HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sareneva, T. Articles by Matikainen, S. Search for Related Content PubMed PubMed Citation Articles by Sareneva, T. Articles by Matikainen, S.

IFN- and IL-12 Induce IL-18 Receptor Gene Expression in Human NK and T Cells¹

Department of Virology, National Public Health Institute, Helsinki, Finland

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-18 is a proinflammatory cytokine that enhances innate and specific Th1 immune responses. During microbial infections, IL-18 is produced by activated macrophages. IL-18 exerts its effects in synergy with IFN- or IL-12 to induce IFN-. Here we show that in human NK and T cells IFN- and IL-12 strongly up-regulate mRNA expression of the IL-18R components, accessory protein-like (AcPL) and IL-1R-related protein (IL-1Rrp). In addition, IFN- enhanced the expression of MyD88, an adaptor molecule involved in IL-18 signaling. Pretreatment of T cells with IFN- or IL-12 enhanced IL-18-induced NF-B activation and sensitized the cells to respond to lower concentrations of IL-18. AcPL and IL-1Rrp genes were strongly expressed in T cells polarized with IL-12, whereas in IL-4-polarized cells these genes were expressed at very low levels, indicating that AcPL and IL-1Rrp genes are preferentially expressed in Th1 cells. In conclusion, the results suggest that IFN- and IL-12 enhance innate as well as Th1 immune response by inducing IL-18R expression.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Interleukin-18 is a proinflammatory cytokine that is important in NK cell activation and in enhancing Th1 immune response (reviewed in Refs. 1, 2, 3). IL-18 was originally described as a factor inducing IFN- production in the livers of mice stimulated with Propionibacterium acnes and LPS (4, 5). Thereafter, mouse and human IL-18 cDNAs were cloned (6, 7). In synergy with IFN- or IL-12, IL-18 induces IFN- production in T cells and enhances Th1 cell development (6, 7, 8, 9, 10, 11). IL-18 also stimulates IFN- synthesis in NK cells (12), up-regulates perforin-mediated NK cell activity (13), and enhances Fas-Fas ligand-mediated cytotoxicity by inducing Fas ligand expression (12). IL-18 is structurally related to IL-1ß (14). Like IL-1ß, IL-18 is synthesized as a precursor form that requires caspase-1 cleavage to become a biologically active molecule (reviewed in Refs. 1, 2, 3).

At present two subunits of IL-18R, IL-1R-related protein (IL-1Rrp)³ and accessory protein-like (AcPL), have been characterized (15, 16). The role of IL-1Rrp as a functional IL-18R has been verified in gene knockout studies (17). Both IL-18R components belong to the IL-1R family (16, 18), the members of which are homologous to the Toll family proteins. Toll-like receptors (TLRs) are involved in the activation of innate immune responses (reviewed in Refs. 19 and 20). IL-1R, IL-18R, and TLRs signal through the IL-1R-associated kinase (IRAK)-NF-B pathway (10, 21, 22, 23, 24, 25, 26, 27, 28). NF-B activation by these receptors requires the interaction of IRAK with the receptor complex via an adapter protein, MyD88, which also belongs to the IL-1R family (22, 23, 24, 25, 26, 27, 28).

In the present report, we analyze the effect of IFN- and IL-12 on IL-1Rrp, AcPL, and MyD88 gene expression in human NK and T cells. We show that IFN- and IL-12 strongly up-regulate IL-1Rrp and AcPL gene expression, whereas only IFN- effectively enhances MyD88 gene expression. In addition, IL-1Rrp and AcPL transcripts are expressed at high levels in IL-12-polarized but not in IL-4-polarized T cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
NK cell line and cytokines

Human NK-92 cell line was maintained in continuous culture in MEM Alpha Medium (Life Technologies, Grand Island, NY) supplemented with 12% horse serum (Life Technologies), 12% FCS, 0.2 mM i-inositol, 20 mM folic acid, 40 mM 2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml of human rIL-2 (Chiron, Emeryville, CA). Human leukocyte IFN- (13 x 10⁶ IU/ml) was provided by Dr. Hannele Tölö (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland) and used at 100 IU/ml. Human rIL-12 and rIL-4 (R&D Systems, Abingdon, U.K.) were used at 5 ng/ml and 10 ng/ml, respectively. Escherichia coli-produced highly purified human IL-18 (7) was used at 1 or 10 ng/ml.

Purification of T cells from PBMCs and T cell activation

PBMCs were isolated from leukocyte-rich buffy coats obtained from healthy blood donors (Finnish Red Cross Blood Transfusion Service) by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). Monocytes were removed from PBMCs by adherence, and nonadherent T cells were further purified by nylon wool columns. In the experiments where resting T cells were used, NK cells were removed by anti-CD16 Ab treatment and adsorption with immunomagnetic beads. Purified T cells were activated with 0.5 µg/ml plate-bound anti-CD3 mAb (R&D Systems) and cultured in RPMI 1640 medium supplemented with 10% FCS (Integro, Zaandam, The Netherlands), 20 mM HEPES, 2 mM L-glutamine, 0.6 µg/ml penicillin, 60 µg/ml streptomycin) and 100 IU/ml IL-2 for 5–6 days. Cells were further expanded for 3–5 days with RPMI 1640 supplemented with IL-2. As determined by flow cytometry, >99% of the cells were CD3 positive consisting of CD4⁺ (30%) and CD8⁺ (70%) cells. In all experiments, the cells were removed from IL-2-containing medium before cytokine stimulations. In each experiment, T cells from two to four donors were used.

Purification of NK cells from PBMCs

Mononuclear cells were isolated by density gradient centrifugation as above using Ficoll-Paque. NK cells were further purified from nonadherent PBMCs by nylon wool columns and two-step density gradient centrifucation by Percoll (Amersham Pharmacia Biotech), followed by further purification with magnetic beads coated with anti-CD3, anti-CD14, and anti-CD19 Abs (Dynal, Oslo, Norway). As determined by flow cytometry with anti-CD16 or anti-CD56 Abs, NK cells were over 90% pure (data not shown).

In vitro polarization of T cells

Purified T cells were activated with 0.5 µg/ml plate-bound anti-CD3 or anti-CD3 plus anti-CD28 mAbs (R&D Systems) in the presence of IL-2 and IL-12 or IL-4 for 3 days. The cells were further expanded for 4 days in the presence of IL-2 plus IL-12 or IL-4 and used in experiments.

IFN- analysis by ELISA

Supernatants from cytokine-stimulated cells were analyzed for IFN- production by ELISA using a matched Ab pair for IFN- (Diaclone, Besancone, France) according to manufacturer’s recommended procedure. The lower limit of sensitivity in the ELISA was 20 pg/ml, using human rIFN- (Diaclone) as a standard.

RNA isolation and Northern blot analysis

Total cellular RNA was isolated from pooled cell samples as previously described (29). Total cellular RNA was quantified photometrically, and samples containing equal amounts of RNA were size fractionated on a 1.0% formaldehyde-agarose gel, transferred to a nylon membrane (Hybond, Amersham, Buckinghamshire, U.K.), and hybridized with the AcPL (16), IL-12Rß2 (30), or MyD88 (31) probes. IL-1Rrp probe was cloned from total cellular RNA obtained from IL-12-treated T cells by RT-PCR using oligonucleotides TGTGTCGGATCCAGAGTTGACTTGGTT (sense) and TGTTTCGGATCCTTAAGACTCGGAAAG (antisense). Ethidium bromide staining of ribosomal RNA bands was used to ensure equal RNA loading. The probes were labeled with [-³²P]dCTP (3000 Ci/mmol; Amersham) using a random-primed DNA-labeling kit (Boehringer Mannheim, Mannheim, Germany). The membranes were hybridized under conditions of high stringency (50% formamide, 5x Denhardt’s solution, 5x SSC phosphate/EDTA, and 0.5% SDS), washed twice at room temperature and once at 60°C in 1x SSC/0.1% SDS for 30 min each time, and exposed to Kodak AR X-Omat films at -70°C using intensifying screens.

EMSA

Nuclear extracts and nuclear protein/DNA-binding reactions were performed as described previously (32, 33). NF-B oligonucleotides (5'-AGTTGAGGGGACTTTCCCAGCC-3') were synthesized with an Applied Biosystems (Foster City, CA) oligonucleotide synthesizer and purified on PAGE in the presence of 8 M urea. The probes were labeled by T4 polynucleotide kinase. The binding reaction was performed at room temperature for 30 min. The samples were analyzed by elecrophoresis on 6% nondenaturing low-ionic strength polyacrylamide gels in 0.25x TBE buffer. The gels were dried and visualized by autoradiography. Anti-p50 (sc-345X; Santa Cruz Biotechnology, Santa Cruz, CA) and anti-p65 (sc-839X; Santa Cruz Biotechnology) Abs (1:20 dilution) were used in supershift experiments.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
IFN- and IL-12 induce IL-1Rrp, AcPL, and MyD88 gene expression in T cells

Previously, it has been reported that IL-12 enhances IL-1Rrp mRNA expression in B and T cells (34). Because IFN- shares many biological properties with IL-12, such as activation of Stat4 and enhancement of Th1 cell development (29, 35, 36), we wanted to study the effect of IFN- on IL-1Rrp and AcPL gene expression. Activated T cells were stimulated with IFN- or IL-12 for different time periods, after which total cellular RNA was isolated for Northern blot analysis. IFN- and IL-12 strongly enhanced IL-1Rrp and AcPL mRNA expression (Fig. 1). However, there were certain kinetic differences. IFN--induced AcPL mRNA expression was rapid, peaked at 3 h, and declined at 6 h after stimulation. In contrast, IFN--induced IL-1Rrp mRNA levels continued to increase up to 6 h. IL-12-induced IL-1Rrp and AcPL mRNA levels remained elevated up to 6 h. MyD88 mRNA expression was strongly induced by IFN-, whereas only a weak induction was seen by IL-12 (Fig. 1). To analyze whether IFN- is able to induce IL-1Rrp and AcPL mRNA expression in resting T cells, they were incubated with IFN- for different time periods. As shown in Fig. 2, IFN- strongly enhanced IL-1Rrp and AcPL mRNA expression also in resting T cells.

View larger version (78K): [in this window] [in a new window]   FIGURE 1. Induction of IL-1Rrp, AcPL, and MyD88 gene expression by IFN- and IL-12 in T cells. Activated T cells were stimulated with IFN- (100 IU/ml) or IL-12 (5 ng/ml) for the times indicated, the cells were collected, and the total cellular RNA was prepared. RNA samples (20 µg) were size-fractionated on agarose gels, transferred to nylon membranes, and hybridized with AcPL, IL-1Rrp, and MyD88 probes. As a control for RNA loading, ethidium bromide staining of ribosomal RNA bands was used.

View larger version (66K): [in this window] [in a new window]   FIGURE 2. IFN- activates IL-1Rrp and AcPL gene expression in resting T cells. Resting human T cells were stimulated with IFN- (100 IU/ml) for different time periods, and the cells were collected and prepared for RNA analysis by Northern blotting with 32P-labeled AcPL and IL-1Rrp probes.

IFN- and IL-12 induce IL-1Rrp, AcPL, IL-12Rß2, and MyD88 gene expression in NK cells

Because IFN- and IL-12 are important NK cell activators, we studied whether these cytokines are able to up-regulate IL-18R expression also in NK cells. Resting enriched NK cells were stimulated with IFN- or IL-12 for 3 h, and total cellular RNA was isolated and analyzed by Northern blotting. Both IFN- and IL-12 enhanced IL-1Rrp and AcPL mRNA expression in NK cells (Fig. 3). In addition, both cytokines strongly enhanced IL-12Rß2 mRNA expression, as has previously been shown in T cells (36). As in T cells (Fig. 1), MyD88 mRNA expression was clearly enhanced only by IFN- (Fig. 3).

View larger version (27K): [in this window] [in a new window]   FIGURE 3. IFN- and IL-12 induce IL-1Rrp, AcPL, IL-12Rß2, and MyD88 gene expression in resting NK cells. NK cells were incubated with IFN- (100 IU/ml) or IL-12 (5 ng/ml) for 3 h, the cells were collected, total cellular RNA was isolated, and the expression of AcPL, IL-1Rrp, IL-12Rß2, and MyD88 mRNAs was analyzed by Northern blotting. Ethidium bromide-stained gel is shown to verify equal RNA loading.

View larger version (77K): [in this window] [in a new window]   FIGURE 4. Induction of IL-1Rrp, AcPL, and MyD88 gene expression by IFN- and IL-12 in NK-92 cell line. NK-92 cells were stimulated with IFN- (100 IU/ml) or IL-12 (5 ng/ml) for 1, 3, 6, or 12 h, and total cellular RNA was isolated and used in Northern analysis with AcPL, IL-1Rrp, and MyD88 probes.

IFN- and IL-12 priming enhances IL-18-induced NF-B DNA binding

Because IFN- and IL-12 stimulation of T cells enhanced IL-18R gene expression (Fig. 1), we wanted to study whether pretreatment of cells with IFN- or IL-12 would result in enhanced IL-18-induced NF-B DNA binding activity. Activated T cells were left untreated or were treated with IFN- or IL-12 for 16 h followed by stimulation with IL-18 for 1 h. As previously shown (38, 39), both IFN- and IL-12 increased background NF-B activity. In unprimed cells, 1 ng/ml of IL-18 weakly and 10 ng/ml more clearly enhanced NF-B DNA binding (Fig. 5). In IFN-- or IL-12-primed T cells, IL-18-induced (1 or 10 ng/ml) NF-B DNA binding was enhanced and was more clearly observed with lower IL-18 doses. The IL-12 priming had a more pronounced effect on IL-18-induced NF-B activation compared with the priming effect of IFN-. The lower-mobility NF-B complex in Fig. 5 supershifted with anti-p50 and anti-p65 Abs (data not shown), suggesting that it is a heterodimer of p50 and p65 proteins. The faster-moving IL-18-induced NF-B complex supershifted with anti-p50 Abs but not with anti-p65-specific Abs (data not shown).

View larger version (54K): [in this window] [in a new window]   FIGURE 5. IFN- and IL-12 enhance IL-18-induced NF-B DNA binding in T cells. Activated T cells were left untreated or were treated with IFN- (100 IU/ml) or IL-12 (5 ng/ml). At 16-h incubation, the cells were washed, resuspended in fresh medium, and stimulated with 0, 1, or 10 ng/ml of IL-18. After 1 h of stimulation, the cells were collected, and nuclear extracts were prepared and analyzed in EMSA with an NF-B probe.

IFN- priming enhances IL-12- plus IL-18-induced IFN- gene expression

To study whether increased IL-18 responsiveness in IFN--primed cells correlates with their increased production of IFN-, we analyzed IL-12, IL-18, or IL-12 plus IL-18-induced IFN- mRNA expression in unprimed or in IFN--primed T cells. IL-18 alone did not result in IFN- mRNA synthesis in these cells, and IL-12-induced IFN- mRNA expression was slightly enhanced in IFN--primed cells compared with unprimed cells (Fig. 6). IL-12 plus IL-18-induced IFN- mRNA levels were clearly higher in IFN--primed T cells compared with unprimed cells (Fig. 6).

View larger version (54K): [in this window] [in a new window]   FIGURE 6. IFN- priming enhances IL-12 plus IL-18-induced IFN- mRNA expression in T cells. Activated T cells were left untreated or were pretreated with IFN- for 16 h. The cells were washed, resuspended in fresh medium, and further incubated with IL-12 (1 ng/ml), IL-18 (1 ng/ml), or IL-12 plus IL-18. After 3 h, the cells were collected and prepared for RNA analysis by Northern blotting with an IFN- probe.

It has been previously shown that IL-1Rrp is expressed in murine Th1, but not in Th2, cells (40). To obtain Th1 and Th2 cells, we cultured purified human peripheral blood T cells in the presence of IL-12 or IL-4, respectively. To verify that these cells represent Th1 and Th2 cells, we studied their IFN- production in response to anti-CD3 stimulation. IL-12-polarized T cells produced very high levels of IFN- compared with IL-4-polarized cells (Fig. 7). The cells cultured in the presence of IL-12 expressed high levels of IL-12Rß2 mRNA, which is a selective marker for Th1 cells (36). As previously shown (30), three different IL-12Rß2 transcripts were detected (Fig. 7). IL-1Rrp and AcPL genes were expressed at high levels in IL-12-polarized T cells (Fig. 7). In contrast, T cells cultured in the presence of IL-4 expressed very low levels of IL-12Rß2, AcPL, and IL-1Rrp mRNAs. MyD88 was expressed in T cells cultured under Th1- and Th2-inducing conditions (Fig. 7A).

View larger version (21K): [in this window] [in a new window]   FIGURE 7. Selective expression of IL-12R and IL-18R in Th1 cells. Peripheral blood T cells were cultured in the presence of IL-12 or IL-4 as described in Materials and Methods. A, After 7 days, the cells were collected, and total cellular RNA was isolated and prepared for Northern blot analysis with AcPL, IL-1Rrp, IL-12Rß2, and MyD88 probes. B, Cells were restimulated with anti-CD3 Abs for 24 h, and IFN- levels in cell-culture supernatants were determined by ELISA.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

NK cells represent the first line of defense against viral infections (42). NK cells kill autologous, virus-infected cells. In addition, NK cells modulate the adaptive immune response through the production of cytokines and chemokines (41, 42). In turn, macrophage-produced cytokines modulate and activate NK cells responses. IFN-, IL-12, and IL-18 activate NK cell cytotoxicity and enhance NK cell IFN- production. Many viruses induce high levels of IFN-, whereas the production of IL-12 may be limited (42). IL-12 production appears to be associated mainly with bacterial infections (43). IL-18 is produced during bacterial and viral infections (6, 7, 11, 44, 45), and therefore it is likely that IL-18 is involved in the activation of innate immunity during both types of infections. Moreover, NK cell responses are impaired in IL-18 gene knockout mice (46). Therefore, it may be that IFN--induced up-regulation of IL-12R and IL-18R expression in NK cells contributes to the activation of innate immune response.

As shown in the present report, IFN- and IL-12 directly induced IL-1Rrp and AcPL gene expression in NK and T cells. IFN- and IL-12 signal via the JAK-STAT signal transduction pathway, and these are the only known cytokines that can activate Stat4 in NK and T cells (29, 35), suggesting that IL-1Rrp and AcPL are Stat4 target genes. However, further studies are needed to characterize the regulatory elements of IL-1Rrp and AcPL genes. In contrast to IL-1Rrp and AcPL, MyD88 gene expression was more efficiently up-regulated by IFN- compared with IL-12. MyD88 was primarily described as an IL-6-responsive myeloid differentiation gene (47). The mouse MyD88 promoter region contains an IFN- activation site element that binds Stat3 in response to IL-6 (48). We have used the same element as a probe in EMSA and found that in NK and T cells it binds Stat1 and Stat4 in response to IFN- and Stat4 in response to IL-12 (data not shown).

In the present report, we show that IFN- or IL-12 pretreatment enhanced IL-18-induced NF-B activity in activated T cells. In addition, IL-12 plus IL-18-induced IFN- gene expression was much higher in IFN--primed T cells compared with the unprimed ones. Similar results were obtained with NK-92 cells (data not shown). These results suggest that IFN--induced up-regulation of IL-18R expression sensitizes cells to lower concentrations of IL-18. Resting NK cells, but not resting T cells, constitutively express IL-1Rrp and AcPL mRNAs and are hence able to respond to IL-18 (data not shown). Resting T cells, instead, require TCR or cytokine stimulation before they can respond to IL-18. Interestingly, IFN- up-regulated IL-1Rrp and AcPL gene expression also in resting T cells (Fig. 2).

Previous studies have shown that IL-12Rß2 mRNA synthesis is restricted to Th1 cells (36). Similarly, Xu and coworkers (40) have shown that IL-1Rrp is selectively expressed in mouse Th1 but not in Th2 cells. In accordance with these results, we found that human PBMC-derived T cells that had been cultured in the presence of IL-12 expressed high levels of IL-1Rrp, AcPL, and IL-12Rß2 mRNAs. In contrast, T cells that had been cultured in the presence of IL-4 expressed low levels of IL-12R and IL-18R mRNAs. These results suggest that IL-1Rrp and AcPL genes are mainly expressed in Th1 cells, and the corresponding proteins may be used as specific markers of Th1 response. In contrast, MyD88 was expressed in both IL-12- and IL-4-treated T cells, suggesting that MyD88 may have important biological functions in both Th1 and Th2 cells.

In conclusion, our results demonstrate that in NK and T cells the expression of IL-1Rrp, AcPL, and MyD88 genes is strongly up-regulated by IFN- and IL-12. In addition, IFN- and IL-12 up-regulated the expression of the IL-12Rß2 gene in resting NK cells. These results suggest that IFN- and IL-12 enhance innate as well as Th1 immune response by activating IL-12R, IL-18R, and MyD88 gene expression.

	Acknowledgments

 
We thank Dr. John E. Sims (Immunex, Seattle, WA) for providing AcPL and MyD88 cDNAs, Dr. Auli Paananen and Dr. Tuomo Timonen (Haartman Institute, University of Helsinki, Finland) for NK cells, and Valma Mäkinen, Teija Westerlund, and Marika Yliselä for skillful technical assistance.

	Footnotes

 
¹ This work was supported by the Medical Research Council of the Academy of Finland, the Sigrid Juselius Foundation, the Finnish Research and Development Center, and the Finnish Cancer Foundations.

² Address correspondence and reprint requests to Dr. Sampsa Matikainen, Laboratory of Viral and Molecular Immunology, Department of Virology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland.

³ Abbreviations used in this paper: IL-1Rrp, IL-1R-related protein; AcPL, accessory protein-like; TLR, Toll-like receptor; IRAK, IL-1R-associated kinase.

Received for publication October 28, 1999. Accepted for publication June 6, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Kohno, K., M. Kurimoto. 1998. Interleukin 18, a cytokine which resembles IL-1 structurally and IL-12 functionally but exerts its effect independently of both. Clin. Immunol. Immunopathol. 86:11.[Medline]
2. Dinarello, C., D. Novick, A. Puren, G. Fantuzzi, L. Shapiro, H. Muhl, D. Yoon, L. Reznikov, S. Kim, M. Rubinstein. 1998. Overview of interleukin-18: more than an interferon- inducing factor. J. Leukocyte Biol. 63:658.[Abstract]
3. Okamura, H., S. Kashiwamura, H. Tsutsui, T. Yoshimoto, K. Nakanishi. 1998. Regulation of interferon- production by IL-12 and IL-18. Curr. Opin. Immunol. 10:259.[Medline]
4. Nakamura, K., H. Okamura, M. Wada, K. Nagata, T. Tamura. 1989. Endotoxin-induced serum factor that stimulates interferon production. Infect. Immun. 572:590.
5. Okamura, H., K. Nagata, T. Komatsu, T. Tanimoto, Y. Nukata, F. Tanabe, K. Akita, K. Torigoe, T. Okura, S. Fukuda, M. Kurimoto. 1995. A novel costimulatory factor for interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63:3966.[Abstract]
6. Okamura, H., H. Tsutsui, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN- production by T cells. Nature 378:88.[Medline]
7. Ushio, S., M. Namba, T. Okura, K. Hattori, Y. Nukada, K. Akita, F. Tanabe, K. Konishi, M. Micallef, M. Fujii, et al 1996. Cloning of cDNA for human IFN--inducing factor, expression in Escherichia coli and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
8. Micallef, M. J., K. Yoshida, S. Kawai, T. Hanya, K. Kohno, S. Arai, T. Tanimoto, K. Torigoe, M. Fujii, M. Ikeda, M. Kurimoto. 1996. Interferon--inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon- production. Eur. J. Immunol. 26:1647.[Medline]
9. Kohno, K., J. Kataoka, T. Ohtsuki, Y. Suemoto, I. Okamoto, M. Usui, M. Ikeda, M. Kurimoto. 1997. IFN--inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
10. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon- production and activates IRAK and NFB. Immunity 7:571.[Medline]
11. Sareneva, T., S. Matikainen, M. Kurimoto, I. Julkunen. 1998. Influenza A virus-induced IFN-/ß and IL-18 synergistically enhance IFN- gene expression in human T cells. J. Immunol. 160:6032.[Abstract/Free Full Text]
12. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, K. Kaneda. 1996. IFN--inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
13. Hyodo, Y., K. Matsui, N. Hayashi, H. Tsutsui, S. Kashiwamura, H. Yamauchi, K. Hiroishi, K. Takeda, Y. Tagawa, Y. Iwakura, et al 1999. IL-18 up-regulates perforin-mediated NK activity without increasing perforin messenger RNA expression by binding to constitutively expressed IL-18 receptor. J. Immunol. 162:1662.[Abstract/Free Full Text]
14. Bazan, J., J. Timans, R. Kastelein. 1996. A newly defined cytokine receptor superfamily. Nature 379:591.[Medline]
15. Torigoe, K., S. Ushio, T. Okura, S. Kobayashi, M. Taniai, T. Kunikata, T. Murakami, O. Sanou, H. Kojima, M. Fujii, et al 1997. Purification and characterization of the human interleukin-18 receptor. J. Biol. Chem. 272:25737.[Abstract/Free Full Text]
16. Born, T. L., E. Thomassen, T. A. Bird, J. E. Sims. 1998. Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J. Biol. Chem. 273:29445.[Abstract/Free Full Text]
17. Hoshino, K., H. Tsutsui, T. Kawai, K. Takeda, K. Nakanishi, Y. Takeda Y, S. Akira. 1999. Generation of IL-18 receptor-deficient mice: evidence for IL-1 receptor-related protein as an essential IL-18 binding receptor. J. Immunol. 162:5041.[Abstract/Free Full Text]
18. Parnet, P., K. E. Garka, T. P. Bonnert, S. K. Dower, J. E. Sims. 1996. IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J. Biol. Chem. 271:3967.[Abstract/Free Full Text]
19. O’Neill, L. A., C. Greene. 1998. Signal transduction pathways activated by the IL-1 receptor family: ancient signaling machinery in mammals, insects, and plants. J. Leukocyte Biol. 63:650.[Abstract]
20. Kopp, E. B., R. Medzhitov. 1999. The Toll-receptor family and control of innate immunity. Curr. Opin. Immunol. 11:13.[Medline]
21. Medzhitov, R., P. Preston-Hulburt, Jr C. A. Janeway. 1997. A human homologue of the Drosphila Toll protein signals activation of adaptive immunity. Nature 388:394.[Medline]
22. Muzio, M., J. Ni, P. Feng P, and V. M. Dixit. IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278:1612.
23. Wesche, H., W. J. Henzel, W. Shillinglaw, S. Li, Z. Cao. 1997. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7:837.[Medline]
24. Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh, Jr C. A. Janeway. 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell. Biol. 2:253.
25. Burns, K., F. Martinon, C. Esslinger, H. Pahl, P. Schneider, J. L. Bodmer, F. Di Marco, L. French, J. Tschopp. 1998. MyD88, an adapter protein involved in interleukin-1 signaling. J. Biol. Chem. 273:12203.[Abstract/Free Full Text]
26. Thomassen, E., T. A. Bird, B. R. Renshaw, M. K. Kennedy, J. E. Sims. 1998. Binding of interleukin-18 to the interleukin-1 receptor homologous receptor IL-1Rrp1 leads to activation of signaling pathways similar to those used by interleukin-1. J. Interferon Cytokine Res. 12:1077.
27. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi K, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9:143.[Medline]
28. Kanakaraj, P., K. Ngo, Y. Wu, A. Angulo, P. Ghazal, C. A. Harris, J. J. Siekierka, P. A. Peterson, W. P. Fung-Leung. 1999. Defective Interleukin (IL)-18-mediated natural killer and T helper cell type 1 responses in IL-1 receptor-associated kinase (IRAK)-deficient mice. J. Exp. Med. 189:1129.[Abstract/Free Full Text]
29. Matikainen, S., T. Sareneva, T. Ronni, A. Lehtonen, P. Koskinen, I. Julkunen. 1999. Interferon- activates multiple STAT proteins and upregulates proliferation-associated IL-2R, c-myc, and pim-1 genes in human T cells. Blood 93:1980.[Abstract/Free Full Text]
30. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
31. Bonnert, T. P., K. E. Garka, P. Parnet, G. Sonoda, J. R. Testa, J. E. Sims. 1997. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Lett. 402:81.[Medline]
32. Andrews, N. C., D. V. Faller. 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limited numbers of mammalian cells. Nucleic Acids Res. 19:2499.[Free Full Text]
33. Matikainen, S., T. Ronni, M. Hurme, R. Pine, I. Julkunen. 1996. Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells. Blood 88:114.[Abstract/Free Full Text]
34. Yoshimoto, T., K. Takeda, T. Tanaka, K. Ohkusu, S. Kashiwamura, H. Okamura, S. Akira, K. Nakanishi. 1998. IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN- production. J. Immunol. 161:3400.[Abstract/Free Full Text]
35. Cho, S. S., C. M. Bacon, C. Sudarshan, R. C. Rees, D. Finbloom, R. Pine, J. J. O’Shea. 1996. Activation of STAT4 by IL-12 and IFN-: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
36. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
37. Gong, J. H., G. Maki, H. G. Klingemann. 1994. Characterization of a human cell line (NK-92) with phenotypical and functional characteristics of activated natural killer cells. Leukemia 8:652.[Medline]
38. Grohmann, U., M. L. Belladonna, R. Bianchi, C. Orabona, E. Ayroldi, M. C. Fioretti, P. Puccetti. 1998. IL-12 acts directly on DC to promote nuclear localization of NF-B and primes DC for IL-12 production. Immunity 9:315.[Medline]
39. Yang, C., A. Murti, J. Kim, D. Donner, L. Pfeffer. 1998. IFN delivers an anti-apoptotic signal through a novel NF-B pathway. Eur. Cytokine Netw. 9:308.
40. Xu, D., W. L. Chan, B. P. Leung, D. Hunter, K. Schulz, R. W. Carter, I. B. McInnes, J. H. Robinson, F. Y. Liew. 1998. Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J. Exp. Med. 188:1485.[Abstract/Free Full Text]
41. Kos, F. J.. 1998. Regulation of adaptive immunity by natural killer cells. Immunol. Res. 17:303.[Medline]
42. Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, T. P. Salazar-Mather. 1999. Natural killer cells in antiviral defense: function and regulation by innate cytokines. Annu. Rev. Immunol. 17:189.[Medline]
43. Trinchieri, G.. 1997. Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN-). Curr. Opin. Immunol. 9:17.[Medline]
44. Miettinen, M., S. Matikainen, J. Vuopio-Varkila, J. Pirhonen, K. Varkila, M. Kurimoto, I. Julkunen. 1998. Lactobacilli and streptococci induce interleukin-12 (IL-12), IL-18, and interferon production in human peripheral blood mononuclear cells. Infect. Immun. 66:6058.[Abstract/Free Full Text]
45. Pirhonen, J., T. Sareneva, M. Kurimoto, I. Julkunen, S. Matikainen. 1999. Virus infection activates IL-1ß and IL-18 production in human macrophages by a caspase-1-dependent pathway. J. Immunol. 162:7322.[Abstract/Free Full Text]
46. Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, H. Okamura, K. Nakanishi, S. Akira. 1998. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8:383.[Medline]
47. Liebermann, D. A., B. Hoffman. 1998. MyD genes in negative growth control. Oncogene 17:3319.[Medline]
48. Harroch, S., Y. Gothelf, M. Revel, J. Chebath. 1995. 5' upstream sequences of MyD88, an IL-6 primary response gene in M1 cells: detection of functional IRF-1 and Stat factors binding sites. Nucleic Acids Res. 23:3539.[Abstract/Free Full Text]

This article has been cited by other articles:

				K. A Hunt and D. A van Heel Recent advances in coeliac disease genetics Gut, April 1, 2009; 58(4): 473 - 476. [Full Text] [PDF]

				L. L.E. Koskinen, E. Einarsdottir, E. Dukes, G. A. R. Heap, P. Dubois, I. R. Korponay-Szabo, K. Kaukinen, K. Kurppa, F. Ziberna, S. Vatta, et al. Association study of the IL18RAP locus in three European populations with coeliac disease Hum. Mol. Genet., March 15, 2009; 18(6): 1148 - 1155. [Abstract] [Full Text] [PDF]

				K.-J. Hong, J. R. Wickstrum, H.-W. Yeh, and M. J. Parmely Toll-Like Receptor 2 Controls the Gamma Interferon Response to Francisella tularensis by Mouse Liver Lymphocytes Infect. Immun., November 1, 2007; 75(11): 5338 - 5345. [Abstract] [Full Text] [PDF]

				J. R. Wickstrum, K.-J. Hong, S. Bokhari, N. Reed, N. McWilliams, R. T. Horvat, and M. J. Parmely Coactivating Signals for the Hepatic Lymphocyte Gamma Interferon Response to Francisella tularensis Infect. Immun., March 1, 2007; 75(3): 1335 - 1342. [Abstract] [Full Text] [PDF]

				A. Sato, M. Ohtsuki, M. Hata, E. Kobayashi, and T. Murakami Antitumor Activity of IFN-{lambda} in Murine Tumor Models. J. Immunol., June 15, 2006; 176(12): 7686 - 7694. [Abstract] [Full Text] [PDF]

				A. Le Bon, V. Durand, E. Kamphuis, C. Thompson, S. Bulfone-Paus, C. Rossmann, U. Kalinke, and D. F. Tough Direct Stimulation of T Cells by Type I IFN Enhances the CD8+ T Cell Response during Cross-Priming. J. Immunol., April 15, 2006; 176(8): 4682 - 4689. [Abstract] [Full Text] [PDF]

				S. Matikainen, J. Siren, J. Tissari, V. Veckman, J. Pirhonen, M. Severa, Q. Sun, R. Lin, S. Meri, G. Uze, et al. Tumor Necrosis Factor Alpha Enhances Influenza A Virus-Induced Expression of Antiviral Cytokines by Activating RIG-I Gene Expression. J. Virol., April 1, 2006; 80(7): 3515 - 3522. [Abstract] [Full Text] [PDF]

				Y. Zhou, E. Yamaguchi, Y. Fukui, S. Konno, Y. Maeda, K. Kimata, and M. Nishimura Enhanced Expression of Interleukin-18 Receptor α Chain by CD4+ T Cells in Sarcoidosis Chest, October 1, 2005; 128(4): 2497 - 2503. [Abstract] [Full Text] [PDF]

				K. Breckpot, J. Corthals, A. Bonehill, A. Michiels, S. Tuyaerts, C. Aerts, C. Heirman, and K. Thielemans Dendritic cells differentiated in the presence of IFN-{beta} and IL-3 are potent inducers of an antigen-specific CD8+ T cell response J. Leukoc. Biol., October 1, 2005; 78(4): 898 - 908. [Abstract] [Full Text] [PDF]

				P. Osterlund, V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and I. Julkunen Gene Expression and Antiviral Activity of Alpha/Beta Interferons and Interleukin-29 in Virus-Infected Human Myeloid Dendritic Cells J. Virol., August 1, 2005; 79(15): 9608 - 9617. [Abstract] [Full Text] [PDF]

				C. Rogez-Kreuz, B. Maneglier, M. Martin, N. Dereuddre-Bosquet, J. Martal, D. Dormont, and P. Clayette Involvement of IL-6 in the anti-human immunodeficiency virus activity of IFN-{tau} in human macrophages Int. Immunol., August 1, 2005; 17(8): 1047 - 1057. [Abstract] [Full Text] [PDF]

				J. Tissari, J. Siren, S. Meri, I. Julkunen, and S. Matikainen IFN-{alpha} Enhances TLR3-Mediated Antiviral Cytokine Expression in Human Endothelial and Epithelial Cells by Up-Regulating TLR3 Expression J. Immunol., April 1, 2005; 174(7): 4289 - 4294. [Abstract] [Full Text] [PDF]

				N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells J. Immunol., January 1, 2005; 174(1): 99 - 109. [Abstract] [Full Text] [PDF]

				J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364. [Abstract] [Full Text] [PDF]

				M. Strengell, I. Julkunen, and S. Matikainen IFN-{alpha} regulates IL-21 and IL-21R expression in human NK and T cells J. Leukoc. Biol., August 1, 2004; 76(2): 416 - 422. [Abstract] [Full Text] [PDF]

				K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells J. Immunol., June 1, 2004; 172(11): 7002 - 7007. [Abstract] [Full Text] [PDF]

				L. Li, H.-C. Hsu, C. R. Stockard, P. Yang, J. Zhou, Q. Wu, W. E. Grizzle, and J. D. Mountz IL-12 Inhibits Thymic Involution by Enhancing IL-7- and IL-2-Induced Thymocyte Proliferation J. Immunol., March 1, 2004; 172(5): 2909 - 2916. [Abstract] [Full Text] [PDF]

				T. Akazawa, H. Masuda, Y. Saeki, M. Matsumoto, K. Takeda, K. Tsujimura, K. Kuzushima, T. Takahashi, I. Azuma, S. Akira, et al. Adjuvant-Mediated Tumor Regression and Tumor-Specific Cytotoxic Response Are Impaired in MyD88-Deficient Mice Cancer Res., January 15, 2004; 64(2): 757 - 764. [Abstract] [Full Text] [PDF]

				R. Gutzmer, K. Langer, S. Mommert, M. Wittmann, A. Kapp, and T. Werfel Human Dendritic Cells Express the IL-18R and Are Chemoattracted to IL-18 J. Immunol., December 15, 2003; 171(12): 6363 - 6371. [Abstract] [Full Text] [PDF]

				R. Lund, T. Aittokallio, O. Nevalainen, and R. Lahesmaa Identification of Novel Genes Regulated by IL-12, IL-4, or TGF-{beta} during the Early Polarization of CD4+ Lymphocytes J. Immunol., November 15, 2003; 171(10): 5328 - 5336. [Abstract] [Full Text] [PDF]

				J. H. Bream, R. E. Curiel, C.-R. Yu, C. E. Egwuagu, M. J. Grusby, T. M. Aune, and H. A. Young IL-4 synergistically enhances both IL-2- and IL-12-induced IFN-{gamma} expression in murine NK cells Blood, July 1, 2003; 102(1): 207 - 214. [Abstract] [Full Text] [PDF]

				M. Witcher, D. T. Ross, C. Rousseau, L. Deluca, and W. H. Miller Jr Synergy between all-trans retinoic acid and tumor necrosis factor pathways in acute leukemia cells Blood, July 1, 2003; 102(1): 237 - 245. [Abstract] [Full Text] [PDF]

				S. Prabhakar, Y. Qiao, Y. Hoshino, M. Weiden, A. Canova, E. Giacomini, E. Coccia, and R. Pine Inhibition of Response to Alpha Interferon by Mycobacterium tuberculosis Infect. Immun., May 1, 2003; 71(5): 2487 - 2497. [Abstract] [Full Text] [PDF]

				G. C. Pien, K. B. Nguyen, L. Malmgaard, A. R. Satoskar, and C. A. Biron A Unique Mechanism for Innate Cytokine Promotion of T Cell Responses to Viral Infections J. Immunol., November 15, 2002; 169(10): 5827 - 5837. [Abstract] [Full Text] [PDF]

				M. Strengell, T. Sareneva, D. Foster, I. Julkunen, and S. Matikainen IL-21 Up-Regulates the Expression of Genes Associated with Innate Immunity and Th1 Response J. Immunol., October 1, 2002; 169(7): 3600 - 3605. [Abstract] [Full Text] [PDF]

				A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198. [Abstract] [Full Text] [PDF]

				R. B. Smeltz, J. Chen, R. Ehrhardt, and E. M. Shevach Role of IFN-{gamma} in Th1 Differentiation: IFN-{gamma} Regulates IL-18R{alpha} Expression by Preventing the Negative Effects of IL-4 and by Inducing/Maintaining IL-12 Receptor {beta}2 Expression J. Immunol., June 15, 2002; 168(12): 6165 - 6172. [Abstract] [Full Text] [PDF]

				Z. Trobonjaca, A. Kroger, D. Stober, F. Leithauser, P. Moller, H. Hauser, R. Schirmbeck, and J. Reimann Activating Immunity in the Liver. II. IFN-{beta} Attenuates NK Cell-Dependent Liver Injury Triggered by Liver NKT Cell Activation J. Immunol., April 15, 2002; 168(8): 3763 - 3770. [Abstract] [Full Text] [PDF]

				D. L. Brassard, M. J. Grace, and R. W. Bordens Interferon-{alpha} as an immunotherapeutic protein J. Leukoc. Biol., April 1, 2002; 71(4): 565 - 581. [Abstract] [Full Text] [PDF]

				V M Salvati, T T MacDonald, M Bajaj-Elliott, M Borrelli, A Staiano, S Auricchio, R Troncone, and G Monteleone Interleukin 18 and associated markers of T helper cell type 1 activity in coeliac disease Gut, February 1, 2002; 50(2): 186 - 190. [Abstract] [Full Text] [PDF]

				M. Iwasaki, T. Mukai, C. Nakajima, Y.-F. Yang, P. Gao, N. Yamaguchi, M. Tomura, H. Fujiwara, and T. Hamaoka A Mandatory Role for STAT4 in IL-12 Induction of Mouse T Cell CCR5 J. Immunol., December 15, 2001; 167(12): 6877 - 6883. [Abstract] [Full Text] [PDF]

				M. Nakahira, M. Tomura, M. Iwasaki, H.-J. Ahn, Y. Bian, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara An Absolute Requirement for STAT4 and a Role for IFN-{gamma} as an Amplifying Factor in IL-12 Induction of the Functional IL-18 Receptor Complex J. Immunol., August 1, 2001; 167(3): 1306 - 1312. [Abstract] [Full Text] [PDF]

				R. B. Smeltz, J. Chen, J. Hu-Li, and E. M. Shevach Regulation of Interleukin (IL)-18 Receptor {alpha} Chain Expression on CD4+ T Cells during T Helper (Th)1/Th2 Differentiation: Critical Downregulatory Role of IL-4 J. Exp. Med., July 16, 2001; 194(2): 143 - 154. [Abstract] [Full Text] [PDF]

				S.-J. Lee, Y.-S. Cho, M.-C. Cho, J.-H. Shim, K.-A. Lee, K.-K. Ko, Y. K. Choe, S.-N. Park, T. Hoshino, S. Kim, et al. Both E6 and E7 Oncoproteins of Human Papillomavirus 16 Inhibit IL-18-Induced IFN-{{gamma}} Production in Human Peripheral Blood Mononuclear and NK Cells J. Immunol., July 1, 2001; 167(1): 497 - 504. [Abstract] [Full Text] [PDF]

				E. Giacomini, E. Iona, L. Ferroni, M. Miettinen, L. Fattorini, G. Orefici, I. Julkunen, and E. M. Coccia Infection of Human Macrophages and Dendritic Cells with Mycobacterium tuberculosis Induces a Differential Cytokine Gene Expression That Modulates T Cell Response J. Immunol., June 15, 2001; 166(12): 7033 - 7041. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sareneva, T. Articles by Matikainen, S. Search for Related Content PubMed PubMed Citation Articles by Sareneva, T. Articles by Matikainen, S.