|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


*
Institute of Virology, University of Cologne, Cologne, Germany;
Department of Dermatology, University of Cologne, Cologne, Germany;
Eberhard-Karls-Universität, Institut für Tropenmedizin, Tübingen, Germany; and
§
Department of Pathology, University of Cologne, Cologne, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Premalignant lesions of the cervix uteri and cervical carcinomas, in particular, harbor human papillomaviruses (HPV)3 in up to 95% of all investigated cases. Either as a consequence of the HPV infection or independently thereof, a variety of cellular changes have been described in cervical carcinomas. Thus, ma- lignant progres-sion is accompanied by the up-regulation of the anti-apoptotic factor bcl-2 (1). Moreover, cellular receptors and cytokines are up-regulated, including the receptor CD40 (2), the epidermal growth factor receptor (3), different growth factors, like endothelin-1 (4) or insulin-like growth factor-1 (5), and the cytokine IL-6 (6, 7).
IL-6 has been characterized as a multifunctional member of the cytokine
family. It is synthesized by a variety of cells upon stimulation and
acts on a wide range of different target cells to regulate cell growth,
differentiation, and gene expression (for review see Refs.
8, 9, 10). This includes up-regulation of the monocyte
chemoattractant protein-1 (MCP-1) (11, 12, 13). IL-6 is
inducible by appropriate stimuli such as IL-1, TNF, IFN-
, IL-4
(14, 15, 16, 17), and CD40 (18, 19, 20) or by viral and
bacterial infections (21). In multiple myeloma
(22) and a number of epithelial tumor cell lines,
including renal cell carcinoma, bladder cell carcinoma, and cervical
carcinoma cells, IL-6 was found to be constitutively expressed
(6, 7, 23, 24). Dependent on the target cell, IL-6 may act
as a positive or negative regulator of cell growth. While it inhibits
the growth of breast carcinoma cell lines, melanocytes, and certain B
cell lymphomas (25, 26), it is an important regulator of
growth and survival of multiple myeloma cells (22, 27).
Moreover, it is supposed to promote the growth of normal and
EBV-transformed B cells, normal keratinocytes, mesangial cells
(14, 28, 29, 30) and also of renal, bladder, and cervical
carcinoma cells (7, 23, 24, 31). In contrast, IL-6 may
also act as a potent antiinflammatory and immunosuppressive cytokine
(reviewed in Tilg et al.; Ref. 32). Thus, IL-6 blocks TNF
and IL-1 production (33, 34) and induces IL-1 receptor
antagonist in macrophages (32) and inhibits the
degradation of the extracellular matrix (35).
Signaling of IL-6 involves binding of the cytokine to the IL-6R (gp80). Both molecules form a binary complex that then associates with gp130 and induces its dimerization (36, 37). Of note, a functional IL-6R complex is formed even when gp80 is lacking its transmembrane and intracellular domains, as it is found in the naturally occurring soluble form of gp80 (sgp80). Thus, cell types with low or lacking surface expression of gp80 may signal through gp130 if they are stimulated with IL-6 in the presence of sgp80 (12, 38). In a sgp80 transgenic model, it was shown that in fact sgp80 strongly sensitized the mice for IL-6 effects and significantly prolonged the plasma half-life of IL-6 in vivo (39). Gp130 is shared by a number of cytokines as a signal-transducing receptor component. It does not bind IL-6 by itself. Dimerization of gp130 is followed by the rapid activation of tyrosine kinases of the Janus kinase (Jak) family and subsequent activation of transcription factors of the STAT family, STAT3 and STAT1 (40, 41, 42, 43, 44). STAT factors participate in transcriptional regulation of genes comprising STAT-specific binding sites, e.g., tissue inhibitor of metalloproteinases-1 (TIMP-1) (45).
In this study, we investigated the production of IL-6 by HPV-transformed cell lines with different malignant potential and analyzed in detail their responsiveness to this cytokine. We demonstrate that cervical carcinoma cells producing IL-6 at high levels only weakly respond to IL-6 in an autocrine manner due to limited gp80 expression. Production of IL-6 but silencing an autocrine IL-6 response prevents the tumor cells from constitutively producing the mononuclear cell-attracting chemokine MCP-1, possibly helping the tumor to escape the immune system.
| Materials and Methods |
|---|
|
|
|---|
Malignant and nonmalignant, in vitro HPV-transformed keratinocyte cell lines were used in this study. The HPV16- or HPV18-positive cervical carcinoma cell lines SiHa (HTB-35, HPV16; American Type Culture Collection, Manassas, VA), CaSki (CRL-1550, HPV16; American Type Culture Collection) HeLa (CCL-2, HPV18; American Type Culture Collection), SW756 (HPV18; kindly provided by Dr. M. von Knebel-Doeberitz, Heidelberg, Germany), the keratinocyte cell line Skv (HPV-16) derived from a vulvar bowenoid papule (6), and the HPV-negative cervical carcinoma cell line C33A (HTB-31) were cultured in DMEM medium. The nonmalignant HPV16-transformed foreskin keratinocyte cell line HPKIA (46) was kindly provided by Dr. M. von Knebel-Doeberitz and cultured in DMEM. The nonmalignant in vitro HPV18 E6/7-transformed keratinocyte strains K51 and I56 (kindly provided by Dr. L. A. Laimins, Chicago, IL) were maintained in DMEM containing 25% Hams F12 medium, 10% FCS, 50 µg/ml gentamicin, 0.4 µg/ml hydrocortisone, 10-10 M cholera toxin, 5 µg/ml transferrin, 2 x 10-11 M trijodthyronin, 1.8 x 10-4 M adenine, 5 µg/ml insulin (all from Sigma, Deisenhofen, Germany), and 10 ng/ml epidermal growth factor (Life Technologies, Eggenstein, Germany). U266 cells (TIB-196; American Type Culture Collection) were maintained in RPMI 1640 medium. All media were supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, and 2 mM L-alanyl-L-glutamin (all from Life Technologies).
Immunohistochemistry
Six specimens with squamous cell carcinoma (SCC) of the cervix uteri, high-grade CIN (CIN III), and nontumorous cervical epithelium derived from the files of the Institute of Pathology (University of Cologne, Cologne, Germany) were fixed in 5% formalin and were embedded in paraffin. After deparaffinization, tissue sections were stained applying the the ImmunoMax technique (47) as described previously (2) with the following modifications: as primary Abs affinity-purified rabbit anti IL-6 (kindly provided by Dr. D. Novick, Weizmann Institute of Science, Rehovot, Israel) or rabbit control Abs (Dianova, Hamburg, Germany) were diluted to 0.1 µg/ml in 10% normal goat serum and incubated for 1 h at 37°C. Biotinylated goat anti-rabbit Ab (Dianova) was added for 30 min at room temperature. Then the sections were incubated with biotinylated tyramin solution (20 mg N-hydroxy-succinimido sulfo-LC-biotin (Pierce, Rockford, IL) dissolved in 0.5 ml DMSO allowed to react with 6.4 mg tyramin (Sigma) in 10 ml 0.1 M borate buffer, pH 8.0) for 10 min at room temperature. StreptAB-alkaline-phosphatase complex (K391; Dako, Hamburg, Germany) was applied for 30 min at room temperature followed by a peroxidase-coupled streptavidin-biotin-complex (k355; Dako) for 30 min at room temperature. Finally, the reaction products were visualized using naphtol-AS-biphosphate and new fuchsin as chromogens. Nuclei were counterstained with hematoxylin.
FACS analysis
Adherent cells were detached with PBS containing 0.005% trypsin-EDTA (1:10 diluted solution from Life Technologies). Following blocking with 2% BSA (Sigma) in PBS, cells were incubated with anti-gp130 mAb (HB-12022, clone 2H4, IgG1, hybridoma supernatant; American Type Culture Collection), anti-gp80 mAb (IgG1; Diaclone, Besançon, France), or MOPC-21 (Sigma) as an isotype-matched control. Cells were then stained with FITC-conjugated goat anti-mouse F(ab')2 (Dianova), and expression was determined by flow cytometry (FACScan, Becton Dickinson, Mountain View, CA).
Stimulation experiments
Cells were seeded in 24-well plates at a density of 1.5 x 105 cells/well. After 20 h, they were stimulated with DMEM or indicated stimulants in a 300-µl volume. Twenty-four hours later, cellular supernatants (SN) were collected, centrifuged, and stored at -20°C.
Cytotoxicity assay
Cells were seeded in flat-bottom microtiter plates (Renner, Damstadt, Germany) at a density of 2.5 x 104 cells/well. Twenty-four hours later, they were stimulated with medium or 100 ng/ml IL-6 in the presence or absence of 500 ng/ml sgp80. After 8 h, the cells were challenged with serial dilutions of anti-Fas mAb in the presence of 50 µg/ml cycloheximide. Cell viability was assessed 16 h later by the neutral red uptake method according to Finter (48) as described previously (49).
Determination of cytokines by ELISA
Cytokine ELISAs were essentially performed as described (2, 19). Maxisorp plates (Nunc, Wiesbaden, Germany) were coated with 1 µg/ml anti-IL-6 or anti-MCP-1 mAb (PharMingen, Hamburg, Germany) overnight. After blocking of the plates for 1 h with PBS containing 0.5% BSA, 0.05% Tween 20 (Serva, Heidelberg, Germany), and 0.02% NaN3, SN or serial dilutions of the respective recombinant human cytokines (Tebu, Frankfurt, Germany) as standards were added for 6 h. Plates were then incubated with anti-IL-6 or anti-MCP-1 polyclonal Ab (pAb) (Tebu) at 0.5 µg/ml overnight. After 2 h incubation with peroxidase-labeled goat anti-rabbit F(ab')2, the substrate was applied and the extinction was measured with an SLT ELISA reader at 405 nm.
Western blot analysis
A total of 3.5 x 106 cells were grown in 10-cm dishes, washed twice with PBS, and scraped off with a cell scraper. Cells were pelleted and resuspended in 100 µl buffer containing 20% glycerol, 50 mM Tris (pH 7.9), 1 mM DTT, and 0.1% Nonidet P-40. A total of 46 µg of each sample were separated on a 10% SDS-PAGE. After transfer onto nitrocellulose membranes (Hybond ECL; Amersham, Braunschweig, Germany), the membranes were blocked with 5% skim milk and 0.1% sodium azide in PBS. Detection was performed with anti-STAT3 pAb (Santa Cruz Biotechnology, Santa Cruz, CA) at 2 µg/ml, peroxidase-labeled goat anti-rabbit Ab (Dianova, Hamburg, Germany), and the enhanced chemiluminescence detection system (Amersham) according to the manufacturers instructions.
EMSA
Cervical carcinoma cell lines were plated in 10-cm culture
dishes reaching subconfluency the next day. They were then stimulated
with medium, 100 ng/ml IL-6, or 1000 U/ml IFN-
. Stimulation took
place in the absence or presence of 500 ng/ml soluble IL-6 receptor
(sgp80; R&D Systems, Wiesbaden, Germany) or 2 µg/ml anti-IL-6 pAb
as indicated. After 15 min incubation at 37°C, the carcinoma cells
were harvested and nuclear extracts were prepared according to Andrews
et al. (50). Five micrograms of the respective extracts
were analyzed for STAT3 binding activity in a buffer containing 10 mM
K-HEPES, 1 mM EDTA, 5 mM MgCl2, 10% glycerol, 50
µg/ml poly(dIdC), 1 mg/ml BSA, 5 mM DTT, and 2 mM PMSF using the
sis-inducible element (SIE) of the c-fos promoter
(double-stranded oligonucleotide, 5'-GATCCGGGAGGGATTTACGGGAAATGCTA-3').
For supershift analyses, 200 ng anti-STAT3 or anti-STAT1 (Santa
Cruz Biotechnology) pAbs were added to the samples for 40 min at 4°C.
DNA-protein complexes were then separated for 1.5 h in a 4.5%
polyacrylamide gel in 0.25x TBE buffer. After fixation of the gels in
10% acetic acid and 10% methanol, autoradiograms were taken.
RT-PCR
Cells were seeded at a density of 3.5 x 106 cells/10-cm dish. Total RNA was extracted using the RNAzol B (Wak-Chemie Medical, Bad Homburg, Germany) according to the manufacturers instructions. One microgram of total RNA and random hexamer primers were used for reverse transcription applying the Superscript preamplification system according to the manufacturers instruction (Life Technologies). ß-actin cDNA-specific PCR was performed in a 50-µl volume using the 5' primer ATCTGGCACCACACCTTCTACAATGAGCTGCG and the 3' primer CGTCATACTCCTGCTTGCTGATCCACATCTGC. Amplification conditions were as follows: 35 cycles with denaturation at 94°C for 45 s, annealing at 45°C for 45 s, and extension at 72°C for 2 min. Gp80-specific RT-PCR was performed using the 5' primer CATTGCCATTGTTCTGAGGTTC and the 3' primer AGTAGTCTGTATTGCTGATGTC. The amplification conditions were the same as for the ß-actin RT-PCR. PCR products were separated on 1% or 2.5% agarose gels, respectively, and photographs were taken.
| Results |
|---|
|
|
|---|
Applying immunohistochemistry, IL-6 was detected in all cervical
SCC investigated. Carcinoma cells showed a diffuse cytoplasmic Ag
distribution (Fig. 1
A,
a). Specific immunostaining of IL-6 was also observed in
some dysplastic lesions, especially in the epithelial cells of
high-grade CIN (Fig. 1
A, b). Of note, basal and
suprabasal cell layers of nontumorous cervical epithelium were devoid
of IL-6 staining (Fig. 1
A, c). These cell layers
are known to represent the proliferating compartment of an epithelium
in which transformation processes take place and from which carcinomas
may arise. Upper, more differentiated cell layers of the normal
epithelium showed staining with anti IL-6 Ab. However, this was also
seen with nonspecific control Ab (Fig. 1
A, f),
suggesting that binding to these cell layers was nonspecific. In the
inflammatory infiltrate of the tumors, preferentially mononuclear cells
were stained for the IL-6 protein. Here, staining was less than in the
tumor cells themselves, further underlining the autochtonous IL-6
production of the cancer cells.
|
Exogenous IL-6 does not activate STAT3 in cervical carcinoma cells
Because IL-6 had been proposed as a cytokine acting in an
autocrine manner on cervical carcinoma cells (7) we were
interested to study the signaling events of IL-6 in these cells. To
this end, we analyzed constitutive and IL-6-inducible STAT binding
activity as an overall measure of gp130 activation. Using the
double-stranded radiolabeled SIE-oligonucleotide from the
c-fos promoter in EMSAs, we obtained two weakly
shifted complexes (I and II) in the carcinomas. While complex I was
strongly inducible in the in vitro-transformed keratinocytes after IL-6
stimulation (Fig. 2
A,
lanes 2, 4, and 6), to our surprise
hardly any changes were observed in the carcinomas (Fig. 2
A,
lanes 10, 12, 14, and 16).
A slight increase was seen in the vulvar bowenoid carcinoma cell line
Skv (Fig. 2
A, lane 8). Supershift analysis
revealed that complex I consisted of STAT3 protein in all tested cell
lines as it was shifted by anti-STAT3 (Fig. 2
B,
upper panel) but not anti-STAT1 Abs (Fig. 2
B,
lower panel) or control pAb. As a positive control,
IFN-
-induced STAT1 complexes where efficiently shifted by STAT1 Abs
(Fig. 2
B, lower panel, lane 18).
Complex II was not inducible and was neither affected by the addition
of STAT3-specific, STAT1-specific, nor control Abs. Therefore, the
nature of the noninducible protein complex II remains elusive. These
data indicated that cervical carcinoma cells show weak constitutive
activation of STAT3. However, STAT3 was not activated by exogenous IL-6
as observed in the in vitro-transformed keratinocytes.
|
Reduced IL-6-mediated STAT3 activation in cervical carcinoma cells
might either be due to a generally suppressed response to IL-6
activation or to a specific defect in the STAT3 signaling pathway.
Based on the fact that IL-6 had been described as an autocrine growth
factor for these cells, we first assumed that the unresponsiveness to
exogenous IL-6 might be restricted to the STAT3 pathway. One
explanation for the lack of STAT3 activation could have been a reduced
expression of the STAT3 protein itself. To test for this hypothesis, we
prepared whole-cell extracts of the cell lines and examined STAT3
expression by Western blot analysis. In EMSAs, only
phosphorylated STAT protein, which has translocated into the nucleus
and specifically binds to DNA, is investigated. In contrast, Western
blot analysis of whole-cell extracts detects activated as well as
nonphosphorylated STAT protein located either in the nucleus or in the
cytoplasm of the cell. As shown in Fig. 3
, the cervical carcinoma cells expressed
STAT3 at least at the same levels as the in vitro-transformed
keratinocytes. Therefore, STAT3 protein expression levels could not
account for the altered responsiveness of the carcinomas.
|
To investigate a disruption of IL-6 signal transduction already at
the level of IL-6 binding or the initiation of IL-6 signaling, we
measured the expression of the respective receptor chains by FACS
analysis. The signal transducing chain gp130 was detectable in all cell
lines and appeared to be expressed even slightly higher in the
malignant cells (Fig. 4
A). In
contrast, using an anti-gp80 mAb (Diaclone), gp80 was only weakly
detectable in the in vitro-transformed keratinocytes and undetectable
on the surface of the carcinoma cell lines (Fig. 4
A). The
same results were obtained with a different anti-gp80 mAb provided
by Dr. D. Novick (Weizmann Institute of Science, Rehovot, Israel; data
not shown). These data suggested that lack of gp80 surface expression
could account for the observed differences in IL-6 signaling.
|
In additional experiments, we examined whether the unresponsiveness of
the carcinoma cell lines to exogenous IL-6 might be due to constitutive
endogenous IL-6 production. In fact, long-term stimulation of the IL-6
responsive cell line HPKIA for 10 days with IL-6 resulted in the
down-regulation of gp80 (Fig. 5
A, upper panel),
but not ß-actin (Fig. 5
A, lower panel), mRNA
expression as shown by semiquantitative RT-PCR analysis. Therefore, we
neutralized IL-6 in the supernatants of the carcinoma cells with anti
IL-6 pAb. As shown in Fig. 5
B, application of IL-6-specific
pAb diminished the constitutive STAT3 binding activity at least in Skv,
HeLa, CaSki, and SiHa cells, suggesting a weak responsiveness to
endogenous IL-6 in these cells (Fig. 5
B, lane 3).
In the second part of the experiment, cells were washed twice after
IL-6 neutralization and immediately stimulated with exogenous IL-6 at a
high dose. In none of the cells tested, neutralization of endogenously
produced IL-6 restored the cellular responsiveness to the exogenously
applied cytokine (Fig. 5
B, lane 4). Thus,
down-regulation of IL-6 signaling in cervical carcinomas could not be
reverted by abolishing the continuous IL-6 stimulus.
|
If gp80 is the limiting factor restricting IL-6 signaling in
cervical carcinomas, sgp80 should be able to complete a functional
IL-6R-signaling complex. Therefore, we investigated the effect of sgp80
addition to the carcinoma cell lines. In fact, addition of sgp80 was
able to restore their IL-6 responsiveness. Applying sgp80, the cell
lines did not only strongly react to exogenous IL-6 with STAT3
activation (Fig. 6
, lane 4)
but also to endogenously produced IL-6 (Fig. 6
, lane 3).
These experiments indicated that the impaired responsiveness of
cervical carcinomas was not due to a defect in intracellular signaling
but related to gp80 expression.
|
In view of the fact that carcinoma cells do produce high amounts
of IL-6 but do obviously hardly respond to it, we were interested in
reasons why these cells might have been selected for not responding to
IL-6. STAT3 signaling had been implicated in the regulation of
apoptosis. With few exceptions, it had been described to promote the
survival of tumor cells, e.g., conferring resistance to Fas-mediated
apoptosis (51). Therefore, we investigated whether STAT3
signaling might influence the sensitivity to apoptosis in cervical
carcinoma cells. Only CaSki cells were strongly sensitive, all other
cells were not or only weakly sensitive to Fas-mediated apoptosis.
However, neither in CaSki (Fig. 7
A) nor in the other the
cell lines (not shown) did preactivation of the IL-6 signaling
pathway by application of IL-6 in combination with sgp80 change the
sensitivity to Fas-mediated cell death.
|
(2), a cytokine that
induces STAT1 activation. As MCP-1 may be induced by IL-6 in other cell
types (11, 12, 13), we concentrated on the IL-6-mediated
induction of MCP-1 in cervical carcinoma cells. Constitutive production
of MCP-1 into the culture supernatants was low as shown previously. As
expected, stimulation of the carcinomas with exogenous IL-6 could not
enhance MCP-1 production. However, in the cell lines with high
constitutive IL-6 secretion, addition of sgp80 was sufficient to induce
an 8-fold induction of MCP-1 in SiHa and a 6-fold induction in SW756,
respectively (Fig. 7| Discussion |
|---|
|
|
|---|
IL-6 had been described as an autocrine factor for cervical carcinoma
cells (7), as it had been done for other cell types,
especially plasmocytomas (22, 27). Therefore, we were
interested to study the signals that mediate this effect. Our data show
that IL-6 is expressed in cervical carcinomas in vivo. The fact that
IL-6 was not found in cervical tumor cells in a different study
(54) might be related to the different immunostaining
techniques applied. In fact, similar to Tartour et al., we were unable
to detect IL-6 using a conventional peroxidase-based staining protocol
(data not shown). Applying the ImmunoMax technique, which reached a
higher sensitivity than the immunoperoxidase method, IL-6 was detected
in the cytoplasm of cervical carcinoma cells and high-grade dysplasias.
Staining was even stronger than in the infiltrate of the tumor stroma,
underlining that IL-6 was produced by the tumor cells themselves.
Keratinocytes in the basal and suprabasal cell layers of normal
epithelium were devoid of IL-6. These layers have proliferative
capacity and represent the compartment where dysplastic transformation
may be initiated. IL-6 staining of carcinoma cells was obtained not
only with a commercial anti-IL-6 pAb (rabbit anti-human
polyclonal IL-6 500-P26; Tebu; data not shown) but also with
affinity-purified anti-IL-6 pAb as shown here. In contrast,
nonspecific control pAb did neither stain the cervical carcinoma cells
nor dysplastic lesions. Moreover, in vitro, HPV-positive cervical
carcinoma cells constitutively produced IL-6, some of them in nanogram
amounts. This is in concordance with a previous report of Malejczyk et
al. demonstrating that the HPV16-harboring cell line Skv expresses and
releases this cytokine (6). IL-6 was neither detected in
the SN of nonmalignant keratinocytes transformed with HPV16 or HPV18 in
vitro nor of the HPV-negative carcinoma cell line C33A. Transcription
of the IL-6 gene is positively regulated by control elements comprising
the binding sites for the transcription factors NF-
B, NF-IL-6
(c/EBPß), and AP-1. In contrast, the tumor suppressor proteins p53
and pRb suppress IL-6 transactivation (55, 56, 57, 58, 59, 60). Whether or
not dysregulation of the HPV oncogenes E6 and E7 plays a role in the
up-regulation of the cytokine in the carcinoma cells, e.g., by E7,
which transactivates AP-1 (61) and neutralizes pRb
(62), or E6, which promotes p53 degradation
(63), remains to be determined.
When IL-6 signaling was analyzed in the HPV-positive cervical carcinomas, we were surprised that we did not observe IL-6-inducible activation of the transcription factor STAT3, a hallmark of IL-6 signal transduction (40), nor of STAT1. Only weak constitutive STAT3 binding activity was detectable. Altered expression of the STAT3 protein could not account for the reduced binding activity as the protein was expressed in the carcinomas at similar levels as in in vitro-transformed keratinocytes, which responded well to IL-6. In fact, all cell lines that did not constitutively secrete IL-6 could be activated by the cytokine. This corresponds to the observations of Igelsias et al. showing IL-6 responses in cervical cell lines producing only low IL-6 levels (31). At least in some cell lines (Skv, HeLa, CaSki, SiHa), the weak constitutive STAT3 binding activity was due to weak autocrine IL-6 signaling as it was abolished after neutralization of IL-6 in the cellular SNs. FACS analysis demonstrated a lack of sgp80 surface expression, the ligand binding chain of the IL-6 receptor complex, on the carcinoma cells. However, loss of gp80 on the cell surface could also be a consequence of receptor release from the surface. The gp80 protein is efficiently shedded in different cell types resulting in a truncated but nevertheless functionally active receptor chain (64). Semiquantitative RT-PCR analysis revealed that the loss of gp80 expression was regulated on transcriptional level (Ref. 65 and this paper). Moreover, in experiments where sgp80 was added to the cervical carcinomas, we could fully restore the responsiveness to endogenously produced and exogenously applied IL-6. This indicated that indeed gp80 was the limiting factor in cervical carcinomas. IL-6 neutralization in the cellular SN did not restore the responsiveness to exogenously applied IL-6. This argued against a sole functional down-regulation of gp80, which can be observed on RNA level after long-term stimulation of IL-6-responsive keratinocytes (as shown here) or on protein level after stable transfection of hepatoma cells with a cDNA-encoding IL-6 (66).
From these observations two questions arose as to 1) why the IL-6-producing carcinomas shut off their IL-6 responsiveness and 2) what could be the in vivo role of IL-6 produced by cervical carcinoma cells. One can only speculate about the answers to these questions.
IL-6 might only be beneficial for the carcinomas when intracellular signaling is low. This is in contrast to myeloma cells, which profit from strong IL-6 signaling sustained by autocrine sgp80 production (67). Low STAT3 signaling in the cervical carcinoma cells did not lead to a higher sensitivity for apoptosis signals as one could have expected from the results of previous studies in other cell types (51, 68, 69). In fact, although SiHa, CaSki, SW756, and HeLa expressed Fas on their surface (data not shown), only CaSki cells were strongly susceptible to Fas apoptosis. Activation of the STAT3 in these cells did not confer protection. This indicated that STAT3 signaling does not represent an advantage in cervical carcinoma cells with respect to cell death regulation. A clue for the cellular restriction of the IL-6 signal came from a different observation. When the high-level IL-6-producer cell lines SW756 or SiHa were stimulated with sgp80, enabling the cell to transduce a strong autocrine IL-6 signal, the chemokine MCP-1 was induced. MCP-1 is hardly detectable in nonactivated cervical carcinoma cells (2, 52). However, when HeLa cells transfected with the MCP-1 gene had been inoculated into nude mice, significant growth retardation and macrophage infiltration was observed (53). Thus, blockade of autocrine signaling via IL-6 may serve the malignant cells to prevent constitutive production of MCP-1 and the attraction of mononuclear cells to the tumor, which in turn could provide the tumor cells with shedded sgp80.
In vivo, IL-6 may also act in a paracrine fashion. There is increasing evidence that IL-6, which had been regarded as a proinflammatory cytokine, may in some respect act as an antiinflammatory mediator (32). Among various mechanisms, IL-6 is able to inhibit IL-1 and TNF production in human blood mononuclear cells (33, 34), enhances the expression of IL-1 receptor antagonist (70), and inhibits the degradation of extracellular matrix (35).
Thus, while production of IL-6 might contribute to a local immunosuppressive effect, silencing an autocrine IL-6 response prevents constitutive production of the mononuclear cell-attracting chemokine MCP-1. Both mechanisms might help the tumor to escape the immune system.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sigrun Hess, Institute of Virology, University of Cologne, Fürst-Pückler-Strasse 56, 50935 Cologne, Germany. ![]()
3 Abbreviations used in this paper: HPV, human papilloma virus; MCP-1, monocyte chemoattractant protein; SN, supernatant; TIMP, tissue inhibitor of metalloproteinases; SCC, squamous cell carcinoma; sgp80, soluble gp80; Jak, Janus kinase; pAb, polyclonal Ab; SIE, sis-inducible element. ![]()
Received for publication August 13, 1999. Accepted for publication May 25, 2000.
| References |
|---|
|
|
|---|
. J. Immunol. 162:4140.
regulates the expression of the adhesion molecule ELAM-1 and IL-6 production by human endothelial cells in vitro. J. Immunol. 145:2110.[Abstract]
. Eur. J. Immunol. 21:97.[Medline]
B. J. Immunol. 153:4357.[Abstract]
B and induction of IL-6 production. J. Immunol. 155:4588.[Abstract]
B pathway involving TNF receptor-associated factors. Oncogene 14:2899.[Medline]
B transcription factor. Mol. Cell. Biol. 10:2327.
B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.
B DNA binding. Cancer Res. 55:2373.This article has been cited by other articles:
![]() |
S. Smola-Hess, U. Sandaradura de Silva, D. Hadaschik, and H. J. Pfister Soluble interleukin-6 receptor activates the human papillomavirus type 18 long control region in SW756 cervical carcinoma cells in a STAT3-dependent manner J. Gen. Virol., October 1, 2001; 82(10): 2335 - 2339. [Abstract] [Full Text] [PDF] |
||||