The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doyonnas, R.
Right arrow Articles by Watt, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doyonnas, R.
Right arrow Articles by Watt, S. M.
The Journal of Immunology, 2000, 165: 840-851.
Copyright © 2000 by The American Association of Immunologists

CD164 Monoclonal Antibodies That Block Hemopoietic Progenitor Cell Adhesion and Proliferation Interact with the First Mucin Domain of the CD164 Receptor1

Regis Doyonnas*, James Yi-Hsin Chan*, Lisa H. Butler*, Irene Rappold*, Jane E. Lee-Prudhoe*, Andrew C. W. Zannettino{dagger}, Paul J. Simmons{ddagger}, Hans-Jörg Bühring§, Jean-Pierre Levesque{ddagger} and Suzanne M. Watt2

* Medical Research Council Molecular Haematology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, United Kingdom; {dagger} Hanson Centre for Cancer Research, Adelaide, Australia; {ddagger} Stem Cell Laboratory, Peter MacCallum Cancer Institute, Melbourne, Australia; and § Medizinische Universitätsklinik II, University of Tubingen, Tubingen, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The novel sialomucin, CD164, functions as both an adhesion receptor on human CD34+ cell subsets in bone marrow and as a potent negative regulator of CD34+ hemopoietic progenitor cell proliferation. These diverse effects are mediated by at least two functional epitopes defined by the mAbs, 103B2/9E10 and 105A5. We report here the precise epitope mapping of these mAbs together with that of two other CD164 mAbs, N6B6 and 67D2. Using newly defined CD164 splice variants and a set of soluble recombinant chimeric proteins encoded by exons 1–6 of the CD164 gene, we demonstrate that the 105A5 and 103B2/9E10 functional epitopes map to distinct glycosylated regions within the first mucin domain of CD164. The N6B6 and 67D2 mAbs, in contrast, recognize closely associated and complex epitopes that rely on the conformational integrity of the CD164 molecule and encompass the cysteine-rich regions encoded by exons 2 and 3. On the basis of their sensitivities to reducing agents and to sialidase, O-sialoglycoprotease, and N-glycanase treatments, we have characterized CD164 epitopes and grouped them into three classes by analogy with CD34 epitope classification. The class I 105A5 epitope is sialidase, O-glycosidase, and O-sialoglycoprotease sensitive; the class II 103B2/9E10 epitope is N-glycanase, O-glycosidase, and O-sialoglycoprotease sensitive; and the class III N6B6 and 67D2 epitopes are not removed by such enzyme treatments. Collectively, this study indicates that the previously observed differential expression of CD164 epitopes in adult tissues is linked with cell type specific post-translational modifications and suggests a role for epitope-associated carbohydrate structures in CD164 function.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recently, we have identified and cloned human CD164, a novel 80- to 100-kDa type 1 transmembrane sialomucin that is highly expressed on primitive CD34+ hemopoietic progenitor cells (1, 2, 3, 4) (J.Y.-H. Chan et al., manuscript in preparation). Analyses of transfectants expressing human CD164 have allowed the identification of at least four mAbs, 103B2/9E10, 105A5, N6B6, and 67D2, that specifically recognize this sialomucin (1, 2, 3, 4). Of these, the interaction of the 103B2/9E10 mAb with the CD164 receptor inhibits the adhesion of CD34+ cells to bone marrow stromal cells in vitro (1). Interestingly, similar interactions with the 103B2/9E10 or 105A5 mAbs inhibit the proliferation and differentiation of primitive CD34+ erythroid and granulocyte-monocyte progenitors in colony forming assays (J.Y.-H. Chan et al., manuscript in preparation) and prevents the recruitment of CD34+CD38low/- cells into cycle in response to the cytokines, IL-3, IL-6, stem cell factor (SCF),3 and G-CSF (1). All these results suggest that CD164 may act as a potent negative signaling molecule for hemopoietic progenitor cell proliferation. The CD164 Ag, when analyzed with any of the four CD164 mAbs described above, is expressed during ontogeny on CD34+ intra-aortic cell clusters in human wk 4–5 embryos and has been shown to be expressed on primitive human hemopoietic progenitors from fetal liver, cord blood, and bone marrow (4). The highest cell surface expression of CD164 epitopes on these cells occurs on the more primitive subset of CD34+ cells (CD34high, AC133high, CD38low). It is also expressed on the vast majority of the lin-CD34low/-CD38low/- cells with the capacity for long term repopulation of hemopoiesis in an in vivo fetal sheep model (4, 5). CD164 expression is maintained at a lower level on the surface of all the committed myeloid and erythroid progenitors, with low or negligible levels of expression on mature peripheral blood neutrophils and erythrocytes (4). In contrast to their common distribution pattern on hemopoietic progenitor cells, the CD164 epitopes defined by the 105A5 and 103B2/9E10 mAbs are differentially and often reciprocally expressed on lymphoid cells, endothelia, postcapillary high endothelial venules, and basal/subcapsular epithelia in hemopoietic and nonhemopoietic tissues, while the N6B6 and 67D2 mAbs react with both the 103B2/9E10+ and 105A5+ cell subsets (4).

Differential epitope expression has also been described for other members of the sialomucin adhesion receptor family, to which CD164 belongs. The expanding family of sialomucin receptors includes CD34, PCLP, PSGL-1 (CD162), CD45RA, MAdCAM,-1, Sgp200, GlyCAM-1, and CD43 (reviewed in Refs. 6, 7, 8, 9, 10). These molecules are expressed on hemopoietic progenitor cells and/or on associated stromal, macrophage, T lymphoid, and/or endothelial cells in hemopoietic microenvironments, where they function in regulating hemopoiesis, leukocyte trafficking, inflammatory responses, or T cell activation. They are all serine and threonine rich, allowing the potential for extensive O-linked glycosylation. They are either secreted or transmembrane molecules with the ability to extend well above the glycocalyx to promote ligand interactions. The diversity of these sialomucin receptors is further enhanced by alternative splicing and by cell-specific glycosyltransferase-mediated sialyl, fucosyl, or sulfate modifications of their oligosaccharide side chains, which alter mucin function and allow it to be regulated independently of the rest of the molecule (reviewed in Refs. 6, 7, 8, 9, 10). Epitope characterization of these receptors has been very helpful in defining the relationship between the post-translational modifications occurring on these molecules and their specific distribution and functions in various tissues. Some of the sialomucins interact with selectin ligands in vitro, a process that may be abrogated by sialidase or O-siaolglycoprotease treatment of the sialomucin (reviewed in Refs. 6, 7, 8, 9, 10). Their ligand specificities depend on post-translational modifications of the peptide or oligosaccharide side chains, which are tissue specific. For example, correct sulfation and glycosylation allow CD34, PCLP, GlyCAM-1, Sgp200, and MAdCAM-1, to act as high affinity ligands for L-selectin on high endothelial venules of peripheral lymph nodes or endothelia of Peyer’s patches (reviewed in Refs. 6, 7, 8, 9, 10). Like CD164, the PSGL-1, CD34, and CD43 sialomucins may also function as signaling molecules that regulate cell proliferation (11, 12, 13, 14, 15, 16, 17, 18), possibly by enabling other receptor-ligand interactions to occur. These diverse functions are thought to be the result, at least in part, of cell type- and stage-specific oligosaccharide modifications, particularly those involving sialylation (19, 20, 21, 22 ; reviewed in Refs. 6, 7, 8, 9, 10).

In this article we report for the first time the identification of novel isoforms of CD164 and of three classes of epitopes on the CD164 sialomucin. Two of these, the class I and II epitopes, have been shown previously to encompass sites that regulate the adhesion and proliferation of CD34+ cell subsets in vitro (1) (J. Y.-H. Chan et al., manuscript in preparation). These epitopes are differentially glycosylated regions located on the N-terminal mucin-like domain of the CD164 molecule that is encoded by exon 1 of the CD164 gene. This study together with our previous analysis suggest that these glycosylation-dependent epitopes are regulated through cell type-specific post-translational modifications of CD164.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Primary Abs

The murine CD164 mAbs, 103B2/9E10 (mIgG3), 105A5 (mIgM), N6B6 (mIgG2a), and 67D2 (mIgG1), were prepared as previously described (1, 2, 3, 4). The CD66 mAb, clone D14-HD11 (mIgG1), was obtained from the Fifth Leucocyte Culture Conference (23). The CD33 mAb, clone WM-54 (mIgG1), was obtained from Dakopatts (Glostrup, Denmark). The PE-conjugated CD34 mAb, QBEND-10 (mIgG1), was purchased from Cambridge Biosciences (Cambridge, U.K.). The CD34 mAbs, clone My10 (mIgG1) and Tük-3 (mIgG3), were purchased from Becton Dickinson (San Jose, CA) or were provided by Prof. D. Mason (LRF Center, Department of Cellular Sciences, Oxford, U.K.), respectively. As comparative negative controls, irrelevant mAbs of the mIgG1, mIgG2a, mIgM (Dakopatts), and mIgG3 (Southern Biotechnology Associates, Birmingham, AL) isotypes, unconjugated or PE conjugated, were used in place of primary Abs. Abs were used as tissue culture supernatants or purified Ig fractions.

Human bone marrow stromal cells, CD34+ cell isolation, and cell lines

All human cell samples were obtained with patient permission and with ethical consent of the institutions or hospitals concerned. Human bone marrow stromal cells were prepared and stained with the CD164 mAbs using the immunofluorescence technique previously described (2, 4). Human CD34+ cells (>90% purity) were purified from fresh cord samples provided by Prof. J. Hows (Southmead Hospital, Bristol, U.K.), using the Miltenyi Biotech (Bergish Gladbach, Germany) miniMACS CD34 stem cell isolation kit (2). The human KG1a, KG1B, THP-1, U937, CEM, RPMI-1788, TF1, and 293T and the mouse MS.5 cell lines were cultured as previously described (2, 4).

Sialidase and O-sialoglycoprotease treatment of cell lines

Clostridium perfringens sialidase was purchased from Roche (Mannheim, Germany). Pasteurella haemolytica O-sialoglycoprotein endopeptidase (O-sialoglycoprotease) was prepared by Cedarlane Laboratories (Hornby, Canada) and was purchased from Accurate Chemical & Scientific Corp. (Westbury, NY). For enzymatic treatment, 7 x 106 KG1a cells were incubated in 300 µl of PBS or RPMI with or without 0.1 U of C. perfringens sialidase or 120 µg of O-sialoglycoprotease for 60 min at 37°C. Cells were then washed with PBS containing 0.2% (w/v) BSA (PBS-BSA) and 0.1% (w/v) sodium azide before flow cytometric analyses.

Flow cytometric analyses

All analyses were conducted at 4°C. The sialidase- or O-sialoglycoprotease-treated and the untreated cell lines were blocked with FcR-blocking agent (Miltenyi Biotech) according to the manufacturer’s instructions and then labeled with the CD164 mAbs; with the CD34 mAbs, Tük-3 and My10; or with isotype-matched control mAbs followed by FITC-anti-isotype-specific secondary Abs (Southern Biotechnology Associates) as detailed above. Cells were also stained with PE-conjugated QBEND-10 or an irrelevant PE-mIgG1 according to the manufacturer’s protocol. After the addition of 2 µg/ml propidium iodide (Sigma, St. Louis, MO), cells were analyzed on a FACSCalibur using CellQuest software (both from Becton Dickinson, Sunnyvale, CA) (2). Experiments were repeated on at least three independent occasions.

Generation of full-length CD164 cDNA splice variant constructs

CD164 isoforms were PCR amplified from templates subcloned in the pMOS-Blue-T vector (Amersham, Aylesbury, U.K.) after the RT-PCR analyses.4 The CD164(E1–6) and CD164(E{Delta}5) cDNA templates were derived from human kidney, while the CD164(E{Delta}4) cDNA template was derived from human spleen. PCR amplifications were conducted using the Expand high fidelity PCR system (Roche) with 100 ng of the CD164(E1–6), CD164(E{Delta}5), or CD164(E{Delta}4) cDNAs, and 1 µM concentrations of the F164 forward primer (5'-3' GATCGCGGCCGCCGCTGAGGACACGATGTCGCGG) containing a NotI restriction enzyme site and the reverse R6BCD164 SpeI primer (5'-3' GGACTAGTTTACAGAGT GTGGTAATTTCGT) containing a SpeI restriction site after the stop codon. The samples were digested with NotI and SpeI restriction enzymes and subcloned into a similarly digested pEFBos-HPC4-TM vector (24) that removed the HPC4-TM sequence. Positive clones were sequenced as described below, and Maxipreps of each cDNA were prepared using the Promega Megaprep separation protocol (Promega, Madison, WI) according to the manufacturer’s instructions.

Production of transient transfectants expressing CD164 cDNA splice variants

The CD164 splice variant cDNAs were transfected into MS.5 mouse stromal cells at 40–50% confluence using calcium phosphate as a facilitator (2–10 µg of plasmid DNA/well of a 24-well tissue culture plate). At 2 days post-transfection, cells were resuspended and washed twice in PBS and lysed directly in 4x modified Laemmli reducing sample buffer (0.05% (w/v) bromophenol blue, 10% (v/v) glycerol, 0.5% (w/v) SDS, and 5 mM DTT in 0.1 M Tris-HCl, pH 6.8) containing 1x Complete protease inhibitors (Roche) and resolved by 6 or 10% SDS-PAGE before immunoblotting as described below. Transiently transfected cells were also fixed in situ in 24-well plates using a 1-ml 50/50 mixture of acetone/methanol and stained with each CD164 mAb or with an irrelevant isotype-matched control mAb followed by HRP-conjugated goat anti-mouse Ig (Dakopatts) at a 1/1000 dilution (4). Cells were counterstained with Harris’ hematoxylin (Surgipath, Eynesbury, U.K.) and viewed under a Leitz inverted microscope (Leica U.K. Ltd., Milton Keynes, U.K.). Images were captured on a JVC 3-CCD color video camera using the Neotech JVC application (Datacell, Maidenhead, U.K.).

Triton X-100 insolubility studies

KG1a cells (8 x 104) were resuspended in 1% (v/v) Triton X-100 lysis buffer (20 mM Tris-HCl, 1% (v/v) Triton X-100, 150 mM NaCl, and 1x Complete protease inhibitors) and incubated for 30 min at 4°C. After centrifugation at 14,000 rpm for 15 min at 4°C, the supernatant or soluble fraction and the pellet or insoluble fraction, resuspended by the addition of 250 µl of nonreducing 1x Laemmli buffer, were collected. After the addition of Laemmli loading buffer containing 5 mM DTT, the lysate proteins from both fractions were boiled for 5 min, resolved on 8% SDS-PAGE, and immunoblotted as described above.

Generation of recombinant soluble chimeric proteins

Soluble extracellular domain deletion cDNA constructs prepared on the basis of the exon organization and containing regions encoded by exon 1 (CD164(E1)), exons 1 and 2 (CD164(E1–2)), exons 1–3 (CD164(E1–3)), exons 1–4 (CD164(E1–4)), and exons 1–4 plus the extracellular region of exon 6 (6a; CD164(E{Delta}5)) were generated by PCR amplification of the corresponding cDNA fragments from the CD164(E{Delta}5) cDNA in the pGEM-T vector (1). Constructs containing exons 1–5 (CD164(E1–5)) and exons 1–6a (CD164(E1–6a)) were produced from a template generated by PCR amplification of the CD164(E1–6) cDNA (J. Y.-H. Chan et al., manuscript in preparation) derived from a normal human colon sample (Clontech, Palo Alto, CA). PCR amplifications were conducted using the Expand high fidelity PCR system (Roche). Oligonucleotide primers (Genosys Biotechnologies Europe, Cambridge, U.K.) containing NotI or XhoI restriction enzyme sites (as underlined below) were used for PCR and were: F164 forward primer (5'-3'), GATCGCGGCCGCCGCT GAG GAC ACG ATG TCG CGG for all the PCR amplifications plus one of the following reverse amplification primers for each exon; R164(E1), ATCCCTCGAGGG TGC CGG AGT GGT GAC CAG; R164(E2), ATCCCTCGAGTC TTT ACA TTC TAT CCA AAA; R164(E3), ATCCCTCGAGAC GGA ACA GAA GTC TGT CGT; R164(E4), ATCCCTCGAGGT AGA ATTGGC TGT TGG CAC; R164(E5), ATCCCTCGAGGT TGT ACC TGA TGT AGT AAC; and R164(E6a), ATCCCTCGAGAA GGT AGA CTT TCG CAC AGG. The CD164(E1,2,4) and CD164(E1,3,4) cDNA constructs were produced using a two-step PCR strategy. In the first step, exon 1 (E1), exons 1 and 2 (E1,2), exons 3 and 4 (E3,4), and exon 4 (E4) were amplified individually using as the respective forward primers: F164 F(E1, 3), ACC ACT CCG GCA CCA GAT GAG AGC TAT TGT TCA; and F(E2, 4), TGG ATA GAA TGT AAA GTT TCC ACG GCC ACT CCA; and as the respective reverse primers: R(E1, 3), TGA ACA ATA GCT CTC ATC TGG TGC CGG AGT GGT; and R(E2, 4) TGG AGT GGC CGT GGA AAC TTT ACA TTC TAT CCA) and R164 (E4). To generate the CD164(E1,2,4) cDNA, 5 µl of the E1, E2, and E4 PCR products were allowed to anneal together for 10 min at 66°C and thus provided the template for the second step PCR. For the CD164(E1, 3,4) cDNA, 5 µl of E1 and E3,4 PCR products were annealed as described above and provided the template for subsequent PCR amplification. These PCR amplifications were conducted as described above using the F164 forward and R164(E4) reverse primers for both constructs. Soluble recombinant chimeric extracellular domain cDNA Fc-mutated (Fc*) constructs were prepared by digesting the PCR with NotI and XhoI restriction enzymes and subcloning these into the similarly digested IgMu/pEFBOS vector (24), which was provided by Prof. P. Kincade (University of Oklahoma, Norman, OK) and was designed to prevent FcR binding. The non-Fc-mutated constructs, hCD66a-Fc (25) and hCD33(VC)-Fc (26), were prepared in the pIG vector as previously described and used as controls in ELISA and Western blotting analyses. The cDNA inserts were sequenced on a Perkin-Elmer ABI-PRISM 377 DNA sequencer (Perkin-Elmer-Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol using pEFBos forward primer at position 1701–1718 bp (CTCAAGCCTCAGACAGTG), pEFBos reverse primer at position 2845–2828 bp (GGGAGACCTGATACTCTC), pIG specific forward and reverse primers (25, 26), or primers specific for the cDNA sequences. The sequences were analyzed using Sequencher and MacVector software programs (Oxford Molecular, Oxford, U.K.). The Fc and mutated Fc* fusion plasmids were transfected into 293T cells at 70–80% confluence using calcium phosphate as a facilitator (25 µg of plasmid DNA/15-cm diameter tissue culture plate). The Fc/Fc* chimeras produced in the culture supernatants were affinity isolated on protein A-Sepharose (4 Fast Flow; Pharmacia Biotec, Piscataway, NJ) and analyzed as described previously (26).

Purification of CD164 native molecules from KG1a cells

A soluble fraction of detergent lysate was prepared from 2 x 108 KG1a cells as described for Triton X-100 insolubility studies. This material was passed twice over a 1-ml column of protein A-Sepharose. The unbound material was then passed over a 1-ml protein A-Sepharose to which 1 mg of purified N6B6 mAb had been bound and covalently coupled with dimethyl pimelimidate (Pierce, Rockford, IL). After washing with PBS containing 0.1% Triton X-100, the bound material was eluted with 100 mM triethylamine containing 0.1% Triton X-100 and neutralized with 0.1 vol of 3 M Tris (pH 6.8); a 1/200 dilution of the resulting material was analyzed on SDS-PAGE followed by Western blotting with CD164 mAbs.

Enzymatic treatment and immunoblotting of modified soluble constructs

Five-microgram aliquots of the lyophilized CD164(E1–3)-Fc* and CD164(E1–6a)-Fc* constructs or a 1/50 dilution of lyophilized CD164 purified from KG1a cells were left untreated or were treated for 16 h at 37°C with N-glycosidase F (200 µU/ml; Flavobacterium meningosepticum enzyme; Roche) in 10 mM sodium phosphate buffer, pH 6; with sialidase (500 µU/ml C. perfringens enzyme; Roche) in 10 mM sodium phosphate buffer, pH 6; with O-glycosidase (50 µU/ml Streptococcus pneumoniae enzyme; Oxford Glycosystems, Abingdon, U.K.) in 100 mM sodium citrate/phosphate buffer, pH 6; with {alpha}-fucosidase (250 µU/ml bovine kidney enzyme; Oxford Glycosystems) in 100 mM sodium citrate/phosphate buffer, pH 6, separately or in combination for the removal of N- and O-linked carbohydrates. The soluble constructs CD164(E1–3)Fc* and CD164(E1–6a)-Fc* were also treated with 250 µg/ml O-sialoglycoprotease in PBS containing 1 mM CaCl2, pH 7.2. The CD33-Fc construct was used as a negative control. All samples were heated for 5 min at 95°C in 2x Laemmli sample buffer (5% (v/v) glycerol, 0.25% (w/v) SDS, and 0.025% (w/v) bromophenol blue in 0.05 M Tris-HCl, pH 6.8) with 5 mM DTT and electrophoresed on 10% SDS-PAGE gels. One gel was stained with Coomassie blue. Four gels were transferred onto polyvinylidene difluoride Immobilon membranes (Millipore, Watford, U.K.) at 9 V for 1 h using a Semiphor semi-dry blot apparatus (Pharmacia Biotech) following the manufacturer’s directions. The membranes were blocked overnight at 4°C in PBS-T (PBS with 0.05% (v/v) Tween-20) buffer plus 5% (w/v) nonfat powdered milk and then incubated with primary Ab for 30 min at room temperature. After washing in PBS-T, a peroxidase-conjugated goat anti-mouse Ig (Dakopatts) Ab diluted 1/5000 in PBS-T was applied for a further 30 min. Following extensive washing in PBS-T, blots were developed using the ECL system (Amersham) as described by the manufacturer.

ELISA analysis of proteins

Maxisorp 96-well Nunc (Life Technologies) or Immulon 4 (Dynatech, Dynal, Oslo, Norway) flat-bottom ELISA plates were coated with untreated or enzyme-treated chimeric proteins (10 µg/ml) in PBS overnight at 4°C, washed, and then blocked with PBS containing 2% (w/v) BSA (fraction V; Sigma) and 0.02% (v/v) Tween-20 before incubation with CD164, CD66a, and CD33 or appropriate isotype-matched negative control mAbs. The assays were developed with alkaline phosphatase-conjugated goat anti-mouse Ig (1/4000 dilution; Dakopatts) and para-nitrophenylpentene (Sigma), and the absorbance was read at 405 nm in a Bio-Rad model 450 plate reader (Bio-Rad Laboratories, Hercules, CA) (2).

Competitive binding assays

Maxisorp plates were coated with CD164(E1–3)-Fc* and washed using the same conditions as for the ELISA analysis. CD164(E1–3)-Fc*-coated constructs were then blocked with 103B2/9E10, 105A5, N6B6, or 67D2 as undiluted tissue culture supernatants or with isotype-matched negative control Abs at 10 µg/ml. After washing, each CD164 mAb was added to the preblocked constructs, and their reactivities were determined by the addition of FITC-conjugated anti Ig isotype-specific secondary Abs. The fluorescence was detected on a Cytofluor II microplate fluorescence reader (PerSeptive Biosystems, Hertford, U.K.) using a wavelength of 485 nm for excitation. The percent binding was calculated as follows: 100 - [(fluorescence reading for each CD164 mAb binding to the CD164(E1–3)-Fc* protein in the presence of the blocking CD164 mAb) divided by (fluorescence reading for each CD164 mAb binding to the CD164(E1–3)-Fc* protein in the presence of the appropriate isotype matched negative control mAb) x 100]. Results are presented as the mean ± SD of triplicate determinations, and the experiment was repeated twice.

Immunoblotting of cell lysates

The equivalent of 8 x 104 exponentially growing cell lines or 1 x 104 cultured human bone marrow stromal reticular, cord blood CD34+ purified cells or bone marrow mononuclear cells were resuspended in 1x nonreducing Laemmli loading buffer (62.5 mM Tris-HCl, 2% (w/v) SDS, 10% (v/v) glycerol, and 0.1% (w/v) bromophenol blue, pH 6.8) containing 1x Complete protease inhibitors (Roche) plus 5 mM DTT as described above and boiled for 5 min, and lysate proteins were fractionated using 6 or 10% SDS-PAGE. The proteins were transferred to polyvinylidene difluoride Immobilon membranes and immunoblotted with either the CD164 mAbs or isotype-matched negative controls as described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of three isoforms of CD164

We have defined the genomic structure of human CD164 (J. Y.-H. Chan et al., manuscript in preparation) and have shown that this gene comprises six exons (E1–6) that undergo alternative splicing to generate at least three isoforms. These are the full-length isoform, CD164(E1–6), the originally identified CD164 or CD164(E{Delta}5) isoform that lacks exon 5, and the CD164(E{Delta}4) variant that has exon 4 spliced out. The full-length isoforms are shown diagrammatically in Fig. 1GoA. The peptide encoded by exon 1 is predicted to be heavily glycosylated with three potential N-linked glycosylation sites and nine potential O-linked glycosylation sites (Fig. 1Go). This exon 1 generates the first mucin-like domain of CD164. Peptides encoded by exons 2 and 3 do not contain any predicted O-linked glycosylation sites, but each possesses two potential N-linked glycosylation sites, and they contain all eight cysteine residues from the extracellular domain. This defines the cysteine-rich region that separates the two mucin domains. The second mucin-like domain is defined by peptides derived from exons 4, 5, and 6, which, like the exon 1-encoded peptide, is predicted to be very highly O-glycosylated, with six potential sites encoded on exon 4, 10 on exon 5, and seven on exon 6. In addition, peptides encoded by exons 4 and 6 have one potential N-linked glycosylation site each (Fig. 1Go). Thus, CD164(E{Delta}4) and CD164(E{Delta}5) have a smaller second mucin domain comparatively to the CD164(E1–6) molecule. This CD164(E1–6) molecule contains a putative membrane-proximal glycosaminoglycan attachment site situated at the splice junction between peptides derived from exons 5 and 6. This is missing in the CD164(E{Delta}5) isoform.



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 1. Structure and sequences of the CD164 isoforms. A, Schematic representations of the CD164(E1–6), CD164(E{Delta}4), and CD164(E{Delta}5) sialomucins. , mucin domains; {square}, the cysteine-rich domain; {circ}, potential N-linked carbohydrates; horizontal bars with or without arrows, potential O-linked carbohydrates; arrows, potential sialic acid motifs on O-linked carbohydrates. B, cDNA of CD164(E1–6) and its deduced amino acid sequences indicated in triplet codons. E1 to E6 represent exon-encoded domains. E6a, E6b, and E6c are regions of exon 6 that encode the extracellular domain, the transmembrane region (TM), and the cytoplasmic tail, respectively. The two dark gray boxes represent the two mucin domains. , the cysteine residues; {circ} , the predicted O-linked carbohydrate residues; , the predicted N-linked carbohydrate residues. The transmembrane region is underlined and shadowed. The putative glycosaminoglycan attachment site is indicated in the lightly shaded box, and the potential tyrosine kinase phosphorylation site is shown by an asterisk. The GenBank accession number is AF263279.

 
The CD164 mAbs do not distinguish between the different CD164 splice variants but recognize distinct domains on CD164

Our initial studies identified four mAbs, 103B2/9E10, 105A5, N6B6, and 67D2, that recognize human CD164 when expressed in FDCP-1 transfectants (1, 2, 3, 4). Two of the mAbs, 103B2/9E10 and 105A5, mediate functional effects in vitro (1) (J. Y.-H. Chan et al., manuscript in preparation). These effects, which are summarized in Fig. 2Go, indicate that while the 103B2/9E10 mAb can partially inhibit the adhesion of CD34+ cells to bone marrow stroma (Fig. 2GoA), both the 103B2/9E10 and 105A5 mAbs inhibit nucleated cell production in liquid cultures (Fig. 2GoB) and colony formation by primitive granulocyte-monocyte (Fig. 2GoC) and erythroid (Fig. 2Go D) precursors in clonogenic assays from CD34+ cells. From single cell studies, the 103B2/9E10 mAb has been shown to prevent recruitment of CD34+CD38low/- cells into cycle in the presence of IL-3, IL-6, G-CSF, and SCF (Fig. 2GoE).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 2. Functional effects of the CD164 mAbs, 103B2/9E10 and 105A5, in vitro. A, Human bone marrow CD34+ cells (104) labeled with 51Cr were incubated at 4°C in RPMI 1640 medium with 2% FCS containing 2 µg/100 µl of the CD164 mAbs, 103B2/9E10 and 105A5, or with a cocktail of mAbs to the VLA-4 and VLA-5 integrins, P4C2 and PHM2, or a cocktail of isotype-matched mIgG3 and mIgM nonbinding negative control mAbs and then transferred to each well of a 96-well plate containing 104 allogeneic cultured human bone marrow stromal reticular cells per well. Unbound cells were removed, and adhesion was quantitated by liquid scintillation counting of Triton X-100-solubilized lysates. Data are presented as the mean ± SEM for three experiments as a percentage of the control adhesion in the presence of the nonbinding mAb control, which has been normalized to 100%. B, Human bone marrow CD34+ cells (103) were cultured in triplicate in serum-deprived medium containing 10 ng/ml of each of the recombinant human cytokines, IL-1ß, IL-3, IL-6, G-CSF, GM-CSF, and SCF, in the presence of 10 µg/ml of the CD164 mAbs, 103B2/9E10 and 105A5, or with isotype-matched mIgG3- and mIgM-negative control mAbs. Additional factors and mAbs were added on days 7, 14, and 21 of culture. Nucleated cells were harvested on day 28 and counted. Data are the mean ± SEM (n = 3) of nucleated cells generated in the presence of the negative isotype-matched control mAbs, which have been normalized to 100%. C and D, Human bone marrow CD34+ cells (103) were incubated with 30 µg/ml of the CD164 mAbs, 103B2/9E10 and 105A5, or the isotype-matched mIgG3 or mIgM negative controls for 1 h at 4°C. Cells were plated in 0.9% methocel supplemented with 10 ng/ml each of recombinant human IL-1ß, IL-3, IL-6, G-CSF, GM-CSF, erythropoietin, and SCF. Results are the mean ± SEM for three experiments, expressed as a percentage of the value in day 14 clonogenic cells, CFU-GM (C), or erythrocyte blast-forming units (BFU-E) (D), from cultures containing CD164 mAbs over those containing the negative isotype-matched mAbs, which have been normalized to 100%. E, Terasaki wells were coated with 0.5 µl of 30 µg/ml CD164 mAb, 103B2/9E10, with an isotype-matched negative control mIgG3 mAb, or with an anti-ß1 integrin mAb, P4C2. Single CD34+CD38low/- human bone marrow cells were added to each well and cultured in serum-deprived medium containing IL-3 (10 ng/ml), IL-6 (10ng/ml), G-CSF (100 ng/ml), and SCF (100 ng/ml). One hundred twenty wells were analyzed for each set of conditions. Plates were monitored on day 10 of culture to determine which cells underwent at least one cell division. The data are expressed as the mean ± SD percentage of dividing cells compared with the mIgG3-negative control culture, which was normalized to 100%.

 
Reactivity of mAbs with splice variants of CD164

All four CD164 mAbs stain CD34+ hemopoietic cell subsets (1, 2, 3, 4), and as shown in Fig. 3GoA, they all stain cultured human bone marrow stromal reticular cells. cDNAs encoding the three CD164 splice variants, CD164(E1–6), CD164(E{Delta}5), and CD164(E{Delta}4), were transiently transfected into the mouse stromal cell line, MS.5, and their protein products were analyzed by immunohistochemistry and immunoblotting. All the CD164 mAbs reacted with the splice variants produced by these cells, indicating that the epitopes recognized by the 103B2/9E10, 105A5, N6B6, and 67D2 mAbs were not located on or did not encompass peptides encoded by exons 4 and 5. This is illustrated in Fig. 3GoB for two of the CD164 mAbs, N6B6 and 103B2/9E10. On Western blots probed with 103B2/9E10, 105A5, or N6B6, the apparent m.w. of the proteins expressed by the splice variants varied slightly, but fell within the range of 80–100 kDa that is observed for CD164 on human bone marrow, on bone marrow stromal reticular cells, on CD34+ hemopoietic progenitors, and on a set of hemopoietic cell lines representing different lineages. Examples of the protein products detected with these mAbs after SDS lysis of hemopoietic cell lines are shown in Fig. 3GoC (lanes 1–7) and Fig. 4Go. These mAbs identified the different CD164 epitopes on cell lines representing different hemopoietic lineages to differing degrees, but were all strongly reactive with the most immature CD34+ hemopoietic multipotential progenitor cell line, KG1a (Fig. 4GoA). This is consistent with our findings that all CD164 epitopes identified to date are highly expressed on the most primitive CD34+ cell subsets from normal bone marrow, cord blood, and fetal liver (1, 2, 3, 4). Some variability in apparent m.w. was also apparent among the cell lines, with the promonocytic cell line, THP-1 (Fig. 4GoA), and the myelomonocytic cell line, HL60 (data not shown), exhibiting the lowest electrophoretic mobilities of SDS-PAGE. It is unclear from the present studies if this molecular mass variability is due to glycosylation differences among CD164 molecules on different hemopoietic lineages or reflects the expression of different CD164 splice variants. These studies are currently under investigation. It was of further interest to note that while the monomeric form of CD164 (80–100 kDa) was found after SDS lysis of cells with all four CD164 mAbs, the 67D2 mAb also detected a band with an apparent Mr >220 kDa. This is illustrated in Fig. 3GoC (lanes 8–10) on a blot of human bone marrow, of human cord blood CD34+ hemopoietic cells, and of cultured bone marrow stromal reticular cells. This additional high molecular mass band may represent a Triton X-100-insoluble form of the CD164 molecule caused by multimeric association, cytoskeletal interaction with its cytoplasmic tail, or glycosaminoglycan (GAG) modification. This insoluble form remains accessible to binding by the 67D2 mAb, but not by the other three CD164 mAbs. To test this possibility, we lysed KG1a cells with Triton X-100 and collected the Triton X-100-soluble and -insoluble fractions. These fractions were then boiled with SDS lysis buffer containing 5 mM DTT and subjected to SDS-PAGE followed by immunoblotting with the different CD164 mAbs. As indicated in Fig. 4GoB, all CD164 mAbs reacted with the 80- to 100-kDa CD164 monomer and with the 160- to 180-kDa CD164 dimer in the Triton X-100-soluble fraction as has been documented previously for Triton X-100 lysis conditions (1). In contrast, 67D2 was the only CD164 mAb to react with a Mr species >220 kDa that was derived from the Triton X-100-insoluble fraction (Fig. 4GoB, 67D2, lane 2). Since this insoluble form of CD164 has been identified at 320 kDa, it could represent a tertrameric form of the molecule. Further studies are in progress to identify this hypothetical tetrameric association and to characterize possible cytoskeletal elements or GAGs that might bind to the CD164 sialomucin.



View larger version (110K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of CD164 epitopes by stromal reticular cells and MS.5 transfectants. A, Immunofluorescence staining of cultured human bone marrow stromal reticular cells with CD164 mAbs: mAb 103B2/9E10 (a), mAb 105A5 (c), mAb N6B6 (e), and mAb 67D2 (g). Isotype-matched negative control mAbs for each CD164 mAb are shown as insets (b, d, f, and h). B, MS.5 cells were transfected with CD164(E1–6) (a and e), CD164(E{Delta}4) (b and f), CD164(E{Delta}5) (c and g), or left untransfected (d and h). Cells were stained with either N6B6 (a–d) or 103B2/9E10 (e–h) using the immunoperoxidase technique. C, Immunoblot analyses of CD164. Nontransfected MS.5 cells (lane 1) or MS.5 cells transfected with the different CD164 splice variants are shown: CD164(E1–6) (lane 2), CD164(E{Delta}4) (lane 3), and CD164(E{Delta}5) (lane 4) were lysed in Laemmli SDS lysis buffer containing 5 mM DTT and immunoblotted with N6B6 (lanes 1–4). Human bone marrow cells (lanes 5 and 8), CD34+ purified cord blood cells (lanes 6 and 9), or cultured bone marrow stromal reticular cells (lanes 7 and 10) were lysed and immunoblotted with N6B6 (lanes 5–7) or 67D2 (lanes 8–10). Molecular mass markers were myosin (220 kDa), phosphorylase b (97.4 kDa), BSA (69 kDa), OVA (46 kDa), and carbonic anhydrase (31 kDa).

 


View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 4. Immunoblot analyses of CD164 from hemopoietic cell lines. A, TF1 (lane 1), KG1a (lane 2), KG1b (lane 3), U937 (lane 4), THP1 (lane 5), CEM (lane 6), and RPMI 1788 (lane 7) cells, were lysed in SDS-Laemmli lysis buffer containing 5 mM DTT and resolved by 10% SDS-PAGE before immunoblotting with N6B6, 103B2/9E10, or 105A5 as indicated below each blot. B, KG1a cells were lysed with 1% SDS (lane 1) or 1% Triton X-100 (lanes 2 and 3). The Triton X-100-insoluble fraction was solubilized in SDS before analysis. The distribution of the CD164 monomer and dimer and the >220-kDa complex between the Triton X-100-soluble (lane 3) and Triton X-100-insoluble (lane 2) fractions was assessed by immunoblotting with the four CD164 mAbs as indicated below each blot. The Mr markers were the same as those shown in Fig. 3GoC.

 
Reactivity of mAbs with CD164 domain truncation mutants.

To characterize the epitopes recognized by the different CD164 mAbs, a set of nine domain truncation mutants were produced in 293T cells: CD164(E1)-Fc*, CD164(E1–2)-Fc*, CD164(E1–3)-Fc*, CD164(E1–4)-Fc*, CD164(E1–5)-Fc*, CD164(E{Delta}5)-Fc*, CD164(E1–6a)-Fc*, CD164(E1, 2, 4)-Fc*, and CD164(E1, 3, 4)-Fc* (Fig. 5GoA). On SDS-PAGE, all purified soluble constructs were resolved as single glycosylated protein bands, except CD164(E1)-Fc*, which occurred as two isoforms: one highly glycosylated and one lacking some oligosaccharide side chains (Fig. 5GoA). This was confirmed by the fact that the additional lower molecular mass band was not recognized by 103B2/9E10 (data not shown), which is dependent on both N- and O-linked glycosylation for binding, but is detected by the 105A5 mAb, which binds sialic acid moieties on O-linked glycans (see below). To localize the epitopes for these mAbs more precisely, the 103B2/9E10, 105A5, N6B6, and 67D2 mAbs were analyzed in a solid phase ELISA assay for their reactivities with the soluble CD164-Fc* domain deletion constructs. The 103B2/9E10 and 105A5 mAbs recognized all nine soluble proteins, indicating that they react with the region encoded by exon 1 (Table IGo). N6B6 and 67D2 recognized the CD164(E1–3)-Fc*, CD164(E1–4)-Fc*, CD164(E1–5)-Fc*, CD164(E1–6a)-Fc*, and CD164(E{Delta}5)-Fc* proteins, but not the CD164(E1)-Fc* and CD164(E1–2)-Fc* constructs (Table IGo), suggesting either that they reacted minimally with epitopes encoded by exon 3 or with specific epitopes created by tertiary folding of exons 1–3. To determine whether the N6B6 and 67D2 mAbs reacted exclusively with epitopes on exon 3 or with more complex epitopes on multiple exons, two additional soluble proteins CD164(E1, 3, 4)-Fc* and CD164(E1, 2, 4)-Fc* were generated. These were encoded by exons 1, 2, and 4 or exons 1, 3, and 4 and linked to the mutated Fc region of human IgG1. As expected, the 103B2/9E10 and 105A5 mAbs reacted with both these proteins. However, the N6B6 and 67D2 mAbs did not (Table IGo). These results were verified by immunoblotting of the CD164-Fc* series with the CD164 mAbs (data not shown) and demonstrate that the latter mAbs require the exon 3-encoded peptide for epitope recognition, but that they are unable to identify the exon 3-derived peptide in the absence of the exon 2-encoded region. In competitive binding assays, the 103B2/9E10 and 105A5 mAbs did not significantly compete with one another or with the N6B6 or 67D2 mAbs for binding to the CD164(E1–3)-Fc*-soluble protein. For example, when the 103B2/9E10 mAb was used to block binding of the 105A5, N6B6, and 67D2 mAbs to the CD164(E1–3)-Fc* construct, no inhibition was observed (0.5 ± 0.4, 1.6 ± 0.4, and 2.4 ± 1.3% inhibition, respectively). Similarly, the 105A5 mAb did not block the binding of 103B2/9E10, N6B6, or 67D2 mAbs (0.3 ± 1, 2.5 ± 0.4, and 1.9 ± 0.5% blocking, respectively). However, N6B6 partially blocked the binding of 67D2 and vice versa (73.8 ± 0.5 and 47.1 ± 0.9% inhibition, respectively), but did not substantially block that of 105A5 or 103B2/9E10 (14.7 ± 0.6 and 1.2 ± 2.5% inhibition for N6B6, and 15.1 ± 0.7 and 0% inhibition for 67D2, respectively).



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 5. N6B6 and 67D2 mAbs recognize conformationally dependent epitopes. A, CD164-Fc* domain truncated chimeric proteins. Two micrograms of each purified protein were resolved by 10% SDS-PAGE under reducing conditions and visualized with Coomassie blue. Approximate molecular masses deduced from electrophoretic mobilities are: CD164(E1)-Fc*, 50 kDa (lane 1); CD164(E1–2)-Fc*, 65 kDa (lane 2); CD164(E1–3)-Fc*, 80 kDa (lane 3); CD164(E1–4)-Fc*, 90 kDa (lane 4); CD164(E1–5)-Fc*, 95 kDa (lane 5); CD164(E{Delta}5)-Fc*, 95 kDa (lane 6); CD164(E1–6a)-Fc*, 100 kDa (lane 7); CD164(E1, 2, 4)-Fc*, 80-kDa (lane 8), and CD164(E1, 3, 4)-Fc*, 75 kDa (lane 9). B, Aliquots of the CD164(E1–3)-Fc* soluble chimeric proteins were treated with different concentrations of DTT (0–100 mM), analyzed by 10% SDS-PAGE, and immunoblotted with the CD164 mAbs 103B2/9E10, 105A5, N6B6, and 67D2. Human CD33-Fc was resolved with 5 mM DTT and immunoblotted with each CD164 mAb and is represented a negative control (Co). The molecular mass markers were the same as those shown in Fig. 3GoC.

 

View this table:
[in this window]
[in a new window]
 
Table I. Reactivity of CD164 mAbs with domain truncation-soluble recombinant CD164 proteinsa

 
The N6B6 and 67D2 epitopes are conformationally dependent

In view of the fact that exons 2 and 3 contain all eight cysteine residues that occur in the extracellular domain (Fig. 1GoB), we considered the possibility that disulfide bridges may strongly influence the conformation of CD164 and thus be intrinsic to the epitopes recognized by the CD164 mAbs. As shown in Fig. 5GoB, in the absence of reducing agents, the soluble CD164(E1–3)Fc* construct formed dimers via disulfide linkages at the hinge region of the human IgG1 Fc, while in 5 mM DTT or above, the protein was monomeric. Treatment of the CD164(E1–3)-Fc* soluble recombinant protein with increasing concentrations of DTT resulted in the loss of the epitopes recognized by N6B6 and 67D2. Reducing conditions (>=20 mM DTT) were sufficient to perturb the N6B6 and 67D2 epitope reactivities on the CD164(E1–3)-Fc* construct, while 103B2/9E10 and 105A5 epitopes were not affected by DTT even at high concentrations (Fig. 5GoB). These results indicate that the N6B6 and 67D2 mAbs recognize conformationally dependent epitopes, involving disulfide bond formation between exons 2 and 3 as shown in Fig. 1GoA.

N- and O-linked oligosaccharide side chains are involved in epitope recognition by CD164 mAbs

Deglycosylation experiments were conducted to determine whether oligosaccharide residues contribute to the CD164 epitopes recognized by the 103B2/9E10, 105A5, 67D2, and N6B6 mAbs. In the first set of experiments the KG1a cell line was treated with sialidase or O-sialoglycoprotease and analyzed by flow cytometry for CD164 mAb binding (Fig. 6Go). The CD34 mAbs, My10, QBEND-10, and Tük-3, which recognize epitopes that are differentially sensitive to sialidase and O-sialoglycoprotease, served as controls for this analysis (Fig. 6Go). In the second set of experiments, CD164(E1–3)-Fc* soluble proteins and CD164 purified from KG1a cells (CD164(KG1a)) were subjected to N-glycanase, O-glycosidase, sialidase, {alpha}-fucosidase, and O-sialoglycoprotease treatments, either separately or together, as indicated in Fig. 7Go. In these latter experiments O-sialoglycoprotease and N-glycanase treatment alone or in combination with the other enzymes dramatically decreased the apparent molecular mass of the soluble constructs. However, sialidase and O-sialoglycoprotease treatment of the native CD164(KG1a) molecule reduced its mobility in SDS-PAGE due to the removal of negative charges present on sialic acid (Fig. 7Go, E–H). After O-glycosidase treatment only partial deglycosylation was observed on CD164(E1–3)-Fc*, since two bands, the original CD164 and a lower Mr band of 60-kDa, were detected after electrophoresis.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 6. Sialidase and O-sialoglycoprotease treatment of KG1a cells identifies three classes of CD164 epitopes. KG1a cells were untreated or enzymatically digested for 1 h at 37°C, then stained with CD164 mAbs (unbroken lines) or isotype-matched negative control mAbs (dotted lines). CD34 mAbs class I (My10), class II (QBEND-10), and class III (Tük3) were used in parallel to stain KG1a cells, and values are shown in the table with their isotype-matched negative controls. Cells were analyzed for fluorescence staining using a FACScalibur flow cytometer. For each Ab, the upper histogram represents the staining of untreated cells; the middle histogram shows the staining of sialidase-treated cells; and the lower histogram shows the staining of O-sialoglycoprotease-treated cells. Values represent the median fluorescence intensity (MFI) ± SD for three individual experiments.

 


View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 7. Enzymatic treatment of the soluble CD164(E1–3)-Fc* protein and the native CD164 protein purified from KG1a cells distinguishes the CD164 epitopes. Chimeric CD164(E1–3)-Fc* (A–D) or native CD164-KG1a (E–H) purified proteins were lyophilized and treated with different glycosidases. Proteins were incubated with N-glycanase (N), O-glycosidase (O), sialidase (S), {alpha}-fucosidase (F), O-sialoglycoprotease (P), O-glycosidase and sialidase (OS), or sialidase and {alpha}-fucosidase (OSF) as indicated above the immunoblots. The untreated proteins (U) were incubated under the same conditions as the treated molecules. Each sample was electrophoresed on 10% SDS-PAGE gels (0.2 µg protein/lane) before immunoblotting with CD164 mAbs 103B2/9E10 (A and E), 105A5 (B and F), N6B6 (C and G), and 67D2 (D and H). The molecular mass markers were the same as those shown in Fig. 3GoC.

 
Only the 105A5 epitope is C. perfringens sialidase sensitive

Our results show that by treating hemopoietic cell lines, such as KG1a, which expresses the CD164 epitopes, with C. perfringens sialidase, we were able to abrogate binding by the 105A5 mAb, but not with the other CD164 mAbs tested (Fig. 6Go). The failure of the 105A5 mAb to immunoblot either the CD164(E1–3)-Fc* soluble protein or the CD164(KG1a) protein after treatment with C. perfringens sialidase confirmed that the 105A5 epitope was sialic acid dependent (Fig. 7Go, B and F). Using the fact that N-glycanase did not remove the 105A5 epitope from CD164(E1–3)-Fc* or CD164(KG1a) (Fig. 6Go, B and F) and that O-glycosidase is unable to digest long chain O-linked glycans without prior sialidase treatment, it appears that the sialic acids intrinsic to the 105A5 epitope are most likely situated on O-glycosylated chains attached to the exon 1-encoded peptide and not on N-linked oligosaccharides (Fig. 1GoB). In contrast to the 105A5 epitope, the 103B2/9E10, N6B6, and 67D2 epitopes were not affected by C. perfringens sialidase treatment of either KG1a cells (Fig. 6Go), or CD164(KG1a) protein (Fig. 7Go, E, G, and H) or the soluble CD164(E1–3)-Fc* protein (Fig. 7Go, A, C, and D). This was confirmed in an ELISA analysis in which the four CD164 mAbs were examined for their ability to bind to the native or sialidase-treated soluble CD164(E1–3)-Fc* construct attached to microtiter wells. In these experiments, sialidase treatment reduced the binding of the 105A5 mAb by 76 ± 1%, but did not reduce the binding of the other CD164 mAbs (data not shown).

Both the 105A5 and 103B2/9E10 epitopes are O-sialoglycoprotease sensitive

Preincubation of KG1a cells with O-sialoglycoprotease significantly reduced the binding of the 103B2/9E10 and 105A5 mAbs as measured by flow cytometry (Fig. 6Go). The other CD164 epitopes were not affected by this treatment. To confirm these studies, the CD164(E1–3)-Fc* protein or the CD164(KG1a) protein was treated with O-sialoglycoprotease, and the resulting protein was analyzed in the presence of 5 mM DTT on SDS-PAGE followed by immunoblotting with the CD164 mAbs. By Coomassie blue analysis, this treatment of the soluble protein reduced its apparent Mr to approximately 65 kDa (data not shown). Neither the 103B2/9E10 nor the 105A5 mAbs bound to this 65-kDa fragment, whereas both N6B6 and 67D2 were found to bind (Fig. 7Go, C and D, respectively). These experiments were repeated with CD164(E1–6a)-Fc*, and the same decrease in the apparent molecular mass was observed (data not shown), indicating than the first mucin domain contained the only cleavage site for the O-sialoglycoprotease enzyme. The sensitivity of CD164 epitopes to O-sialoglycoprotease was similar to that of purified CD164(KG1a) (Fig. 7Go, E–H). These studies demonstrate the partial removal of the exon 1-encoded region identified with 105A5 and 103B2/9E10 mAbs from CD164 on KG1a cells, and its complete removal from the soluble CD164(E1–3)-Fc* molecule by O-sialoglycoprotease treatment. Furthermore, they indicate that the region encoded by exon 1 is not essential for epitope recognition by the N6B6 and 67D2 mAbs.

Recognition of the 103B2/9E10 epitope requires N-linked carbohydrate attachment

The 103B2/9E10 epitope (but not the 105A5, N6B6, or 67D2 epitopes) was sensitive to N-glycanase treatment either on soluble CD164(E1–3)-Fc* protein or CD164(KG1a) protein (Fig. 7Go). This was confirmed in an ELISA analysis in which the four CD164 mAbs were examined for the ability to bind to the native or N-glycanase-treated soluble CD164(E1–3)-Fc* construct attached to microtiter wells. In these experiments removal of N-linked carbohydrates reduced the binding of the 103B2/9E10 mAb by 63.1 ± 6.9%, but did not reduce the binding of the other CD164 mAbs (data not shown). Hence, the 103B2/9E10 epitope is dependent on the N-linked carbohydrates of exon 1 (Fig. 1Go).

The N6B6 and 67D2 mAbs bind deglycosylated CD164

Our results demonstrate that the N6B6 and 67D2 epitopes on CD164(E1–3)-Fc* or on CD164(KG1a) are not removed by the deglycosylation procedures used, since N6B6 and 67D2 still recognize the different deglycosylated forms (Fig. 7Go, C, D, G, and H). Only N-glycanase and O-sialoglycoprotease treatments of the soluble chimeric molecule appear to reach complete deglycosylation, since treatment with O-glycosidase only partially removed the O-linked carbohydrates. This is evidenced by the fact that the 80-kDa molecule is the major band detected by Coomassie blue staining (data not shown), with an additional weaker band at approximately 60 kDa being detected by immunoblotting with the N6B6 and 67D2 mAbs (Fig. 7Go, C and D), but not with 103B2/9E10 or 105A5 mAbs (Fig. 7Go, A and B). This partial digestion with O-glycosidase was improved by the prior addition of exoglycosidases such as sialidase or {alpha}-fucosidase (Fig. 7Go, C and D, lanes OS and OSF), but even in the presence of these enzymes, O-glycosidase did not completely digest the original CD164(E1–3)-Fc* protein.

Identification of three classes of CD164 epitopes

The CD34 mAbs have been classified into three classes based on their sensitivities to sialidase and O-sialoglycoprotease (27). Thus, by comparing CD164 mAbs with the CD34 mAb classes, it has been possible to subtype the CD164 mAbs into three analogous categories. Like the CD34 epitope, My10, the CD164 epitope, 105A5, is sensitive to both C. perfringens sialidase and O-sialoglycoprotease treatments and can be classified as a class I epitope (Fig. 8Go). The CD164 epitope, 103B2/9E10, is similar to the CD34 epitope, QBEND 10, in that it is sensitive to O-sialoglycoprotease, but not to C. perfringens sialidase, and can be classified as a class II epitope (Fig. 8Go). Interestingly, this 103B2/9E10 epitope is also sensitive to N-glycanase digestion. The CD164 epitopes, N6B6 and 67D2, and the CD34 epitope, Tük3, are insensitive to both C. perfringens sialidase and O-sialoglycoprotease enzymes and can therefore be classified as class III epitopes (Fig. 8Go). From our results on the differential binding of the N6B6 and 67D2 mAbs to the Triton X-100-insoluble cell fraction (Fig. 4Go), we are able to group the class III epitopes into two subclasses. The subclass IIIA mAb N6B6 does not bind to the 320-kDa Triton X-100-insoluble material, whereas the subclass IIIB mAb 67D2 reacts with the Triton X-100-insoluble material.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 8. Schematic representation of CD164 epitopes deduced from glycosidase treatments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our previous studies have demonstrated that CD164 is expressed on CD34+ hemopoietic progenitor cells and bone marrow stroma (1, 2, 3, 4). Evidence that 103B2/9E10 mAb inhibits the adhesion of CD34+ cells to bone marrow stroma and that this same mAb or the 105A5 mAb prevents recruitment of quiescent hemopoietic progenitor cells into cell cycle (1) has heightened interest in this molecule. In this paper we have identified for the first time three classes of epitopes on CD164: the class I 105A5, the class II 103B2/9E10, and the class III N6B6 and 67D2 epitopes. We have shown previously that these epitopes are differentially distributed on distinct cell types in the adult (4). The variation in epitope distribution observed may be explained by the experiments conducted in this paper. Analyses of mAb binding to splice variants and to soluble domain deletion constructs of human CD164 as well as analyses of the differential sensitivity of CD164 epitopes to sialidase, O-sialoglycoprotease, and N-glycanase digestions indicate that both the class I and class II epitopes of CD164 encompass different oligosaccharide modifications of the first mucin domain of CD164. The class I epitope is associated with long chain sialylated O-linked glycans, while the 103B2/9E10 class II epitope is dependent on both N- and O-linked glycosylation of CD164. The class III epitopes, N6B6 and 67D2, appear to be more dependent on the peptide backbone than on carbohydrate modifications. These latter epitopes are not removed by any of the glycosidases used, but encompass the cysteine-rich domain that is encoded by exons 2 and 3 of the CD164 gene and that forms a link between mucin domains I and II. Moreover, 67D2 appears to recognize a Triton X-100-insoluble form of CD164 that could represent a tetrameric form of CD164, an aggregate formed by interaction with cytoskeletal elements, or a CD164 isoform modified by GAG attachment as described previously for CD44 (28, 29) and syndecan (30). Thus, N6B6 and 67D2 mAbs appear to predominantly identify the core CD164 peptide upon which specific oligosaccharide modifications encompassing the 103B2/9E10 and 105A5 epitopes are arrayed and are responsible for both their more restricted patterns of expression and the functional significance of this molecule.

The classification of the CD164 epitopes presented in this paper is reminiscent of certain structural features of the CD34 molecule. Three classes of epitopes on CD34 have been defined on the basis of their sensitivities to sialidase and O-sialoglycoprotease treatments (27, 31, 32). Like CD164, the CD34 class I epitopes are sialidase/O-sialoglycoprotease sensitive, the class II epitopes are removed by O-sialoglycoprotease, and the class III epitopes are insensitive to digestion by both enzymes. Furthermore, although not as dramatic as the differential tissue distribution of the class I and II epitopes of CD164, there are some reports on the differential expression of CD34 epitope classes. For example, while the three classes of CD34 epitopes are equally expressed on immature hemopoietic progenitor cells and immature leukemic blasts (AML-M0/1), class I and class II epitopes are less likely to be expressed on more mature progenitors and on the AML-M3 and -M4/5 leukemic blasts than class III epitopes. This suggests a more rapid down-regulation of the CD34 class I and II epitopes during normal hemopoietic progenitor cell differentiation (33). More significantly, on high endothelial venules, the CD34 isoform displays the class II and III, but not class I epitopes (34), thereby implicating the class II rather than the class I epitopes in the high affinity adhesion of these cells to L-selectin on lymphocytes.

The variable glycosylation of CD164 observed here for different cell types is by no means uncommon. One feature of many glycoproteins is microheterogeneity, which is due at least in part to the attached glycan chains. This heterogeneity is nonrandom and reproducible for a given protein synthesized by a specific cell type under defined conditions, a feature reflected when the physiological relevance of protein glycosylation is considered. While it is interesting to examine the differential glycosylation of the CD164 molecule in different cell lineages and tissues, examination of the glycosylation pattern by enzymatic treatment (Fig. 8Go) provides insight into the possible functional relevance of post-translational processing. Glycans can serve as recognition determinants for or as modulators of cell-cell, cell-matrix, and protein-(glyco)protein interactions. They can also be involved in either adhesive or anti-adhesive interactions. Both roles may be played by the same molecule depending on the tissues in which these glycoproteins are expressed and on the type of specific carbohydrate modifications that have been processed. This is further demonstrated by the wide diversity of glycosyltransferases and protein machinery present in a particular cell type, necessary for the production of a molecule with functionally relevant glycosylation (35). In many cases partial occupancy of potential glycosylation sites has correlated effects on physiological attributes. Particularly striking examples of the complexities of variable glycosylation site occupancy upon the biological attributes of a protein are illustrated by GM-CSF and CD44. Human GM-CSF exhibits variable N-linked glycosylation site occupancy, which plays an important role in its biological activity. Indeed, it has been demonstrated that there is an inverse correlation between biological activity and the extent of N-glycosylation, suggesting that N-linked glycans down-regulate the bioactivity of the molecule (36, 37). The 85-kDa isoform of CD44 on hemopoietic cells, on the other hand, acts as a ligand for hyaluronan produced by endothelial cells when it is sulfated on O-linked oligosaccharides in response to TNF-{alpha} stimulation (38). Other examples of post-translational modification influencing biological activity are by no means rare. Modifications involving O-linked oligosaccharide or tyrosine sulfation on CD34, PCLP, GlyCAM-1, and PSGL-1 on high endothelial venules or on specific leukocyte types are responsible for their high affinity specificity for L-selectin in vitro (reviewed in Ref. 10). Since the interaction of sialomucins with selectin ligands generally promotes the rapid proadhesive tethering of leukocytes to endothelia under conditions of flow in vitro, it has been postulated that these interactions result in tissue-specific homing and recirculation of lymphocytes to high endothelial venules in lymph nodes and mucosal lymphoid tissues and the accumulation of leukocytes at sites of inflammation. Despite this, controversy still surrounds the ligand specificity of these sialomucins and the functional significance of such sialomucin-ligand interactions in vivo (35). For example, L- and E-selectins function as ligands for CD34, yet both sialidase/O-sialoglycoprotease-dependent and O-sialoglycoprotease-independent adhesion of leukocytes to high endothelial venules have been described (9 ; reviewed in Ref. 10). Finally, gene knockout studies in mice indicate that GlyCAM-1 and CD34, at least by themselves, are not responsible for L-selectin-mediated lymphocyte recruitment into peripheral lymph nodes, although eosinophil recruitment into the lung following allergen challenge is down-regulated in CD34-deficient mice (14, 39).

Our previous studies have demonstrated that while all the CD164 epitopes discussed here are expressed on the phenotypically most primitive hemopoietic progenitor cells, it is the class II epitope, 103B2/9E10, that has been shown to elicit a very potent regulatory effect on stem cell proliferation/adhesion in in vitro systems. In this respect, CD164 resembles other sialomucins, such as PSGL-1, CD34, and CD43, in that interaction of both sialomucins with specific mAbs regulates cell proliferation. In the case of CD43 and PSGL-1, this receptor binding is functional and specific to a particular progenitor cell stage of differentiation (11, 13, 16, 40, 41, 42, 43). Whether the biochemical mechanisms regulating cell proliferation following the engagement of CD164 receptor on CD34+CD38low/- cells are similar to those observed for CD34, CD43, and PSGL-1 is as yet unknown (11, 13, 15, 16, 17, 18, 40, 41, 42, 43). However, as indicated in this paper and from our current research, with the characterization and better understanding of functional epitopes on progenitor cells, new tools are now available that will allow us to answer such questions.


    Acknowledgments
 
We thank Profs. Sir D. J. Weatherall and L. Kanz for their support.


    Footnotes
 
1 This work was supported by the United Kingdom Medical Research Council, the United Kingdom Leukaemia Research Fund, SmithKline Beecham, INTAS/RFBR, E. U. Biotech. Framework 4, and Taiwan Government Grants (to R.D., J.Y.-H.C., L.H.B., I.R., J.L.-P., and S.M.W.), National Health and Medical Research Council of Australia (to A.C.W.Z., P.J.S., and J.-P.L.), and Deutsche Forschungsgemeinschaft SFB 510, Project A1 (to H.J.B.). Back

2 Address correspondence and reprint requests to Dr. Suzanne M. Watt, Medical Research Council Molecular Hematology Unit, Institute of Molecular Medicine, The John Radcliffe Hospital, Headington, Oxford, United Kingdom OX3 9DS. Back

3 Abbreviations used in this paper: SCF, stem cell factor; GAG, glycosaminoglycan; PCLP, podocalyxin-like protein; PSGL-1, P-selectin glycoprotein ligand-1; MAdCAM-1, mucosal addressin cell adhesion molecule-1; GlyCAM-1, glycosylation-dependent cell adhesion molecule-1. Back

4 J. Y.-H. Chan, J. E. Lee-Prudhoe, B. Jorgensen, G. Ihrke, R. Doyonnas, A. C. W. Zannettino, P. J. Simmons, V. J. Buekle, and S. M. Watt. Submitted for publication. Back

Received for publication December 15, 1999. Accepted for publication April 25, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zannettino, A. C. W., H.-J. Bühring, S. Niutta, S. M. Watt, M. A. Benton, P. J. Simmons. 1998. The sialomucin CD164 (MGC-24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal cells which serves as a potent negative regulator of hematopoiesis. Blood 92:2613.[Abstract/Free Full Text]
  2. Watt, S. M., H.-J. Bühring, I. Rappold, J. Y.-H. Chan, J. Lee-Prudhoe, T. Jones, A. C. W. Zannettino, P. J. Simmons, D. Sheer, R. Doyonnas, et al 1998. CD164 a novel sialomucin on CD34+ and erythroid subsets is located on human chromosome 6q21. Blood 92:849.[Abstract/Free Full Text]
  3. Zannettino, A. C. W., I. Rappold, H.-J. Bühring, S. M. Watt, M. A. Benton, S. Nuitta, P. J. Simmons. 1997. CD164 (MGC-24v) workshop panel report. , , , , , , , , , , , , ed. Leucocyte Typing VI 456. Garland Publishing, New York.
  4. Watt, S. M., L. H. Butler, M. Tavian, H.-J. Bühring, I. Rappold, P. J. Simmons, A. C. W. Zannettino, D. Buck, A. Fuchs, R. Doyonnas, et al 2000. Functionally defined CD164 epitopes are expressed on CD34+ cells throughout ontogeny but display distinct distribution patterns in adult hematopoietic and non-hematopoietic tissues. Blood 95:3113.[Abstract/Free Full Text]
  5. Almeida-Porada, G., H.-J. Bühring, S. M. Watt, P. J. Simmons, G. Rathke, S. Scheding, L. Kanz, W. Brugger, E. D. Zanjani. 1999. CD164 defines an immature subset of human bone marrow CD34-negative stem cells. Blood 94:462a.
  6. Varki, A.. 1997. Perspectives series: cell adhesion in vascular biology. J. Clin. Invest. 99:158.[Medline]
  7. McEver, R. P., R. D. Cummings. 1997. Perspectives series: cell adhesion in vascular biology. J. Clin. Invest. 100:485.[Medline]
  8. Ostberg, J. R., R. K. Barth, J. G. Frelinger. 1998. The Roman god Janus: a paradigm for the function of CD43. Immunol. Today 19:546.[Medline]
  9. Clark, R. A., R. C. Fuhlbrigge, T. A. Springer. 1998. L-selectin ligands that are O-glycoprotease resistant and distinct from MECA-79 antigen are sufficient for tethering and rolling of lymphocytes on human endothelial venules. J. Cell Biol. 140:721.[Abstract/Free Full Text]
  10. Gonzalez-Amaro, R., F. Sanchez-Madrid. 1999. Cell adhesion molecules: selectins and integrins. Crit. Rev. Immunol. 19:389.[Medline]
  11. Bazil, V., J. Brandt, S. Chen, M. Roeding, K. Luens, A. Tsukamoto, R. Hoffman. 1996. A monoclonal antibody recognizing CD43 (leukosialin) initiates apoptosis of human hematopoietic progenitor cells but not stem cells. Blood 87:1272.[Abstract/Free Full Text]
  12. Wiken, M., P. Bjorck, B. Axelsson, P. Perlmann. 1989. Enhancement of human B-cell proliferation by a monoclonal antibody to CD43. Scand. J. Immunol. 29:363.[Medline]
  13. Levesque, J. P., A. C. W. Zannettino, M. Pudney, S. Niutta, D. N. Haylock, K. R. Snapp, G. S. Kansas, M. C. Berndt, P. J. Simmons. 1999. PSGL-1-mediated adhesion of human hematopoietic progenitors to P-selectin results in suppression of hematopoiesis. Immunity 11:369.[Medline]
  14. Cheng, J., S. Baumhueter, G. Cacalano, K. Carver-Moore, H. Thibodeaux, R. Thomas, H. E. Broxmeyer, S. Cooper, N. Hague, M. Moore, et al 1996. Hematopoietic defects in mice lacking the sialomucin CD34. Blood 87:479.[Abstract/Free Full Text]
  15. Bazil, V., J. Brandt, A. Tsukamoto, R. Hoffman. 1995. Apoptosis of human hematopoietic progenitor cells induced by crosslinking of surface CD43, the major sialoglycoprotein of leukocytes. Blood 86:502.[Abstract/Free Full Text]
  16. Bazil, V., J. E. Brandt, R. Hoffman. 1997. Resistance of human hematopoietic stem cells to a monoclonal antibody recognizing CD43. Stem Cells 15:13.
  17. Hu, M. C., S. L. Chien. 1998. The cytoplasmic domain of stem cell antigen CD34 is essential for cytoadhesion signaling but not sufficient for proliferation signaling. Blood 91:1152.[Abstract/Free Full Text]
  18. Krause, D. S., M. J. Fackler, C. I. Civin, W. S. May. 1996. CD34: structure, biology and clinical utility. Blood 87:1.[Free Full Text]
  19. Ardman, B., M. A. Sikorski, D. E. Staunton. 1992. CD43 interferes with T-lymphocyte adhesion. Proc. Natl. Acad. Sci. USA 89:5001.[Abstract/Free Full Text]
  20. Zhang, K., D. Baeckstrom, H. Brevinge, G. C. Hansson. 1997. Comparison of sialyl-Lewis a-carrying CD43 and MUC1 mucins secreted from a colon carcinoma cell line for E-selectin binding and inhibition of leukocyte adhesion. Tumor Biol. 18:175.
  21. Baum, L. G., M. Pang, N. L. Perillo, T. Wu, A. Delegeane, C. H. Uittenbogaart, M. Fukuda, J. J. Seilhamer. 1995. Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J. Exp. Med. 181:877.[Abstract/Free Full Text]
  22. Tsuboi, S., M. Fukuda. 1997. Branched O-linked oligosaccharides ectopically expressed intransgenic mice reduce primary T-cell immune responses. EMBO J. 16:6364.[Medline]
  23. Skubitz, K. M., K. Micklem, E. van der Schoot. 1995. CD66 and CD67 cluster workshop report. , , , , , , , , , , , , ed. Leucocyte Typing V 889. Oxford University Press, Oxford, U.K.
  24. Oritani, K., P. W. Kincade. 1996. Identification of stromal cell products that interact with pre-B cells. J. Cell. Biol. 134:771.[Abstract/Free Full Text]
  25. Teixeira, A. M., J. Fawcett, D. L. Simmons, S. M. Watt. 1994. The N-domain of the biliary glycoprotein (BGP) adhesion molecule mediates homotypic binding: domain interactions and epitope analysis of BGPc. Blood 84:211.[Abstract/Free Full Text]
  26. Watt, S. M., J. Williamson, H. Genevier, J. Fawcett, D. L. Simmons, A. Hatzfeld, S. A. Nesbitt, D. R. Coombe. 1993. The heparin binding PECAM-1 adhesion molecule is expressed by CD34+ hematopoietic precursor cells with early myeloid and B-lymphoid cell phenotypes. Blood 82:2649.[Abstract/Free Full Text]
  27. Sutherland, D. R., K. M. Abdullah, P. Cyopick, A. Mellors. 1992. Cleavage of the cell-surface O-sialoglycoproteins CD34, CD43, CD44, and CD45 by a novel glycoprotease from Pasteurella haemolytica. J. Immunol. 148:1458.[Abstract]
  28. Perschl, A., J. Lesley, N. English, R. Hyman, I. S. Trowbridge. 1995. Transmembrane domain of CD44 is required for its detergent insolubility in fibroblasts. J. Cell Sci. 108:1033.[Abstract]
  29. Neame, S. J., C. R. Uff, H. Sheikh, S. C. Wheatley, C. M. Isacke. 1995. CD44 exhibits a cell type dependent interaction with Triton X-100 insoluble, lipid rich, plasma membrane domains. J. Cell Sci. 108:3127.[Abstract]
  30. Carey, D. J., K. M. Bendt, R. C. Stahl. 1996. The cytoplasmic domain of syndecan-1 is required for cytoskeleton association but not detergent insolubility. J. Biol. Chem. 271:15253.[Abstract/Free Full Text]
  31. Sutherland, D. R., S. M. Watt, G. Dowden, K. Karhi, M. A. Baker, M. F. Greaves, J. E. Smart. 1988. Structural and partial amino acid sequence analysis of the human hemopoietic progenitor cell antigen CD34. Leukemia 2:793.[Medline]
  32. Watt, S. M., K. Karhi, K. Gatter, A. J. W. Furley, F. E. Katz, L. E. Healy, L. J. Altass, N. J. Bradley, D. R. Sutherland, R. Levinsky, et al 1987. Distribution and epitope analysis of the cell surface membrane glycoprotein (HPCA-1) associated with human hemopoietic progenitor cells. Leukemia 1:417.[Medline]
  33. Steen, R., G. E. Tjonnefjord, G. Gaudernack, L. Brinch, T. Egeland. 1996. Differences in the distribution of CD34 epitopes on normal haemopoietic progenitor cells and leukaemic blast cells. Br. J. Haematol. 94:579.[Medline]
  34. Baumhueter, S., M. S. Singer, W. Henzel, S. Hemmerich, M. Renz, S. D. Rosen, L. A. Lasky. 1993. Binding of L-selectin to the vascular sialomucin CD34. Science 262:436.[Abstract/Free Full Text]
  35. Lowe, J. B.. 1997. Selectin ligands, leukocyte trafficking, and fucosyltransferase genes. Kidney Int. 51:1418.[Medline]
  36. Ding, D. X.-H., J. C. Vera, M. L. Heaney, D. W. Golde. 1995. N-glycosylation of the human granulocyte-macrophage colony-stimulating factor receptor {alpha} subunit is essential for ligand binding and signal transduction. J. Biol. Chem. 270:24580.[Abstract/Free Full Text]
  37. Cebon, J., N. Nicola, M. Ward, I. Gardner, P. Dempsey, J. Layton, U. Duhrsen, A. W. Burgess, E. Nice, G. Morstyn. 1990. Granulocyte-macrophage colony stimulating factor from human lymphocytes: the effect of glycosylation on receptor binding and biological activity. J. Biol. Chem. 265:4483.[Abstract/Free Full Text]
  38. Maiti, A., G. Maki, P. Johnson. 1998. TNF-{alpha} induction of CD44-mediated leukocyte adhesion by sulfation. Science 282:941.[Abstract/Free Full Text]
  39. Suzuki, A., D. P. Adnrew, J.-A. Gonzalo, M. Fukumoto, J. Spellberg, M. Hashiyar, H. Takimoto, N. Gerwin, I. Webb, G. Molineux, et al 1996. CD34-deficient mice have reduced eosinophil accumulation after allergen exposure and show a novel crossreactive 90-kD protein. Blood 87:3550.[Abstract/Free Full Text]
  40. Moore, T., S. Huang, L. W. Terstappen, M. Bennett, V. Kumar. 1994. Expression of CD43 on murine and human pluripotent hematopoietic stem cells. J. Immunol. 153:4978.[Abstract]
  41. Woodman, R. C., B. Johnston, M. J. Hickey, D. Teoh, P. Reinhardt, B. Y. Poon, P. Kubes. 1998. The functional paradox of CD43 in leukocyte recruitment: a study using CD43-deficient mice. J. Exp. Med. 188:2181.[Abstract/Free Full Text]
  42. Anzai, N., A. Gotoh, H. Shibayama, H. E. Broxmeyer. 1999. Modulation of integrin function in hematopoietic progenitor cells by CD43 engagement: possible involvement of protein tyrosine kinase and phospholipase C-{gamma}. Blood 93:3317.[Abstract/Free Full Text]
  43. Rosenstein, Y., A. Santana, G. Pedraza-Alva. 1999. CD43, a molecule with multiple functions. Immunol. Res. 20:89.[Medline]



This article has been cited by other articles:


Home page
haematolHome page
V. L. Battula, S. Treml, P. M. Bareiss, F. Gieseke, H. Roelofs, P. de Zwart, I. Muller, B. Schewe, T. Skutella, W. E. Fibbe, et al.
Isolation of functionally distinct mesenchymal stem cell subsets using antibodies against CD56, CD271, and mesenchymal stem cell antigen-1
Haematologica, February 1, 2009; 94(2): 173 - 184.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Forde, B. J. Tye, S. E. Newey, M. Roubelakis, J. Smythe, C. P. McGuckin, R. Pettengell, and S. M. Watt
Endolyn (CD164) modulates the CXCL12-mediated migration of umbilical cord blood CD133+ cells
Blood, March 1, 2007; 109(5): 1825 - 1833.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Serafini, S. J. Dylla, M. Oki, Y. Heremans, J. Tolar, Y. Jiang, S. M. Buckley, B. Pelacho, T. C. Burns, S. Frommer, et al.
Hematopoietic reconstitution by multipotent adult progenitor cells: precursors to long-term hematopoietic stem cells
J. Exp. Med., January 22, 2007; 204(1): 129 - 139.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. A. Potter, G. Ihrke, J. R. Bruns, K. M. Weixel, and O. A. Weisz
Specific N-Glycans Direct Apical Delivery of Transmembrane, but Not Soluble or Glycosylphosphatidylinositol-anchored Forms of Endolyn in Madin-Darby Canine Kidney Cells
Mol. Biol. Cell, March 1, 2004; 15(3): 1407 - 1416.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
U. Samulowitz, A. Kuhn, G. Brachtendorf, R. Nawroth, A. Braun, A. Bankfalvi, W. Bocker, and D. Vestweber
Human Endomucin : Distribution Pattern, Expression on High Endothelial Venules, and Decoration with the MECA-79 Epitope
Am. J. Pathol., May 1, 2002; 160(5): 1669 - 1681.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y.-N. Lee, J.-S. Kang, and R. S. Krauss
Identification of a Role for the Sialomucin CD164 in Myogenic Differentiation by Signal Sequence Trapping in Yeast
Mol. Cell. Biol., November 15, 2001; 21(22): 7696 - 7706.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
F. Prosper and C. M. Verfaillie
Regulation of hematopoiesis through adhesion receptors
J. Leukoc. Biol., March 1, 2001; 69(3): 307 - 316.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Y.-H. Chan, J. E. Lee-Prudhoe, B. Jorgensen, G. Ihrke, R. Doyonnas, A. C. W. Zannettino, V. J. Buckle, C. J. Ward, P. J. Simmons, and S. M. Watt
Relationship between Novel Isoforms, Functionally Important Domains, and Subcellular Distribution of CD164/Endolyn
J. Biol. Chem., January 12, 2001; 276(3): 2139 - 2152.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doyonnas, R.
Right arrow Articles by Watt, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doyonnas, R.
Right arrow Articles by Watt, S. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS