|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institute for Medical Microbiology, Immunology and Hygiene, Klinikum Rechts der Isar, Technical University of Munich, Munich, Germany
| Abstract |
|---|
|
|
|---|
from
dendritic cells and T cells was shown. Prior injection by up to 2 wk
with CpG-DNA protected BALB/c mice from Th2 driven lethal
leishmaniasis. CpG-DNA injection by up to 5 wk before soluble Ag
challenge resulted in the generation of Ag-specific CTL, Th1 recall
responses to Ag, and Th1-polarized Ag-specific Abs. Thus, CpG-DNA
instigated a local predisposition for intense CTL responses and
Th1-polarized immune responses to subsequent infections or Ag
challenge. The induction by the innate immune system of a locally
contained hypersensitivity could represent a capacitating immune
reaction yielding rapid conditioned responses to secondary
infections. | Introduction |
|---|
|
|
|---|
, and TNF as predominant cytokines.
Because these cytokines inhibit the induction of Th2 responses, the
absence of such infections might release Th2 immune mechanisms and thus
promote atopic disorders. One implication would be that infections
driving Th1 responses predispose for reduced Th2 responses to
subsequent Ag challenge. Supporting this view, a retrospective study of
Japanese children demonstrated an inverse relationship between
tuberculin delayed-type hypersensitivity and atopy (2).
Indeed in murine models, infection with mycobacteria suppresses
allergenic sensitization to Ag (3, 4).
It has been established that the deoxynucleotide fraction of bacillus
of Calmette-Guérin
(BCG)5 preparations is
immunostimulatory (5, 6). The vertebrate innate immune
system, through pattern recognition of foreign unmethylated CpG
dinucleotides (CpG-DNA), senses infectious danger (7, 8).
CpG-DNA stimulates macrophages and dendritic cells (DCs) to synthesize
cytokines (IL-12, IL-18, TNF-
, IFN-
, and IFN-ß), chemokines
(macrophage-inflammatory protein-1
and -1ß, monocyte
chemoattractant protein-1) and to up-modulate costimulatory receptors
(CD 40, CD86), thus promoting Th1-biased T and B cell responses to Ag
(9, 10, 11, 12, 13, 14, 15). These events could be reproduced with CpG
containing single-stranded oligonucleotides, which serve as a powerful
adjuvant for the induction of Ag-driven Th1 responses
(16, 17, 18, 19). CpG-DNA administration concurrent with
Leishmania major infection in BALB/c mice results in
protection from the normally lethal Th2-mediated disease
(20). Similar to BCG infection, CpG-DNA when given
concurrently or post-allergen sensitization eliminates the Th2-driven
response leading to airway eosinophilia and IgE production on allergen
challenge (21, 22). Thus, exposure to bacterial DNA
recapitulates some immunological aspects of live bacterial infection
including Th1-biased responses.
We have previously shown that an injection of CpG-DNA leads to an increase in splenic cell count, granulocyte-macrophage CFUs and early erythroid progenitors (23). In consideration of potential long-term changes in immunocyte composition and activation status due to infections, we examined the ability of CpG-DNA to alter the immune systems responsiveness to Ag and infection. Here we show that in vivo exposure to CpG-DNA predisposes for extended periods of time the immune system to induce CTL and to bias for Th1 responses.
| Materials and Methods |
|---|
|
|
|---|
Female C57BL/6 and BALB/c mice were purchased from Harlan-Winkelmann (Borchen, Germany). Animals were used at an age of 8 to 12 wk. LPS and DNA from Escherichia coli and OVA were purchased from Sigma (Munich, Germany). DNA was heat denatured (95°C, 10 min) and sonicated (2 min) before use. Quil A (Spikoside) was purchased from Isotec Production (Lulea, Sweden). CpG-DNA was the oligonucleotide 1668, containing a "CpG-motif" marked with bold letters (5'-TCC-ATG-ACG-TTC-CTG-ATG-CT) and its control non-CpG-DNA (oligodeoxynucleotide (ODN) 1720: 5'-TCC-ATG- AGC-TTC-CTG-ATG-CT) (24, 25). Both ODNs were phosphorothioate stabilized and synthesized by TibMolBiol (Berlin, Germany).
Infection model
We have previously described the use of CpG-DNA to cure murine leishmaniasis (20). Leishmania major promastigotes (strain MHOM/IL/81/FE/BNI) were grown in Clicks/RPMI supplemented with 10% FCS on Novy-Nicolle-MacNeal agar. Promastigotes (2 x 106) were injected into the right hind footpad of BALB/c mice. In addition, 5 nmol CpG-DNA in 40 µl per hind footpad were injected 2 h before infection or at either 7 or 14 days before infection. Swelling in both hind footpads was measured weekly with a metric caliper, the uninfected footpad serving as an internal control for non-infection-related swelling. From both values, the percent increase of thickness was calculated (20).
Mouse treatment and harvesting cells
To determine the long term effects of CpG-DNA on the cellular composition of lymph nodes (LN), CpG-DNA was injected s.c. into each hind footpad of C57BL/6 mice in low endotoxin water (Sigma) at a dose of 5 nmol/footpad unless otherwise noted. LNs were aseptically removed and collected into HBSS (Life Technologies, Gaithersburg, MD). LNs were digested for 1 h at 37°C with 400 U/ml collagenase type Ia (Sigma). Single-cell suspensions were prepared, and clumps were removed by forcing the cells through a 100-µm pore size filter (Falcon, Becton Dickinson, Mountain View, CA). LN cells were washed in PBS containing 2% FCS and counted.
For preparation of DCs, draining LN cells were collected as above with the exception that after collagenase treatment LN cells were washed in Ca2+-free HBSS and handled in buffers containing 2 mM EDTA. For positive selection of DCs, LN cells were incubated with anti-CD11c Ab-coated magnetic beads (MiniMACs) and selected according to the manufacturers protocol (Miltenyi, Bergisch Gladbach, Germany).
To produce LN cells depleted for a given cell population, T cells, B
cells, or DCs were removed from LN cells with magnetic beads (MiniMACs)
coupled with Abs to CD4 and CD8, CD19 or CD11c respectively, according
to the manufacturers protocol (Miltenyi). To positively selected
CD4+ or CD8+ T cells, LN
cells were depleted of B cells, as above, and positively selected, as
above, for CD4 or CD8. CD4+ and
CD8+ T cell purity was
95% as determined
by FACS.
Flow cytometry
LN cells were first incubated for 10 min at 4°C with
anti-FC
RII/III mAb (PharMingen, San Diego, CA) to block
unspecific Ab binding. mAbs included anti-CD11c, -B220, -CD3, and
-GR.1 and their isotype controls (PharMingen).
Cytokine production in presensitized LN
To determine the long range changes in basal cytokine production
within local draining LN post-CpG-DNA sensitization, CpG-DNA was
injected in low endotoxin water (Sigma) at a dose of 5 nmol/footpad
s.c. into each hind footpad of C57BL/6 mice unless otherwise noted.
After various time intervals, LN cells were prepared as above and
placed in culture without addition stimulus. The cells were cultured in
Clicks/RPMI supplemented with 10% (v/v) heat-inactivated FCS, 50 µM
2-ME, and antibiotics (penicillin G and streptomycin sulfate, both at
100 IU/ml). After overnight culture, the supernatants were harvested
and assayed for IFN-
, TNF, or total IL-12 by ELISA according to the
manufacturers protocol (PharMingen). Type I IFN was accessed with
a bioassay according to the method of Diefenbach et al.
(26). Additionally, mRNA was immediately prepared from
isolated CD4 or CD8 T cells and used for RT-PCR. Both IFN-
and
IL-12Rß2 expression was accessed in a semiquantitative PCR using
ß-actin as the housekeeping gene. Primers used for murine IL-12Rß2
and ß-actin were as previously reported (20). Primers
used for IFN-
were: sense 7393, AACGCTACACACTGCATCTTG; antisense
473453, ATGAGCTCATTGAATGCTTGG, modified from the work of
Montgomery and Dallman (27).
Functional analysis of presensitized LN
C57BL/6 mice were preinjected with 5 nmol/footpad CpG-DNA s.c. into each hind footpad unless otherwise noted. In additional experiments, LPS (100 µg), Quil-A (30 µg), or non-CpG-DNA were preinjected. This was followed by OVA injection at the indicated times. Soluble OVA or liposomes containing OVA (300 µg/100-µl injection dose) were prepared as previously described (28). Four days post-OVA injection, draining popliteal LN cells were harvested as above. The LN cells were cultured for an additional 4 days in Clicks/RPMI supplemented with 10% (v/v) heat-inactivated FCS, 10 U/ml recombinant human IL-2, 50 µM 2-ME, and antibiotics (penicillin G and streptomycin sulfate, both at 100 IU/ml). OVA-specific CTL assays were performed as previously described (29). The targets were 51Cr-labeled EL-4 cells, EL-4 cells pulsed with 100 nM SIINFEKL (the Kb-restricted immunodominant peptide from OVA) or EG-7 cells (EG-7 cells are EL-4 cells transfected with the gene for OVA, gift from M. Bevan, University of Washington).
For Ab induction, C57BL/6 mice were injected with CpG-DNA in the hind footpads as above and then injected with 300 µg/100 µl OVA (50 µl/footpad) at the indicated times. An OVA boost (300 µg/100 µl OVA, 50 µl/footpad) was given 10 days after the initial OVA injection, and 1 wk later OVA-specific serum Ab titer was determined by Ab isotype-specific ELISA (16). Endpoint Ab titer was determined by coating 96F plates with 2 µg OVA/well, incubating with serially diluted test sera and Ab detection with isotype-specific peroxidase-labeled Ab (PharMingen).
For Th recall assays, C57BL/6 mice were injected with CpG-DNA, as above, rested for various intervals, and injected with OVA. On day 7 post-OVA inoculation, LN cells were harvested, and 2.5 x 105 cells/ml were placed in 96-well culture plates with a restimulating dose of soluble OVA (100 µg/ml). The supernatant was harvested, and cytokine ELISA was performed.
For adoptive transfer of in vivo presensitized DCs, positively selected CD11c cells were harvested from LN 7 days post-CpG-DNA injection as described above. The DC were pulsed with 50 µg/ml OVA in vitro overnight, and 2 x 105 cells/50 µl were injected into each hind footpad of naive C57BL/6 mice. LN cells were harvested from the injected mice and treated for Th recall as above. Cytokine levels were determined by commercially available ELISA kits (Genzyme (Cambridge, MA) or PharMingen). In additional experiments, the same transfer protocol was followed; however, popliteal LN cells were harvested 4 days after inoculation with OVA-pulsed DCs, and a CTL assay was performed as described above.
| Results |
|---|
|
|
|---|
In rodent models, it has been shown that BCG infection can inhibit
the induction of Th2-driven asthma (3, 30). We asked
whether preinjection of CpG-DNA, used to mimic BCG, would protect
animals from Th2 responses. When BALB/c mice are infected locally with
L. major, the resultant Th2-dominated response leads to
nonclearance and death (20). BALB/c mice were injected at
day -14, -7, or 0 with CpG-ODN before footpad infection with L.
major. Fig. 1
shows that unprotected
mice developed unchecked footpad swelling throughout the first 5 wk,
whereas simultaneous CpG-ODN injection led to protection. Surprisingly,
a day -14 or -7 preinjection also protected mice (Fig. 1
). The
protection was long lived, had the characteristics of a protective Th1
response to L. major, and the mice were protected from
L. major reinfection (data not shown). These results imply
that injection of CpG-DNA alters the immune status, predisposing for a
Th1-biased Leishmania clearance. We thus attempted to
characterize what changes in immune status occurred post-CpG-DNA
injection.
|
We recently described that bacterial CpG-DNA induces
extramedullary splenic hemopoiesis peaking at day 6 (23).
In the course of these studies, not only splenomegaly but also
lymphadenopathy restricted to the drainage field from the injection
site was observed. To characterize the kinetics of lymphadenopathy,
mice were injected in one hind footpad with CpG-DNA, and cellularity
was recorded (Fig. 2
). The ipsilateral
popliteal LN experienced a increase in cellularity peaking
10 days
postinjection and contracting thereafter. In contrast, the
contralateral LN did not change, appreciably reflecting the local
nature of the response in the periphery and also serving as an internal
control. Maximum cellularity in the local draining LN thus follows in
time to that of the spleen, day 10 vs day 6, respectively (Fig. 2
and
Ref. 23).
|
|
Because of the Ag presenting cells (APC) critical role for
productive T cell responses, we asked whether the numerical and
compositional changes observed in the local draining LN would alter
Ag-driven T cell activation. Previously, we described a vaccination
technique that allows for the analysis of in vivo-generated primary
cytolytic T cells; see Materials and Methods
(28). Here we injected CpG-DNA into the hind footpads of
mice, waited 7 days, and then inoculated the hind footpads with either
liposome-encapsulated OVA (Lipo-OVA) or soluble OVA. Lipo-OVA induced
mild CTL activity in non-DNA-sensitized mice (Fig. 3
A). However, the response was
greatly enhanced if the mice were "presensitized" with CpG-DNA. As
expected, soluble OVA alone did not induce CTL, whereas
CpG-DNA-presensitized mice generated a strong CTL response when
inoculated with soluble OVA (Fig. 3
A). Presensitization did
not occur when a nonstimulatory control ODN, LPS, or the adjuvant Quil
A was used (Fig. 3
B). Thus, CpG-DNA presensitization
predisposes for productive CTL responses to soluble Ags.
|
Because the adjuvant effects of CpG-DNA are Th1 biasing
(16, 17, 18), we tested whether CpG-DNA inoculation was Th1
predisposing. We presensitized mice at day -7 with CpG-DNA, injected
Ag, and evaluated the Ab and Th responses. Fig. 3
D shows
that the serum Ab response to injected Ag in presensitized mice was
both elevated and biased to IgG2a and IgG2b. This result was in
agreement with the Th1-polarized response seen when CpG-DNA was
injected simultaneously with Ag (16). Ab class switching
to IgG2a is IFN-
controlled; therefore, we tested the Ag-driven Th
cell recall response in presensitized animals. C57BL/6 mice were
presensitized at day -7 with CpG-DNA and then inoculated with OVA.
Seven days later, the LNs were harvested, and an Ag-specific
recall assay was performed. Fig. 3
E shows that Ag induces a
recall response resulting in IFN-
production by cells harvested from
CpG-DNA-presensitized mice. By ELISA, recall IL-4 production was not
measurable in either nonsensitized or presensitized animals (data not
shown). Additionally, it was determined that both
CD4+ and CD8+ T cells
contributed to Ag-specific recall IFN-
production (G.B.L.,
unpublished data). This result suggests that both Th1 and T cytotoxic
(Tc) 1 responses were generated. Presensitization of animals with
CpG-DNA thus fosters a predisposition toward T cell-generated IFN-
responses to Ag and induces Th1-polarized Ab responses.
CpG-DNA presensitization kinetics of LN Ag responses
Because of the intensity and altered character of the observed
Ag-driven responses, we next analyzed the kinetics of presensitization.
Fig. 4
A demonstrates the
effect of day 17 CpG-DNA presensitization on the induction of CTL
activity. Preinjection of CpG-DNA led to a biphasic response kinetics
to subsequent Ag challenge. The CTL response is diminished at both day
1 and 2 preinjection time followed by a recovery and overshoot with
peak activity at day 4. In multiple experiments, the phase of
diminished response was always at day 1; however, the peak of augmented
response varied between day 4 and day 6. The kinetics of
nonresponsiveness corresponds to the early infiltration of DC into the
local draining LN (Table I
). The recovery correlates with the strong
cellular infiltration observed after day 2 (Table I
). These results
demonstrate that time was required for the predisposed LN environment
to be established.
|
in response to in
vitro OVA rechallenge. These data were unexpected and together imply
that the Ag responsive environment once established prevails for
extended periods of time. CpG-DNA in vivo presensitized LN CD11c+ cells transfer CTL and Th1 responses to naive mice
Adoptively transferring Ag-pulsed DCs induces CTL responses in
naive mice (33, 34). Because DCs occupy a critical role in
initiating adaptive immune responses, we asked whether CTL induction
and Th1 predisposition could be adoptively transferred via
7-day-presensitized LN DCs. LNs were CpG-DNA presensitized in vivo for
7 days, and then CD11c+ cells were isolated from
the swollen LN. These cells were pulsed with soluble OVA overnight and
then injected into the footpads of naive syngeneic mice. Fig. 5
A shows that adoptively
transferred in vitro OVA-pulsed CD11c+ cells
harvested from presensitized mice induced primary CTL in the local LN.
The DCs from nonpresensitized mice were not effective in inducing CTL
under these conditions. Although the specific lysis values were low,
they were reproducible, and it must be emphasized that the assay
determined primary CTL response. Fig. 5
B shows that the OVA
response generated in naive mice inoculated with nonsensitized
CD11c+ cells developed a Th2-polarized recall
response, in that high amounts of IL-4 and IL-10 but low amounts of
IFN-
were produced. On the other hand, the presensitized
CD11c+ cells initiated a Th1-biased response,
i.e., high IFN-
and low IL-4 and IL-10. Thus, Ag-pulsed DCs from
7-day CpG-DNA-presensitized LNs were able to induce Ag-driven CTL and
Th1 responses in naive animals but nonpresensitized DCs bias to Th2
responses. These data infer that in vivo-presensitized DCs were able to
convey the information for CTL induction and Th1 biasing to a naive LN
environment.
|
are elevated in presensitized LNs
IL-12 and IFN-
are involved in Th1 development. We reasoned
that alterations in basal IL-12 or IFN-
production could explain the
presensitization. To determine basal cytokine production, we injected
mice in the right hind footpad, harvested the ipsilateral and
contralateral popliteal LN 7 days later, and cultured the dissociated
cells with no stimulus. Fig. 6
,
A and B, shows that the basal production of both
IL-12 and IFN-
were elevated in the draining LN and not the
contralateral LN. TNF-
and type I IFNs were not detectable (not
shown). Fig. 6
C shows that basal IL-12 production in the
ipsilateral LN remained elevated for at least 21 days. Detected by this
method, IFN-
was elevated only until day 7 and not detectable at day
14 (Fig. 6
B and data not shown).
|
production from the 7-day LNs, we stained for intracellular cytokines
followed by FACS analysis. Overall, this method proved too insensitive
and thus inconclusive; however, small numbers of
CD11c+ cells appeared positive for IL-12, and T
cells were positive for IFN-
if the TCR was cross-linked with
anti-CD3 (data not shown). We therefore harvested 7-day
presensitized LN cells, depleted for either
CD4+/CD8+ or
CD11c+ cells, cultured the remaining cells with
no stimulus overnight, and assessed cytokine production as in Fig. 6
production (Fig. 7
could not be restricted to a
single cell type. When CD4+ or
CD8+ T cells were purified and RT-PCR was
performed, both cell types were positive for IFN-
mRNA, whereas
cells from nonpresensitized LN were negative (Fig. 7
production but did not rule out DCs as a possible source.
|
were elevated in CpG-DNA-presensitized
LNs, the altered environment could be expected to affect the
composition of T cells. We purified CD4+ or
CD8+ T cells and analyzed for IL-12Rß2 mRNA, a
marker for Th1 cells. IL-12Rß2 mRNA was elevated in T cells from
presensitized LN with a bias toward CD8+ T cells
(Fig. 7
would be
expected to influence T cell differentiation in response to subsequent
infections or Ag inoculation. | Discussion |
|---|
|
|
|---|
Recently, it was demonstrated that prior injection by up to 2 wk with
CpG-DNA protected mice from lethal challenges with Listeria
monocytogenes or Francisella tularensis
(35, 36, 37). Serum IFN-
levels were elevated for 24
h, and IFN-
was claimed to be necessary for protection from
Listeria monocytogenes. The serum levels of IL-12, on the
other hand, were increased for at least 8 days after a single injection
of CpG-DNA. In response to F. tularensis, B cells were
critical for protection; however, both IL-12- and IFN-
-deficient
mice succumbed to infection (36). Whether the responses
were Th1 or Th2 dominated was not evaluated. We show here that prior
injection of CpG-DNA predisposes for a Th1-driven protection of BALB/c
mice from Th2-driven lethal leishmaniasis (Fig. 1
). The results suggest
that extended IL-12 and IFN-
production (Fig. 6
) predisposes the
immune response to Th1-polarized clearance of subsequent infection.
In the absence of adjuvants, challenge with soluble protein has been
reported to induce T cell tolerance rather than productive T cell
responses (38). CFA, rich in microbial components retained
in an oil depot, is believed to simulate infectious non-self and to
generate signals that activate APC (39, 40). During Ag
presentation by APC to T cells, APC activation provides the secondary
and tertiary signals necessary to overcome the inactivating signal of
Ag only (41). Injection with soluble hen egg lysozyme
failed to induce recall T cell proliferation or cytokine production;
however, combination with IFA yielded a Th2 response, and CFA yielded a
Th1 response (42). It was concluded that the addition of
infectious non-self components to the adjuvant resulted in Th1-biased
responses. Here we show that preinjection with CpG-DNA, a chemically
defined APC-activating "infectious" signal, promotes a long lasting
fertile ground for the induction of both Th1 and CTL responses to
subsequent Ags injection (Figs. 3
and 4
). In the absence of oils, both
strong Th1 and CTL responses ensue in CpG-DNA-presensitized
animals.
A model has been proposed for the development of tolerance, Th2 or Th1
responses based on two thresholds in the magnitude of "infectious
danger" signaling to innate immune cells (42). In
essence, the model contends that APC activation attains three levels.
When Ag is presented by nonactivated APC, tolerance develops, as
expected during naturally developing self-tolerance. When the first
threshold of activation is breached, costimulation occurs in the
absence of IL-12, and Th2-like responses develop. When the second
threshold is breached, in addition to costimulation, the innate immune
system produces IL-12 and causes Th1 immunity. Here we show that LN
cells from CpG-DNA presensitized mice spontaneously produced both IL-12
and IFN-
without further stimulation (Fig. 6
). Depletion of
CD11c+ cells from presensitized LN cells
eliminated IL-12 detection (Fig. 7
A). Additionally,
Ag-driven Th1 induction in naive mice could be adoptively transferred
by Ag-pulsed in vivo-presensitized CD11c+ cells
(Fig. 5
B). Taken together, these data demonstrate that DCs
of the local draining LNs produce IL-12 for extended periods of time
post-CpG-DNA injection and are sufficient to convey Th1 predisposition.
If IL-12 is present at the time of T cell Ag stimulation, Th1
differentiation follows (43). It is thus not surprising
that CpG-DNA-presensitized LNs respond to subsequent Ag or infectious
challenge with polarization toward Th1.
IFN-
positively modulates APC-presenting molecules and costimulatory
molecules, enhancing Ag presentation and thus the likelihood of
inducing productive T cell responses (44). We could not,
however, detect the up-regulation of costimulatory molecules on DC
after the first 3 days post-CpG-DNA injection (54). Alternatively,
IFN-
and possibly IL-12 positively influence DC maturation resulting
from CD40-CD40L engagement (45, 46, 47). Both IL-12 and
IFN-
were continuously made in presensitized LNs (Fig. 6
), and
activated T cells were also present in the LN as judged from the
detection of IFN-
mRNA in the T cell population (Fig. 7
B). The LN environment could thus provide the necessary
queues for immature DC activation. Subsequent to Ag challenge, Ag-laden
DCs would migrate into the local draining LN and be matured by
activated bystander CD40L+ T cells and
constitutively elevated IFN-
and IL-12. This chain of events could
explain the local hypersensitivity to soluble Ag.
CpG-DNA-sensitized LNs produced IL-12 and IFN-
for extended periods
(Fig. 6
). IL-12 was produced by DCs, whereas both T cells and DCs
appear partly responsible for IFN-
production (Fig. 7
). IL-12 can
augment the production of IL-12 from DC and was recently shown also to
drive DC IFN-
production (48, 49). IL-12 and IL-18 can
act together as a stimulus for IFN-
production from differentiated
Th1 cells through a TCR-independent mechanism (50, 51).
Although we did not assay for IL-18, IFN-
mRNA was expressed by
resident T cells from CpG-DNA-presensitized LNs in the absence of an
external Ag source (Fig. 7
B). IFN-
positively modulates
the IL-12Rß2 chain to yield the high affinity IL-12 receptor capable
of transducing the IL-12-driven signal (43, 52). We
demonstrated that IL-12Rß2 chain mRNA was elevated in T cells from
7-day CpG-DNA-presensitized LNs (Fig. 7
C). Whether the T
cells expressing IL-12Rß2 mRNA were differentiated in situ or
recruited to the LN as memory cells was not determined; however, it can
be expected that these T cells should be responsive to environmental
IL-12 and thus produce IFN-
. The possibility arises that a positive,
and perhaps autocrine, feedback loop between IL-12 and IFN-
is
self-perpetuating slowly diminishing with time. The maintenance of such
an environment appears Ag independent and a product of the innate
immune response, given that it was initiated by CpG-DNA without
Ag-driven TCR stimulation.
If CpG-DNA represents a pattern recognition ligand that serves as an innate immune system stimulus signifying infectious danger, then the predisposition of local lymphoid organs to organize long term hypersensitive and Th1-polarized immune responses could mirror a biological consequence of infections. In analogy to a capacitor, elevated potential for activation would be stored locally. Once a primary infection compromises the first wall of defense, the epithelial barrier, challenge from secondary invaders would be more likely and perhaps at higher initial challenge dose. By lowering the activating threshold for the innate or adaptive immune system, responses driven by local hypersensitivity would be faster and more intense. In restricting hyperresponsiveness to the local environment, containment may be achieved, limiting the possibility of detrimental anti-self responses, whereas the cellular resources utilization would be minimized. Maintenance of a Th1-predisposed local environment could be adaptive because most pathogen clearing responses are of a Th1 nature (53).
The idea of long term Th1-polarizing changes in the immune system has been postulated for humans; i.e., suppression of atopy was correlated with exposure and response to Mycobacterium tuberculosis (2). Because the propensity for atopic disorders is increasing in western societies, there is a need to determine the mechanisms by which Th1-polarizing infections change the signaling setpoints of the immune system, thus predisposing for subsequent Th1-biased responses. As shown here, the use of CpG-DNA may facilitate these investigations.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Grayson B. Lipford, Institute for Medical Microbiology, Immunology and Hygiene, Technical University of Munich, Trogerstrasse 32, Munich, Germany, 81675. ![]()
3 Current address: Skirball Institute of Biomolecular Medicine, New York University Medical Center, New York, NY. ![]()
4 Current address: Institute of Medical Microbiology and Hospital Hygiene, Philipps University of Marburg, Marburg, Germany. ![]()
5 Abbreviations used in this paper: BCG, bacillus of Calmette-Guérin; ODN, oligodeoxynucleotide; DC, dendritic cell; LN, lymph node; Lipo-OVA, liposome-encapsulated OVA. ![]()
Received for publication October 14, 1999. Accepted for publication May 10, 2000.
| References |
|---|
|
|
|---|
/ß and -
with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. 79:866.[Medline]
-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
/ß) and type 2 nitric oxide synthase regulate the innate immune response to a protozoan parasite. Immunity 8:77.[Medline]
. Annu. Rev. Immunol. 15:749.[Medline]
B and primes DC for IL-12 production. Immunity 9:315.[Medline]
production by CD8
+ lymphoid dendritic cells. J. Exp. Med. 189:1981.
production from CD4(+) versus CD8(+) T cells. J. Exp. Med. 189:1355.
production and activates IRAK and Nf
B. Immunity 7:571.[Medline]
This article has been cited by other articles:
![]() |
D. Miyazaki, C. H. Kuo, T. Tominaga, Y. Inoue, and S. J. Ono Regulatory Function of CpG-Activated B Cells in Late-Phase Experimental Allergic Conjunctivitis Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1626 - 1635. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hkima Abou Fakher, N. Rachinel, M. Klimczak, J. Louis, and N. Doyen TLR9-Dependent Activation of Dendritic Cells by DNA from Leishmania major Favors Th1 Cell Development and the Resolution of Lesions J. Immunol., February 1, 2009; 182(3): 1386 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. N. Haining, J. Davies, H. Kanzler, L. Drury, T. Brenn, J. Evans, J. Angelosanto, S. Rivoli, K. Russell, S. George, et al. CpG Oligodeoxynucleotides Alter Lymphocyte and Dendritic Cell Trafficking in Humans Clin. Cancer Res., September 1, 2008; 14(17): 5626 - 5634. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Anderson, G. J. Cianciolo, M. N. Kennedy, and S. V. Pizzo {alpha}2-Macroglobulin binds CpG oligodeoxynucleotides and enhances their immunostimulatory properties by a receptor-dependent mechanism J. Leukoc. Biol., February 1, 2008; 83(2): 381 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Krieg Antiinfective Applications of Toll-like Receptor 9 Agonists Proceedings of the ATS, July 1, 2007; 4(3): 289 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. H. Wikstrom, B. M. Meehan, M. Berg, S. Timmusk, J. Elving, L. Fuxler, M. Magnusson, G. M. Allan, F. McNeilly, and C. Fossum Structure-Dependent Modulation of Alpha Interferon Production by Porcine Circovirus 2 Oligodeoxyribonucleotide and CpG DNAs in Porcine Peripheral Blood Mononuclear Cells J. Virol., May 15, 2007; 81(10): 4919 - 4927. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Molenkamp, P. A.M. van Leeuwen, S. Meijer, B. J.R. Sluijter, P. G.J.T.B. Wijnands, A. Baars, A. J.M. van den Eertwegh, R. J. Scheper, and T. D. de Gruijl Intradermal CpG-B Activates Both Plasmacytoid and Myeloid Dendritic Cells in the Sentinel Lymph Node of Melanoma Patients Clin. Cancer Res., May 15, 2007; 13(10): 2961 - 2969. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, L. Xiang, J. Shao, and Z. Yuan The 3' CCACCA Sequence of tRNAAla(UGC) Is the Motif That Is Important in Inducing Th1-Like Immune Response, and This Motif Can Be Recognized by Toll-Like Receptor 3. Clin. Vaccine Immunol., July 1, 2006; 13(7): 733 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. A. MacDonald, V. Rowe, H. M. Bofinger, R. Thomas, T. Sasmono, D. A. Hume, and G. R. Hill The Colony-Stimulating Factor 1 Receptor Is Expressed on Dendritic Cells during Differentiation and Regulates Their Expansion J. Immunol., August 1, 2005; 175(3): 1399 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Mason, H. Ariga, R. Neal, D. Valdecanas, N. Hunter, A. M. Krieg, J. K. Whisnant, and L. Milas Targeting Toll-like Receptor 9 with CpG Oligodeoxynucleotides Enhances Tumor Response to Fractionated Radiotherapy Clin. Cancer Res., January 1, 2005; 11(1): 361 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Milas, K. A. Mason, H. Ariga, N. Hunter, R. Neal, D. Valdecanas, A. M. Krieg, and J. K. Whisnant CpG Oligodeoxynucleotide Enhances Tumor Response to Radiation Cancer Res., August 1, 2004; 64(15): 5074 - 5077. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vogt, P.-T. Chuang, J. Hebert, J. Hwang, Y. Lu, L. Kopelovich, M. Athar, D. R. Bickers, and E. H. Epstein Jr. Immunoprevention of Basal Cell Carcinomas with Recombinant Hedgehog-interacting Protein J. Exp. Med., March 15, 2004; 199(6): 753 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Chaput, N. E. C. Schartz, F. Andre, J. Taieb, S. Novault, P. Bonnaventure, N. Aubert, J. Bernard, F. Lemonnier, M. Merad, et al. Exosomes as Potent Cell-Free Peptide-Based Vaccine. II. Exosomes in CpG Adjuvants Efficiently Prime Naive Tc1 Lymphocytes Leading to Tumor Rejection J. Immunol., February 15, 2004; 172(4): 2137 - 2146. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Chen, C.-W. Lin, Y.-P. Tsao, and S.-L. Chen Cytotoxic-T-Lymphocyte Human Papillomavirus Type 16 E5 Peptide with CpG-Oligodeoxynucleotide Can Eliminate Tumor Growth in C57BL/6 Mice J. Virol., February 1, 2004; 78(3): 1333 - 1343. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. M. Olbrich, S. Schimmer, and U. Dittmer Preinfection Treatment of Resistant Mice with CpG Oligodeoxynucleotides Renders Them Susceptible to Friend Retrovirus-Induced Leukemia J. Virol., October 1, 2003; 77(19): 10658 - 10662. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Oran and H. L. Robinson DNA Vaccines, Combining Form of Antigen and Method of Delivery to Raise a Spectrum of IFN-{gamma} and IL-4-Producing CD4+ and CD8+ T Cells J. Immunol., August 15, 2003; 171(4): 1999 - 2005. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Ray and A. M. Krieg Oral Pretreatment of Mice with CpG DNA Reduces Susceptibility to Oral or Intraperitoneal Challenge with Virulent Listeria monocytogenes Infect. Immun., August 1, 2003; 71(8): 4398 - 4404. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Marshall, K. Fearon, C. Abbate, S. Subramanian, P. Yee, J. Gregorio, R. L. Coffman, and G. Van Nest Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions J. Leukoc. Biol., June 1, 2003; 73(6): 781 - 792. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Sandler, H. Chihara, G. Kobayashi, X. Zhu, M. A. Miller, D. L. Scott, and A. M. Krieg CpG Oligonucleotides Enhance the Tumor Antigen-specific Immune Response of a Granulocyte Macrophage Colony-stimulating Factor-based Vaccine Strategy in Neuroblastoma Cancer Res., January 15, 2003; 63(2): 394 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Heckelsmiller, K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, A. Krug, S. Rothenfusser, S. Endres, and G. Hartmann Peritumoral CpG DNA Elicits a Coordinated Response of CD8 T Cells and Innate Effectors to Cure Established Tumors in a Murine Colon Carcinoma Model J. Immunol., October 1, 2002; 169(7): 3892 - 3899. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Davila, M. G. Velez, C. J. Heppelmann, and E. Celis Creating space: an antigen-independent, CpG-induced peripheral expansion of naive and memory T lymphocytes in a full T-cell compartment Blood, September 18, 2002; 100(7): 2537 - 2545. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Rhee, S. Mendez, J. A. Shah, C.-y. Wu, J. R. Kirman, T. N. Turon, D. F. Davey, H. Davis, D. M. Klinman, R. N. Coler, et al. Vaccination with Heat-killed Leishmania Antigen or Recombinant Leishmanial Protein and CpG Oligodeoxynucleotides Induces Long-Term Memory CD4+and CD8+T Cell Responses and Protection Against Leishmania major Infection J. Exp. Med., June 17, 2002; 195(12): 1565 - 1573. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gierynska, U. Kumaraguru, S.-K. Eo, S. Lee, A. Krieg, and B. T. Rouse Induction of CD8 T-Cell-Specific Systemic and Mucosal Immunity against Herpes Simplex Virus with CpG-Peptide Complexes J. Virol., June 5, 2002; 76(13): 6568 - 6576. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Storni, F. Lechner, I. Erdmann, T. Bachi, A. Jegerlehner, T. Dumrese, T. M. Kundig, C. Ruedl, and M. F. Bachmann Critical Role for Activation of Antigen-Presenting Cells in Priming of Cytotoxic T Cell Responses After Vaccination with Virus-Like Particles J. Immunol., March 15, 2002; 168(6): 2880 - 2886. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Miconnet, S. Koenig, D. Speiser, A. Krieg, P. Guillaume, J.-C. Cerottini, and P. Romero CpG Are Efficient Adjuvants for Specific CTL Induction Against Tumor Antigen-Derived Peptide J. Immunol., February 1, 2002; 168(3): 1212 - 1218. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |