The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamauchi, P. S.
Right arrow Articles by Modlin, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamauchi, P. S.
Right arrow Articles by Modlin, R. L.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2000, 165: 1506-1512.
Copyright © 2000 by The American Association of Immunologists

A Role for CD40-CD40 Ligand Interactions in the Generation of Type 1 Cytokine Responses in Human Leprosy1

Paul S. Yamauchi*,{dagger}, Joshua R. Bleharski*,{ddagger}, Koichi Uyemura*,{dagger}, Jenny Kim*,{dagger},{ddagger}, Peter A. Sieling*,{dagger}, Ari Miller*,{dagger}, Hans Brightbill*,{ddagger}, Katia Schlienger*,{dagger}, Thomas H. Rea§ and Robert L. Modlin2,*,{dagger},{ddagger}

* Department of Medicine, {dagger} Division of Dermatology, and {ddagger} Department of Microbiology and Immunology, University of California School of Medicine, Los Angeles, CA 90095; and § Section of Dermatology, University of Southern California School of Medicine, Los Angeles, CA 90033


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The interaction of CD40 ligand (CD40L) expressed by activated T cells with CD40 on macrophages has been shown to be a potent stimulus for the production of IL-12, an obligate signal for generation of Th1 cytokine responses. The expression and interaction of CD40 and CD40L were investigated in human infectious disease using leprosy as a model. CD40 and CD40L mRNA and surface protein expression were predominant in skin lesions of resistant tuberculoid patients compared with the highly susceptible lepromatous group. IL-12 release from PBMC of tuberculoid patients stimulated with Mycobacterium leprae was partially inhibited by mAbs to CD40 or CD40L, correlating with Ag-induced up-regulation of CD40L on T cells. Cognate recognition of M. leprae Ag by a T cell clone derived from a tuberculoid lesion in the context of monocyte APC resulted in CD40L-CD40-dependent production of IL-12. In contrast, M. leprae-induced IL-12 production by PBMC from lepromatous patients was not dependent on CD40L-CD40 ligation, nor was CD40L up-regulated by M. leprae. Furthermore, IL-10, a cytokine predominant in lepromatous lesions, blocked the IFN-{gamma} up-regulation of CD40 on monocytes. These data suggest that T cell activation in situ by M. leprae in tuberculoid leprosy leads to local up-regulation of CD40L, which stimulates CD40-dependent induction of IL-12 in monocytes. The CD40-CD40L interaction, which is not evident in lepromatous leprosy, probably participates in the cell-mediated immune response to microbial pathogens.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Elucidating the pathways that regulate cytokine production remains a central focus toward understanding immune responses in human infectious disease. CD40 is a 50-kDa glycoprotein present on the surface of B cells (1), monocytes (2), dendritic cells (3), eosinophils (4), and endothelial cells (5) and is a member of the TNF receptor superfamily (6, 7). The expression of CD40 on monocytes has been shown to be up-regulated by IFN-{gamma}, GM-CSF, and IL-3 (2). The ligand for CD40 (CD40L)3 is induced on the surface of T cells after activation (8, 9). The importance of CD40-CD40L interactions in humans is underscored by the immunodeficiency disorder, X-linked hyper-IgM syndrome, which is characterized by a defect in the CD40L gene (10, 11, 12, 13).

Increasing evidence has supported the idea that CD40-CD40L interactions are critical for T cell-dependent activation of monocytes. Ligation of CD40 stimulates macrophages to produce a variety of cytokines, including IL-12 (2, 14, 15, 16, 17). CD40-CD40L interactions are required for conferring protective cell-mediated immunity (CMI) in a mouse model of Leishmania major infection, by activation of macrophages to a leishmaniacidal state and inducing IL-12 production (18, 19). IL-12 is a key regulator of Th1 cytokine responses (20, 21) in vitro as well as in mouse models of infection (22, 23, 24, 25, 26). The action of IL-12 is mediated through an IL-12R composed of ß1 and ß2 subunits; the latter is selectively expressed primarily on type 1 cytokine-producing T cells (27, 28, 29, 30). Furthermore, patients with mutations in their IL-12R have increased susceptibility to mycobacterial infection (31, 32).

In the present study we investigated the role of CD40-CD40L interactions in generating IL-12 production in human infectious disease. We studied leprosy because the disease serves as an excellent model for investigating the regulation of cytokine production in the host response against invading pathogens. Leprosy presents as a clinical spectrum that correlates with the nature of the immune response against the causative agent, Mycobacterium leprae (33). At one end of the spectrum, patients with tuberculoid leprosy are able to contain and control the pathogen correlating with the manifestation of strong CMI to M. leprae, including the local production of type 1 cytokines (34, 35). At the other end of the spectrum, patients with lepromatous leprosy are unable to localize the infection and manifest disseminated disease in which the type 2 cytokine profile predominates, and diminished CMI is observed.

These divergent cytokine patterns are regulated in part by the local production of IL-12, which is present in 10-fold greater levels in lesions from tuberculoid than in those from lepromatous patients (36). IL-12 can contribute to host resistance in human infectious disease by inducing the selective expansion of type 1 cytokine-producing T cells. In turn, several factors contribute to the regulation of IL-12 production. One determinant of IL-12 production is IFN-{gamma}, which in leprosy patients up-regulates IL-12 production and down-regulates the inhibitory cytokine, IL-10 (37).

The present study was devised to address the role of the CD40-CD40L pathway in generating IL-12 production in human infectious disease, using leprosy as a model. We present evidence that the level of CD40 and CD40L expression in leprosy correlates with CMI to the pathogen. In particular, CD40-CD40L interactions contribute to CMI responses in the tuberculoid form of leprosy by inducing IL-12 production in monocytes. We also show that such interactions are not evident in lepromatous leprosy patients.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Patients

Patients diagnosed with leprosy were evaluated at the Los Angeles County/University of Southern California Medical Center Hansen’s Disease Clinic and were classified according to the criteria of Ridley and Jopling (33). After receiving informed consent, peripheral blood was collected in heparinized tubes from patients with tuberculoid and lepromatous leprosy. Skin biopsies from leprosy patients were also obtained, embedded in OCT medium (Miles, Elkhart, IN), snap-frozen in liquid nitrogen, and stored at -70°C.

M. leprae

M. leprae was provided by Dr. Patrick Brennan (Colorado State University, Ft. Collins, CO) and prepared by probe sonication. The M. leprae 10-kDa protein was prepared by Dr. Vijay Mehra (Albert Einstein College of Medicine, New York, NY) as previously described (38). The level of endotoxin contaminating the M. leprae was measured quantitatively with a Limulus amebocyte lysate assay (Whittaker M.A. Bioproducts, Walkersville, MD) and was less than 1.0 endotoxin units/mg M. leprae sonicate.

Polymerase chain reaction

Total RNA from skin biopsy specimens or PBMC was isolated after lysing samples in guanidinium isothiocyanate buffer as previously described (39), and cDNA was synthesized with reverse transcriptase (Life Technologies, Gaithersburg, MD) and stored at -20°C until further use.

cDNA samples were amplified in a DNA thermocycler for 35 cycles, with each cycle consisting of denaturation at 95°C for 20 s and annealing/extension at 65°C for 45 s. The details of the PCR to verify the linearity of the appropriate controls employed have been previously described (40, 41). Each PCR mixture contained 2.5 mM MgCl2, 0.2 mM dNTP, 25 pM 5'- and 3'-oligonucleotide primers, and 2.5 U of Taq polymerase. The sequences of the primer pairs, 5' and 3', were as follows: CD40, GTCTCACAGCTTGTCCAAGGGTG and TGCTGACCGCTGATCCAGAACCA; CD40L, GCCACTGGACTGCCCATCAGCATG and CTGGCCTCACTTATGACATGTGCCGC in skin lesion biopsies, and TGAAAAAGGATACTACACCATGAGC and GGATCAGGCACATTGACAAACAAC for Ag-stimulated PBMC. For comparison of CD40 or CD40L mRNA, cDNA concentrations were normalized to yield equivalent ß-actin PCR products, as previously outlined (40, 41).

To verify CD40 or CD40L mRNA, PCR products were transferred to Hybond-N nylon membranes (Amersham, Piscataway, NJ) as previously described (40, 41) and probed with a labeled oligonucleotide complementary to sequences internal to the sequences recognized by the PCR amplification primers. Sequences of the oligonucleotide probes were as follows: CD40, GCACCTCAGAAACAGACACCATCT; and CD40L, AGCCAGTTTGAAGGCTTTGTGAAGGA.

Immunohistochemistry

CD40 and CD40L protein expression in leprosy skin lesions was determined by immunoperoxidase labeling of cryostat sections of biopsy samples by mouse anti-CD40 (5C3, IgG1 isotype; PharMingen, San Diego, CA) or rat anti-CD40L (5C8, IgG2a isotype, American Type Culture Collection, Manassas, VA) mAbs. Isotype-matched control mAbs were used for negative controls. Tissue sections (3 to 5 µm) were fixed in acetone and blocked with normal horse serum before undergoing incubations with primary mAb (1/200 dilution) for 30 min followed by biotinylated horse anti-mouse IgG for 30 min. Slides were washed with PBS between incubations. Primary Ab was visualized by using the ABC Elite system (Vector, Burlingame, CA). Slides were counterstained with hematoxylin and mounted in aqueous dry mounting medium. For detection of CD40L, an amplification step was performed with repeated incubation steps with biotinylated horse anti-mouse IgG and streptavidin/biotin-conjugated peroxidase (42).

IL-12 production

PBMC from leprosy patients were isolated on Ficoll-Hypaque gradients (Pharmacia LKB Biotechnology, Piscataway, NJ) and were cultured in 48-well plates at 5 x 105 cells/ml with M. leprae sonicate at 37°C in a CO2 incubator in RPMI 1640 and 10% heat-inactivated FBS. Supernatants were harvested 24 h later, and p40 IL-12 release was measured by ELISA. Adherent monocytes were obtained by culturing PBMC in 48-well plates (1 x 106/well) in the presence of 10% FCS for 2 h at 37°C, followed by removal of nonadherent cells through two washes with medium.

THP-1 cells (American Type Culture Collection; 2 x 105 cells/ml) were primed with IFN-{gamma} (100 U/ml; Endogen, Cambridge, MA) for 12 h in T-75 flasks at 37°C in a CO2 incubator with RPMI 1640 and 10% heat-inactivated FBS. A T cell line (D103-5) derived from a tuberculoid lesion and specific for the 10-kDa peptide in M. leprae sonicate was used as previously described (43). This T cell line was restricted by HLA-DR5*0101 and hence was MHC class II compatible with THP-1 cells. The F103-5 cells (1 x 105 cells/ml) were cocultured with either unprimed or IFN-{gamma}-primed cells THP-1 cells (5 x 105 cells/ml) and 10-kDa Ag at 5 µg/ml in 48-well plates at 37°C in a CO2 incubator with RPMI 1640 and 10% heat-inactivated FBS. Supernatants were harvested 24 h later, and p40 IL-12 release was measured by ELISA. IL-12 production in THP-1 cells was also measured by culturing 293 cells transfected with CD40L (293-CD40L; provided by Dr. Seth Lederman, Columbia University, New York, NY) at a 10:1 concentration ratio with unprimed or IFN-{gamma}-primed THP-1 (5 x 105 cells/ml). 293 cells transfected with CD8 (293-CD8; gift from Dr. Seth Lederman) were used as negative controls. CD40L trimer was obtained from Immunex (Seattle, WA).

For blocking CD40-CD40L interactions, neutralizing mouse mAbs, anti-CD40 (M3, IgG1 isotype, Genzyme, Cambridge, MA) or anti-CD40L (5C8) at 10 µg/ml, were added to some cultures. Isotype-matched mAbs (10 µg/ml) were used as controls.

Ninety-six-well ELISA plates (Corning Glass Works, Corning, NY) were coated overnight at 4°C with 100 µl of rat anti-human p40 IL-12 (mAb 2-4A1; 2.5 µg/ml; gift from Dr. Maurice Gately, Hoffmann-La Roche, Nutley, NJ). Plates were blocked with 200 µl of 1% BSA and 0.05% Tween-20 in PBS for 2 h at room temperature. One hundred-microliter aliquots of each sample or p40 standards (gift from Dr. Maurice Gately) were then added to each well and incubated at room temperature for 2 h. Peroxidase-conjugated anti-IL-12 mAb (POD-4D6; 179 ng/ml; gift from Dr. Maurice Gately) was added to each well and incubated for 1 h. Peroxidase substrate solution (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was used to detect IL-12 p40, and the plates were read in a 7520 microplate reader (Cambridge Technology, Cambridge, MA) at a wavelength of 405 nm.

Flow cytometry

Cells were recovered, washed twice in PBS, and resuspended in FACS buffer containing PBS with 2% FCS and 0.1% sodium azide. mAb to CD40 (G28–5, IgG1 isotype, provided by Dr. Andrew Saxon, University of California, Los Angeles, CA) or CD40L (5C8) or isotype-matched control was added at a final concentration of 10 µg/ml to the cells and incubated at 4°C for 30 min. The cells were washed twice with FACS buffer and incubated with goat anti-mouse IgG-FITC F(ab')2 (Caltag, Burlingame, CA) for 30 min at 4°C. After further washing, the cells were fixed in 1% paraformaldehyde, and flow cytometric analysis was performed using a FACScan (Becton Dickinson, Mountain View, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
CD40 and CD40L mRNA in lesions

We investigated the roles of CD40 and CD40L in the human immune response to infection by evaluating the mRNA expression in skin lesions of patients with tuberculoid and lepromatous leprosy. RNA was extracted from skin biopsy specimens, and complementary cDNA was synthesized. PCR was performed on the cDNA using oligonucleotide-specific primers, and the products for each sample were normalized to yield equivalent amounts of ß-actin PCR product as a measure of total cellular RNA.

Both CD40 and CD40L mRNA were prominently expressed in tuberculoid skin lesions compared with lepromatous lesions (Fig. 1Go). CD40 mRNA was detected in 10 of 10 lesions from tuberculoid leprosy patients, but, in contrast, two lepromatous patients exhibited weak CD40 expression, and one lepromatous patient showed moderate CD40 expression. Similarly, CD40L mRNA was expressed in 9 of 10 tuberculoid lesions and 0 of 10 lepromatous lesions. These data indicate that the level of CD40 and CD40L expression in leprosy correlates with the degree of CMI to the pathogen.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 1. CD40 and CD40L mRNA in leprosy lesions. The cDNA derived from the skin lesions of 10 tuberculoid and 10 lepromatous patients were normalized to yield equivalent ß-actin PCR products.

 
Surface expression of CD40 and CD40L in lesions

We next determined whether cell surface expression of CD40 and CD40L paralleled the mRNA levels in the two patient populations. Surface expression in skin lesions was measured by immunoperoxidase staining of frozen sections from patients with tuberculoid or lepromatous leprosy (n = 5 in each group). Immunohistologic analysis revealed strongly positive cells labeled with mAbs directed against CD40 or CD40L in the tuberculoid granulomas from all five patients. Representative examples are shown in Fig. 2Go, A and B. CD40 expression was detected on large ovoid cells, consistent with cells of the monocyte lineage (Fig. 2GoA). CD40L was detected on small round cells, consistent with lymphocytes (Fig. 2GoB). Staining with an isotype-matched control Ab to anti-CD40 or anti-CD40L was negative (data not shown).



View larger version (124K):
[in this window]
[in a new window]
  		FIGURE 2. CD40 and CD40L protein expression in leprosy skin lesions. Representative staining patterns for CD40 (A and C) and CD40L (B and D) of tuberculoid (A and B) and lepromatous (C and D) granulomas. Thin (3 µM) sections of leprosy biopsy samples were incubated with either anti-CD40 or anti-CD40L and stained secondarily with an immunoperoxidase system followed by counterstaining with hematoxylin. The isotype controls were negative. The findings shown are representative of five patients in each group.

 
In contrast to the strong staining in tuberculoid granulomas, CD40- or CD40L-positive cells were absent or rare in the granulomas of all the lepromatous patients (Fig. 2Go, C and D). In both sets of lesions, a small percentage of the keratinocytes in the basal layer of the epidermis stained weakly positive for CD40, in agreement with previous reports (44, 45). In summary, the high levels of CD40 and CD40L mRNA expression in tuberculoid lesions correlate with their surface expression in the granulomas.

Up-regulation of CD40L mRNA by M. leprae

To understand the disparate expression of CD40L in leprosy lesions, we determined whether M. leprae could up-regulate mRNA expression of CD40L on PBMC from leprosy patients. PBMC from tuberculoid and lepromatous groups were stimulated with M. leprae for 24 h, and mRNA was extracted, followed by cDNA synthesis and normalization to the ß-actin PCR product. PCR analysis was performed using CD40L oligonucleotide-specific primers. Three patients from each group were examined. Fig. 3Go shows that although unstimulated PBMC from both groups of patients exhibited weak CD40L mRNA expression, M. leprae strongly up-regulated mRNA expression in the PBMC in all three tuberculoid patients. In contrast, there was no significant induction of CD40L mRNA expression in the three lepromatous patients. In addition, the degree of cell proliferation correlated with the up-regulation of CD40L mRNA expression. Ag-stimulated PBMC from tuberculoid patients exhibited high proliferation, while lepromatous patients displayed low proliferation. These results indicate that mononuclear cells in the blood of tuberculoid patients can be activated by M. leprae to induce CD40L expression, while mononuclear cells from lepromatous patients were unable to up-regulate CD40L. Therefore, the induction of CD40L by M. leprae is a correlate of CMI in leprosy.



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 3. M. leprae-induced up-regulation of CD40L mRNA in PBMC from tuberculoid and lepromatous patients. PBMC (5 x 105/ml) from tuberculoid (T; n = 3) and lepromatous (L; n = 3) patients were stimulated with (+) or without (-) 10 µg/ml M. leprae for 24 h. The isolated cDNA was normalized to ß-actin, and PCR analysis was performed on CD40L oligonucleotide-specific primers.

 
Regulation of CD40 expression on monocytes

Previous work had demonstrated that type 1 cytokines such as IFN-{gamma} up-regulate the surface expression of CD40 on monocytes (2) as well as keratinocytes (44, 45), endothelial cells (5), and eosinophils (4). In addition, IL-10 was shown to down-regulate CD40 mRNA synthesis in eosinophils (4). Because Th1 cytokines such as IFN-{gamma} are prominent in tuberculoid lesions, and Th2 cytokines such as IL-10 are predominant in lepromatous lesions (34, 35), it was of interest to ascertain whether CD40 expression was regulated by the Th1/Th2 response pattern evident in such patients.

We used flow cytometry to quantify CD40 surface expression on monocytes in response to IFN-{gamma} and IL-10. The up-regulation of CD40 by IFN-{gamma} (10 U/ml) during a 24-h incubation was inhibited to baseline levels in the presence of IL-10 (100 U/ml; data not shown). The lowest concentration of IFN-{gamma} was used in these experiments to give maximal induction of CD40 on monocytes. Thus, CD40 expression in leprosy lesions is probably regulated by the local cytokine pattern, in particular the predominance of type 1 and type 2 cytokines.

Role of CD40-CD40L interactions in IL-12 production

Previous investigations demonstrated that M. leprae stimulates the release of IL-12 from monocytes from both tuberculoid and lepromatous patients (36, 46). IL-12 production has been shown to occur through at least three distinct pathways: 1) a CD14-dependent pathway involving stimulation by microbial lipids (47), 2) binding of microbial lipoproteins through Toll-like receptors (48), or 3) through ligation of CD40 by CD40L (14, 15, 16, 17, 47). We asked whether the M. leprae-induced IL-12 production in leprosy was dependent on CD40-CD40L interaction. To accomplish this, blocking mAbs directed toward human CD40 and CD40L were employed, and IL-12 release was measured by ELISA from supernatants of PBMC stimulated with M. leprae after 24-h incubation.

M. leprae stimulated IL-12 release in PBMC from both groups of patients. However, blocking CD40-CD40L interactions with mAbs partially inhibited (~35%) IL-12 production only in PBMC from tuberculoid patients, but not in those from lepromatous patients (Fig. 4Go, upper panel). These results were consistent for every patient tested in each group (n = 4 per group). PBMC from normal donors also released IL-12 when stimulated with M. leprae, but similar to the lepromatous group, neither anti-CD40 nor anti-CD40L inhibited IL-12 production (data not shown). Isotype-matched control Abs showed no effect on IL-12 production. IL-12 was not detected in medium control cultures.



View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of blocking CD40-CD40L interactions on M. leprae-induced IL-12 production in PBMC and monocytes from tuberculoid and lepromatous patients. PBMC (5 x 105/ml) or adherent monocytes (obtained from 1 x 106/ml PBMC) from tuberculoid and lepromatous patients were stimulated with 10 µg/ml M. leprae sonicate in the absence or the presence of neutralizing Abs directed against CD40 or CD40L or isotype-matched control. Cell-free supernatants were collected after 24-h incubation at 37°C and assayed for IL-12 p40 release by ELISA. Upper panel, PBMC; lower panel, monocytes. The figures shown here are representative of four patients in each group.

 
When adherent monocytes lacking T cells were isolated from PBMC of the same sets of patients and were stimulated with M. leprae, IL-12 production was again observed. However, in these experiments, blocking CD40-CD40L interactions showed no demonstrable inhibition in either the lepromatous or the tuberculoid group (Fig. 4Go, lower panel). Similar results were obtained using adherent monocytes from normal donors (data not shown).

We then sought to determine whether soluble CD40L trimer could directly induce IL-12 production in adherent monocytes from both sets of leprosy patients. Fig. 5Go shows that soluble CD40L trimer was a potent stimulator of IL-12 production in both tuberculoid and lepromatous monocytes, and that the levels of IL-12 were nearly similar in both patient groups.



View larger version (9K):
[in this window]
[in a new window]
  		FIGURE 5. Soluble CD40L trimer induction of IL-12 in monocytes. Adherent monocytes (obtained from 1 x 106/ml PBMC) from tuberculoid and lepromatous patients were primed with IFN-{gamma} (100 U/ml) for 24 h and stimulated with soluble CD40L trimer (1 µg/ml). Supernatants were collected at 24 h, and IL-12 p40 was measured by ELISA.

 
At least two possibilities could explain the presence of CD40-CD40L-dependent production of IL-12 in tuberculoid, but not lepromatous, patients. First, the expression of CD40 could be greater on monocytes from tuberculoid than on those from lepromatous patients. Yet, as mentioned, the IFN-{gamma}-induced expression of CD40 on lepromatous monocytes was similar to that on tuberculoid donors. Secondly, soluble CD40L trimer induced nearly equivalent IL-12 production in tuberculoid vs lepromatous patients. In addition, there was no difference in the level of expression of CD40 on the surface of monocytes from tuberculoid and lepromatous patients, determined by flow cytometric analysis (data not shown). A second explanation for the presence of CD40-CD40L-dependent production of IL-12 in tuberculoid, but not lepromatous, donors could be the T cell repertoire. T cells are responsive to M. leprae in tuberculoid, but not lepromatous, patients (Fig. 3Go); hence, M. leprae-induced up-regulation of CD40L on T cells from tuberculoid patients could lead to CD40 triggering and IL-12 release.

Our next goal was to determine whether T cells, when activated by M. leprae Ags, could stimulate IL-12 production in APC by CD40-CD40L-dependent mechanisms and thereby contribute to CMI by amplifying a type 1 cytokine response. We used a T cell line (D103-5) derived from a granulomatous skin lesion of a patient with tuberculoid leprosy that specifically recognizes a 15-mer epitope of the M. leprae 10-kDa protein in the context of HLA-DR5*0101 (43). Because we wanted to use a pure population of monocytes in these experiments, we chose to use the monocytic cell line, THP-1, as APC. This was possible, since THP-1 cells are MHC class II compatible with the D103-5 T cells.

We first determined whether the CD40 signal was a sufficient component for IL-12 production in THP-1 cells. Control experiments using 293 kidney epithelial cells transfected with CD40L were able to directly drive IL-12 production in THP-1 cells, and this effect was abolished by blocking with anti-CD40 and CD40L (data not shown). This was also confirmed using soluble CD40L trimer, which induced IL-12 production in THP-1 cells (data not shown).

When the D103-5 T cell line was cocultured with THP-1 cells in the presence of M. leprae 10-kDa Ag, CD40L was up-regulated as measured by FACS analysis (Fig. 6GoA). Under these same conditions, high levels of IL-12 were produced, which could be inhibited by anti-CD40 or anti-CD40L (Fig. 6GoB). Furthermore, as a correlate, blocking anti-MHC II Abs were able to inhibit IL-12 production in monocytes (Fig. 6GoB), suggesting that Ag presentation and hence cognate T cell interactions with monocytes were required for IL-12 induction. In these experiments we used a level of M. leprae 10-kDa Ag that induced negligible levels of IL-12 from THP-1 cells in the absence of the T cell line. Somewhat higher amounts of IL-12 were released when THP-1 cells were primed with IFN-{gamma} for 24 h to up-regulate CD40 and then washed thoroughly with medium before coculture with the T cells and M. leprae (Fig. 6GoB). This suggested that the level of IL-12 was dependent on the degree of expression of CD40 on the surface of the monocytes.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 6. A, Flow cytometric analysis of CD40L surface expression on a T cell clone specific for the 10-kDa epitope in M. leprae during Ag presentation. The T cell clone, D103-5 (1 x 105 cells/ml), was cocultured with the 10-kDa Ag (the cognate Ag for D103-5 at 5 µg/ml) and THP-1 cells (2 x 105 cells/ml). The cells were harvested after 24-h incubation, and CD40L expression was measured on gated lymphocytes. Left panel, Unstimulated T cells; right panel, T cells stimulated with THP-1 and 10-kDa Ag. Filled histogram, Staining with control Ab alone; solid lines, staining with CD40L. No CD40L expression was detected on THP-1 cells. B, T cell dependent IL-12 production by the human monocytic cell line, THP-1, is mediated by CD40-CD40L interaction. THP-1 cells (2 x 105 cells/ml) were cultured with the T cell clone, D103-5 (1 x 105 cells/ml), and the 10-kDa Ag (the cognate Ag for the T cells at 5 µg/ml). Supernatants were collected at 24 h, and IL-12 p40 was measured by ELISA. Neutralizing Abs were added to evaluate the role of CD40-CD40L interactions in the production of IL-12 from monocytes. {square}, Unprimed THP-1 cells; {blacksquare}, THP-1 cells primed with IFN-{gamma} (100 U/ml) for 24 h before coculture.

 
These sets of experiments suggest that the activation of T cells in situ by M. leprae in tuberculoid lesions leads to local expression of CD40L, which becomes a potent stimulus for CD40-mediated IL-12 induction in monocytes and may play a contributing role in the CMI response to microbial pathogens.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Delineation of cytokine induction pathways that participate in cell-mediated immune responses is essential for understanding the mechanism of host defense against invading pathogens. For many intracellular pathogens, the generation of IL-12 is an obligate signal for the development of a Th1 response required to contain the infection. We investigated CD40-CD40L interactions in human infectious disease, given that CD40 activation is a powerful pathway for IL-12 production in monocytes (14, 15, 16, 17, 47). CD40-CD40L interactions were studied in leprosy, a disease that presents as a spectrum of clinical manifestations that correlate with the degree of CMI to M. leprae. We provide evidence that local expression and interaction of CD40-CD40L contribute to the production of IL-12. Furthermore, activation of the CD40-CD40L pathway is dependent on the local immunologic environment, including the degree of Ag reactivity in the local T cell repertoire as well as the local cytokine pattern.

IL-12, a key monocyte cytokine for enhancing Th1 responses, is predominantly found in tuberculoid leprosy lesions, but is noticeably absent in lepromatous lesions and is therefore thought to play a role in determining the outcome of the T cell cytokine response to the pathogen (36). Previous studies indicate that M. leprae is a powerful inducer of IL-12 release from monocytes (36, 46), yet the mechanism of induction is not defined. Here we measured M. leprae-induced IL-12 release, examining the role of CD40-CD40L. In tuberculoid patients the ability of M. leprae to induce IL-12 release in PBMC was partially dependent on CD40-CD40L interaction, whereas in lepromatous patients IL-12 production was independent of CD40 and CD40L. These data are consistent with the requirement for up-regulation of CD40L on activated T cells and suggest that CD40-CD40L interactions could be one mechanism responsible for the pattern of IL-12 production in tuberculoid leprosy lesions.

To provide further evidence that M. leprae-induced T cell activation could result in CD40-CD40L interaction and the production of IL-12, we developed an in vitro model employing a T cell clone (D103-5) derived from a tuberculoid lesion that recognizes a defined epitope of the M. leprae 10-kDa Ag presented by MHC class II molecules present on the THP-1 monocyte cell line. Ag presentation induced the up-regulation of CD40L on the T cell clone. In addition, Ag activation of this T cell clone induced IFN-{gamma} production (43), thus leading to up-regulation of CD40 on monocytes. The simultaneous up-regulation of CD40L and CD40 led to the production of IL-12, which was completely dependent on CD40-CD40L interaction and did not occur in the absence of Ag stimulation. In this manner, the interaction of M. leprae-specific Th1 lymphocytes with monocytes in tuberculoid lesions could lead to the production of IL-12 by activating the CD40-CD40L pathway.

Consistent with this hypothesis, our data indicate that the local expression of CD40 and CD40L in leprosy lesions correlates with the expression of IL-12 and the presence of type 1 cytokine responses. As determined by PCR and immunohistochemical analysis, CD40 and CD40L were more strongly expressed in the granulomatous lesions of the relatively resistant tuberculoid patients compared with those lesions from the more susceptible lepromatous patients. We hypothesize that these striking differences in expression relate to the local cytokine environment as well as the level of T cell responsiveness to the pathogen. Both IFN-{gamma} and GM-CSF, cytokines that up-regulate CD40 on the surface of monocytes (2), are preferentially expressed in tuberculoid lesions (34). The low expression of CD40 in lepromatous leprosy is not due to an intrinsic defect in the monocyte’s capacity to express or up-regulate CD40, since the data indicate that monocytes from both tuberculoid as well as lepromatous patients are able to increase the surface expression of CD40 when stimulated with IFN-{gamma}. Our results point to the high levels of IL-10 in lepromatous lesions (34, 40), since we found that IL-10 inhibits the IFN-{gamma} induction of CD40 on monocytes. Therefore, it is likely that the level of CD40 expression in lesions is due to the local cytokine environment, the relative balance of stimulatory type 1 cytokines such as IFN-{gamma} and GM-CSF, and the level of the inhibitory type 2 cytokine IL-10.

The high expression of CD40L in tuberculoid lesions is consistent with the observation that M. leprae strongly enhanced CD40L mRNA expression in peripheral blood T cells from tuberculoid patients. However, when peripheral blood T cells from lepromatous subjects were challenged with the same Ag, little up-regulation of CD40L mRNA expression was seen. Taken together, these data correlate the expression of CD40L in both lesions and peripheral T cells in the context of T cell responsiveness to M. leprae.

In contrast, a recent report demonstrated that CD40L knockout mice were capable of developing CMI and resistance to Mycobacterium tuberculosis of CD40-CD40L interactions (48). The T cells in these mice were able to proliferate and generate high levels of IFN-{gamma} despite the lack of CD40L when exposed to Ags derived from either pathogen. Furthermore, stimulation of monocytes with the pathogen induced the production of high levels of IL-12 independent of CD40 ligation. The results of these studies differ from those of our study, perhaps reflecting differences in the species of mycobacteria or the different courses of mycobacterial and fungal disease in mice and humans.

Finally, recent studies have demonstrated that mycobacterial lipoproteins in infectious diseases are potent stimulators of cellular activation and the production of IL-12 production by human macrophages, and that such induction is mediated through Toll-like receptors (49, 50). We have shown that the production of IL-12 in tuberculoid leprosy is mediated in part through CD40-CD40L interactions. The relative contribution of IL-12 induction by M. leprae through Toll-like receptors, however, remains to be investigated.

In our investigation the identification of CD40-CD40L interactions as contributing to the production of IL-12 in leprosy provides another pathway in CMI responses against intracellular pathogens. Engagement of the CD40-CD40L pathway is dependent on the local cytokine pattern to up-regulate CD40 and the immunologic responsiveness of the T cell repertoire, which determined the level of CD40L expression. These studies provide a new impetus to develop strategies to facilitate CD40-CD40L interaction to enhance cell-mediated immunity in human infectious disease.


   Acknowledgments
 
We thank Varianny Hartono, Wendy Wong, Tom Hoang, and Annaliza Legaspi for excellent technical assistance, and Drs. Genghong Cheng and Phillip Morrissey for helpful discussions.


   Footnotes
 
1 This work was supported in part by grants from the National Institutes of Health (AI22553, AR40312), the United Nations Development Programme/World Bank/World Health Organization Special Program for Research and Training in Tropical Diseases, and the Dermatology Foundation of California, Inc. Back

2 Address correspondence and reprint requests to Dr. Robert L. Modlin, University of California Division of Dermatology, 52-121 CHS, 10833 Le Conte Avenue, Los Angeles, CA 90095. Back

3 Abbreviations used in this paper: CD40L, CD40 ligand; CMI, cell-mediated immunity. Back

Received for publication February 16, 2000. Accepted for publication May 16, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Clark, E. A., J. A. Ledbetter. 1986. Activation of human B cells mediated through two distinct cell surface differentiation antigens, Bp35 and Bp50. Proc. Natl. Acad. Sci. USA 83:4494.[Abstract/Free Full Text]
  2. Alderson, M. R., R. J. Armitage, T. W. Tough, L. Strockbine, W. C. Fanslow, M. K. Spriggs. 1993. CD40 expression by human monocytes: regulation by cytokines and activation of monocytes by the ligand for CD40. J. Exp. Med. 178:669.[Abstract/Free Full Text]
  3. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, C. Van Kooten, I. Durand, J. Banchereau. 1994. Activation of human dendritic cells through CD40 cross-linking. J. Exp. Med. 180:1263.[Abstract/Free Full Text]
  4. Ohkawara, Y., K. G. Lim, Z. Xing, M. Glibetic, K. Nakano, J. Dolovich, K. Croitoru, P. F. Weller, M. Jordana. 1996. CD40 expression by human peripheral blood eosinophils. J. Clin. Invest. 97:1761.[Medline]
  5. Karmann, K., C. C. Hughes, J. Schechner, W. C. Fanslow, J. S. Pober. 1995. CD40 on human endothelial cells: inducibility by cytokines and functional regulation of adhesion expression. Proc. Natl. Acad. Sci. USA 92:4342.[Abstract/Free Full Text]
  6. Schall, T. J., M. Lewis, K. J. Koller, A. Lee, G. C. Rice, G. H. Wong, T. Gatanaga, G. A. Granger, R. Lentz, H. Raab. 1990. Molecular cloning and expression of a receptor for human tumor necrosis factor. Cell 61:361.[Medline]
  7. Smith, C. A., T. Davis, D. Anderson, L. Solam, M. P. Beckmann, R. Jerzy, S. K. Dower, D. Cosman, R. G. Goodwin. 1990. A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248:1019.[Abstract/Free Full Text]
  8. Lederman, S., M. J. Yellin, A. Krichevsky, J. Belko, J. J. Lee, L. Chess. 1992. Identification of a novel surface protein on activated CD4+ T cells that induces contact-dependent B cell differentiation (help). J. Exp. Med. 175:1091.[Abstract/Free Full Text]
  9. Noelle, R. J., M. Roy, D. M. Shepherd, I. Stamenkovic, J. A. Ledbetter, A. Aruffo. 1992. A 39-kDa protein on activated helper T cells binds CD40 and transduces the signal for cognate activation of B cells. Proc. Natl. Acad. Sci. USA 89:6550.[Abstract/Free Full Text]
  10. Allen, R. C., R. J. Armitage, M. E. Conley, H. Rosenblatt, N. A. Jenkins, N. G. Copeland, M. A. Bedell, S. Edelhoff, C. M. Disteche, D. K. Simoneaux. 1993. CD40 ligand gene defects responsible for X-linked hyper-IgM syndrome. Science 259:990.[Abstract]
  11. Aruffo, A., M. Farrington, D. Hollenbaugh, X. Li, A. Milatovich, S. Nonoyama, J. Bajorath, L.S. Grosmaire, R. Stenkamp, M. Neubauer. 1993. The CD40 ligand, gp39, is defective in activated T cells from patients with X-linked hyper-IgM syndrome. Cell 72:291.[Medline]
  12. DiSanto, J. P., J. Y. Bonnefoy, J. F. Gauchat, A. Fischer, G. de Saint Basile. 1993. CD40 ligand mutations in x-linked immunodeficiency with hyper-IgM. Nature 361:541.[Medline]
  13. Korthauer, U., D. Graf, H. W. Mages, F. Briere, M. Padayachee, S. Malcolm, A. G. Ugazio, L. D. Notarangelo, R. J. Levinsky, R. A. Kroczek. 1993. Defective expression of T cell CD40 ligand causes X-linked immunodeficiency with hyper-IgM. Nature 361:539.[Medline]
  14. Shu, U., M. Kiniwa, C. Y. Wu, C. Maliszewski, N. Vezzio, J. Hakimi, M. Gately, G. Delespesse. 1995. Activated T cells induce interleukin-12 production by monocytes via CD40-CD40 ligand interaction. Eur.J. Immunol. 25:1125.[Medline]
  15. Kiener, P. A., P. Moran-Davis, B. M. Rankin, A. F. Wahl, A. Aruffo, D. Hollenbaugh. 1995. Stimulation of CD40 with purified soluble gp39 induces proinflammatory responses in human monocytes. J. Immunol. 155:4917.[Abstract]
  16. Kennedy, M. K., K. S. Pichia, W. C. Fanstow, K. H. Grabstein, M. R. Alderson, K. N. Clifford, W. A. Chin, K. M. Mohler. 1996. CD40/CD40 ligand interactions are required for T cell-dependent production of interleukin-12 by mouse macrophages. Eur. J. Immunol. 26:370.[Medline]
  17. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.[Abstract/Free Full Text]
  18. Soong, L., J. C. Xu, I. S. Grewal, P. Kima, J. Sun, B. J. J. Longley, N. H. Ruddle, D. McMahon-Pratt, R. A. Flavell. 1996. Disruption of CD40-CD40 ligand interactions results in an enhanced susceptibility to Leishmania amazonensis infection. Immunity 4:263.[Medline]
  19. Kamanaka, M., P. Yu, T. Yasui, K. Yoshida, T. Kawabe, T. Horii, T. Kishimoto, H. Kikutani. 1996. Protective role of CD40 in Leishmania major infection at two distinct phases of cell-mediated immunity. Immunity 4:275.[Medline]
  20. Gately, M. K., B. B. Desai, A. G. Wolitsky, P. M. Quinn, C. M. Dwyer, F. J. Podlaski, P. C. Familletti, F. Sinigaglia, R. Chizzonite, U. Gubler, et al 1991. Regulation of human lymphocyte proliferation by a heterodimeric cytokine, IL-12 (cytotoxic lymphocyte maturation factor). J. Immunol. 147:874.[Abstract]
  21. Scharton, T. M., P. Scott. 1993. Natural killer cells are a source of interferon {gamma} that drives differentiation of CD4+ T cell subsets and induces early resistance to Leishmania major in mice. J. Exp. Med. 178:567.[Abstract/Free Full Text]
  22. Heinzel, F. P., D. S. Schoenhaut, R. M. Rerko, L. E. Rosser, M. K. Gately. 1993. Recombinant interleukin 12 cures mice infected with Leishmania major. J. Exp. Med. 177:1505.[Abstract/Free Full Text]
  23. Sypek, J. P., C. L. Chung, S. E. H. Mayor, J. M. Subramanyam, S. J. Goldman, D. S. Sieburth, S. F. Wolf, R. G. Schaub. 1993. Resolution of cutaneous leishmaniasis: interleukin 12 initiates a protective T helper type 1 response. J. Exp. Med. 177:1797.[Abstract/Free Full Text]
  24. Afonso, L. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, G. Trinchieri, P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235.[Abstract/Free Full Text]
  25. Flynn, J. L., M. M. Goldstein, K. J. Triebold, J. Sypek, S. Wolf, B. R. Bloom. 1995. IL-12 increases resistance of BALB/c mice to Mycobacterium tuberculosis infection. J. Immunol. 155:2515.[Abstract]
  26. Cooper, A. M., A. D. Roberts, E. R. Rhoades, J. E. Callahan, D. M. Getzy, I. M. Orme. 1995. The role of interleukin-12 in acquired immunity to Mycobacterium tuberculosis infection. Immunology 84:423.[Medline]
  27. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  28. Wu, C., R. R. Warrier, X. Wang, D. H. Presky, M. K. Gately. 1997. Regulation of interleukin-12 receptor ß1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells. Eur. J. Immunol. 27:147.[Medline]
  29. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  30. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  31. Altare, F., A. Durandy, D. Lammas, J. F. Emile, S. Lamhamedi, F. Le Deist, P. Drysdale, E. Jouanguy, R. Doffinger, F. Bernaudin, et al 1998. Impairment of mycobacterial immunity in human interleukin-12 receptor deficiency. Science 280:1432.[Abstract/Free Full Text]
  32. de Jong, R., F. Altare, I.-A. Haagen, D. G. Elferink, T. de Boer, P. J. C. van Breda Vriesman, P. J. Kabel, J. M. T. Craaisma, J. T. van Dissel, F. P. Kroon, et al 1998. Severe mycobacterial and salmonella infections in interleukin-12 receptor-deficient patients. Science 280:1435.[Abstract/Free Full Text]
  33. Ridley, D. S., W. H. Jopling. 1966. Classification of leprosy according to immunity: a five-group system. Int. J. Lepr. 34:255.
  34. Yamamura, M., K. Uyemura, R. J. Deans, K. Weinberg, T. H. Rea, B. R. Bloom, R. L. Modlin. 1991. Defining protective responses to pathogens: cytokine profiles in leprosy lesions. Science 254:277.[Abstract/Free Full Text]
  35. Salgame, P., J. S. Abrams, C. Clayberger, H. Goldstein, J. Convit, R. L. Modlin, B. R. Bloom. 1991. Differing lymphokine profiles of functional subsets of human CD4 and CD8 T cell clones. Science 254:279.[Abstract/Free Full Text]
  36. Sieling, P. A., X.-H. Wang, M. K. Gately, J. L. Oliveros, T. McHugh, P. F. Barnes, S. F. Wolf, L. Golkar, M. Yamamura, Y. Yogi, et al 1994. IL-12 regulates T helper type 1 cytokine responses in human infectious disease. J. Immunol. 153:3639.[Abstract]
  37. Kubin, M., J. M. Chow, G. Trinchieri. 1994. Differential regulation of interleukin-12 (IL-12), tumor necrosis factor {alpha}, and IL-1ß production in human myeloid leukemia cell lines and peripheral blood mononuclear cells. Blood 83:1847.[Abstract/Free Full Text]
  38. Mehra, V., B. R. Bloom, A. C. Bajardi, C. L. Grisso, P. A. Sieling, D. Alland, J. Convit, X. D. Fan, S. W. Hunter, P. J. Brennan, et al 1992. A major T cell antigen of Mycobacterium leprae is a 10-kD heat-shock cognate protein. J. Exp. Med. 175:275.[Abstract/Free Full Text]
  39. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  40. Yamamura, M., X.-H. Wang, J. D. Ohmen, K. Uyemura, T. H. Rea, B. R. Bloom, R. L. Modlin. 1992. Cytokine patterns of immunologically mediated tissue damage. J. Immunol. 149:1470.[Abstract]
  41. Yamamura, M., R. L. Modlin, R. L. Moy. 1993. Local expression of anti-inflammatory cytokines in cancer. J. Clin. Invest. 91:1005.
  42. Vyth-Dreese, F. A., T. A. Dellemijn, D. Majoor, D. de Jong. 1995. Localization in situ of the co-stimulatory molecules B7.1, B7.2, CD40 and their ligands in normal human lymphoid tissue. Eur. J. Immunol. 25:3023.[Medline]
  43. Kim, J., A. Sette, S. Rodda, S. Southwood, P. A. Sieling, V. Mehra, J. D. Ohmen, J. L. Oliveros, E. Appella, Y. Higashimoto, et al 1997. Determinants of T cell reactivity to the Mycobacterium leprae GroES homologue. J. Immunol. 159:335.[Abstract]
  44. Peguet-Navarro, J., C. Dalbiez-Gauthier, C. Moulon, O. Berthier, A. Reano, M. Gaucherand, J. Banchereau, F. Rousset, D. Schmitt. 1997. CD40 ligation of human keratinocytes inhibits their proliferation and induces their differentiation. J. Immunol. 158:144.[Abstract]
  45. Denfeld, R. W., D. Hollenbaugh, A. Fehrenbach, J. M. Weiss, A. von Leoprechting, B. Mai, U. Voith, E. Schopf, A. Aruffo, J. C. Simon. 1996. CD40 is functionally expressed on human keratinocytes. Eur. J. Immunol. 26:2329.[Medline]
  46. Libraty, D. H., L. E. Airan, K. Uyemura, D. Jullien, B. Spellberg, T. H. Rea, R. L. Modlin. 1997. Interferon-{gamma} differentially regulates interleukin-12 and interleukin-10 production in leprosy. J. Clin. Invest. 99:336.[Medline]
  47. DeKruyff, R. H., R. S. Gieni, D. T. Umetsu. 1997. Antigen-driven but not lipopolysaccharide-driven IL-12 production in macrophages requires triggering of CD40. J. Immunol. 158:359.[Abstract]
  48. Campos-Neto, A., P. Ovendale, T. Bement, T. A. Koppi, W. C. Fanslow, M. A. Rossi, M. R. Alderson. 1998. CD40 ligand is not essential for the development of cell-mediated immunity and resistance to Mycobacterium tuberculosis. J. Immunol. 160:2037.[Abstract/Free Full Text]
  49. Means, T. K., E. Lien, A. Yoshimura, S. Wang, D. T. Golenbock, M. J. Fenton. 1999. The CD14 ligands lipoarabinomannan and lipopolysaccharide differ in their requirement for Toll-like receptors. J. Immunol. 163:6748.[Abstract/Free Full Text]
  50. Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R. B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al 1999. Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science 285:732.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
L. Barrett, C. Dai, J. Gamberg, M. Gallant, and M. Grant
Circulating CD14-CD36+ peripheral blood mononuclear cells constitutively produce interleukin-10
J. Leukoc. Biol., July 1, 2007; 82(1): 152 - 160.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. P. Hewitson, G. R. Jenkins, P. A. Hamblin, and A. P. Mountford
CD40/CD154 Interactions Are Required for the Optimal Maturation of Skin-Derived APCs and the Induction of Helminth-Specific IFN-{gamma} but Not IL-4.
J. Immunol., September 1, 2006; 177(5): 3209 - 3217.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
Q. Zhou, R. A. Gault, T. R. Kozel, and W. J. Murphy
Immunomodulation with CD40 Stimulation and Interleukin-2 Protects Mice from Disseminated Cryptococcosis
Infect. Immun., April 1, 2006; 74(4): 2161 - 2168.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Q. Li, A. C. Grover, E. J. Donald, A. Carr, J. Yu, J. Whitfield, M. Nelson, N. Takeshita, and A. E. Chang
Simultaneous Targeting of CD3 on T Cells and CD40 on B or Dendritic Cells Augments the Antitumor Reactivity of Tumor-Primed Lymph Node Cells
J. Immunol., August 1, 2005; 175(3): 1424 - 1432.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
P. T. King, P. E. Hutchinson, P. D. Johnson, P. W. Holmes, N. J. Freezer, and S. R. Holdsworth
Adaptive Immunity to Nontypeable Haemophilus influenzae
Am. J. Respir. Crit. Care Med., February 15, 2003; 167(4): 587 - 592.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
K. Hashimoto, Y. Maeda, H. Kimura, K. Suzuki, A. Masuda, M. Matsuoka, and M. Makino
Mycobacterium leprae Infection in Monocyte-Derived Dendritic Cells and Its Influence on Antigen-Presenting Function
Infect. Immun., September 1, 2002; 70(9): 5167 - 5176.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
A. R. Companjen, L. I. v. d. Wel, L. Boon, E. P. Prens, and J. D. Laman
CD40 ligation-induced cytokine production in human skin explants is partly mediated via IL-1
Int. Immunol., June 1, 2002; 14(6): 669 - 676.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
U. Schonbeck and P. Libby
CD40 Signaling and Plaque Instability
Circ. Res., December 7, 2001; 89(12): 1092 - 1103.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Kim, K. Uyemura, M. K. Van Dyke, A. J. Legaspi, T. H. Rea, K. Shuai, and R. L. Modlin
A Role for IL-12 Receptor Expression and Signal Transduction in Host Defense in Leprosy
J. Immunol., July 15, 2001; 167(2): 779 - 786.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
L. H. Hogan, W. Markofski, A. Bock, B. Barger, J. D. Morrissey, and M. Sandor
Mycobacterium bovis BCG-Induced Granuloma Formation Depends on Gamma Interferon and CD40 Ligand but Does Not Require CD28
Infect. Immun., April 1, 2001; 69(4): 2596 - 2603.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamauchi, P. S.
Right arrow Articles by Modlin, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamauchi, P. S.
Right arrow Articles by Modlin, R. L.
Right arrowPubmed/NCBI databases
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS