|
|
||||||||
and IL-12 Induce IL-18 Receptor Gene Expression in Human NK and T Cells1
Department of Virology, National Public Health Institute, Helsinki, Finland
| Abstract |
|---|
|
|
|---|
or IL-12 to induce IFN-
. Here we show that in human NK
and T cells IFN-
and IL-12 strongly up-regulate mRNA expression of
the IL-18R components, accessory protein-like (AcPL) and IL-1R-related
protein (IL-1Rrp). In addition, IFN-
enhanced the expression of
MyD88, an adaptor molecule involved in IL-18 signaling. Pretreatment of
T cells with IFN-
or IL-12 enhanced IL-18-induced NF-
B activation
and sensitized the cells to respond to lower concentrations of IL-18.
AcPL and IL-1Rrp genes were strongly expressed in T cells polarized
with IL-12, whereas in IL-4-polarized cells these genes were expressed
at very low levels, indicating that AcPL and IL-1Rrp genes are
preferentially expressed in Th1 cells. In conclusion, the results
suggest that IFN-
and IL-12 enhance innate as well as Th1 immune
response by inducing IL-18R expression. | Introduction |
|---|
|
|
|---|
production in the livers of mice stimulated with
Propionibacterium acnes and LPS (4, 5).
Thereafter, mouse and human IL-18 cDNAs were cloned (6, 7). In synergy with IFN-
or IL-12, IL-18 induces IFN-
production in T cells and enhances Th1 cell development
(6, 7, 8, 9, 10, 11). IL-18 also stimulates IFN-
synthesis in NK
cells (12), up-regulates perforin-mediated NK cell
activity (13), and enhances Fas-Fas ligand-mediated
cytotoxicity by inducing Fas ligand expression (12). IL-18
is structurally related to IL-1ß (14). Like IL-1ß,
IL-18 is synthesized as a precursor form that requires caspase-1
cleavage to become a biologically active molecule (reviewed in Refs.
1, 2, 3).
At present two subunits of IL-18R, IL-1R-related protein
(IL-1Rrp)3 and
accessory protein-like (AcPL), have been characterized (15, 16). The role of IL-1Rrp as a functional IL-18R has been
verified in gene knockout studies (17). Both IL-18R
components belong to the IL-1R family (16, 18), the
members of which are homologous to the Toll family proteins. Toll-like
receptors (TLRs) are involved in the activation of innate immune
responses (reviewed in Refs. 19 and 20).
IL-1R, IL-18R, and TLRs signal through the IL-1R-associated kinase
(IRAK)-NF-
B pathway (10, 21, 22, 23, 24, 25, 26, 27, 28). NF-
B activation by
these receptors requires the interaction of IRAK with the receptor
complex via an adapter protein, MyD88, which also belongs to the IL-1R
family (22, 23, 24, 25, 26, 27, 28).
In the present report, we analyze the effect of IFN-
and IL-12 on
IL-1Rrp, AcPL, and MyD88 gene expression in human NK and T cells. We
show that IFN-
and IL-12 strongly up-regulate IL-1Rrp and AcPL gene
expression, whereas only IFN-
effectively enhances MyD88 gene
expression. In addition, IL-1Rrp and AcPL transcripts are expressed at
high levels in IL-12-polarized but not in IL-4-polarized T cells.
| Materials and Methods |
|---|
|
|
|---|
Human NK-92 cell line was maintained in continuous culture in
MEM Alpha Medium (Life Technologies, Grand Island, NY) supplemented
with 12% horse serum (Life Technologies), 12% FCS, 0.2 mM i-inositol,
20 mM folic acid, 40 mM 2-ME, 2 mM L-glutamine,
antibiotics, and 100 IU/ml of human rIL-2 (Chiron, Emeryville, CA).
Human leukocyte IFN-
(13 x 106 IU/ml)
was provided by Dr. Hannele Tölö (Finnish Red Cross Blood
Transfusion Service, Helsinki, Finland) and used at 100 IU/ml. Human
rIL-12 and rIL-4 (R&D Systems, Abingdon, U.K.) were used at 5 ng/ml and
10 ng/ml, respectively. Escherichia coli-produced highly
purified human IL-18 (7) was used at 1 or 10 ng/ml.
Purification of T cells from PBMCs and T cell activation
PBMCs were isolated from leukocyte-rich buffy coats obtained from healthy blood donors (Finnish Red Cross Blood Transfusion Service) by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). Monocytes were removed from PBMCs by adherence, and nonadherent T cells were further purified by nylon wool columns. In the experiments where resting T cells were used, NK cells were removed by anti-CD16 Ab treatment and adsorption with immunomagnetic beads. Purified T cells were activated with 0.5 µg/ml plate-bound anti-CD3 mAb (R&D Systems) and cultured in RPMI 1640 medium supplemented with 10% FCS (Integro, Zaandam, The Netherlands), 20 mM HEPES, 2 mM L-glutamine, 0.6 µg/ml penicillin, 60 µg/ml streptomycin) and 100 IU/ml IL-2 for 56 days. Cells were further expanded for 35 days with RPMI 1640 supplemented with IL-2. As determined by flow cytometry, >99% of the cells were CD3 positive consisting of CD4+ (30%) and CD8+ (70%) cells. In all experiments, the cells were removed from IL-2-containing medium before cytokine stimulations. In each experiment, T cells from two to four donors were used.
Purification of NK cells from PBMCs
Mononuclear cells were isolated by density gradient centrifugation as above using Ficoll-Paque. NK cells were further purified from nonadherent PBMCs by nylon wool columns and two-step density gradient centrifucation by Percoll (Amersham Pharmacia Biotech), followed by further purification with magnetic beads coated with anti-CD3, anti-CD14, and anti-CD19 Abs (Dynal, Oslo, Norway). As determined by flow cytometry with anti-CD16 or anti-CD56 Abs, NK cells were over 90% pure (data not shown).
In vitro polarization of T cells
Purified T cells were activated with 0.5 µg/ml plate-bound anti-CD3 or anti-CD3 plus anti-CD28 mAbs (R&D Systems) in the presence of IL-2 and IL-12 or IL-4 for 3 days. The cells were further expanded for 4 days in the presence of IL-2 plus IL-12 or IL-4 and used in experiments.
IFN-
analysis by ELISA
Supernatants from cytokine-stimulated cells were analyzed for
IFN-
production by ELISA using a matched Ab pair for IFN-
(Diaclone, Besancone, France) according to manufacturers recommended
procedure. The lower limit of sensitivity in the ELISA was 20 pg/ml,
using human rIFN-
(Diaclone) as a standard.
RNA isolation and Northern blot analysis
Total cellular RNA was isolated from pooled cell samples as
previously described (29). Total cellular RNA was
quantified photometrically, and samples containing equal amounts of RNA
were size fractionated on a 1.0% formaldehyde-agarose gel, transferred
to a nylon membrane (Hybond, Amersham, Buckinghamshire, U.K.), and
hybridized with the AcPL (16), IL-12Rß2
(30), or MyD88 (31) probes. IL-1Rrp probe was
cloned from total cellular RNA obtained from IL-12-treated T cells by
RT-PCR using oligonucleotides TGTGTCGGATCCAGAGTTGACTTGGTT (sense) and
TGTTTCGGATCCTTAAGACTCGGAAAG (antisense). Ethidium bromide staining of
ribosomal RNA bands was used to ensure equal RNA loading. The probes
were labeled with [
-32P]dCTP (3000 Ci/mmol;
Amersham) using a random-primed DNA-labeling kit (Boehringer Mannheim,
Mannheim, Germany). The membranes were hybridized under conditions of
high stringency (50% formamide, 5x Denhardts solution, 5x SSC
phosphate/EDTA, and 0.5% SDS), washed twice at room temperature and
once at 60°C in 1x SSC/0.1% SDS for 30 min each time, and exposed
to Kodak AR X-Omat films at -70°C using intensifying screens.
EMSA
Nuclear extracts and nuclear protein/DNA-binding reactions were
performed as described previously (32, 33). NF-
B
oligonucleotides (5'-AGTTGAGGGGACTTTCCCAGCC-3') were synthesized with
an Applied Biosystems (Foster City, CA) oligonucleotide synthesizer and
purified on PAGE in the presence of 8 M urea. The probes were labeled
by T4 polynucleotide kinase. The binding reaction was performed at room
temperature for 30 min. The samples were analyzed by elecrophoresis on
6% nondenaturing low-ionic strength polyacrylamide gels in 0.25x TBE
buffer. The gels were dried and visualized by autoradiography. Anti-p50
(sc-345X; Santa Cruz Biotechnology, Santa Cruz, CA) and anti-p65
(sc-839X; Santa Cruz Biotechnology) Abs (1:20 dilution) were used in
supershift experiments.
| Results |
|---|
|
|
|---|
and IL-12 induce IL-1Rrp, AcPL, and MyD88 gene expression
in T cells
Previously, it has been reported that IL-12 enhances IL-1Rrp mRNA
expression in B and T cells (34). Because IFN-
shares
many biological properties with IL-12, such as activation of Stat4 and
enhancement of Th1 cell development (29, 35, 36), we
wanted to study the effect of IFN-
on IL-1Rrp and AcPL gene
expression. Activated T cells were stimulated with IFN-
or IL-12 for
different time periods, after which total cellular RNA was isolated for
Northern blot analysis. IFN-
and IL-12 strongly enhanced IL-1Rrp and
AcPL mRNA expression (Fig. 1
). However,
there were certain kinetic differences. IFN-
-induced AcPL mRNA
expression was rapid, peaked at 3 h, and declined at 6 h
after stimulation. In contrast, IFN-
-induced IL-1Rrp mRNA levels
continued to increase up to 6 h. IL-12-induced IL-1Rrp and AcPL
mRNA levels remained elevated up to 6 h. MyD88 mRNA expression was
strongly induced by IFN-
, whereas only a weak induction was seen by
IL-12 (Fig. 1
). To analyze whether IFN-
is able to induce IL-1Rrp
and AcPL mRNA expression in resting T cells, they were incubated with
IFN-
for different time periods. As shown in Fig. 2
, IFN-
strongly enhanced IL-1Rrp and
AcPL mRNA expression also in resting T cells.
|
|
and IL-12 induce IL-1Rrp, AcPL, IL-12Rß2, and MyD88 gene
expression in NK cells
Because IFN-
and IL-12 are important NK cell activators, we
studied whether these cytokines are able to up-regulate IL-18R
expression also in NK cells. Resting enriched NK cells were stimulated
with IFN-
or IL-12 for 3 h, and total cellular RNA was isolated
and analyzed by Northern blotting. Both IFN-
and IL-12 enhanced
IL-1Rrp and AcPL mRNA expression in NK cells (Fig. 3
). In addition, both cytokines strongly
enhanced IL-12Rß2 mRNA expression, as has previously been shown in T
cells (36). As in T cells (Fig. 1
), MyD88 mRNA expression
was clearly enhanced only by IFN-
(Fig. 3
).
|
and IL-12 at 3 h after stimulation (Fig. 4
-induced IL-1Rrp and AcPL mRNA
levels declined at 12 h after stimulation. In contrast,
IL-12-induced IL-1Rrp and AcPL mRNA levels remained elevated up to
12 h. As in T cells and resting NK cells, IFN-
was a more
potent up-regulator of MyD88 mRNA expression compared with IL-12
(Fig. 4
|
and IL-12 priming enhances IL-18-induced NF-
B DNA
binding
Because IFN-
and IL-12 stimulation of T cells enhanced IL-18R
gene expression (Fig. 1
), we wanted to study whether pretreatment of
cells with IFN-
or IL-12 would result in enhanced IL-18-induced
NF-
B DNA binding activity. Activated T cells were left untreated or
were treated with IFN-
or IL-12 for 16 h followed by
stimulation with IL-18 for 1 h. As previously shown (38, 39), both IFN-
and IL-12 increased background NF-
B
activity. In unprimed cells, 1 ng/ml of IL-18 weakly and 10 ng/ml more
clearly enhanced NF-
B DNA binding (Fig. 5
). In IFN-
- or IL-12-primed T cells,
IL-18-induced (1 or 10 ng/ml) NF-
B DNA binding was enhanced and was
more clearly observed with lower IL-18 doses. The IL-12 priming had a
more pronounced effect on IL-18-induced NF-
B activation compared
with the priming effect of IFN-
. The lower-mobility NF-
B complex
in Fig. 5
supershifted with anti-p50 and anti-p65 Abs (data not
shown), suggesting that it is a heterodimer of p50 and p65 proteins.
The faster-moving IL-18-induced NF-
B complex supershifted with
anti-p50 Abs but not with anti-p65-specific Abs (data not
shown).
|
priming enhances IL-12- plus IL-18-induced IFN-
gene
expression
To study whether increased IL-18 responsiveness in IFN-
-primed
cells correlates with their increased production of IFN-
, we
analyzed IL-12, IL-18, or IL-12 plus IL-18-induced IFN-
mRNA
expression in unprimed or in IFN-
-primed T cells. IL-18 alone did
not result in IFN-
mRNA synthesis in these cells, and IL-12-induced
IFN-
mRNA expression was slightly enhanced in IFN-
-primed cells
compared with unprimed cells (Fig. 6
).
IL-12 plus IL-18-induced IFN-
mRNA levels were clearly higher in
IFN-
-primed T cells compared with unprimed cells (Fig. 6
).
|
It has been previously shown that IL-1Rrp is expressed in murine
Th1, but not in Th2, cells (40). To obtain Th1 and Th2
cells, we cultured purified human peripheral blood T cells in the
presence of IL-12 or IL-4, respectively. To verify that these cells
represent Th1 and Th2 cells, we studied their IFN-
production in
response to anti-CD3 stimulation. IL-12-polarized T cells produced
very high levels of IFN-
compared with IL-4-polarized cells (Fig. 7
). The cells cultured in the presence of
IL-12 expressed high levels of IL-12Rß2 mRNA, which is a selective
marker for Th1 cells (36). As previously shown
(30), three different IL-12Rß2 transcripts were detected
(Fig. 7
). IL-1Rrp and AcPL genes were expressed at high levels in
IL-12-polarized T cells (Fig. 7
). In contrast, T cells cultured in the
presence of IL-4 expressed very low levels of IL-12Rß2, AcPL, and
IL-1Rrp mRNAs. MyD88 was expressed in T cells cultured under Th1- and
Th2-inducing conditions (Fig. 7
A).
|
| Discussion |
|---|
|
|
|---|
is produced by activated NK and T cells and it has a major
role in the activation of cell-mediated immunity. During early phases
of infection, NK cell-derived IFN-
activates macrophages and
promotes Th1 immune response (41, 42). IFN-
production
is induced by TCR stimulation or by macrophage-produced cytokines such
as IFN-
, IL-12, and IL-18. Recent evidence suggests that IFN-
, in
addition to IL-12, is able to directly activate IFN-
gene
transcription (11). In addition, both IFN-
and IL-12
synergize with IL-18 to induce IFN-
(11). Our present
data show that IFN-
can also indirectly enhance IFN-
production
and, consequently, cell-mediated immune response by inducing IL-12R,
IL-18R, and MyD88 expression in NK and T cells.
NK cells represent the first line of defense against viral infections
(42). NK cells kill autologous, virus-infected cells. In
addition, NK cells modulate the adaptive immune response through the
production of cytokines and chemokines (41, 42). In turn,
macrophage-produced cytokines modulate and activate NK cells responses.
IFN-
, IL-12, and IL-18 activate NK cell cytotoxicity and enhance NK
cell IFN-
production. Many viruses induce high levels of IFN-
,
whereas the production of IL-12 may be limited (42). IL-12
production appears to be associated mainly with bacterial infections
(43). IL-18 is produced during bacterial and viral
infections (6, 7, 11, 44, 45), and therefore it is likely
that IL-18 is involved in the activation of innate immunity during both
types of infections. Moreover, NK cell responses are impaired in IL-18
gene knockout mice (46). Therefore, it may be that
IFN-
-induced up-regulation of IL-12R and IL-18R expression in NK
cells contributes to the activation of innate immune response.
As shown in the present report, IFN-
and IL-12 directly induced
IL-1Rrp and AcPL gene expression in NK and T cells. IFN-
and IL-12
signal via the JAK-STAT signal transduction pathway, and these are the
only known cytokines that can activate Stat4 in NK and T cells
(29, 35), suggesting that IL-1Rrp and AcPL are Stat4
target genes. However, further studies are needed to characterize the
regulatory elements of IL-1Rrp and AcPL genes. In contrast to IL-1Rrp
and AcPL, MyD88 gene expression was more efficiently up-regulated by
IFN-
compared with IL-12. MyD88 was primarily described as an
IL-6-responsive myeloid differentiation gene (47). The
mouse MyD88 promoter region contains an IFN-
activation site element
that binds Stat3 in response to IL-6 (48). We have used
the same element as a probe in EMSA and found that in NK and T cells it
binds Stat1 and Stat4 in response to IFN-
and Stat4 in response to
IL-12 (data not shown).
In the present report, we show that IFN-
or IL-12 pretreatment
enhanced IL-18-induced NF-
B activity in activated T cells. In
addition, IL-12 plus IL-18-induced IFN-
gene expression was much
higher in IFN-
-primed T cells compared with the unprimed ones.
Similar results were obtained with NK-92 cells (data not shown). These
results suggest that IFN-
-induced up-regulation of IL-18R expression
sensitizes cells to lower concentrations of IL-18. Resting NK cells,
but not resting T cells, constitutively express IL-1Rrp and AcPL mRNAs
and are hence able to respond to IL-18 (data not shown). Resting T
cells, instead, require TCR or cytokine stimulation before they can
respond to IL-18. Interestingly, IFN-
up-regulated IL-1Rrp and AcPL
gene expression also in resting T cells (Fig. 2
).
Previous studies have shown that IL-12Rß2 mRNA synthesis is restricted to Th1 cells (36). Similarly, Xu and coworkers (40) have shown that IL-1Rrp is selectively expressed in mouse Th1 but not in Th2 cells. In accordance with these results, we found that human PBMC-derived T cells that had been cultured in the presence of IL-12 expressed high levels of IL-1Rrp, AcPL, and IL-12Rß2 mRNAs. In contrast, T cells that had been cultured in the presence of IL-4 expressed low levels of IL-12R and IL-18R mRNAs. These results suggest that IL-1Rrp and AcPL genes are mainly expressed in Th1 cells, and the corresponding proteins may be used as specific markers of Th1 response. In contrast, MyD88 was expressed in both IL-12- and IL-4-treated T cells, suggesting that MyD88 may have important biological functions in both Th1 and Th2 cells.
In conclusion, our results demonstrate that in NK and T cells the
expression of IL-1Rrp, AcPL, and MyD88 genes is strongly up-regulated
by IFN-
and IL-12. In addition, IFN-
and IL-12 up-regulated the
expression of the IL-12Rß2 gene in resting NK cells. These results
suggest that IFN-
and IL-12 enhance innate as well as Th1 immune
response by activating IL-12R, IL-18R, and MyD88 gene expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sampsa Matikainen, Laboratory of Viral and Molecular Immunology, Department of Virology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. ![]()
3 Abbreviations used in this paper: IL-1Rrp, IL-1R-related protein; AcPL, accessory protein-like; TLR, Toll-like receptor; IRAK, IL-1R-associated kinase. ![]()
Received for publication October 28, 1999. Accepted for publication June 6, 2000.
| References |
|---|
|
|
|---|
inducing factor. J. Leukocyte Biol. 63:658.[Abstract]
production by IL-12 and IL-18. Curr. Opin. Immunol. 10:259.[Medline]
interferon production. Infect. Immun. 572:590.
interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63:3966.[Abstract]
production by T cells. Nature 378:88.[Medline]
-inducing factor, expression in Escherichia coli and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-
production. Eur. J. Immunol. 26:1647.[Medline]
-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
production and activates IRAK and NF
B. Immunity 7:571.[Medline]
/ß and IL-18 synergistically enhance IFN-
gene expression in human T cells. J. Immunol. 160:6032.
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
activates multiple STAT proteins and upregulates proliferation-associated IL-2R
, c-myc, and pim-1 genes in human T cells. Blood 93:1980.
production. J. Immunol. 161:3400.
: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
B and primes DC for IL-12 production. Immunity 9:315.[Medline]
B pathway. Eur. Cytokine Netw. 9:308.
). Curr. Opin. Immunol. 9:17.[Medline]
interferon production in human peripheral blood mononuclear cells. Infect. Immun. 66:6058.This article has been cited by other articles:
![]() |
Y. Y. Wan and R. A. Flavell How Diverse--CD4 Effector T Cells and their Functions J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A Hunt and D. A van Heel Recent advances in coeliac disease genetics Gut, April 1, 2009; 58(4): 473 - 476. [Full Text] [PDF] |
||||
![]() |
L. L.E. Koskinen, E. Einarsdottir, E. Dukes, G. A. R. Heap, P. Dubois, I. R. Korponay-Szabo, K. Kaukinen, K. Kurppa, F. Ziberna, S. Vatta, et al. Association study of the IL18RAP locus in three European populations with coeliac disease Hum. Mol. Genet., March 15, 2009; 18(6): 1148 - 1155. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-J. Hong, J. R. Wickstrum, H.-W. Yeh, and M. J. Parmely Toll-Like Receptor 2 Controls the Gamma Interferon Response to Francisella tularensis by Mouse Liver Lymphocytes Infect. Immun., November 1, 2007; 75(11): 5338 - 5345. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Wickstrum, K.-J. Hong, S. Bokhari, N. Reed, N. McWilliams, R. T. Horvat, and M. J. Parmely Coactivating Signals for the Hepatic Lymphocyte Gamma Interferon Response to Francisella tularensis Infect. Immun., March 1, 2007; 75(3): 1335 - 1342. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sato, M. Ohtsuki, M. Hata, E. Kobayashi, and T. Murakami Antitumor Activity of IFN-{lambda} in Murine Tumor Models. J. Immunol., June 15, 2006; 176(12): 7686 - 7694. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Le Bon, V. Durand, E. Kamphuis, C. Thompson, S. Bulfone-Paus, C. Rossmann, U. Kalinke, and D. F. Tough Direct Stimulation of T Cells by Type I IFN Enhances the CD8+ T Cell Response during Cross-Priming. J. Immunol., April 15, 2006; 176(8): 4682 - 4689. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matikainen, J. Siren, J. Tissari, V. Veckman, J. Pirhonen, M. Severa, Q. Sun, R. Lin, S. Meri, G. Uze, et al. Tumor Necrosis Factor Alpha Enhances Influenza A Virus-Induced Expression of Antiviral Cytokines by Activating RIG-I Gene Expression. J. Virol., April 1, 2006; 80(7): 3515 - 3522. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhou, E. Yamaguchi, Y. Fukui, S. Konno, Y. Maeda, K. Kimata, and M. Nishimura Enhanced Expression of Interleukin-18 Receptor α Chain by CD4+ T Cells in Sarcoidosis Chest, October 1, 2005; 128(4): 2497 - 2503. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Breckpot, J. Corthals, A. Bonehill, A. Michiels, S. Tuyaerts, C. Aerts, C. Heirman, and K. Thielemans Dendritic cells differentiated in the presence of IFN-{beta} and IL-3 are potent inducers of an antigen-specific CD8+ T cell response J. Leukoc. Biol., October 1, 2005; 78(4): 898 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Osterlund, V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and I. Julkunen Gene Expression and Antiviral Activity of Alpha/Beta Interferons and Interleukin-29 in Virus-Infected Human Myeloid Dendritic Cells J. Virol., August 1, 2005; 79(15): 9608 - 9617. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rogez-Kreuz, B. Maneglier, M. Martin, N. Dereuddre-Bosquet, J. Martal, D. Dormont, and P. Clayette Involvement of IL-6 in the anti-human immunodeficiency virus activity of IFN-{tau} in human macrophages Int. Immunol., August 1, 2005; 17(8): 1047 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tissari, J. Siren, S. Meri, I. Julkunen, and S. Matikainen IFN-{alpha} Enhances TLR3-Mediated Antiviral Cytokine Expression in Human Endothelial and Epithelial Cells by Up-Regulating TLR3 Expression J. Immunol., April 1, 2005; 174(7): 4289 - 4294. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells J. Immunol., January 1, 2005; 174(1): 99 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strengell, I. Julkunen, and S. Matikainen IFN-{alpha} regulates IL-21 and IL-21R expression in human NK and T cells J. Leukoc. Biol., August 1, 2004; 76(2): 416 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells J. Immunol., June 1, 2004; 172(11): 7002 - 7007. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, H.-C. Hsu, C. R. Stockard, P. Yang, J. Zhou, Q. Wu, W. E. Grizzle, and J. D. Mountz IL-12 Inhibits Thymic Involution by Enhancing IL-7- and IL-2-Induced Thymocyte Proliferation J. Immunol., March 1, 2004; 172(5): 2909 - 2916. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Akazawa, H. Masuda, Y. Saeki, M. Matsumoto, K. Takeda, K. Tsujimura, K. Kuzushima, T. Takahashi, I. Azuma, S. Akira, et al. Adjuvant-Mediated Tumor Regression and Tumor-Specific Cytotoxic Response Are Impaired in MyD88-Deficient Mice Cancer Res., January 15, 2004; 64(2): 757 - 764. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gutzmer, K. Langer, S. Mommert, M. Wittmann, A. Kapp, and T. Werfel Human Dendritic Cells Express the IL-18R and Are Chemoattracted to IL-18 J. Immunol., December 15, 2003; 171(12): 6363 - 6371. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lund, T. Aittokallio, O. Nevalainen, and R. Lahesmaa Identification of Novel Genes Regulated by IL-12, IL-4, or TGF-{beta} during the Early Polarization of CD4+ Lymphocytes J. Immunol., November 15, 2003; 171(10): 5328 - 5336. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Bream, R. E. Curiel, C.-R. Yu, C. E. Egwuagu, M. J. Grusby, T. M. Aune, and H. A. Young IL-4 synergistically enhances both IL-2- and IL-12-induced IFN-{gamma} expression in murine NK cells Blood, July 1, 2003; 102(1): 207 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Witcher, D. T. Ross, C. Rousseau, L. Deluca, and W. H. Miller Jr Synergy between all-trans retinoic acid and tumor necrosis factor pathways in acute leukemia cells Blood, July 1, 2003; 102(1): 237 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Prabhakar, Y. Qiao, Y. Hoshino, M. Weiden, A. Canova, E. Giacomini, E. Coccia, and R. Pine Inhibition of Response to Alpha Interferon by Mycobacterium tuberculosis Infect. Immun., May 1, 2003; 71(5): 2487 - 2497. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Pien, K. B. Nguyen, L. Malmgaard, A. R. Satoskar, and C. A. Biron A Unique Mechanism for Innate Cytokine Promotion of T Cell Responses to Viral Infections J. Immunol., November 15, 2002; 169(10): 5827 - 5837. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strengell, T. Sareneva, D. Foster, I. Julkunen, and S. Matikainen IL-21 Up-Regulates the Expression of Genes Associated with Innate Immunity and Th1 Response J. Immunol., October 1, 2002; 169(7): 3600 - 3605. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Smeltz, J. Chen, R. Ehrhardt, and E. M. Shevach Role of IFN-{gamma} in Th1 Differentiation: IFN-{gamma} Regulates IL-18R{alpha} Expression by Preventing the Negative Effects of IL-4 and by Inducing/Maintaining IL-12 Receptor {beta}2 Expression J. Immunol., June 15, 2002; 168(12): 6165 - 6172. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Trobonjaca, A. Kroger, D. Stober, F. Leithauser, P. Moller, H. Hauser, R. Schirmbeck, and J. Reimann Activating Immunity in the Liver. II. IFN-{beta} Attenuates NK Cell-Dependent Liver Injury Triggered by Liver NKT Cell Activation J. Immunol., April 15, 2002; 168(8): 3763 - 3770. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Brassard, M. J. Grace, and R. W. Bordens Interferon-{alpha} as an immunotherapeutic protein J. Leukoc. Biol., April 1, 2002; 71(4): 565 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
V M Salvati, T T MacDonald, M Bajaj-Elliott, M Borrelli, A Staiano, S Auricchio, R Troncone, and G Monteleone Interleukin 18 and associated markers of T helper cell type 1 activity in coeliac disease Gut, February 1, 2002; 50(2): 186 - 190. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iwasaki, T. Mukai, C. Nakajima, Y.-F. Yang, P. Gao, N. Yamaguchi, M. Tomura, H. Fujiwara, and T. Hamaoka A Mandatory Role for STAT4 in IL-12 Induction of Mouse T Cell CCR5 J. Immunol., December 15, 2001; 167(12): 6877 - 6883. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakahira, M. Tomura, M. Iwasaki, H.-J. Ahn, Y. Bian, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara An Absolute Requirement for STAT4 and a Role for IFN-{gamma} as an Amplifying Factor in IL-12 Induction of the Functional IL-18 Receptor Complex J. Immunol., August 1, 2001; 167(3): 1306 - 1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Smeltz, J. Chen, J. Hu-Li, and E. M. Shevach Regulation of Interleukin (Il)-18 Receptor {alpha} Chain Expression on Cd4+ T Cells during T Helper (Th)1/Th2 Differentiation: Critical Downregulatory Role of IL-4 J. Exp. Med., July 16, 2001; 194(2): 143 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Lee, Y.-S. Cho, M.-C. Cho, J.-H. Shim, K.-A. Lee, K.-K. Ko, Y. K. Choe, S.-N. Park, T. Hoshino, S. Kim, et al. Both E6 and E7 Oncoproteins of Human Papillomavirus 16 Inhibit IL-18-Induced IFN-{{gamma}} Production in Human Peripheral Blood Mononuclear and NK Cells J. Immunol., July 1, 2001; 167(1): 497 - 504. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Giacomini, E. Iona, L. Ferroni, M. Miettinen, L. Fattorini, G. Orefici, I. Julkunen, and E. M. Coccia Infection of Human Macrophages and Dendritic Cells with Mycobacterium tuberculosis Induces a Differential Cytokine Gene Expression That Modulates T Cell Response J. Immunol., June 15, 2001; 166(12): 7033 - 7041. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |