| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Production by the Stress Kinase p38 and by the Extracellular Regulated Kinases p44erk-1 and p42erk-21
Department of Hematology, Johann Wolfgang Goethe University Hospital, Frankfurt/Main, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
protein production, given in conjunction with IL-2,
was counteracted by inhibition of MAPK. IL-18 alone failed to stimulate
IFN- protein production despite inducing expression of IFN- mRNA.
IL-2 alone stimulated neither IFN- mRNA expression nor IFN-
protein production. IL-18 did not stimulate proliferation of NK92
cells, either alone or in combination with IL-2 or IL-12. Inhibition of
the MAPK pathway did not significantly alter the IL-2- and
IL-12-induced proliferation of NK92 cells, whereas the Janus
kinase/STAT pathway inhibitor AG490 strongly suppressed proliferation.
MAPK activation appears to play a prominent role in IL-18 signaling,
being involved in transcription and translation of IL-18-induced
IFN- mRNA and IL-18-induced cytolytic effects. In contrast,
proliferation of NK92 cells is not affected by MAPK
p44erk-1 and
p42erk-2. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production (1) and was purified as a
costimulatory factor from liver extracts preconditioned with
Propionibacterium acnes (2). Subsequent cloning
of murine and human IL-18 (3, 4) facilitated detailed
studies of this cytokine (5). IL-18 primarily acts in
concert with IL-12, IL-2, microbial agents, or mitogens by inducing Th1
cytokines and production of IFN-, particularly in NK cells and T
cells (6). It enhances the killing activity of NK and T
cells by mechanisms possibly involving the CD95(Fas)-dependent or
perforin-dependent pathway (7, 8, 9).
Although IL-18 shares biological activities with IL-12, such as the
ability to activate NK cells and switch T cells toward Th1 cell
function (4), the primary structure of IL-18 suggests a
relationship with the IL-1 cytokine family. Like IL-1, IL-18 is
produced as an inactive precursor molecule and processed to yield the
mature and active protein of 
18.5 kDa by the intracellular cysteine
protease caspase-1 (10, 11). Similar to IL-1
and
IL-1ß, IL-18 enhances the ability of IL-12 or IL-2 to stimulate
IFN- production by NK cells. However, unlike IL-1 or
IL-1ß, high concentration of IL-18 alone can stimulate production of
low levels IFN- by NK cells (12).
Two transmembranous IL-18 receptors related to the IL-1 receptor family have been identified: the IL-18R previously described as IL-1 receptor-related protein (Rrp),3 which was purified from the Hodgkin cell line L428 (13, 14) and the accessory protein-like (AcPL) chain, which is homologous to the IL-1R accessory protein (15). In addition, a soluble IL-18 binding protein was purified from human urine, which does not share any homology to other soluble cytokine receptors (16). Whether this binding protein exists also as a transmembranous form is currently unclear.
In contrast to the structural similarities to IL-1, IL-18 does not bind to either the type I or type II IL-1R, and IL-1 does not bind to the IL-18Rs (14, 15).
Beside viral infection, mitogens, and stress (17), IL-1 is
one of the best known activators of NF-
B (18). It
activates NF-B by activation of the serine-threonine
IL-1R-associated kinase (IRAK) (19, 20, 21), together with
TNF-receptor associated factor-6 (TRAF6) (22) and
NF-B-inducing kinase (NIK) (23). With respect to the
structural relationship of IL-1 and IL-18, it was demonstrated that
IL-18 also induces the formation of the IRAK/TRAF6 complex
(24), subsequently activating NF-B in Th1 cells
(25) and in EL4/6.1 thymoma cells (26). In
COS cells, coexpression of the two IL-18 receptors, IL-18R and AcPL,
was required for the induction of NF-B (15).
IL-18 signaling defects were demonstrated in immune effector cells
derived from IRAK-deficient mice (27, 28). Because IL-18
signaling defects in IRAK-deficient Th1 cells resulted in only partial
inactivation of NF-B, it was suggested that other mechanisms can
compensate the function of IRAK (27). Splenocytes from
IRAK knockout mice secreted increasing amounts of IFN- in response
to IL-18 and IL-12, but only approximately one-half of the amount of
IFN- protein produced by wild-type cells. The investigators
suggested that although IRAK participates in IL-1 and IL-18 signal
transduction, residual cytokine responsiveness operates through an
IRAK-independent pathway (28).
In this report, we provide evidence that in NK92 cells IL-18 activates
STAT3 but not STAT5 and that the IL-18-induced activation of the
mitogen-activated protein kinases (MAPK)
p42erk-2 and p44erk-1 is
involved in the production of IFN-. Inhibition of the MAPK pathway
did not alter the IL-18-induced IFN- mRNA expression but suppressed
the IFN- protein production. MAPK also participates in the
IL-18-induced cytolytic effect and does not alter the proliferation of
NK92 cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
All cell culture experiments were performed at 37°C in 5%
CO2 humidified atmosphere. The IL-2-dependent NK
cell line NK92, established from a patient with rapidly progressive
non-Hodgkin’s lymphoma (29) was provided by Dr. H.
G. Klingemann (Chicago, IL). NK92 cells were maintained in -MEM
(Life Technologies, Karlsruhe, Germany) containing 12.5% FCS (HyClone,
Logan, UT), 12.5% horse serum (Cansera, Ontario, Canada), 2 mM
L-glutamate, 100 µg/ml penicillin, 100 µg/ml
streptomycin (Life Technologies) and supplemented with 100 U/ml IL-2
(Chiron, Emeryville, CA). To achieve independence from exogenous IL-2,
the NK92 cells were transfected with the expression vector
(DFG-hIL-2Neo) to produce IL-2 (30, 31). The resulting
cell line was called NK92Ci.
The erythroleukemia cell line K562 served as a target for the cytotoxicity experiments and was maintained in RPMI culture medium (Life Technologies) containing 10% FCS, 2 mM L-glutamate, 100 µg/ml penicillin, and 100 µg/ml streptomycin.
Cell-mediated cytotoxicity assay
Cytotoxic activity of NK92 cells against K562 cells was evaluated by FACS analysis. NK92 effector cells were deprived of IL-2 for 24 h and subsequently cultured for 2 days with IL-18 (R&D Systems, Wiesbaden, Germany) at concentrations ranging from 1 to 10 ng/ml in the presence of trace amounts of IL-2 (5 U/ml). K562 target cells (4 x 106) were prestained with the green fluorescent membrane dye PKH67-GL (Sigma, Deisenhofen, Germany) and resuspended in NK cell medium. Effector cells were added to 5 x 103 target cells to yield E:T ratios of 10:1–0.5:1 and incubated for 3 h. The cell mixture was centrifuged at 1200 rpm and stained with propidium iodide (5 µg/ml, Sigma). Dead target cells were determined to be PKH67-GL, and propidium iodide-positive cells using a flow cytometer (FACScalibur, Becton Dickinson, San Jose, CA). Target cells incubated without effector cells were used to assess spontaneous cell death. The percent of cytotoxicity was calculated as follows: cytotoxicity (%) = [dead target cells (%) - spontaneous dead target cells (%)]/[(total target cells %) - (spontaneous dead target cells %)] x 100 (%).
In some experiments (indicated in the text) a europium release assay was used according to the manufacturer’s instructions (Wallach, Freiburg, Germany). Europium releases were measured in a DELFIA 1234 fluorometer (Wallach). Cytotoxic activity was determined by specific release (%) = [experimental release (counts) - spontaneous release (counts)]/[maximum release (counts) - spontaneous release (counts)] x 100 (%).
Inhibitor assays
After serum deprivation, NK92 cells were preincubated for 2 h with 20 µM MAPK pathway inhibitor PD098059 or 20 µM stress kinase inhibitor SB203580, or 100 nM of Janus kinase (JAK)/STAT pathway inhibitor AG490 (all inhibitors from Calbiochem, Schwalbach, Germany) and stimulated as described.
Reverse transcription-polymerase chain reaction
The RT-PCR for evaluation of IFN-- and IL-18-binding chain
expression was performed according to the guanidium/phenol/chloroform
method. For cDNA preparation, 5 µg total RNA, extracted from 5
x 106 cells, were used for random-primed cDNA
synthesis using a reverse transcriptase preamplification system kit
(SuperScript, Life Technologies) according to the manufacturer’s
instructions. The RT-PCR was performed using a thermal cycler
(Perkin-Elmer, Emeryville, CA) in 50 µl PCR buffer containing 100 mM
Tris-HCl (pH 8.8), 1 mM dNTPs, 1 U of Taq polymerase (Life
Technologies), and 2.5 mM concentrations of the specific primers.
The forward (fw) and reverse (rv) primers used were: fw-IFN-,
5'-GACTAATTATTCGGTAACTGACTTGA-3'; rv-IFN-,
5'-GCTATGTTTTCATCAGGGTCAC-3'; fw-IL-18-binding protein (IL-18BP),
5'-CAGCAGCTAAGCAGTGTCCA-3'; rv-IL-18BP,
5'-CGTGACGCTGGACAACCTG-3'; fw-IL-18R,
5'-GCCATTTGAAGCAGAATCCAAACC-3'; rv-IL-18R,
5'-TTAAGACTCGGAAAGAACAGGCAA-3'; fw-IL-18R, nested,
5'-GTCAACAGCACATCATTGTATAAG-3'; rv-IL-18, nested,
5'-GTTTTTCCATCTGTTAATGTTTC-3'; fw-IL-18AcPL,
5'-ATGCTCTGTTTGGGCTGGATA-3'; rv-IL-18AcPL,
5'-TCACCATTCCTTAGGCTGGGA-3'; fw-IL-18AcPL, nested,
5'-GGTACCAACAACCTTCGAATG-3'; rv-IL-18AcPL, nested,
5'-GAGACTCTGGCTCTTGGAAG-3'.
PCR conditions were: 96°C (1 min), 60°C (1 min), 72°C (2 min), 30 cycles. For amplification of IL-18R and IL-18AcPL, nested RT-PCRs including additional 25 cycles were performed. PCR samples were run for analysis on an ethidium bromide-stained 1% agarose gel.
Western blot analysis
NK92 cells (5 x 106) were starved from serum, growth factors, and IL-2 for at least 2 h before stimulation with 100 ng/ml IL-18 for 10 min. Cells were lysed in lysis buffer containing 20 mM Tris-HCl (pH 7.5), 1% Nonidet P-40 (v/v), 137 mM NaCl, 10 mM EDTA, 100 mM sodium fluoride, 10% glycerol (v/v) with the addition of 0.2 mM Na3VO4, 1 mM NaF, 1 mM PMSF, 5 mM leupeptin, and 100 U/ml aprotinin (Sigma). Lysates were centrifuged at 13,000 rpm in a benchtop centrifuge for 15 min at 4°C to remove nuclei and cell debris. The supernatants were retained for protein assay and Western blotting. Protein concentrations were determined by Bradford assay (Bio-Rad Laboratories, Munich, Germany) using IgG as a standard. Thirty micrograms protein of each sample were separated by SDS-PAGE on 10% acrylamide, 0.2% bis gels. Proteins were transferred to nitrocellulose membrane (Bio-Rad) and detected by Western blot with Abs against STAT3, STAT5, MAPK (Transduction Laboratories, Hamburg, Germany), phosphoSTAT3, phosphoSTAT5 (Upstate Biotechnology, Lake Placid, NY), and active-MAPK (Promega, Madison, WI). Abs for the detection of MAPK p38 and active MAPK p38 were purchased from New England Biolabs (Beverly, MA). Immunoreactive bands were visualized with enhanced chemiluminescence (Pharmacia Biotech, Freiburg, Germany). For reprobing, the blots were stripped with 62.5 mM Tris-HCl (pH 8.0), 100 mM 2-ME, 2% SDS (w/v) at 57°C for 1 h.
Transcription factor binding assay
The assay was performed according to the method of Ng and
Cantrell (32) with some modifications. Whole cell extracts
were prepared by lysis of 5 x 106 cells
in lysis buffer used for Western blot analysis. The extracts were
incubated with 1 µg double-stranded, 5'-biotinylated oligonucleotide
at 4°C for 1 h and coupled to 30 µl of a 50% suspension of
streptavidin-agarose (Sigma). DNA-protein complexes were washed three
times with lysis buffer and sedimented by centrifugation. The
oligonucleotide sequence was derived from the high affinity mutant
sis-inducible element (SIEM67) of the c-fos gene:
GTCGACATTTCCCGTAAATC (32). Precipitated proteins were
separated by SDS-PAGE on 10% acrylamide, 0.2% bis gels and
transferred to nitrocellulose membrane (Bio-Rad). Western blot analysis
was performed with an Ab against activated STAT3.
IFN- induction
NK92 cells (5 x 106)
were serum starved for 4 h and stimulated
with the following cytokines: IL-2 (100 U/ml), IL-12 (50 ng/ml, Cell
Concepts, Umkirch, Germany), IL-18 (50 ng/ml). After 4 h of
incubation at 37°C, 5 x 106 cells were
harvested for the RT-PCR approach. Inhibitor PD098059 or SB203580 were
added as described before. For estimation of IFN- protein
production, 1 x 106 NK92 cells were treated
as for the RT-PCR approach with the exception that the cells were
stimulated for 24 h. The supernatants were subsequently tested in
an ELISA according to the manufacturer’s instruction (R&D Systems) and
compared with an internal IFN- standard.
Proliferation assay
After 2 h of IL-2 starvation, the NK92 cells were seeded at 1 x 104 cells/well in 96-well microtiter plates (Greiner, Frickenhausen, Germany) in a volume of 100 µl and incubated with the inhibitors PD098059 or AG490 for 2 h. The cells were then stimulated with the respective cytokines and incubated at 37°C and 5% CO2 for 24 h, followed by an 8-h pulse with 37 KBq per well [methyl-3H]thymidine (1.92 TBq/mmol, Amersham/Pharmacia Biotech, Freiburg, Germany). Samples were analyzed in a Packard Tri-Carb 1500 liquid scintillation analyzer (Packard Instrument, Groningen, The Netherlands). The results were expressed as mean cpm of triplicate determinations.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To determine the expression of IL-18R, IL-18AcPL, and IL-18BP, the
NK92 cell line was examined by semiquantitative RT-PCR. Whereas the
mRNA for the IL-18BP was strongly expressed in NK92 and NK92Ci cells
and could be detected using a standard RT-PCR approach, the mRNAs of
IL-18R and IL-18AcPL were detected only when using a highly sensitive
nested RT-PCR due to low expression levels (Fig. 1
A). All IL-18 binding chains
were expressed constitutively. The expression of IL-18R and IL-18AcPL
was enhanced after a 24-h exposure to IL-12 (data not shown).
|
50% compared with unstimulated
cells (Fig. 1
B). IL-18 rapidly activates STAT3 in NK92 cells
To determine whether IL-18 induces signaling molecules other than
IRAK, TRAF6 (24), or NF-B, known to be involved in
IL-18 signaling (25, 26), we examined the extracellular
regulated kinases p42erk-2 and
p44erk-1, which belong to the family of MAP
kinases, as well as STAT3 and STAT5 molecules.
When the NK92 cells were starved for at least 2 h and subsequently
stimulated with IL-18 for 10 min, activation of STAT3 was demonstrated,
using an Ab against phosphorylated STAT3 (Fig. 2A). Equal expression of STAT3
and uniform loading of the gel was assured by stripping the membrane
and reprobing it with an Ab recognizing both the active and the
inactive form of STAT3 as demonstrated in Fig. 2A.
|
B). With an identical
approach, we investigated the potential involvement of STAT5 in IL-18
signaling. In NK92 cells, an IL-18-triggered phosphorylation of STAT5
was not detectable. In contrast to the parental cell line, STAT5 was
already phosphorylated in NK92Ci cells in the absence of exogenous
stimulation. This phosphorylation level was not amplified by IL-18
(Fig. 2C). Inhibition of MAPK suppresses the IL-18-enhanced cytotoxicity of NK92 cells against tumor cells
Because IL-18 was shown to activate the lymphoid phosphotyrosine
kinases p56lck and MAPK
p42erk-2 in a murine Th1 clone
(33), we examined the role of MAPK in mediation of
IL-18-enhanced cytotoxicity in the NK92 cells. Stimulation of starved
NK92 cells with IL-18 resulted in a strong activation of
p42erk-2 and to a lesser extent of
p44erk-1 as demonstrated by Western blotting
with an Ab against activated MAPK
p42erk-2/p44erk-1 (Fig. 3A). Phorbol ester, a strong
inducer of MAPK, served as a positive control and activated both
p42erk-2 and p44erk-1.
Kinetic experiments of IL-18-induced MAPK phosphorylation revealed that
the activation of p42erk-2 and
p44erk-1 took place within 4 min and lasted for
>1 h (data not shown). IL-18 induced a comparable activation of MAPK
p42erk-2/p44erk-1 in
NK92Ci cells genetically modified to express IL-2 (Fig. 3A).
This activation was completely abrogated in the presence of the MAP
kinase inhibitor PD098059 (Fig. 3B). Furthermore, IL-18
strongly activated MAPK p38 in NK92 cells, whereas IL-2 activated p38
to a lesser extent in these cells. In the presence of the MAPK p38
inhibitor, the activation was completely abrogated (Fig. 3C).
|
30% at an E:T ratio
of 25:1 (Fig. 3D).
IL-18 alone does not induce IFN- protein but up-regulates
IFN- mRNA in NK92 cells
To determine the impact of the inhibited MAPK-pathway on
IL-18-induced IFN- production, NK92 cells were starved for 4 h
and subsequently stimulated with IL-18 alone or in combination with
IL-2 or IL-12. The expression of IFN- was determined by
semiquantitative RT-PCR and ELISA.
As shown in Fig. 4A, IL-18
alone strongly induced IFN- mRNA expression in NK92 cells, while
IFN- protein production was not observed by ELISA (Fig. 4B). In contrast to IL-18, 100 U/ml IL-2 given as the only
stimulus was not capable either of inducing IFN- mRNA expression or
of IFN- protein production. When NK92 cells were costimulated with
IL-18 and IL-2, IFN- mRNA synthesis was induced to the same amount
that was observed by the treatment with IL-18 alone. However, this
costimulation led to an enhanced IFN- protein production of 2500
pg/ml (Fig. 4B).
|
mRNA as well as IFN- protein production of 1140 pg/ml (Fig. 4).
IL-18 acted synergistically in combination with IL-12, resulting in a
strong increase of the IFN- production, whereas the expression level
of IFN- mRNA did not change.
Inhibition of MAPK interferes with IFN- production
The MAPK pathway inhibitor PD098059 did not affect the IFN-
mRNA expression induced by IL-18 but resulted in a 43% reduction of
IFN- protein production when administered with IL-2 and IL-18.
PD098059 had only a minor effect on the IFN- protein production
induced by IL-18 and IL-12 (6%) (Fig. 4B). In contrast to
the inhibition of the MAPK p42erk-2 and
p44erk-1, the inhibition of MAPK p38 by SB203580
affected the IFN- mRNA expression and suppressed the IFN- protein
production by 89% (Fig. 4B).
Inhibition of the MAPK pathway does not alter the proliferation of NK92 cells
NK92 cells were deprived of IL-2 and subsequently cultured with
various combinations of IL-2, IL-12, and IL-18 in the presence or
absence of the MAPK pathway inhibitor PD098059 or the JAK/STAT pathway
inhibitor AG490. The influence on proliferation was measured by
incorporation of [3H]thymidine. In this
setting, IL-2 was the maximal stimulus for NK92 cell proliferation.
Whereas treatment with IL-12 still reached the half-maximal effect of
IL-2, IL-18 alone stimulated proliferation of only 25% compared with
IL-2. IL-18 applied in combination with IL-2 or IL-12 did not enhance
proliferation above levels observed with IL-2 or IL-12 alone. PD098059
did not significantly influence the proliferation, irrespective of
whether the cells were treated with IL-2 or IL-12 or in combination
with IL-18 (Fig. 5). In contrast to the
MAPK pathway inhibitor, AG490 reduced the proliferation of NK92 cells
by 70%, when they were treated with IL-2 or IL-12, respectively.
When a combination of IL-18 and IL-2 was applied, the growth reduction
was 60% (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, IL-18 was discovered as an important regulator of NK cell
function, stimulating IFN- production and augmenting the cytolytic
effect, predominantly through CD95(Fas)-dependent or perforin-dependent
pathways (7, 8, 9). In view of its structural relationship to
IL-1, investigation of IL-18-mediated signaling has focused on the
IL-1-related signaling pathways. Albeit the involvement of IRAK in
IL-18 signaling was clearly demonstrated in a knockout mouse model,
these results also revealed that residual cytokine responsiveness
operates through IRAK-independent pathways. Furthermore, IL-1 and IL-18
act on a different spectrum of cell types and lead to divergent
cellular responses (27). These signaling pathways also
differ from those activated by the functionally related IL-12. In our
work, we therefore tried to elucidate other relevant IL-18 signaling
pathways. Because of its clinical relevance in tumor therapy, the
evaluation was conducted in the human NK92 cell line, which has
retained phenotypic features characteristic of normal NK and
lymphokine-activated killer cells.
Because the presence of the IL-18 receptors is a prerequisite to
mediate the different IL-18 effects, we initially demonstrated that the
NK92 cells constitutively express all three IL-18-binding chains
including the IL-18-binding protein, which reveals no structural
relationship to any known receptor family (Fig. 1A).
Furthermore, the functionality of the IL-18-binding chains was
demonstrated by production of IFN- in response to IL-18 and the
enhancement of IL-18-induced cytolytic effects against K562 target
cells in a dose-dependent manner.
IL-18 was thought to act as a costimulatory factor for induction of
IFN- in collaboration with secondary stimuli such as IL-2 or
mitogens (1). This was also confirmed for the IFN-
production in human NK92 cells. However, IL-18 alone strongly induces
IFN- mRNA expression, whereas IL-2 alone did not effectively
stimulate transcription of the IFN- gene. However, only the
combination of IL-2 and IL-18 resulted in an increase of both IFN-
mRNA and IFN- protein production. This clearly demonstrates that
IL-18 alone regulates the transcription of the IFN- gene but
requires the additional presence of IL-2 to force IFN- protein
production at the translational level.
Stimulation of human NK92 cells with IL-18 rapidly activates the MAPK
p42erk-2 and p44erk-1.
This activation was completely suppressed by the MAPK pathway inhibitor
PD098059. In contrast to a minimal influence of the MAPK pathway
inhibitor on IFN- mRNA expression induced by IL-18, the IFN-
protein production was drastically reduced in IL-18- and
IL-2-stimulated cells. These data suggest that the MAPK
p42erk-2/p44erk-1 are
involved in IL-18-mediated IFN- protein production, presumably at a
translational level. The activation of the MAPK alone is not sufficient
to induce IFN- protein production, because IL-18 alone mediates the
IFN- mRNA expression as well as MAPK
p42erk-2/p44erk-1
activation without stimulating protein production. In contrast to the
inhibition of MAPK
p42erk-2/p44erk-1,
inhibition of MAPK p38 by the specific inhibitor SB203580
down-regulated IFN- protein production at the transcriptional level.
This is concordant with the finding that MAPK p38 is relevant for the
activation of the ATF2 element in the IFN- promoter
(35).
Wei et al. (36) reported that the MAPK-pathway inhibitor reduced NK lysis of tumor cells and completely blocked the redirection of both perforin and granzyme B. The MAPK pathway also appears to have a role in IL-18-mediated cytotoxic activity. The cytolytic effect of NK92 cells was markedly reduced by the MAPK pathway inhibitor, when cells were activated by IL-18 in concert with IL-2. Interestingly, the proliferation of the NK92 cells was nearly unaltered in this setting.
It was reported that IL-12 is a potent NK cell-stimulatory factor (37) and acts synergistically with IL-18 (2). IL-12 mediates its effects by activation of JAK which in turn activates the specific members of the STAT family of transcription factors, STAT3 and STAT4 (38, 39). It was further demonstrated that IL-18 does not activate STAT4 (40). Because it was known that IL-2 mediates its functions by activating STAT molecules in that it activates STAT3 and STAT5 (41), we investigated whether IL-18 might also activate those signaling molecules.
In Western blot experiments, we could demonstrate that in NK92 cells STAT3 but not STAT5 was rapidly phosphorylated in response to IL-18. The specific DNA-binding activity of these phosphorylated STAT3 molecules was revealed in oligonucleotide binding experiments, using the specific SIEM motif of the c-fos gene as bait. In contrast to the STAT3 activation, IL-18 was not able either to induce the phosphorylation of STAT5 in NK92 cells or to enhance the phosphorylation in NK92Ci cells. NK92Ci cells contain the IL-2 expression vector and already display phosphorylated STAT5, presumably activated by the endogenous IL-2 production.
NK92 cells proliferate in response to IL-2 and to a lesser extent to
IL-12, alone or in combination with IL-18. IL-18 alone only barely
stimulated the cells to proliferate. The cytokine-induced NK92 cell
proliferation is completely abrogated when cells were cultured in the
presence of the JAK/STAT pathway inhibitor AG490. AG490 prevents the
phosphorylation of STAT molecules without affecting the vitality of the
cells. Our findings suggest that the translation of IFN- mRNA
induced by IL-18 involves MAPK activation and additional costimulatory
factors activated by IL-2. MAPK also participates in the IL-18-induced
cytolytic effect but does not alter the proliferation of NK92 cells.
These data may also be relevant in the context of a clinical
application of NK cells in tumor therapies. The parental NK92 cell line
is currently being tested in clinical trials.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Uwe Kalina, Department of Hematology, Johann Wolfgang Goethe University Hospital, Theodor-Stern-Kai 7, 60590 Frankfurt/Main, Germany.
3 Abbreviations used in this paper: Rrp, receptor-related protein; AcPL, accessory protein-like; IRAK, serine-threonine IL-1R-associated kinase; TRAF6, TNFR-associated factor-6; NIK, NF-B-inducing kinase; MAPK, mitogen-activated protein kinases; JAK, Janus kinase; fw, forward primer; rv, reverse primer; SIEM67, sis-inducible element; IL-18BP, IL-18-binding protein.
Received for publication September 7, 1999. Accepted for publication May 17, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
interferon production. Infect. Immun. 57:590. production by T cells. Nature 378:88.[Medline]
interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63:3966.[Abstract]
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon- production. Eur. J. Immunol. 26:1647.[Medline]
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
-inducing factor and regulates LPS-induced IFN- production. Nature 386:619.[Medline]
inducing factor mediated by interleukin-1ß converting enzyme. Science 275:206., interleukin-1ß and interferon--inducing factor on the production of interferon- gamma by natural killer. Eur. J. Immunol. 27:2787.[Medline]
B and IB proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
B activation by interleukin-1 (IL-1) requires an IL-1 receptor-associated protein kinase activity. J. Biol. Chem. 270:16514.B induction by TNF, CD95 and IL-1. Nature 385:540.[Medline]
B in murine T helper type 1 cells. Biochem. Biophys. Res. Commun. 234:454.[Medline]
promoter elements during Th cell differentiation. J. Immunol. 161:6105. production. J. Immunol. 161:3400.This article has been cited by other articles:
|
|
 |
|
  E. Morel and T. Bellon HLA Class I Molecules Regulate IFN-{gamma} Production Induced in NK Cells by Target Cells, Viral Products, or Immature Dendritic Cells through the Inhibitory Receptor ILT2/CD85j J. Immunol., August 15, 2008; 181(4): 2368 - 2381. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Schierloh, N. Yokobori, M. Aleman, V. Landoni, L. Geffner, R. M. Musella, J. Castagnino, M. Baldini, E. Abbate, S. S. de la Barrera, et al. Mycobacterium tuberculosis-Induced Gamma Interferon Production by Natural Killer Cells Requires Cross Talk with Antigen-Presenting Cells Involving Toll-Like Receptors 2 and 4 and the Mannose Receptor in Tuberculous Pleurisy Infect. Immun., November 1, 2007; 75(11): 5325 - 5337. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Trotta, D. Ciarlariello, J. D. Col, J. Allard II, P. Neviani, R. Santhanam, H. Mao, B. Becknell, J. Yu, A. K. Ferketich, et al. The PP2A inhibitor SET regulates natural killer cell IFN-{gamma} production J. Exp. Med., October 1, 2007; 204(10): 2397 - 2405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Yoo, H. Kwon, L.-Y. Khil, L. Zhang, H.-S. Jun, and J.-W. Yoon IL-18 Induces Monocyte Chemotactic Protein-1 Production in Macrophages through the Phosphatidylinositol 3-Kinase/Akt and MEK/ERK1/2 Pathways J. Immunol., December 15, 2005; 175(12): 8280 - 8286. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhou, F. Li, L. Kong, H. Tomita, C. Li, and W. Cao Involvement of Inflammation, Degradation, and Apoptosis in a Mouse Model of Glaucoma J. Biol. Chem., September 2, 2005; 280(35): 31240 - 31248. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. R. Woldbaek, J. B. Sande, T. A. Stromme, P. K. Lunde, S. Djurovic, T. Lyberg, G. Christensen, and T. Tonnessen Daily administration of interleukin-18 causes myocardial dysfunction in healthy mice Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H708 - H714. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S-M Dai, Z-Z Shan, K Nishioka, and K Yudoh Implication of interleukin 18 in production of matrix metalloproteinases in articular chondrocytes in arthritis: direct effect on chondrocytes may not be pivotal Ann Rheum Dis, May 1, 2005; 64(5): 735 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Trotta, R. Parihar, J. Yu, B. Becknell, J. Allard II, J. Wen, W. Ding, H. Mao, S. Tridandapani, W. E. Carson, et al. Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation Blood, April 15, 2005; 105(8): 3011 - 3018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A.B. Joosten, R. L. Smeets, M. I. Koenders, L. A.M. van den Bersselaar, M. M.A. Helsen, B. Oppers-Walgreen, E. Lubberts, Y. Iwakura, F. A.J. van de Loo, and W. B. van den Berg Interleukin-18 Promotes Joint Inflammation and Induces Interleukin-1-Driven Cartilage Destruction Am. J. Pathol., September 1, 2004; 165(3): 959 - 967. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Bream, R. E. Curiel, C.-R. Yu, C. E. Egwuagu, M. J. Grusby, T. M. Aune, and H. A. Young IL-4 synergistically enhances both IL-2- and IL-12-induced IFN-{gamma} expression in murine NK cells Blood, July 1, 2003; 102(1): 207 - 214. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Chiorean, S. J. Dylla, K. Olsen, T. Lenvik, Y. Soignier, and J. S. Miller BCR/ABL alters the function of NK cells and the acquisition of killer immunoglobulin-like receptors (KIRs) Blood, May 1, 2003; 101(9): 3527 - 3533. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Cornish, M. T. Gillespie, K. E. Callon, N. J. Horwood, J. M. Moseley, and I. R. Reid Interleukin-18 Is a Novel Mitogen of Osteogenic and Chondrogenic Cells Endocrinology, April 1, 2003; 144(4): 1194 - 1201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Gracie, S. E. Robertson, and I. B. McInnes Interleukin-18 J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Scott, C. J. Godshall, and W. G. Cheadle Jaks, STATs, Cytokines, and Sepsis Clin. Vaccine Immunol., November 1, 2002; 9(6): 1153 - 1159. [Full Text] [PDF]
|
|
|
|
|
|
N. Koide, T. Sugiyama, I. Mori, M. M. Mu, T. Hamano, T. Yoshida, and T. Yokochi Change of Mouse CD5+ B1 Cells to a Macrophage-Like Morphology Induced by Gamma Interferon and Inhibited by Interleukin-4 Clin. Vaccine Immunol., November 1, 2002; 9(6): 1169 - 1174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 |
)
PD098059 for 2 h before stimulation with IL-18 and trace amounts
of IL-2. Cytotoxic activity was performed using europium release assay
as described.
