|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Medicine and Gwen Knapp Center for Lupus and Immunology Research, Committee on Immunology, University of Chicago, Chicago, IL 60637
| Abstract |
|---|
|
|
|---|
D) and DBA donors into C3H recipients (D
C), as well
as DBA sham chimeric mice (D
D) were resistant to the development of
experimental Lyme arthritis as measured by ankle swelling and arthritis
severity scores. Only the C3H sham chimeric mice (C
C) developed
severe arthritis. These results indicate that independent and
nonoverlapping mechanisms exist in hemopoietic and nonhemopoietic
cellular compartments that can provide protection against arthritic
pathology. | Introduction |
|---|
|
|
|---|
10% will have
chronic arthritis, which is refractive to treatment even after the
apparent eradication of the spirochete from the joint (4, 6). The development of treatment-resistant chronic Lyme
arthritis has been correlated with the presence of HLA-DR4 and thus may
have an autoimmune component (7). In support of this, T
cells responsive to the outer surface protein A
(OspA)3 of B.
burgdorferi have been shown to cross-react with LFA
(8). Other possible T cell epitopes and molecular mimics
have also been recently described in chronic Lyme disease
(9).
Infection of inbred strains of mice with the spirochete B.
burgdorferi recapitulates a portion of the disease spectrum seen
in humans with Lyme disease (10). Susceptible mouse
strains generally develop acute arthritis during the second week of
infection, involving the joints, tendon sheaths, and bursae. The
arthritis peaks during the third or fourth week of infection and then
undergoes immune-mediated resolution. Arthritis resolution correlates
with Ab-mediated clearance of the spirochetes and B cell activation
(11, 12). Although there is a decrease in the level of
pathology with B. burgdorferi-specific Ab responses, sterile
immunity is never achieved (13). Th cell subset phenotypes
have been shown to correlate with arthritis development. In vivo
modulation of IL-4 or IFN-
responses, however, tends to alter only
the degree of disease severity, rather than bring about a complete
reversal of disease phenotype (14, 15, 16). Recently, we have
shown that there is no absolute requirement for the presence of IL-4 or
IFN-
for arthritis resistance or susceptibility, respectively
(17).
The genetic control of development of experimental Lyme arthritis has been linked to both cells of the innate (18) and adaptive (11, 14, 15) immune response. We recently demonstrated that mice made immunodeficient through the targeted disruption of their recombinase genes (RAG-/-) and which therefore have no T or B cells retained the arthritis phenotype of their wild-type counterparts (18). Arthritis-resistant DBA and C57BL/6J mice retained a resistant phenotype, and arthritis-susceptible C3H and BALB/cJ mice retained a susceptible phenotype, even when made immunodeficient by homozygous disruption of their RAGs. To determine whether the genetic control of resistance and susceptibility was mediated by cells of hemopoietic or nonhemopoietic origin, we created radiation bone marrow (BM) chimeras between arthritis-resistant DBA and arthritis-susceptible C3H mice.
| Materials and Methods |
|---|
|
|
|---|
Female DBA/2J and C3H/HeJ mice between 3 and 4 wk of age were
purchased from The Jackson Laboratory (Bar Harbor, ME) and housed in
microisolator cages. At least 1 wk before irradiation and BM transfer,
the mice were given acidified water ad libitum. On the day of the BM
transfer the mice were switched to trimethoprim-sulfamethoxazole in the
water. Mice were given lethal total body irradiation (9501000 rad)
from a 137Cs source. Four hours later they were
reconstituted with syngeneic or allogeneic BM cells (1 x
107) that had been harvested from the femurs of
age-matched mice. Experimental transfers were as follows: C3H donors
into C3H recipients (C
C), C3H donors into DBA recipients (C
D),
DBA donors into DBA recipients (D
D), and DBA donors into C3H
recipients (D
C). In some experiments the BM was depleted of T cells
by treatment with anti-Thy1 mAb (PharMingen, San Diego, CA)
followed by complement lysis (Cedar Lane, Westbury, NY). Animals were
allowed to reconstitute for
45 days. Before use in experiments all
mice were bled from the retro-orbital plexus, and the erythrocytes were
removed by hypotonic lysis. PBLs were analyzed by FACScan (Becton
Dickinson, Mountain View, CA) for the expression of
H-2Kk or H-2Kd class I
molecules to assess the degree of chimerism. Only healthy mice with no
obvious signs of graft-vs-host disease were used in experiments. At the
time of sacrifice, spleens were harvested and processed into a
single-cell suspension. Erythrocytes were removed by ammonium chloride
lysis, and the remaining cells were tested by immunofluorescent
staining for H-2Kk (AF3-12.1),
H-2Kd (SF1-1.1), pan NK cells (DX5; all from
PharMingen), and MAC-1 (M1/70.15), B220 (RA3-6B2), CD3 (500-A2), CD4
(CT-CD4), and CD8 (CT-CD8a; all from Caltag, Burlingame, CA). Cells
were then analyzed by FACS.
Bacteria and infections
The N40 strain of B. burgdorferi (gift from Steven Barthold, University of California, Davis, CA) was grown from a low passage frozen aliquot in 7 ml of BSK-H medium (Sigma, St. Louis, MO) for 5 days at 32°C. Before injection B. burgdorferi numbers were determined by darkfield microscopy using a Petroff-Hauser counter. The mice were inoculated in both hind footpads with 5 x 105 B. burgdorferi organisms in 50 µl of BSK-H medium. Arthritis development was monitored by weekly measurements through the thickest anteroposterior portion of the tibiotarsal joint using a metric caliper (Ralmikes Tool-A-Rama, South Plainfield, NJ). Mice were sacrificed on day 28 following infection. Blood, heart, spleen, urinary bladder, skin (ear punch), and left ankles were aseptically collected and cultured at 32°C for 14 days in BSK-H medium. Cultures were scored for the presence of spirochetes by placing 10 µl of supernatant on a microscope slide under a 22 x 22-mm coverslip and examining 20 high powered fields by dark-field microscopy.
Histologic assessment of arthritis severity
Histologic analysis were performed on the right tibiotarsal joint from each mouse following their sacrifice 28 days postinfection. The joints were fixed in 10% buffered formalin and embedded in paraffin, and 5-µm sections stained with hematoxylin and eosin. The sections were evaluated in a blinded manner and assessed for arthritis severity on a scale of 03 (19). A score of 0 represents normal tissue, 3 represents severe arthritis, and 1 and 2 indicate mild and moderate inflammation, respectively. The pathology present in histologic sections was characterized by edema; neutrophil and monocyte infiltration into the joints, tendons, and ligament sheaths; hypertrophy and hyperplasia of the synovium; and fibrin exudates. The basis for the arthritis severity scores was the extent of the observed inflammatory changes.
PCR analysis
To extract DNA from ankles, samples were first incubated in 0.5 ml of 1% collagenase overnight at 37°C. Ankle tissue was then digested by incubation in 0.25 ml of 3x SDS-Tris lysis buffer (0.3 mg/ml proteinase K in 600 mM NaCl, 20 mM Tris-HCl (pH 8.0), 150 mM EDTA, and 0.6% SDS) for 16 h at 55°C. Hearts and ear punches were digested in 1x SDS-Tris lysis buffer only. DNA was extracted using phenol/chloroform and was precipitated with ethanol. The sample DNA was resuspended in 200 µl of Tris-EDTA buffer. DNA from uninfected mice was tested as a negative control. For each PCR run a standard curve was set up consisting of mouse DNA spiked with known numbers of spirochetes. Each PCR reaction contained 10 ng of control or sample DNA. The presence of B. burgdorferi ospA in sample DNA was detected using the following primers: ospA 5' primer, TCTTGAAGGAACTTTAACTGCTG; and ospA 3' primer, CAAGTTTTGTAATTTCAACTGCTGA. PCR reactions were denatured for 60 s at 94°C followed by 35 cycles of denaturation at 94°C for 50 s, annealing at 60°C for 30 s, and extension at 72°C for 60 s. Amplified products were visualized on a 2.5% agarose gel, and the data were stored as a computer file. The bands were then integrated using National Institutes of Health Image 1.61 software. Quantitative levels of Borrelia DNA within each sample was determined comparing the integration levels to those of the standard curve.
ELISA for Borrelia-specific IgG
Mice were bled from the retro-orbital plexus, and the serum was collected and stored at 4°C until analyzed. Briefly, 96-well Immulon plates were coated with 40 µl of sonicated B. burgdorferi Ag (30 µg/ml) overnight at 4°C. The wells were then blocked with 3% BSA in PBS for 2 h at room temperature. Dilutions of mouse serum (1/100 in 3% BSA) were added to wells in triplicate and incubated for 2 h at room temperature. Samples were then incubated with alkaline phosphatase-conjugated rat anti-mouse Abs to IgG1, IgG2a, IgG2b, IgG3 (all from PharMingen), or IgG (heavy and light; Jackson ImmunoResearch Laboratories, West Grove, PA) diluted 1/1000 in 3% BSA in PBS and incubated at room temperature for 45 min. Plates were developed with Sigma 104 reagent (Sigma) and read at 405 nm on a spectrophotometer.
Statistics
Data were analyzed by Students t test for single
comparisons or Tukeys test for multiple comparisons. Critical values
for statistical significance were set at
= 0.05.
| Results |
|---|
|
|
|---|
To determine whether the genetic control of arthritis development
was mediated by cells of hemopoietic or nonhemopoietic origin, we
created radiation BM chimeric mice from arthritis-resistant DBA and
arthritis-susceptible C3H mice. For proper interpretation of results of
experiments using these chimeric mice we must establish their
reconstitution by donor cells and the ability of these cells to
function in their new environment. To test for the repopulation of
chimeric mice by donor BM cells, we stained spleen cells for MHC (C3H
H-2Kk; DBA H-2Kd) and cell
surface markers for specific cell types and analyzed them by FACS. Fig. 1
shows FACS plots from representative
mice from each group for one of three experiments. There was good
reconstitution of BM-derived cells regardless of whether they were from
syngeneic or allogeneic donors. There was little evidence of
graft-vs-host disease even though we did not deplete T cells from the
BM in each experiment. Any animal that displayed signs of graft-vs-host
disease, such as weight loss or skin lesions, was excluded from the
study. The mice used in experiments appeared healthy at both the time
of infection and the time of sacrifice. Fig. 1
A shows the
MHC haplotype of spleen cells from the control sham chimeric and
chimeric mice. Spleen cells from the C
C and C
D mice show only
cells of the H-2Kk C3H donor haplotype, and the
D
D and D
C mice show only cells of the H-2Kd
haplotype. This indicates repopulation of hemopoietic cells from the BM
donors only. We also checked for repopulation of specific cell types:
NK cells (Fig. 1
B), macrophages (Fig. 1
C), B
cells (Fig. 1
D), and T cells (Fig. 1
E). Fig. 1
F shows the ratio of CD4+ to
CD8+ cells, demonstrating normal percentages of
these cell populations. These results indicate proper reconstitution of
BM of lethally irradiated mice with hemopoietic cells from donor
origin.
|
After
45 days of BM reconstitution the mice were infected in
both hind footpads with 5 x 105 B.
burgdorferi of the N40 strain. The mice were injected in the hind
footpads to deliver the spirochetes to a site just adjacent to the
joint of interest. This obviates the need for the spirochetes to
disseminate and traverse to this site and minimizes differences in
dissemination patterns that have been shown to occur between mice of
different strains and immunological status (10, 19, 20).
Sham inoculations of BSK-H medium alone into the footpads does not
result in pathological changes in the joint itself (C. Brown,
unpublished observation). To demonstrate that the reconstituted BM
cells were capable of making a proper specific immune response to
challenge we examined the ability of these mice to activate B cells and
produce Borrelia-specific Abs. BM chimeric and wild-type
mice infected for 28 days were bled from the retro-orbital plexus, and
the levels of Borrelia-specific IgG in the serum were
measured by ELISA. As shown in Fig. 2
A, all mouse strains were
able to produce Ab to B. burgdorferi. The chimeric mice and
control sham chimeric mice made B. burgdorferi-specific IgG
in amounts very similar to those in the wild-type control mice. Thus,
the repopulation by donor BM cells resulted in recovery of the
functional ability to produce specific immune responses similar to
those of wild-type mice.
|
C
chimeric mice made significantly higher levels of IgG1 than did the
other BM chimeric mouse strains. These mice, however, also had higher
total IgG levels (Fig. 2
C mice also tended to have higher levels of IgG2b, they were not
statistically different from the levels found in the
arthritis-resistant D
D or D
C mice. There were no differences in
the production of IgG2a or IgG3 Ab isotypes between any of the BM
chimeric mice. Experimental arthritis development in BM chimeric mice
We infected the BM chimeric mice and monitored arthritis
development for 28 days by weekly measurement of tibiotarsal joints
(Fig. 3
). Only the arthritis-susceptible
control sham chimeric mice, C
C (C3H donors into C3H recipients),
developed any ankle swelling. This swelling became evident during the
second week of infection and peaked around the third week of infection.
All other mice were resistant to ankle swelling and had significantly
smaller ankle diameters than the C
C mice at 3 and 4 wk of infection
(p < 0.001). To determine whether ankle
swelling correlated with underlying development of arthritis, one ankle
from each mouse was sectioned and evaluated histologically. Ankle
sections were stained with hematoxylin and eosin and were given an
arthritis severity score in a blinded manner. The results of these
analysis are given in Table I
. In
correlation with the ankle swelling results, only the sham chimeric
C
C mice had significantly higher arthritis severity scores than the
other mouse strains (p < 0.001). Sham chimeric
C
C mice had moderate to severe arthritis severity scores, while the
other strains had only mild inflammation. These results indicate that
resistance to arthritis development is dominant over susceptibility and
that this resistance can be mediated by nonoverlapping mechanisms of
hemopoietic or nonhemopoietic cells.
|
|
We have previously shown that arthritis-resistant DBA and
arthritis-susceptible C3H mice can harbor relatively equal numbers of
B. burgdorferi in their tissues and yet retain their
distinct phenotypic outcomes (22). To determine whether
the BM chimeric mice also harbored similar levels of B.
burgdorferi within their tissues, we measured the presence of
spirochetes in various tissues by culture and measured the relative
levels of spirochetes in selected tissues by PCR. Spirochete
dissemination and presence in tissues were similar in all mouse strains
tested (Table I
). The presence of spirochetes was highest in urinary
bladder and skin (ear punches) and lowest in spleen, which is a common
pattern seen using this experimental model. PCR detection of
Borrelia ospA DNA in individual mice and tissues shows a
wide variation of spirochetal loads (Fig. 4
). In ankles, mice from the C3H
recipients appear to contain less spirochetal DNA than the mice from
the DBA recipients (Fig. 4
A). Thus, even though the C
C
mouse ankles contained the fewest spirochetes, they were the only mice
to develop arthritis. The D
C mice, which had similar levels of
spirochetes in their ankles, and the D
D and C
D mice, which had
higher levels of spirochetes in their ankles, were resistant to
arthritis development. These results confirm previous reports that
showed no correlation between spirochete loads in tissues and arthritis
development (22, 23), although at distant sites (skin and
hearts; Fig. 4
, B and C, respectively), while the
C
C mice still have low levels of ospA DNA, the D
C and
C
D mice appear to harbor higher ospA DNA levels than the
mice that received syngeneic BM cells. This may indicate a failure of
the immune system of the D
C and C
D chimeric mice to effectively
clear the spirochetes, even though they made adequate levels of
Borrelia-specific IgG (see Fig. 2
). It is possible that the
epitopes recognized by the Abs from these mice are not as efficient as
those from the control sham chimeric mice at spirochetal clearance.
|
| Discussion |
|---|
|
|
|---|
We thus created radiation BM chimeras between arthritis-resistant DBA
and arthritis-susceptible C3H mouse strains. Following reconstitution
of each mouse strain with BM from syngeneic or allogeneic donors, the
animals were infected in the hind footpads with the N40 strain of
B. burgdorferi. Surprisingly, only the sham C3H chimeric
mice (C3H bone marrow into a C3H recipient) developed any arthritic
pathology. Transfer of bone marrow from a genetically resistant mouse
into a genetically susceptible mouse (D
C) resulted in resistance to
arthritis development. Similarly, transfer of BM from a genetically
susceptible mouse into a genetically resistant mouse (C
D) also
resulted in resistance to arthritis development. That the transferred
BM cells were active was shown by their ability to make
Borrelia-specific Ab responses similar to those of wild-type
animals. There was no correlation between Borrelia-specific
Ab isotype production and arthritis development in the chimeric mice.
These results suggest that at least two mechanisms are likely to
provide protection against arthritis development in Lyme disease: one
of hemopoietic origin and one of nonhemopoietic origin. This is in
contrast to streptococcal cell wall-induced arthritis and
adjuvant-induced arthritis in which only hemopoietic cells mediated
susceptibility to chronic joint inflammation (25).
One possible mechanism by which nonhemopoietic cells might influence
the development of experimental Lyme arthritis is through their
regulation of inflammation. It had been speculated that the mechanism
of genetic resistance and susceptibility to arthritis development in
inbred mouse strains might be due to different patterns of cytokines
produced by first-line defense cells such as fibroblasts and
endothelial cells early in infection, which would then determine the
further course of pathogenesis and infection (24).
Fibroblasts can be activated by substances released during tissue
injury or derived from infectious organisms, such as the lipid moiety
of B. burgdorferi OspA to produce chemokines and other
compounds to recruit and activate hemopoietic cells
(26, 27, 28, 29). Chemokines have been implicated in many disease
processes, including collagen-induced arthritis, rheumatoid arthritis,
lung fibrosis, granuloma formation, atherosclerosis, and septic shock
(30, 31, 32, 33, 34, 35). The up-regulation of adhesion molecules and IL-8
production promotes the transendothelial migration of neutrophils
(36, 37) and monocytes (38), which constitute
a large portion of the inflammatory infiltrate seen in the joints of
experimental animals (39) and Lyme patients with active
disease (40). Similarly, TNF-
can be locally produced
by synovial tissue cells and is a pivotal cytokine in the pathogenesis
of rheumatoid arthritis and collagen-induced arthritis (41, 42). Furthermore, fibroblasts, even those from a single tissue,
are composed of cellular subsets, much like lymphocytes (43, 44), and those from different anatomic regions display distinct
phenotypic characteristics (45). Thus, it is possible that
these differences among fibroblasts may not only control genetic
resistance and susceptibility to pathology, but may even be the basis
for its tissue specificity. These studies demonstrate the ability of
B. burgdorferi to stimulate the nonhemopoietic first-line
defense of cells to recruit and regulate an inflammatory response.
Polymorphisms contained within these nonhemopoietic cell types could
account for the genetic predisposition of inbred mouse strains to
resistance or susceptibility to experimental Lyme arthritis.
Various hemopoietic cell types or their products have been implicated
in mediating the development of experimental Lyme arthritis. We and
others have demonstrated that both genetic resistance and
susceptibility to arthritis development are mediated by cells of the
innate immune response (18, 25). We have also shown that
NK cells were activated in arthritis-susceptible, but not resistant,
mouse strains during early Lyme infection. This suggested that an early
overexuberent inflammatory response or perhaps the activation of
macrophages via IFN-
may lead to excess inflammation and arthritis
pathology (46). Depletion of NK cells (46, 47), however, or the infection of susceptible C3H mice deficient
in IFN-
production (17), had no effect on arthritis
development. Human monocytes can be activated by B.
burgdorferi or its lipoproteins to produce pro- and
anti-inflammatory cytokines and chemokines (48, 49)
through the activation of NF-
B (50). Manipulation of
the levels of pro- or anti-inflammatory cytokines produced by
macrophages, including IL-6 (51), IL-10 (52),
and IL-12 (53), can modulate the severity of arthritis
development in mouse models, but does not induce an overall change in
arthritis phenotype. Only C57BL/6 (B6) mice with the beige
mutation appear to undergo a phenotype switch from arthritis-resistant
to -susceptible following infection with B. burgdorferi
(47). Mice with the beige mutation and patients
with Chediak-Higashi syndrome have defective vesicular transport to and
from the lysosome and late endosome (54). B6 mice are
normally resistant to arthritis development when infected with B.
burgdorferi; however, B6 beige mice developed severe
arthritis similar to that in C3H control animals. Although the authors
of that study failed to identify the cell type responsible for
resistance in the B6 animals, they speculated that granulocytes were
the most likely mediators of the protection (47). Thus
differences in a single gene can alter genetic resistance or
susceptibility in inbred mouse strains. Perhaps polymorphisms in
granulocytes between C3H and DBA mice can explain the hemopoietic
component of the genetic control of Lyme pathology.
Recently, Weis et al. (55) reported correlations between genetic loci and susceptibility to experimental Lyme arthritis. They linked three distinct chromosomal regions with arthritis severity. Regions associated with ankle swelling were mapped to chromosomes 4 and 5, and regions associated with arthritis severity were mapped to chromosomes 5 and 11, thus indicating several possible control points for determining the type of host response made. Most inbred strains of mice are either resistant or susceptible to arthritis development and retain this phenotype even when challenged with high or low numbers of spirochetes (56). BALB/c mice, however, have a resistant phenotype when challenged with low numbers of spirochetes, but a susceptible phenotype when challenged with high numbers (23). Thus, there appears to be one resistance mechanism that is sensitive to overall bacterial load and one that is not. Whether these mechanisms correlate with the hemopoietically and nonhemopoietically mediated resistance mechanisms we describe in this report is unknown. Further studies to identify these control mechanisms are currently underway.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Steven L. Reiner at the current address: Abramson Research Institute, 421 Curie Boulevard, 414 BRB II/III, Philadelphia, PA 19104. ![]()
3 Abbreviations used in this paper: OspA, outer surface protein A; RAG, recombination-activating gene; BM, bone marrow. ![]()
Received for publication February 24, 2000. Accepted for publication May 16, 2000.
| References |
|---|
|
|
|---|
in modulation of immunity to Borrelia burgdorferi in mice. J. Immunol. 155:2020.[Abstract]
. Infect. Immun. 67:3329.
Lewis and in Lewis
F344 bone marrow chimeras. Cell. Immunol. 136:278.[Medline]
B in the immune system. Annu. Rev. Immunol. 12:141.[Medline]
B and inflammatory activation in human endothelial cells. J. Immunol. 157:4584.[Abstract]
B and is a potent inducer of chemokine and adhesion molecule gene expression in endothelial cells and fibroblasts. J. Immunol. 158:3285.[Abstract]
and is required for subsequent transendothelial migration of neutrophils. Infect. Immun. 65:1217.[Abstract]
in synovial tissues and at the cartilage-pannus junction in patients with rheumatoid arthritis. Arthritis Rheum. 34:1125.[Medline]
and transforming growth factor ß during induction of collagen type II arthritis in mice. Proc. Natl. Acad. Sci. USA 89:7375.
-interferon on collagen synthesis by normal and fibrotic human lung fibroblasts. Chest 101:1326.
is a inducer of plasminogen activator inhibitor type 1 in human orbital fibroblasts. Am. J. Physiol. 263:C24.
B. Infect. Immun. 64:3845.[Abstract]
This article has been cited by other articles:
![]() |
H. S. Li, D. L. Ligons, N. R. Rose, and M. L. Guler Genetic Differences in Bone Marrow-Derived Lymphoid Lineages Control Susceptibility to Experimental Autoimmune Myocarditis J. Immunol., June 1, 2008; 180(11): 7480 - 7484. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Liu, R. R. Montgomery, S. W. Barthold, and L. K. Bockenstedt Myeloid Differentiation Antigen 88 Deficiency Impairs Pathogen Clearance but Does Not Alter Inflammation in Borrelia burgdorferi-Infected Mice Infect. Immun., June 1, 2004; 72(6): 3195 - 3203. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |