic model resulted in an infiltration of CD11b+ granulocytes into the thymus within 1 h. This was before apoptosis became apparent, and no other organs were affected (20). We repeated the experiments on class I- and class II-restricting backgrounds.
The proportion of total thymocytes stained for annexin V in class
I-restricted female H-Y TCR transgenics increased 6 h after
cognate peptide injection, particularly among the
CD4low, CD8low
double-positive population associated with apoptosis (Fig. 7
a) (35). This
was reflected in a significantly higher number of TUNEL-positive
apoptotic bodies in cryostat sections from peptide-treated mice (Table I
). We observed a progressive increase in
the number of CD11b+ cells in the thymus after
peptide injection. Isolated cells had the same phenotype as thymic
eosinophils from normal mice, and cytospins of enriched populations
confirmed them to be the only granulocyte population. Six hours after
injection the absolute number of
CD11b+/CD11c+ cells had
increased 75% (Fig. 7
b). In terms of absolute numbers,
eosinophils are roughly equivalent in both negatively selecting males,
which delete all TCR+ thymocytes, and positively
selecting female mice. However, the relative percentage of eosinophils
to total cellularity in males was 2-fold higher (Fig. 7
b).
|
|
|
| Discussion |
|---|
|
|
|---|
Thymic eosinophils display some features of activated eosinophils. There is a loss of Gr-1 and CD62L expression, which are present on bone marrow eosinophils. They express several phenotypic markers associated with activation, including CD25, CD69, and low levels of class II. The cells are hypodense, a characteristic of some circulating eosinophils in hypereosinophilic patients and in allergic inflammatory foci (10, 36), and their level of superoxide production was maximal without further stimulation. Although little information is available on the phenotypic and functional characteristics of tissue-marginated eosinophils, it is proposed that partial activation or priming may be a normal facet of eosinophil entry into tissue (10). Movement across endothelial barriers is enough to activate circulating human eosinophils, as measured by increased expression of CD11b and superoxide anion production (31), both features of thymic eosinophils.
RT-PCR of sorted eosinophil RNA extracts revealed a distinct pattern of
cytokine mRNA. Differential patterns of eosinophil cytokine production
have been reported in different disease states. For example, IL-5 is
expressed by intestinal tract eosinophils in celiac, but not Crohns,
disease (13). Eosinophils taken from bronchial lavage or
nasal polyps of atopic individuals express IL-5 and GM-CSF, which are
proposed to act in an autocrine fashion, respectively, to enhance
recruitment to (37) and survival (12) at
sites of inflammation. Eosinophils are capable of producing multiple
subsets of cytokines in a directed fashion. Binding of IgA complexes in
vitro induces IL-10 secretion in eosinophils taken from
hypereosinophilic patients, while the ligation of CD28 induces IL-2 and
IFN-
secretion (11).
Thymic eosinophils expressed mRNA for IL-4 and IL-13, which are closely
related cytokines that share receptors and have overlapping functions.
Critical in generating eosinophil responses to parasitic infection
(27), IL-4 and IL-13 have recently been associated with
activation and survival of human peripheral blood eosinophils
(29) and recruitment of murine eosinophils during
allergen-induced airway inflammation (30), both in synergy
with TNF-
. Expression of IL-4, IL-13, and TNF-
, therefore,
represents a cytokine pattern associated with extravasion and
activation.
It seems likely that eosinophils are recruited into the thymus as in normal subepithelial mucosa. Eotaxin, an eosinophil-specific CCR3 ligand, is constitutively expressed in thymus and lymph nodes (38). Eotaxin null mice have a reduction in both the number of circulating (39) and tissue-marginated eosinophils, including thymic eosinophils (40), suggesting that the baseline level of eosinophils in the thymus is maintained through an eotaxin-driven pathway of extravasion.
Comparison of CD11c+ cells isolated at different time points suggests that eosinophil recruitment is particularly augmented between 714 days and in older mice (>100 days old). Recruitment seems to diminish between these periods, since the absolute number of thymic eosinophils drops 50% between 14 and 28 days of age. In comparison, DC numbers are closely related to total thymic cellularity, consistent with experiments showing that both T cells and DC arise from the same progenitor in the thymus (41). These data imply that eosinophils have a relatively short half-life in the thymus; it has been calculated that marginated tissue eosinophils survive for at least 3 wk after extravasion (10). On tissue sections there is also a distinct difference in anatomical distribution; 2-wk-old animals have CD11b+ cells concentrated in the CMR, while at 16 wk eosinophils are distributed evenly throughout the medulla and into the CMR.
Without knowing the source of the chemotactic signal or its stimulus, it is difficult to determine the significance of the differential spatial and temporal distribution of thymic eosinophils. Several lines of evidence suggest that under physiological conditions, negative selection of developing double-positive thymocytes occurs in the CMR (2, 4). In addition, between 7 and 14 days of age there is an exponential increase in the cellularity of the thymus caused primarily by the clonal expansion of double-positive thymocytes (1). Accordingly, recruitment of eosinophils is associated with increased demand for repertoire selection and is localized to the region in which it is occurring.
Thus, an important observation in this study was the dramatic elevation of eosinophil numbers in a model of acute negative selection. This finding confirms and extends a previous report from a different MHC class I-restricted TCR transgenic line in which cognate peptide injection induced a prompt influx of CD11b+ granulocytes (20). In both studies, CD11b+ cells were distributed throughout the apoptotic fields. The granulocyte recruitment is unlikely to be an artifact of systemic activation, since infiltration was already significant at 3 h, was only apparent in the thymus, and was selective for eosinophils. In addition, eosinophils were distributed throughout the tissue of the negatively selecting male H-Y TCR transgenic mouse in which the cognate Ag is constitutively present. When these experiments were repeated in class II-restricted HA TCR mice, systemic administration of cognate peptide failed to recruit eosinophils, although significant apoptosis was observed.
Taken together, eosinophil recruitment above baseline is associated with high affinity, class I-restricted selection/deletion and is not likely to be a nonspecific reaction to cell death. However, significant differences exist between TCR transgenic models, in particular the affinity of the TCR for the peptide/MHC complex, that may affect the mechanism of thymic deletion (42). Although striking differences in eosinophil numbers are observed between H-Y and HA TCR transgenic models we cannot exclude the possibility that these might be intrinsic to the model and not a result of the restriction element. Further analysis of TCR transgenic mice that encompasses a wide spectrum of avidity will determine whether eosinophil recruitment is indeed associated with MHC class I-restricted selection or with a particular mechanism of thymocyte deletion.
Interestingly, the number of thymic eosinophils in female Rag-1-/- H-Y mice was greater than that age-matched controls. These mice have an increased thymic medullary area and an exaggerated proportion of mature CD8+ cells compared with normal mice. Therefore, signals released from mature thymocytes or other medullary components could elevate eosinophil numbers under steady state conditions. Consistent with this hypothesis, eosinophils were not present in RelB-/- mice, which do not form a thymic medulla but are characterized by granulopoiesis (19). Mature CD8 single-positive cells only begin to populate the medulla after 7 days (43), consistent with the time point at which a large influx of eosinophils is observed.
Recent evidence has cast the traditional nonredundant physiological role of eosinophils, protection against helminthic infection, into doubt (10). Moreover, eosinophils express a diverse array of cytokines and cell surface ligands (11, 13), which suggest that it may have an immunomodulatory role. Eosinophils are associated with most inflammatory and infectious disorders and have been implicated beneficially in anti-tumor cytotoxicity and wound healing. Yet, most of our knowledge about this cell comes from analysis in particular pathologies, e.g., hypereosinophilia, or in hypersensitivity reactions (10). These situations may not accurately reflect the physiological role of eosinophils, especially tissue-marginated eosinophils, under nonpathological conditions. In this study we show that murine thymic eosinophils express Ag-presenting molecules and have several physical characteristics of APCs that enhance cellular contact, including nonadherence, motility, and dendritic projections. Others have shown that both human and murine eosinophils are capable of acting as APCs. They express costimulatory molecules previously shown to be involved in clonal deletion, such as CD30 ligand (CD153) and CD86 (44, 45). Uniquely, eosinophils produce considerable levels of free radicals that diffuse freely through membranes in the immediate vicinity of their release. Developing thymocytes may have an increased sensitivity to these molecules (e.g., through down-regulation of Cu/Zn superoxide dismutase) that could induce apoptosis in concert with other signals given simultaneously or sequentially.
Eosinophils have been identified in the thymus, based on their distinctive granular staining (40, 46, 47) or peroxidase activity (48). In this study we describe a method by which tissue-bound eosinophils can be isolated from normal tissue. We demonstrate that the eosinophil is a regulated component of the murine thymus that is recruited in the absence of overt inflammatory stimulus similar to other tissue-marginated eosinophils. In mucosal tissue, eosinophils assume a sentinel position in the subepithelium among macrophages, DC, and lymphocytes (40). Their precise role under these circumstances is not clear; however, as with thymic eosinophils, it is likely to be different from that of eosinophils recruited during allergic inflammation. Further insight into this cell population may be useful in clarifying not only the role of eosinophils in thymic function, but also the physiological role of tissue-marginated eosinophils in general, leading to a better understanding of their participation in a variety of physiological and pathological responses, in particular atopic diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: DC, dendritic cell; CMR, cortico-medullary region; ß2m, ß2-microglobulin; B6, C57BL/6; HA, hemagglutinin; Rag, recombinase-activating gene; TNT, Tris/saline/Tween 20; AMCA, 7-amino-4-methylcoumarin-3-acetic acid; MSS, monovalent salt solution; SA, streptavidin; FSC, forward scatter; SSC, side scatter; MBP, major basic protein; SS, subcapsular sinus; INSERM, Institut National de la Santé et de la Recherche Médicale. ![]()
Received for publication March 8, 2000. Accepted for publication June 5, 2000.
| References |
|---|
|
|
|---|
): inhibition by immunoglobulin a complexes. J. Exp. Med. 190:487.
) and type 2 (IL-4, IL-5, and IL-10) cytokines by human eosinophils. Ann. NY Acad. Sci. 796:203.[Medline]
expression. J. Immunol. 150:2554.[Abstract]
receptors on murine eosinophils: implications for the functional significance of elevated IgE and eosinophils in parasitic infections. Blood 89:3826.This article has been cited by other articles:
![]() |
E. A. B. Kelly, C. J. Koziol-White, K. J. Clay, L. Y. Liu, M. E. Bates, P. J. Bertics, and N. N. Jarjour Potential Contribution of IL-7 to Allergen-Induced Eosinophilic Airway Inflammation in Asthma J. Immunol., February 1, 2009; 182(3): 1404 - 1410. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Jacobsen, S. I. Ochkur, R. S. Pero, A. G. Taranova, C. A. Protheroe, D. C. Colbert, N. A. Lee, and J. J. Lee Allergic pulmonary inflammation in mice is dependent on eosinophil-induced recruitment of effector T cells J. Exp. Med., March 17, 2008; 205(3): 699 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-B. Wang, I. Ghiran, K. Matthaei, and P. F. Weller Airway Eosinophils: Allergic Inflammation Recruited Professional Antigen-Presenting Cells J. Immunol., December 1, 2007; 179(11): 7585 - 7592. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Burke, A. J. Stagg, P. A. Bedford, N. English, and S. C. Knight IL-10-Producing B220+CD11c- APC in Mouse Spleen J. Immunol., August 15, 2004; 173(4): 2362 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Kelly-Welch, M. E. F. Melo, E. Smith, A. Q. Ford, C. Haudenschild, N. Noben-Trauth, and A. D. Keegan Complex Role of the IL-4 Receptor {alpha} in a Murine Model of Airway Inflammation: Expression of the IL-4 Receptor {alpha} on Nonlymphoid Cells of Bone Marrow Origin Contributes to Severity of Inflammation J. Immunol., April 1, 2004; 172(7): 4545 - 4555. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bros, X.-L. Ross, A. Pautz, A. B. Reske-Kunz, and R. Ross The Human Fascin Gene Promoter Is Highly Active in Mature Dendritic Cells Due to a Stage-Specific Enhancer J. Immunol., August 15, 2003; 171(4): 1825 - 1834. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. van Rijt, J.-B. Prins, P. J. M. Leenen, K. Thielemans, V. C. de Vries, H. C. Hoogsteden, and B. N. Lambrecht Allergen-induced accumulation of airway dendritic cells is supported by an increase in CD31hiLy-6Cneg bone marrow precursors in a mouse model of asthma Blood, November 15, 2002; 100(10): 3663 - 3671. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Woerly, P. Lacy, A. B. Younes, N. Roger, S. Loiseau, R. Moqbel, and M. Capron Human eosinophils express and release IL-13 following CD28-dependent activation J. Leukoc. Biol., October 1, 2002; 72(4): 769 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bonkobara, P. K. Zukas, S. Shikano, S. Nakamura, P. D. Cruz Jr., and K. Ariizumi Epidermal Langerhans Cell-Targeted Gene Expression by a Dectin-2 Promoter J. Immunol., December 15, 2001; 167(12): 6893 - 6900. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Moulian, F. Truffault, Y. M. Gaudry-Talarmain, A. Serraf, and S. Berrih-Aknin In vivo and in vitro apoptosis of human thymocytes are associated with nitrotyrosine formation Blood, June 1, 2001; 97(11): 3521 - 3530. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bandeira-Melo, K. Sugiyama, L. J. Woods, and P. F. Weller Cutting Edge: Eotaxin Elicits Rapid Vesicular Transport-Mediated Release of Preformed IL-4 from Human Eosinophils J. Immunol., April 15, 2001; 166(8): 4813 - 4817. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |