|
|
||||||||



*
Medical Research Council Molecular Haematology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, United Kingdom;
Hanson Centre for Cancer Research, Adelaide, Australia;
Stem Cell Laboratory, Peter MacCallum Cancer Institute, Melbourne, Australia; and
§
Medizinische Universitätsklinik II, University of Tubingen, Tubingen, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Differential epitope expression has also been described for other members of the sialomucin adhesion receptor family, to which CD164 belongs. The expanding family of sialomucin receptors includes CD34, PCLP, PSGL-1 (CD162), CD45RA, MAdCAM,-1, Sgp200, GlyCAM-1, and CD43 (reviewed in Refs. 6, 7, 8, 9, 10). These molecules are expressed on hemopoietic progenitor cells and/or on associated stromal, macrophage, T lymphoid, and/or endothelial cells in hemopoietic microenvironments, where they function in regulating hemopoiesis, leukocyte trafficking, inflammatory responses, or T cell activation. They are all serine and threonine rich, allowing the potential for extensive O-linked glycosylation. They are either secreted or transmembrane molecules with the ability to extend well above the glycocalyx to promote ligand interactions. The diversity of these sialomucin receptors is further enhanced by alternative splicing and by cell-specific glycosyltransferase-mediated sialyl, fucosyl, or sulfate modifications of their oligosaccharide side chains, which alter mucin function and allow it to be regulated independently of the rest of the molecule (reviewed in Refs. 6, 7, 8, 9, 10). Epitope characterization of these receptors has been very helpful in defining the relationship between the post-translational modifications occurring on these molecules and their specific distribution and functions in various tissues. Some of the sialomucins interact with selectin ligands in vitro, a process that may be abrogated by sialidase or O-siaolglycoprotease treatment of the sialomucin (reviewed in Refs. 6, 7, 8, 9, 10). Their ligand specificities depend on post-translational modifications of the peptide or oligosaccharide side chains, which are tissue specific. For example, correct sulfation and glycosylation allow CD34, PCLP, GlyCAM-1, Sgp200, and MAdCAM-1, to act as high affinity ligands for L-selectin on high endothelial venules of peripheral lymph nodes or endothelia of Peyers patches (reviewed in Refs. 6, 7, 8, 9, 10). Like CD164, the PSGL-1, CD34, and CD43 sialomucins may also function as signaling molecules that regulate cell proliferation (11, 12, 13, 14, 15, 16, 17, 18), possibly by enabling other receptor-ligand interactions to occur. These diverse functions are thought to be the result, at least in part, of cell type- and stage-specific oligosaccharide modifications, particularly those involving sialylation (19, 20, 21, 22 ; reviewed in Refs. 6, 7, 8, 9, 10).
In this article we report for the first time the identification of novel isoforms of CD164 and of three classes of epitopes on the CD164 sialomucin. Two of these, the class I and II epitopes, have been shown previously to encompass sites that regulate the adhesion and proliferation of CD34+ cell subsets in vitro (1) (J. Y.-H. Chan et al., manuscript in preparation). These epitopes are differentially glycosylated regions located on the N-terminal mucin-like domain of the CD164 molecule that is encoded by exon 1 of the CD164 gene. This study together with our previous analysis suggest that these glycosylation-dependent epitopes are regulated through cell type-specific post-translational modifications of CD164.
| Materials and Methods |
|---|
|
|
|---|
The murine CD164 mAbs, 103B2/9E10 (mIgG3), 105A5 (mIgM), N6B6 (mIgG2a), and 67D2 (mIgG1), were prepared as previously described (1, 2, 3, 4). The CD66 mAb, clone D14-HD11 (mIgG1), was obtained from the Fifth Leucocyte Culture Conference (23). The CD33 mAb, clone WM-54 (mIgG1), was obtained from Dakopatts (Glostrup, Denmark). The PE-conjugated CD34 mAb, QBEND-10 (mIgG1), was purchased from Cambridge Biosciences (Cambridge, U.K.). The CD34 mAbs, clone My10 (mIgG1) and Tük-3 (mIgG3), were purchased from Becton Dickinson (San Jose, CA) or were provided by Prof. D. Mason (LRF Center, Department of Cellular Sciences, Oxford, U.K.), respectively. As comparative negative controls, irrelevant mAbs of the mIgG1, mIgG2a, mIgM (Dakopatts), and mIgG3 (Southern Biotechnology Associates, Birmingham, AL) isotypes, unconjugated or PE conjugated, were used in place of primary Abs. Abs were used as tissue culture supernatants or purified Ig fractions.
Human bone marrow stromal cells, CD34+ cell isolation, and cell lines
All human cell samples were obtained with patient permission and with ethical consent of the institutions or hospitals concerned. Human bone marrow stromal cells were prepared and stained with the CD164 mAbs using the immunofluorescence technique previously described (2, 4). Human CD34+ cells (>90% purity) were purified from fresh cord samples provided by Prof. J. Hows (Southmead Hospital, Bristol, U.K.), using the Miltenyi Biotech (Bergish Gladbach, Germany) miniMACS CD34 stem cell isolation kit (2). The human KG1a, KG1B, THP-1, U937, CEM, RPMI-1788, TF1, and 293T and the mouse MS.5 cell lines were cultured as previously described (2, 4).
Sialidase and O-sialoglycoprotease treatment of cell lines
Clostridium perfringens sialidase was purchased from Roche (Mannheim, Germany). Pasteurella haemolytica O-sialoglycoprotein endopeptidase (O-sialoglycoprotease) was prepared by Cedarlane Laboratories (Hornby, Canada) and was purchased from Accurate Chemical & Scientific Corp. (Westbury, NY). For enzymatic treatment, 7 x 106 KG1a cells were incubated in 300 µl of PBS or RPMI with or without 0.1 U of C. perfringens sialidase or 120 µg of O-sialoglycoprotease for 60 min at 37°C. Cells were then washed with PBS containing 0.2% (w/v) BSA (PBS-BSA) and 0.1% (w/v) sodium azide before flow cytometric analyses.
Flow cytometric analyses
All analyses were conducted at 4°C. The sialidase- or O-sialoglycoprotease-treated and the untreated cell lines were blocked with FcR-blocking agent (Miltenyi Biotech) according to the manufacturers instructions and then labeled with the CD164 mAbs; with the CD34 mAbs, Tük-3 and My10; or with isotype-matched control mAbs followed by FITC-anti-isotype-specific secondary Abs (Southern Biotechnology Associates) as detailed above. Cells were also stained with PE-conjugated QBEND-10 or an irrelevant PE-mIgG1 according to the manufacturers protocol. After the addition of 2 µg/ml propidium iodide (Sigma, St. Louis, MO), cells were analyzed on a FACSCalibur using CellQuest software (both from Becton Dickinson, Sunnyvale, CA) (2). Experiments were repeated on at least three independent occasions.
Generation of full-length CD164 cDNA splice variant constructs
CD164 isoforms were PCR amplified from templates subcloned in
the pMOS-Blue-T vector (Amersham, Aylesbury, U.K.) after the RT-PCR
analyses.4 The CD164(E16) and
CD164(E
5) cDNA templates were derived from human kidney, while the
CD164(E
4) cDNA template was derived from human spleen. PCR
amplifications were conducted using the Expand high fidelity PCR system
(Roche) with 100 ng of the CD164(E16), CD164(E
5), or CD164(E
4)
cDNAs, and 1 µM concentrations of the F164 forward primer (5'-3'
GATCGCGGCCGCCGCTGAGGACACGATGTCGCGG) containing a
NotI restriction enzyme site and the reverse R6BCD164
SpeI primer (5'-3' GGACTAGTTTACAGAGT
GTGGTAATTTCGT) containing a SpeI restriction site after
the stop codon. The samples were digested with NotI and
SpeI restriction enzymes and subcloned into a similarly
digested pEFBos-HPC4-TM vector (24) that removed the
HPC4-TM sequence. Positive clones were sequenced as described below,
and Maxipreps of each cDNA were prepared using the Promega Megaprep
separation protocol (Promega, Madison, WI) according to the
manufacturers instructions.
Production of transient transfectants expressing CD164 cDNA splice variants
The CD164 splice variant cDNAs were transfected into MS.5 mouse stromal cells at 4050% confluence using calcium phosphate as a facilitator (210 µg of plasmid DNA/well of a 24-well tissue culture plate). At 2 days post-transfection, cells were resuspended and washed twice in PBS and lysed directly in 4x modified Laemmli reducing sample buffer (0.05% (w/v) bromophenol blue, 10% (v/v) glycerol, 0.5% (w/v) SDS, and 5 mM DTT in 0.1 M Tris-HCl, pH 6.8) containing 1x Complete protease inhibitors (Roche) and resolved by 6 or 10% SDS-PAGE before immunoblotting as described below. Transiently transfected cells were also fixed in situ in 24-well plates using a 1-ml 50/50 mixture of acetone/methanol and stained with each CD164 mAb or with an irrelevant isotype-matched control mAb followed by HRP-conjugated goat anti-mouse Ig (Dakopatts) at a 1/1000 dilution (4). Cells were counterstained with Harris hematoxylin (Surgipath, Eynesbury, U.K.) and viewed under a Leitz inverted microscope (Leica U.K. Ltd., Milton Keynes, U.K.). Images were captured on a JVC 3-CCD color video camera using the Neotech JVC application (Datacell, Maidenhead, U.K.).
Triton X-100 insolubility studies
KG1a cells (8 x 104) were resuspended in 1% (v/v) Triton X-100 lysis buffer (20 mM Tris-HCl, 1% (v/v) Triton X-100, 150 mM NaCl, and 1x Complete protease inhibitors) and incubated for 30 min at 4°C. After centrifugation at 14,000 rpm for 15 min at 4°C, the supernatant or soluble fraction and the pellet or insoluble fraction, resuspended by the addition of 250 µl of nonreducing 1x Laemmli buffer, were collected. After the addition of Laemmli loading buffer containing 5 mM DTT, the lysate proteins from both fractions were boiled for 5 min, resolved on 8% SDS-PAGE, and immunoblotted as described above.
Generation of recombinant soluble chimeric proteins
Soluble extracellular domain deletion cDNA constructs prepared
on the basis of the exon organization and containing regions encoded by
exon 1 (CD164(E1)), exons 1 and 2 (CD164(E12)), exons 13
(CD164(E13)), exons 14 (CD164(E14)), and exons 14 plus the
extracellular region of exon 6 (6a; CD164(E
5)) were generated by PCR
amplification of the corresponding cDNA fragments from the CD164(E
5)
cDNA in the pGEM-T vector (1). Constructs containing exons
15 (CD164(E15)) and exons 16a (CD164(E16a)) were produced from
a template generated by PCR amplification of the CD164(E16) cDNA (J.
Y.-H. Chan et al., manuscript in preparation) derived from a normal
human colon sample (Clontech, Palo Alto, CA). PCR amplifications were
conducted using the Expand high fidelity PCR system (Roche).
Oligonucleotide primers (Genosys Biotechnologies Europe, Cambridge,
U.K.) containing NotI or XhoI restriction enzyme
sites (as underlined below) were used for PCR and were: F164 forward
primer (5'-3'), GATCGCGGCCGCCGCT GAG GAC ACG ATG TCG CGG
for all the PCR amplifications plus one of the following reverse
amplification primers for each exon; R164(E1), ATCCCTCGAGGG
TGC CGG AGT GGT GAC CAG; R164(E2), ATCCCTCGAGTC TTT ACA TTC
TAT CCA AAA; R164(E3), ATCCCTCGAGAC GGA ACA GAA GTC TGT
CGT; R164(E4), ATCCCTCGAGGT AGA ATTGGC TGT TGG CAC;
R164(E5), ATCCCTCGAGGT TGT ACC TGA TGT AGT AAC; and
R164(E6a), ATCCCTCGAGAA GGT AGA CTT TCG CAC AGG. The
CD164(E1,2,4) and CD164(E1,3,4) cDNA constructs were produced using a
two-step PCR strategy. In the first step, exon 1 (E1), exons 1 and 2
(E1,2), exons 3 and 4 (E3,4), and exon 4 (E4) were amplified
individually using as the respective forward primers: F164 F(E1, 3),
ACC ACT CCG GCA CCA GAT GAG AGC TAT TGT TCA; and F(E2, 4), TGG ATA GAA
TGT AAA GTT TCC ACG GCC ACT CCA; and as the respective reverse primers:
R(E1, 3), TGA ACA ATA GCT CTC ATC TGG TGC CGG AGT GGT; and R(E2, 4) TGG
AGT GGC CGT GGA AAC TTT ACA TTC TAT CCA) and R164 (E4). To generate the
CD164(E1,2,4) cDNA, 5 µl of the E1, E2, and E4 PCR products were
allowed to anneal together for 10 min at 66°C and thus provided the
template for the second step PCR. For the CD164(E1, 3,4) cDNA, 5 µl
of E1 and E3,4 PCR products were annealed as described above and
provided the template for subsequent PCR amplification. These PCR
amplifications were conducted as described above using the F164 forward
and R164(E4) reverse primers for both constructs. Soluble recombinant
chimeric extracellular domain cDNA Fc-mutated (Fc*) constructs were
prepared by digesting the PCR with NotI and XhoI
restriction enzymes and subcloning these into the similarly digested
IgMu/pEFBOS vector (24), which was provided by Prof. P.
Kincade (University of Oklahoma, Norman, OK) and was designed to
prevent FcR binding. The non-Fc-mutated constructs, hCD66a-Fc
(25) and hCD33(VC)-Fc (26), were prepared in
the pIG vector as previously described and used as controls in ELISA
and Western blotting analyses. The cDNA inserts were sequenced on a
Perkin-Elmer ABI-PRISM 377 DNA sequencer (Perkin-Elmer-Applied
Biosystems, Foster City, CA) according to the manufacturers protocol
using pEFBos forward primer at position 17011718 bp
(CTCAAGCCTCAGACAGTG), pEFBos reverse primer at position 28452828 bp
(GGGAGACCTGATACTCTC), pIG specific forward and reverse primers
(25, 26), or primers specific for the cDNA sequences. The
sequences were analyzed using Sequencher and MacVector software
programs (Oxford Molecular, Oxford, U.K.). The Fc and mutated Fc*
fusion plasmids were transfected into 293T cells at 7080% confluence
using calcium phosphate as a facilitator (25 µg of plasmid DNA/15-cm
diameter tissue culture plate). The Fc/Fc* chimeras produced in the
culture supernatants were affinity isolated on protein A-Sepharose (4
Fast Flow; Pharmacia Biotec, Piscataway, NJ) and analyzed as described
previously (26).
Purification of CD164 native molecules from KG1a cells
A soluble fraction of detergent lysate was prepared from 2 x 108 KG1a cells as described for Triton X-100 insolubility studies. This material was passed twice over a 1-ml column of protein A-Sepharose. The unbound material was then passed over a 1-ml protein A-Sepharose to which 1 mg of purified N6B6 mAb had been bound and covalently coupled with dimethyl pimelimidate (Pierce, Rockford, IL). After washing with PBS containing 0.1% Triton X-100, the bound material was eluted with 100 mM triethylamine containing 0.1% Triton X-100 and neutralized with 0.1 vol of 3 M Tris (pH 6.8); a 1/200 dilution of the resulting material was analyzed on SDS-PAGE followed by Western blotting with CD164 mAbs.
Enzymatic treatment and immunoblotting of modified soluble constructs
Five-microgram aliquots of the lyophilized CD164(E13)-Fc* and
CD164(E16a)-Fc* constructs or a 1/50 dilution of lyophilized CD164
purified from KG1a cells were left untreated or were treated for
16 h at 37°C with N-glycosidase F (200 µU/ml;
Flavobacterium meningosepticum enzyme; Roche) in 10 mM
sodium phosphate buffer, pH 6; with sialidase (500 µU/ml C.
perfringens enzyme; Roche) in 10 mM sodium phosphate buffer, pH 6;
with O-glycosidase (50 µU/ml Streptococcus
pneumoniae enzyme; Oxford Glycosystems, Abingdon, U.K.) in 100 mM
sodium citrate/phosphate buffer, pH 6; with
-fucosidase (250 µU/ml
bovine kidney enzyme; Oxford Glycosystems) in 100 mM sodium
citrate/phosphate buffer, pH 6, separately or in combination for the
removal of N- and O-linked carbohydrates. The
soluble constructs CD164(E13)Fc* and CD164(E16a)-Fc* were also
treated with 250 µg/ml O-sialoglycoprotease in PBS
containing 1 mM CaCl2, pH 7.2. The CD33-Fc
construct was used as a negative control. All samples were heated for 5
min at 95°C in 2x Laemmli sample buffer (5% (v/v) glycerol, 0.25%
(w/v) SDS, and 0.025% (w/v) bromophenol blue in 0.05 M Tris-HCl, pH
6.8) with 5 mM DTT and electrophoresed on 10% SDS-PAGE gels. One gel
was stained with Coomassie blue. Four gels were transferred onto
polyvinylidene difluoride Immobilon membranes (Millipore, Watford,
U.K.) at 9 V for 1 h using a Semiphor semi-dry blot apparatus
(Pharmacia Biotech) following the manufacturers directions. The
membranes were blocked overnight at 4°C in PBS-T (PBS with 0.05%
(v/v) Tween-20) buffer plus 5% (w/v) nonfat powdered milk and then
incubated with primary Ab for 30 min at room temperature. After washing
in PBS-T, a peroxidase-conjugated goat anti-mouse Ig (Dakopatts) Ab
diluted 1/5000 in PBS-T was applied for a further 30 min. Following
extensive washing in PBS-T, blots were developed using the ECL system
(Amersham) as described by the manufacturer.
ELISA analysis of proteins
Maxisorp 96-well Nunc (Life Technologies) or Immulon 4 (Dynatech, Dynal, Oslo, Norway) flat-bottom ELISA plates were coated with untreated or enzyme-treated chimeric proteins (10 µg/ml) in PBS overnight at 4°C, washed, and then blocked with PBS containing 2% (w/v) BSA (fraction V; Sigma) and 0.02% (v/v) Tween-20 before incubation with CD164, CD66a, and CD33 or appropriate isotype-matched negative control mAbs. The assays were developed with alkaline phosphatase-conjugated goat anti-mouse Ig (1/4000 dilution; Dakopatts) and para-nitrophenylpentene (Sigma), and the absorbance was read at 405 nm in a Bio-Rad model 450 plate reader (Bio-Rad Laboratories, Hercules, CA) (2).
Competitive binding assays
Maxisorp plates were coated with CD164(E13)-Fc* and washed using the same conditions as for the ELISA analysis. CD164(E13)-Fc*-coated constructs were then blocked with 103B2/9E10, 105A5, N6B6, or 67D2 as undiluted tissue culture supernatants or with isotype-matched negative control Abs at 10 µg/ml. After washing, each CD164 mAb was added to the preblocked constructs, and their reactivities were determined by the addition of FITC-conjugated anti Ig isotype-specific secondary Abs. The fluorescence was detected on a Cytofluor II microplate fluorescence reader (PerSeptive Biosystems, Hertford, U.K.) using a wavelength of 485 nm for excitation. The percent binding was calculated as follows: 100 - [(fluorescence reading for each CD164 mAb binding to the CD164(E13)-Fc* protein in the presence of the blocking CD164 mAb) divided by (fluorescence reading for each CD164 mAb binding to the CD164(E13)-Fc* protein in the presence of the appropriate isotype matched negative control mAb) x 100]. Results are presented as the mean ± SD of triplicate determinations, and the experiment was repeated twice.
Immunoblotting of cell lysates
The equivalent of 8 x 104 exponentially growing cell lines or 1 x 104 cultured human bone marrow stromal reticular, cord blood CD34+ purified cells or bone marrow mononuclear cells were resuspended in 1x nonreducing Laemmli loading buffer (62.5 mM Tris-HCl, 2% (w/v) SDS, 10% (v/v) glycerol, and 0.1% (w/v) bromophenol blue, pH 6.8) containing 1x Complete protease inhibitors (Roche) plus 5 mM DTT as described above and boiled for 5 min, and lysate proteins were fractionated using 6 or 10% SDS-PAGE. The proteins were transferred to polyvinylidene difluoride Immobilon membranes and immunoblotted with either the CD164 mAbs or isotype-matched negative controls as described above.
| Results |
|---|
|
|
|---|
We have defined the genomic structure of human CD164 (J. Y.-H.
Chan et al., manuscript in preparation) and have shown that this gene
comprises six exons (E16) that undergo alternative splicing to
generate at least three isoforms. These are the full-length isoform,
CD164(E16), the originally identified CD164 or CD164(E
5)
isoform that lacks exon 5, and the CD164(E
4) variant that has exon 4
spliced out. The full-length isoforms are shown diagrammatically in
Fig. 1
A. The peptide encoded
by exon 1 is predicted to be heavily glycosylated with three potential
N-linked glycosylation sites and nine potential
O-linked glycosylation sites (Fig. 1
). This exon 1 generates
the first mucin-like domain of CD164. Peptides encoded by exons 2 and 3
do not contain any predicted O-linked glycosylation sites,
but each possesses two potential N-linked glycosylation
sites, and they contain all eight cysteine residues from the
extracellular domain. This defines the cysteine-rich region that
separates the two mucin domains. The second mucin-like domain is
defined by peptides derived from exons 4, 5, and 6, which, like the
exon 1-encoded peptide, is predicted to be very highly
O-glycosylated, with six potential sites encoded on exon 4,
10 on exon 5, and seven on exon 6. In addition, peptides encoded by
exons 4 and 6 have one potential N-linked glycosylation site
each (Fig. 1
). Thus, CD164(E
4) and CD164(E
5) have a smaller
second mucin domain comparatively to the CD164(E16) molecule. This
CD164(E16) molecule contains a putative membrane-proximal
glycosaminoglycan attachment site situated at the splice junction
between peptides derived from exons 5 and 6. This is missing in the
CD164(E
5) isoform.
|
Our initial studies identified four mAbs, 103B2/9E10, 105A5, N6B6,
and 67D2, that recognize human CD164 when expressed in FDCP-1
transfectants (1, 2, 3, 4). Two of the mAbs, 103B2/9E10 and
105A5, mediate functional effects in vitro (1) (J. Y.-H.
Chan et al., manuscript in preparation). These effects, which are
summarized in Fig. 2
, indicate that while
the 103B2/9E10 mAb can partially inhibit the adhesion of
CD34+ cells to bone marrow stroma (Fig. 2
A), both the 103B2/9E10 and 105A5 mAbs inhibit nucleated
cell production in liquid cultures (Fig. 2
B) and colony
formation by primitive granulocyte-monocyte (Fig. 2
C) and
erythroid (Fig. 2
D) precursors in clonogenic assays from
CD34+ cells. From single cell studies, the
103B2/9E10 mAb has been shown to prevent recruitment of
CD34+CD38low/- cells into
cycle in the presence of IL-3, IL-6, G-CSF, and SCF (Fig. 2
E).
|
All four CD164 mAbs stain CD34+ hemopoietic
cell subsets (1, 2, 3, 4), and as shown in Fig. 3
A, they all stain cultured
human bone marrow stromal reticular cells. cDNAs encoding the three
CD164 splice variants, CD164(E16), CD164(E
5), and CD164(E
4),
were transiently transfected into the mouse stromal cell line, MS.5,
and their protein products were analyzed by immunohistochemistry and
immunoblotting. All the CD164 mAbs reacted with the splice variants
produced by these cells, indicating that the epitopes recognized by the
103B2/9E10, 105A5, N6B6, and 67D2 mAbs were not located on or did not
encompass peptides encoded by exons 4 and 5. This is illustrated in
Fig. 3
B for two of the CD164 mAbs, N6B6 and 103B2/9E10. On
Western blots probed with 103B2/9E10, 105A5, or N6B6, the apparent m.w.
of the proteins expressed by the splice variants varied slightly, but
fell within the range of 80100 kDa that is observed for CD164 on
human bone marrow, on bone marrow stromal reticular cells, on
CD34+ hemopoietic progenitors, and on a set of
hemopoietic cell lines representing different lineages. Examples of the
protein products detected with these mAbs after SDS lysis of
hemopoietic cell lines are shown in Fig. 3
C
(lanes 17) and Fig. 4
. These mAbs identified the different
CD164 epitopes on cell lines representing different hemopoietic
lineages to differing degrees, but were all strongly reactive with the
most immature CD34+ hemopoietic multipotential
progenitor cell line, KG1a (Fig. 4
A). This is consistent
with our findings that all CD164 epitopes identified to date are highly
expressed on the most primitive CD34+ cell
subsets from normal bone marrow, cord blood, and fetal liver
(1, 2, 3, 4). Some variability in apparent m.w. was also
apparent among the cell lines, with the promonocytic cell line, THP-1
(Fig. 4
A), and the myelomonocytic cell line, HL60 (data not
shown), exhibiting the lowest electrophoretic mobilities of SDS-PAGE.
It is unclear from the present studies if this molecular mass
variability is due to glycosylation differences among CD164 molecules
on different hemopoietic lineages or reflects the expression of
different CD164 splice variants. These studies are currently under
investigation. It was of further interest to note that while the
monomeric form of CD164 (80100 kDa) was found after SDS lysis of
cells with all four CD164 mAbs, the 67D2 mAb also detected a band with
an apparent Mr >220 kDa. This is
illustrated in Fig. 3
C (lanes 810) on a
blot of human bone marrow, of human cord blood
CD34+ hemopoietic cells, and of cultured bone
marrow stromal reticular cells. This additional high molecular mass
band may represent a Triton X-100-insoluble form of the CD164 molecule
caused by multimeric association, cytoskeletal interaction with its
cytoplasmic tail, or glycosaminoglycan (GAG) modification. This
insoluble form remains accessible to binding by the 67D2 mAb, but not
by the other three CD164 mAbs. To test this possibility, we lysed KG1a
cells with Triton X-100 and collected the Triton X-100-soluble and
-insoluble fractions. These fractions were then boiled with SDS lysis
buffer containing 5 mM DTT and subjected to SDS-PAGE followed by
immunoblotting with the different CD164 mAbs. As indicated in Fig. 4
B, all CD164 mAbs reacted with the 80- to 100-kDa CD164
monomer and with the 160- to 180-kDa CD164 dimer in the Triton
X-100-soluble fraction as has been documented previously for Triton
X-100 lysis conditions (1). In contrast, 67D2 was the only
CD164 mAb to react with a Mr species
>220 kDa that was derived from the Triton X-100-insoluble fraction
(Fig. 4
B, 67D2, lane 2). Since this insoluble
form of CD164 has been identified at 320 kDa, it could represent a
tertrameric form of the molecule. Further studies are in progress to
identify this hypothetical tetrameric association and to characterize
possible cytoskeletal elements or GAGs that might bind to the CD164
sialomucin.
|
|
To characterize the epitopes recognized by the different CD164
mAbs, a set of nine domain truncation mutants were produced in
293T cells: CD164(E1)-Fc*, CD164(E12)-Fc*, CD164(E13)-Fc*,
CD164(E14)-Fc*, CD164(E15)-Fc*, CD164(E
5)-Fc*,
CD164(E16a)-Fc*, CD164(E1, 2, 4)-Fc*, and CD164(E1, 3, 4)-Fc* (Fig. 5
A). On SDS-PAGE, all
purified soluble constructs were resolved as single glycosylated
protein bands, except CD164(E1)-Fc*, which occurred as two isoforms:
one highly glycosylated and one lacking some oligosaccharide side
chains (Fig. 5
A). This was confirmed by the fact that the
additional lower molecular mass band was not recognized by 103B2/9E10
(data not shown), which is dependent on both N- and
O-linked glycosylation for binding, but is detected by the
105A5 mAb, which binds sialic acid moieties on O-linked
glycans (see below). To localize the epitopes for these mAbs more
precisely, the 103B2/9E10, 105A5, N6B6, and 67D2 mAbs were analyzed in
a solid phase ELISA assay for their reactivities with the soluble
CD164-Fc* domain deletion constructs. The 103B2/9E10 and 105A5 mAbs
recognized all nine soluble proteins, indicating that they react with
the region encoded by exon 1 (Table I
).
N6B6 and 67D2 recognized the CD164(E13)-Fc*, CD164(E14)-Fc*,
CD164(E15)-Fc*, CD164(E16a)-Fc*, and CD164(E
5)-Fc*
proteins, but not the CD164(E1)-Fc* and CD164(E12)-Fc*
constructs (Table I
), suggesting either that they reacted minimally
with epitopes encoded by exon 3 or with specific epitopes created by
tertiary folding of exons 13. To determine whether the N6B6 and 67D2
mAbs reacted exclusively with epitopes on exon 3 or with more complex
epitopes on multiple exons, two additional soluble proteins CD164(E1,
3, 4)-Fc* and CD164(E1, 2, 4)-Fc* were generated. These were encoded by
exons 1, 2, and 4 or exons 1, 3, and 4 and linked to the mutated Fc
region of human IgG1. As expected, the 103B2/9E10 and 105A5 mAbs
reacted with both these proteins. However, the N6B6 and 67D2 mAbs did
not (Table I
). These results were verified by immunoblotting of the
CD164-Fc* series with the CD164 mAbs (data not shown) and demonstrate
that the latter mAbs require the exon 3-encoded peptide for epitope
recognition, but that they are unable to identify the exon 3-derived
peptide in the absence of the exon 2-encoded region. In competitive
binding assays, the 103B2/9E10 and 105A5 mAbs did not significantly
compete with one another or with the N6B6 or 67D2 mAbs for binding to
the CD164(E13)-Fc*-soluble protein. For example, when the 103B2/9E10
mAb was used to block binding of the 105A5, N6B6, and 67D2 mAbs to the
CD164(E13)-Fc* construct, no inhibition was observed (0.5 ±
0.4, 1.6 ± 0.4, and 2.4 ± 1.3% inhibition, respectively).
Similarly, the 105A5 mAb did not block the binding of 103B2/9E10, N6B6,
or 67D2 mAbs (0.3 ± 1, 2.5 ± 0.4, and 1.9 ± 0.5%
blocking, respectively). However, N6B6 partially blocked the binding of
67D2 and vice versa (73.8 ± 0.5 and 47.1 ± 0.9%
inhibition, respectively), but did not substantially block that of
105A5 or 103B2/9E10 (14.7 ± 0.6 and 1.2 ± 2.5% inhibition
for N6B6, and 15.1 ± 0.7 and 0% inhibition for 67D2,
respectively).
|
|
In view of the fact that exons 2 and 3 contain all eight cysteine
residues that occur in the extracellular domain (Fig. 1
B),
we considered the possibility that disulfide bridges may strongly
influence the conformation of CD164 and thus be intrinsic to the
epitopes recognized by the CD164 mAbs. As shown in Fig. 5
B,
in the absence of reducing agents, the soluble CD164(E13)Fc*
construct formed dimers via disulfide linkages at the hinge region of
the human IgG1 Fc, while in 5 mM DTT or above, the protein was
monomeric. Treatment of the CD164(E13)-Fc* soluble recombinant
protein with increasing concentrations of DTT resulted in the loss of
the epitopes recognized by N6B6 and 67D2. Reducing conditions (
20 mM
DTT) were sufficient to perturb the N6B6 and 67D2 epitope reactivities
on the CD164(E13)-Fc* construct, while 103B2/9E10 and 105A5 epitopes
were not affected by DTT even at high concentrations (Fig. 5
B). These results indicate that the N6B6 and 67D2 mAbs
recognize conformationally dependent epitopes, involving disulfide bond
formation between exons 2 and 3 as shown in Fig. 1
A.
N- and O-linked oligosaccharide side chains are involved in epitope recognition by CD164 mAbs
Deglycosylation experiments were conducted to determine whether
oligosaccharide residues contribute to the CD164 epitopes recognized by
the 103B2/9E10, 105A5, 67D2, and N6B6 mAbs. In the first set of
experiments the KG1a cell line was treated with sialidase or
O-sialoglycoprotease and analyzed by flow cytometry
for CD164 mAb binding (Fig. 6
). The CD34
mAbs, My10, QBEND-10, and Tük-3, which recognize epitopes that
are differentially sensitive to sialidase and
O-sialoglycoprotease, served as controls for this analysis
(Fig. 6
). In the second set of experiments, CD164(E13)-Fc* soluble
proteins and CD164 purified from KG1a cells (CD164(KG1a)) were
subjected to N-glycanase, O-glycosidase,
sialidase,
-fucosidase, and O-sialoglycoprotease
treatments, either separately or together, as indicated in Fig. 7
. In these latter experiments
O-sialoglycoprotease and N-glycanase treatment
alone or in combination with the other enzymes dramatically decreased
the apparent molecular mass of the soluble constructs. However,
sialidase and O-sialoglycoprotease treatment of the native
CD164(KG1a) molecule reduced its mobility in SDS-PAGE due to the
removal of negative charges present on sialic acid (Fig. 7
, EH). After O-glycosidase treatment only partial
deglycosylation was observed on CD164(E13)-Fc*, since two bands, the
original CD164 and a lower Mr band of
60-kDa, were detected after electrophoresis.
|
|
Our results show that by treating hemopoietic cell lines, such as
KG1a, which expresses the CD164 epitopes, with C.
perfringens sialidase, we were able to abrogate binding by the
105A5 mAb, but not with the other CD164 mAbs tested (Fig. 6
). The
failure of the 105A5 mAb to immunoblot either the CD164(E13)-Fc*
soluble protein or the CD164(KG1a) protein after treatment with
C. perfringens sialidase confirmed that the 105A5 epitope
was sialic acid dependent (Fig. 7
, B and F).
Using the fact that N-glycanase did not remove the 105A5
epitope from CD164(E13)-Fc* or CD164(KG1a) (Fig. 6
, B and
F) and that O-glycosidase is unable to digest
long chain O-linked glycans without prior sialidase
treatment, it appears that the sialic acids intrinsic to the 105A5
epitope are most likely situated on O-glycosylated chains
attached to the exon 1-encoded peptide and not on N-linked
oligosaccharides (Fig. 1
B). In contrast to the 105A5
epitope, the 103B2/9E10, N6B6, and 67D2 epitopes were not affected by
C. perfringens sialidase treatment of either KG1a cells
(Fig. 6
), or CD164(KG1a) protein (Fig. 7
, E, G, and
H) or the soluble CD164(E13)-Fc* protein (Fig. 7
, A, C, and D). This was confirmed in an
ELISA analysis in which the four CD164 mAbs were examined for their
ability to bind to the native or sialidase-treated soluble
CD164(E13)-Fc* construct attached to microtiter wells. In these
experiments, sialidase treatment reduced the binding of the 105A5 mAb
by 76 ± 1%, but did not reduce the binding of the other CD164
mAbs (data not shown).
Both the 105A5 and 103B2/9E10 epitopes are O-sialoglycoprotease sensitive
Preincubation of KG1a cells with O-sialoglycoprotease
significantly reduced the binding of the 103B2/9E10 and 105A5 mAbs as
measured by flow cytometry (Fig. 6
). The other CD164 epitopes were not
affected by this treatment. To confirm these studies, the
CD164(E13)-Fc* protein or the CD164(KG1a) protein was treated with
O-sialoglycoprotease, and the resulting protein was analyzed
in the presence of 5 mM DTT on SDS-PAGE followed by immunoblotting with
the CD164 mAbs. By Coomassie blue analysis, this treatment of the
soluble protein reduced its apparent
Mr to approximately 65 kDa (data not
shown). Neither the 103B2/9E10 nor the 105A5 mAbs bound to this 65-kDa
fragment, whereas both N6B6 and 67D2 were found to bind (Fig. 7
, C and D, respectively). These experiments were
repeated with CD164(E16a)-Fc*, and the same decrease in the apparent
molecular mass was observed (data not shown), indicating than the
first mucin domain contained the only cleavage site for the
O-sialoglycoprotease enzyme. The sensitivity of CD164
epitopes to O-sialoglycoprotease was similar to that of
purified CD164(KG1a) (Fig. 7
, EH). These studies
demonstrate the partial removal of the exon 1-encoded region identified
with 105A5 and 103B2/9E10 mAbs from CD164 on KG1a cells, and its
complete removal from the soluble CD164(E13)-Fc* molecule by
O-sialoglycoprotease treatment. Furthermore, they indicate
that the region encoded by exon 1 is not essential for epitope
recognition by the N6B6 and 67D2 mAbs.
Recognition of the 103B2/9E10 epitope requires N-linked carbohydrate attachment
The 103B2/9E10 epitope (but not the 105A5, N6B6, or 67D2
epitopes) was sensitive to N-glycanase treatment either on
soluble CD164(E13)-Fc* protein or CD164(KG1a) protein (Fig. 7
). This
was confirmed in an ELISA analysis in which the four CD164 mAbs were
examined for the ability to bind to the native or
N-glycanase-treated soluble CD164(E13)-Fc* construct
attached to microtiter wells. In these experiments removal of
N-linked carbohydrates reduced the binding of the 103B2/9E10
mAb by 63.1 ± 6.9%, but did not reduce the binding of the other
CD164 mAbs (data not shown). Hence, the 103B2/9E10 epitope is dependent
on the N-linked carbohydrates of exon 1 (Fig. 1
).
The N6B6 and 67D2 mAbs bind deglycosylated CD164
Our results demonstrate that the N6B6 and 67D2 epitopes on
CD164(E13)-Fc* or on CD164(KG1a) are not removed by the
deglycosylation procedures used, since N6B6 and 67D2 still recognize
the different deglycosylated forms (Fig. 7
, C, D, G, and
H). Only N-glycanase and
O-sialoglycoprotease treatments of the soluble chimeric
molecule appear to reach complete deglycosylation, since treatment with
O-glycosidase only partially removed the O-linked
carbohydrates. This is evidenced by the fact that the 80-kDa molecule
is the major band detected by Coomassie blue staining (data not shown),
with an additional weaker band at approximately 60 kDa being detected
by immunoblotting with the N6B6 and 67D2 mAbs (Fig. 7
, C and
D), but not with 103B2/9E10 or 105A5 mAbs (Fig. 7
, A and B). This partial digestion with
O-glycosidase was improved by the prior addition of
exoglycosidases such as sialidase or
-fucosidase (Fig. 7
, C and D, lanes OS and OSF), but even in the
presence of these enzymes, O-glycosidase did not completely
digest the original CD164(E13)-Fc* protein.
Identification of three classes of CD164 epitopes
The CD34 mAbs have been classified into three classes based on
their sensitivities to sialidase and O-sialoglycoprotease
(27). Thus, by comparing CD164 mAbs with the CD34 mAb
classes, it has been possible to subtype the CD164 mAbs into three
analogous categories. Like the CD34 epitope, My10, the CD164 epitope,
105A5, is sensitive to both C. perfringens sialidase and
O-sialoglycoprotease treatments and can be classified as a
class I epitope (Fig. 8
). The CD164
epitope, 103B2/9E10, is similar to the CD34 epitope, QBEND 10, in that
it is sensitive to O-sialoglycoprotease, but not to C.
perfringens sialidase, and can be classified as a class II epitope
(Fig. 8
). Interestingly, this 103B2/9E10 epitope is also sensitive to
N-glycanase digestion. The CD164 epitopes, N6B6 and 67D2,
and the CD34 epitope, Tük3, are insensitive to both
C. perfringens sialidase and
O-sialoglycoprotease enzymes and can therefore be classified
as class III epitopes (Fig. 8
). From our results on the differential
binding of the N6B6 and 67D2 mAbs to the Triton X-100-insoluble cell
fraction (Fig. 4
), we are able to group the class III epitopes into two
subclasses. The subclass IIIA mAb N6B6 does not bind to the 320-kDa
Triton X-100-insoluble material, whereas the subclass IIIB mAb 67D2
reacts with the Triton X-100-insoluble material.
|
| Discussion |
|---|
|
|
|---|
The classification of the CD164 epitopes presented in this paper is reminiscent of certain structural features of the CD34 molecule. Three classes of epitopes on CD34 have been defined on the basis of their sensitivities to sialidase and O-sialoglycoprotease treatments (27, 31, 32). Like CD164, the CD34 class I epitopes are sialidase/O-sialoglycoprotease sensitive, the class II epitopes are removed by O-sialoglycoprotease, and the class III epitopes are insensitive to digestion by both enzymes. Furthermore, although not as dramatic as the differential tissue distribution of the class I and II epitopes of CD164, there are some reports on the differential expression of CD34 epitope classes. For example, while the three classes of CD34 epitopes are equally expressed on immature hemopoietic progenitor cells and immature leukemic blasts (AML-M0/1), class I and class II epitopes are less likely to be expressed on more mature progenitors and on the AML-M3 and -M4/5 leukemic blasts than class III epitopes. This suggests a more rapid down-regulation of the CD34 class I and II epitopes during normal hemopoietic progenitor cell differentiation (33). More significantly, on high endothelial venules, the CD34 isoform displays the class II and III, but not class I epitopes (34), thereby implicating the class II rather than the class I epitopes in the high affinity adhesion of these cells to L-selectin on lymphocytes.
The variable glycosylation of CD164 observed here for different cell
types is by no means uncommon. One feature of many glycoproteins is
microheterogeneity, which is due at least in part to the attached
glycan chains. This heterogeneity is nonrandom and reproducible for a
given protein synthesized by a specific cell type under defined
conditions, a feature reflected when the physiological relevance of
protein glycosylation is considered. While it is interesting to examine
the differential glycosylation of the CD164 molecule in different cell
lineages and tissues, examination of the glycosylation pattern by
enzymatic treatment (Fig. 8
) provides insight into the possible
functional relevance of post-translational processing. Glycans can
serve as recognition determinants for or as modulators of cell-cell,
cell-matrix, and protein-(glyco)protein interactions. They can also be
involved in either adhesive or anti-adhesive interactions. Both
roles may be played by the same molecule depending on the tissues in
which these glycoproteins are expressed and on the type of specific
carbohydrate modifications that have been processed. This is further
demonstrated by the wide diversity of glycosyltransferases and protein
machinery present in a particular cell type, necessary for the
production of a molecule with functionally relevant glycosylation
(35). In many cases partial occupancy of potential
glycosylation sites has correlated effects on physiological attributes.
Particularly striking examples of the complexities of variable
glycosylation site occupancy upon the biological attributes of a
protein are illustrated by GM-CSF and CD44. Human GM-CSF exhibits
variable N-linked glycosylation site occupancy, which plays
an important role in its biological activity. Indeed, it has been
demonstrated that there is an inverse correlation between biological
activity and the extent of N-glycosylation, suggesting that
N-linked glycans down-regulate the bioactivity of the
molecule (36, 37). The 85-kDa isoform of CD44 on
hemopoietic cells, on the other hand, acts as a ligand for hyaluronan
produced by endothelial cells when it is sulfated on
O-linked oligosaccharides in response to TNF-
stimulation
(38). Other examples of post-translational modification
influencing biological activity are by no means rare. Modifications
involving O-linked oligosaccharide or tyrosine sulfation on
CD34, PCLP, GlyCAM-1, and PSGL-1 on high endothelial venules or on
specific leukocyte types are responsible for their high affinity
specificity for L-selectin in vitro (reviewed in Ref. 10).
Since the interaction of sialomucins with selectin ligands generally
promotes the rapid proadhesive tethering of leukocytes to endothelia
under conditions of flow in vitro, it has been postulated that these
interactions result in tissue-specific homing and recirculation of
lymphocytes to high endothelial venules in lymph nodes and mucosal
lymphoid tissues and the accumulation of leukocytes at sites of
inflammation. Despite this, controversy still surrounds the ligand
specificity of these sialomucins and the functional significance of
such sialomucin-ligand interactions in vivo (35). For
example, L- and E-selectins function as ligands for CD34, yet both
sialidase/O-sialoglycoprotease-dependent and
O-sialoglycoprotease-independent adhesion of leukocytes to
high endothelial venules have been described (9 ; reviewed
in Ref. 10). Finally, gene knockout studies in mice
indicate that GlyCAM-1 and CD34, at least by themselves, are not
responsible for L-selectin-mediated lymphocyte recruitment into
peripheral lymph nodes, although eosinophil recruitment into the lung
following allergen challenge is down-regulated in CD34-deficient mice
(14, 39).
Our previous studies have demonstrated that while all the CD164 epitopes discussed here are expressed on the phenotypically most primitive hemopoietic progenitor cells, it is the class II epitope, 103B2/9E10, that has been shown to elicit a very potent regulatory effect on stem cell proliferation/adhesion in in vitro systems. In this respect, CD164 resembles other sialomucins, such as PSGL-1, CD34, and CD43, in that interaction of both sialomucins with specific mAbs regulates cell proliferation. In the case of CD43 and PSGL-1, this receptor binding is functional and specific to a particular progenitor cell stage of differentiation (11, 13, 16, 40, 41, 42, 43). Whether the biochemical mechanisms regulating cell proliferation following the engagement of CD164 receptor on CD34+CD38low/- cells are similar to those observed for CD34, CD43, and PSGL-1 is as yet unknown (11, 13, 15, 16, 17, 18, 40, 41, 42, 43). However, as indicated in this paper and from our current research, with the characterization and better understanding of functional epitopes on progenitor cells, new tools are now available that will allow us to answer such questions.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Suzanne M. Watt, Medical Research Council Molecular Hematology Unit, Institute of Molecular Medicine, The John Radcliffe Hospital, Headington, Oxford, United Kingdom OX3 9DS. ![]()
3 Abbreviations used in this paper: SCF, stem cell factor; GAG, glycosaminoglycan; PCLP, podocalyxin-like protein; PSGL-1, P-selectin glycoprotein ligand-1; MAdCAM-1, mucosal addressin cell adhesion molecule-1; GlyCAM-1, glycosylation-dependent cell adhesion molecule-1. ![]()
4 J. Y.-H. Chan, J. E. Lee-Prudhoe, B. Jorgensen, G. Ihrke, R. Doyonnas, A. C. W. Zannettino, P. J. Simmons, V. J. Buekle, and S. M. Watt. Submitted for publication. ![]()
Received for publication December 15, 1999. Accepted for publication April 25, 2000.
| References |
|---|
|
|
|---|
subunit is essential for ligand binding and signal transduction. J. Biol. Chem. 270:24580.
induction of CD44-mediated leukocyte adhesion by sulfation. Science 282:941.
. Blood 93:3317.This article has been cited by other articles:
![]() |
V. L. Battula, S. Treml, P. M. Bareiss, F. Gieseke, H. Roelofs, P. de Zwart, I. Muller, B. Schewe, T. Skutella, W. E. Fibbe, et al. Isolation of functionally distinct mesenchymal stem cell subsets using antibodies against CD56, CD271, and mesenchymal stem cell antigen-1 Haematologica, February 1, 2009; 94(2): 173 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Martin-Rendon, S. J.M. Hale, D. Ryan, D. Baban, S. P. Forde, M. Roubelakis, D. Sweeney, M. Moukayed, A. L. Harris, K. Davies, et al. Transcriptional Profiling of Human Cord Blood CD133+ and Cultured Bone Marrow Mesenchymal Stem Cells in Response to Hypoxia Stem Cells, April 1, 2007; 25(4): 1003 - 1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Forde, B. J. Tye, S. E. Newey, M. Roubelakis, J. Smythe, C. P. McGuckin, R. Pettengell, and S. M. Watt Endolyn (CD164) modulates the CXCL12-mediated migration of umbilical cord blood CD133+ cells Blood, March 1, 2007; 109(5): 1825 - 1833. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Serafini, S. J. Dylla, M. Oki, Y. Heremans, J. Tolar, Y. Jiang, S. M. Buckley, B. Pelacho, T. C. Burns, S. Frommer, et al. Hematopoietic reconstitution by multipotent adult progenitor cells: precursors to long-term hematopoietic stem cells J. Exp. Med., January 22, 2007; 204(1): 129 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Potter, G. Ihrke, J. R. Bruns, K. M. Weixel, and O. A. Weisz Specific N-Glycans Direct Apical Delivery of Transmembrane, but Not Soluble or Glycosylphosphatidylinositol-anchored Forms of Endolyn in Madin-Darby Canine Kidney Cells Mol. Biol. Cell, March 1, 2004; 15(3): 1407 - 1416. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. McGuckin, N. Forraz, M.-O. Baradez, C. Lojo-Rial, D. Wertheim, K. Whiting, S. M. Watt, and R. Pettengell Colocalization Analysis of Sialomucins CD34 and CD164 Stem Cells, March 1, 2003; 21(2): 162 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Samulowitz, A. Kuhn, G. Brachtendorf, R. Nawroth, A. Braun, A. Bankfalvi, W. Bocker, and D. Vestweber Human Endomucin : Distribution Pattern, Expression on High Endothelial Venules, and Decoration with the MECA-79 Epitope Am. J. Pathol., May 1, 2002; 160(5): 1669 - 1681. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-N. Lee, J.-S. Kang, and R. S. Krauss Identification of a Role for the Sialomucin CD164 in Myogenic Differentiation by Signal Sequence Trapping in Yeast Mol. Cell. Biol., November 15, 2001; 21(22): 7696 - 7706. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Prosper and C. M. Verfaillie Regulation of hematopoiesis through adhesion receptors J. Leukoc. Biol., March 1, 2001; 69(3): 307 - 316. [Abstract] [Full Text] |
||||
![]() |
J. Y.-H. Chan, J. E. Lee-Prudhoe, B. Jorgensen, G. Ihrke, R. Doyonnas, A. C. W. Zannettino, V. J. Buckle, C. J. Ward, P. J. Simmons, and S. M. Watt Relationship between Novel Isoforms, Functionally Important Domains, and Subcellular Distribution of CD164/Endolyn J. Biol. Chem., January 12, 2001; 276(3): 2139 - 2152. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |