The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rudolf2 3, M. P.
Right arrow Articles by Kricek, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rudolf2 3, M. P.
Right arrow Articles by Kricek, F.
The Journal of Immunology, 2000, 165: 813-819.
Copyright © 00 by The American Association of Immunologists

Molecular Basis for Nonanaphylactogenicity of a Monoclonal Anti-IgE Antibody1

Michael P. Rudolf2 3*, Adrian W. Zuercher2 4*, Andreas Nechansky{dagger}, Christine Ruf{dagger}, Monique Vogel*, Sylvia M. Miescher*, Beda M. Stadler* and Franz Kricek5,{dagger}

* Institute of Immunology and Allergology, Inselspital, University of Bern, Bern, Switzerland; and {dagger} Novartis Forschungsinstitut GmbH, Vienna, Austria


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IgE Abs mediate allergic responses by binding to specific high affinity receptors (Fc{epsilon}RI) on mast cells and basophils. Therefore, the IgE/Fc{epsilon}RI interaction is a target for clinical intervention in allergic disease. An anti-IgE mAb, termed BSW17, is nonanaphylactogenic, although recognizing IgE bound to Fc{epsilon}RI, and interferes with binding of IgE to Fc{epsilon}RI. Thus, BSW17 represents a candidate Ab for treatment of IgE-mediated disorders. By panning BSW17 against random peptide libraries displayed on phages, we defined mimotopes that mimic the conformational epitope recognized on human IgE. Two types of mimotopes, one within the C{epsilon}3 and one within the C{epsilon}4 domain, were identified, indicating that this mAb may recognize either a large conformational epitope or eventually two distinct epitopes on IgE. On the basis of alignments of the two mimotopes with the human IgE sequence, we postulate that binding of BSW17 to the C{epsilon}3 region predominantly blocks binding of IgE to Fc{epsilon}RI, leading to neutralization of IgE. Moreover, binding of BSW17 to the C{epsilon}4 region may explain how BSW17 recognizes Fc{epsilon}RI-bound IgE, and binding to this region may also interfere with degranulation of IgE sensitized cells (basophils and mast cells). As a practical application of these findings, mimotope peptides coupled to a carrier protein may be used for the development of a peptide-based anti–allergy vaccine by induction of anti-IgE Abs similar to the current approach of using humanized nonanaphylactogenic anti-IgE Abs as a passive vaccine.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Immunoglobulin E interacts with the {alpha}-chain of its high affinity receptor (Fc{epsilon}RI{alpha}) to form a complex with a Kd of ~10-10 M. Cross-linking of the Fc{epsilon}RI/IgE complex by an Ag results in degranulation of mast cells and basophils and release of a variety of preformed inflammatory mediators, e.g., histamine, serotonin, and leukotrienes (for review, see Ref. 1). In the human system, high affinity binding of IgE to Fc{epsilon}RI is achieved by a complex protein-protein interaction, involving various parts of the third heavy chain constant region domain (C{epsilon}3) of IgE (2, 3, 4) and the membrane-proximal Ig-like domain {alpha} (2) of the Fc{epsilon}RI{alpha} subunit (Refs. 5, 6, 7, 8, 9 ; for review, see Ref. 10). However, the detailed mechanism of the binding process still remains to be characterized.

The monoclonal anti-IgE Ab BSW17 (11) is of particular interest because it is not capable of triggering histamine release from IgE-sensitized human basophils (12). Furthermore, BSW17 reduces in a time-dependent manner the amount of IgE bound to Fc{epsilon}RI (13) resulting in a de facto removal of cell-bound IgE by interfering with the association of IgE to Fc{epsilon}RI. Finally, BSW17 inhibits de novo synthesis of IgE in an in vitro culture system of human B cells (14). This unique capacity to recognize and to remove receptor-bound IgE without triggering effector cells renders BSW17 a candidate mAb for immunotherapy (15).

In this paper, we report that recently isolated mimotopes recognized by BSW17 (16) showed a structural homology (but no amino acid homology) to a part of the C{epsilon}4 domain of human IgE. Because this result was in contrast to our previous findings, mapping the epitope of BSW17 to C{epsilon}3 (17), we screened BSW17 again with other random peptide libraries. This selection procedure resulted in the isolation of peptides with sequence homology to C{epsilon}3. Inhibition and cross-inhibition experiments as well as molecular homology modeling clearly confirmed the presence of epitopes in both C{epsilon}3 and C{epsilon}4 of IgE. Our data indicate that this mAb may recognize either a large conformational epitope or eventually two distinct epitopes on IgE. Importantly, our findings provide the structural basis to explain the functional characteristics of BSW17.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Antibodies

Rat anti-mouse Ig conjugated to peroxidase (anti-mouse Ig-HRP) was purchased from Nordic Immunology (Tilburg, The Netherlands). Production of rabbit anti-phage Ab (RaP)6 was described earlier (18). Abs Le27 and BSW17 are described elsewhere (11). The anti-human Fc{epsilon}RI{alpha} mAb 5H5/F8 was generated at the Novartis Forschungsinstitut (Vienna, Austria), and is described elsewhere (19). The anti-IgE mAbs 11-3, 11-4, and 11-5 were obtained from Dr. R. Vasilov (NPO Biotechnologia, Moscow, Russia). 4F4 was a gift of Dr. M. P. Samoilovich and Dr. V. B. Klimovich (Hybridoma Technology Laboratory, Central Research Institute for Roentgeno-Radiology, St. Petersburg, Russia). Human myeloma IgE-PS was affinity purified from serum of a patient with an IgE myeloma (a gift of Dr. K. Ishizaka, La Jolla, CA) as described elsewhere (20).

Domain mapping experiments

Binding experiments of various truncated C{epsilon}1–3 proteins to mAbs 8E7/H8, 5H10, and BSW17 were performed as described (21). Briefly, linear DNA templates encoding various C{epsilon} fragments were in vitro expressed using bacterial extracts and affinity purified by metal chelate chromatography. The radiolabeled proteins were tested for binding to the indicated Abs in a RIA.

Fc{epsilon} constant domains displaying phage clones

Combinations of the following primers were used to clone different C{epsilon} fragments from cDNA C{epsilon}1–4 into XhoI and BamHI sites of pComb8 (22): primer Fc{epsilon}H1 forward, GCGGGATCCGCCTCCACACAGAGCC; primer Fc{epsilon}H2 forward, CGCGGATCCGTCTGCTCCAGGG; primer Fc{epsilon}H2 reverse, GCGCTCGAGTGCACACTTCTTGGTGC; primer Fc{epsilon}H4 forward, GCGGGATCCGGCCCGCGTGCTGCCC; primer Fc{epsilon}H4 reverse, GCGCTCGAGTTTACCGGGATTTACACACCG.

pComb8 vector and PCR fragments were digested with BamHI and XhoI (Boehringer Mannheim, Rotkreuz, Switzerland) and purified on agarose gels followed by phenol extraction before ligation. Ligated DNA was electroporated into 200 µl electrocompetent Escherichia coli XL-I blue (Stratagene, La Jolla, CA) using a Bio-Rad Gene pulser (Bio-Rad, Richmond, CA) according to the manufacturers’ instructions. After cloning, C{epsilon}-displaying phages were produced as described elsewhere (16).

Immunodot assays with phage particles

Monoclonal anti-IgE (1 µl; 500 µg/ml) was dotted onto nitrocellulose (Schleicher & Schüll, Riehen, Switzerland) and after drying was blocked with PBS containing 1.5 mg/ml casein (PBS-C, Fluka Chemie, Buchs, Switzerland) for 1 h. Strips were incubated overnight at room temperature with 1011 CFU/ml phage particles diluted in PBS-C. After washing, bound phages were detected with RaP-HRP (1:1000 in PBS-C) after incubation for 4 h. Staining was performed as described earlier (23).

Phage libraries

Random peptide phage display libraries were obtained from different sources as outlined in Table IGo. Amplification and precipitation of phages were performed according to standard protocols (24).


View this table:
[in this window]
[in a new window]
  		Table I. Domain mapping of anti-IgE mAbs using truncated C{epsilon}1–3 fragments

 
Panning of phage particles

StarTubes (Nunc, Fakola, Basel, Switzerland) were coated with 20 µg/ml BSW17 in 0.1 M carbonate buffer at pH 9.6 for 16 h at 4°C, washed with water, and blocked with PBS-C for 1 h at 37°C. Amplified phage libraries were pooled (1012 CFU of each individual library) in 2 ml PBS-C and incubated at 37°C for 2 h in coated/blocked tubes with constant agitation. Tubes were washed 10 times with PBS-C containing 0.1% Tween 20, and bound phage particles were eluted with 1 ml 0.1 M HCl, pH 2.2, containing 1% BSA (Fluka) for 10 min at 37°C with constant agitation. Eluted phage suspension was neutralized with 2 M Tris and amplified before use for a next round of panning.

Selection of mAb specific clones

After three rounds of panning, individual clones were incubated in single wells of 96-well EIA/RIA plates (Costar, Integra Bioscience, Walisellen, Switzerland) in 150 µl/well NZY medium (1% NZ amine A, 0.5% yeast extract, 0.5% NaCl) containing 100 µg/ml kanamycin and 20 µg/ml tetracycline and grown overnight at 37°C. Plates were centrifuged at 4000 x g for 20 min at 4°C, and supernatant was tested in an ELISA for the presence of BSW17-specific phages. For this purpose, Tc96 flat-bottom ELISA plates were coated with 10 µg BSW17 in carbonate buffer (pH 9.6) overnight at 4°C, washed once with water, and blocked with PBS-C-Tween for 2 h at 37°C. Fifty microliters of supernatant from culture were transferred and incubated for 4 h at room temperature, washed three times with PBS, 0.5% Tween 20, and subsequently incubated as described below. Wells showing a staining intensity 3 times above the background (VCS-M13 in bacterial growth medium NZY) were considered positive. Positive phage clones were amplified, and phage DNA isolated and sequenced.

Peptide synthesis and coupling to keyhole limpet hemocyanin (KLH)

The following chemically synthesized peptides were used: C{epsilon}3 epitope (C3E), 397VNLTWSRASG406; C{epsilon}3 mimotope (C3M), VNLPWSFGLE; C{epsilon}4 mimotope linear (C4M-lin), INHRGYWV; C{epsilon}4 mimotope circular, (C4 M-circ), GEFCINHRGYWVCGDPA; C{epsilon}3 peptide Pro453-Arg467:453PRALMRSTTKTSGPR467, C{epsilon}3 peptide Pro370-Leu375:370PSPFTL375.

Numeration of amino acid position according to the putative human IgE protein is as described under EMBL accession numbers L00022 and V00555.

The mimotope and epitope peptides were synthesized by piCHEM Research and Development (Graz, Austria) using Fmoc chemistry on a Biolynx 4170 automated peptide synthesizer as described in detail in Ref. 16 . All peptides were >80% pure (HPLC) and characterized by mass spectroscopy. Amino-terminal coupling of 2.2 mg mimotope or epitope peptides (in 0.1 M NaHCO3/Na2CO3, 0.5 M NaCl, pH 8.0) and 2.1 mg KLH (dialyzed into the same buffer) was performed in PIERCE Reacti-Vials (Pierce, Rockford, IL) with 3.5 mM bis(sulfosuccinimidyl) suberate for 90 min at room temperature. The mixture was loaded onto a Pharmacia PD-10 desalting column (10 ml Sephadex G-25, equilibrated with 40 ml 38 mM phosphate buffer, 0.9 M NaCl, pH 7.2), and eluted with 3.5 ml of the same buffer. Purified protein was stored at -20°C. Coupling ratio was estimated to 200 mol peptide per mol KLH.

ELISA experiments

Chemically synthesized peptides (100 ng/ml) were covalently coupled to DNA-BIND microtiter plates (Costar, Cambridge, MA). The remaining reactive surface of the wells was blocked by incubation for 2 h at 37°C with 5% BSA (Sigma, St. Louis, MO) (200 µl/well). Subsequently, BSW17 in increasing amounts specified in Results was incubated for 2 h at 37°C in 100 µl PBS (pH 7.5) containing 0.05% Tween 20 (Serva, Heidelberg, Germany), and 2% FCS (BioWhittaker, Verviers, Belgium). After washing (twice with 300 µl PBS, pH 7.5, 0.05% Tween 20), bound BSW17 was determined by incubation for 2 h at 37°C with HRP-conjugated anti-mouse Ig Ab (1:1000 dilution in the same buffer). After removal of the incubation mixture and two washing steps, color reaction was induced using the HRP Substrate Kit purchased from Bio-Rad (Hercules, CA), and optical density at 405 nm was measured in an ELISA plate spectrophotometer (EasyReader, SLT Labinstruments, Vienna, Austria). The readout shown in the figures was corrected for background binding to microtiter plates coated with the indicated control and represents mean values of duplicates.

Inhibition and cross-inhibition experiments

For inhibition of BSW17 binding to mimotopes/epitopes with IgE-PS, EIA/RIA plates (Costar) were coated with KLH-coupled mimotopes/epitopes (10 µg/ml) or IgE-PS (5 µg/ml) overnight at 4°C in carbonate buffer, pH 9.6, and thereafter blocked with PBS containing 5% BSA. Immune complexes of BSW17 (5 µg/ml) with IgE-PS (20 µg/ml) (both in PBS, 2% FCS, 0.05% Tween 20) were formed overnight at room temperature. Immune complexes were added for 4 h at room temperature and bound BSW17 detected by incubation with anti-mouse IgG-HRP. Wells were washed and incubated with 100 µl 0.5 mM tetramethylbenzidine in 30 mM potassium citrate buffer, pH 4.1, containing 4 mM H2O2. Reaction was stopped by the addition of an equal amount of 1 M H2SO4 and OD450 nm was determined on an automated ELISA reader.

For inhibition of BSW17 binding to KLH-coupled mimotopes/epitopes with phage-displayed mimotopes, plates were coated and blocked as described above with KLH-coupled mimotope/epitope. Immune complexes of BSW17 (1 µg/ml) with mimotope-displaying phages (1013 CFU/ml) were formed for 4 h at room temperature and incubated for 2 h on the ELISA plates. Bound BSW17 was detected and revealed as described above.

Amino acid sequence alignment

Alignment of the postulated putative BSW17 epitopes within the three-dimensional homology based model of Fc{epsilon} (25), the atomic coordinates of which were obtained from the Brookhaven Protein Data Bank, was performed with Weblab Viewer version 2.01 (Molecular Simulations, San Diego, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
BSW17 recognizes peptide sequences with homology to C{epsilon}3 and C{epsilon}4

Earlier attempts to map the epitope of the monoclonal anti-human IgE Ab BSW17 with recombinant heavy chain constant region domains of IgE (C{epsilon}) produced in E. coli indicated an epitope within the third constant Fc{epsilon} domain (C{epsilon}3) (13, 17). The specificity of BSW17 for C{epsilon}3 was further confirmed in a domain-mapping experiment by binding of truncated, recombinant in vitro expressed C{epsilon} fragments to BSW17 and other anti-C{epsilon}3 mAbs (Table IGo). The binding pattern demonstrates that BSW17 indeed recognizes intact C{epsilon}3 and that removal of the carboxyl-terminal 20 amino acids abrogates binding. Because the other anti-C{epsilon}3 mAbs still bound to C{epsilon}3 truncated at Cys445, we conclude that the intact carboxy terminus of C{epsilon}3 is essential for binding of BSW17. Nevertheless, whether the deleted part itself contains the BSW17 epitope or is of importance for a stable structure of the epitope within C{epsilon}3 cannot be deduced from the presented data.

However, by screening a constrained random nonapeptide library (26), nona- and octapeptide mimotope sequences have been identified that were specifically recognized by BSW17 (16). None of these peptides (Table IIGo) showed amino acid homology to the primary sequence of human IgE (EMBL accession numbers. V00555 and L00022). Nevertheless, it is possible to deduce structural homology between these peptides by pattern alignment based on the properties of the amino acids: 1) the carboxyl-terminal region of the central glycine is highly conserved and contains aromatic side chains; and 2) the region amino terminal to the central glycine is less conserved but must contain positively charged amino acids spaced by uncharged polar and nonpolar residues to maintain strong BSW17 binding if displayed on the surface of the bacteriophages. Surprisingly, screening of the C{epsilon} sequence for the presence of a region with similar organization revealed a structural homology to a region within C{epsilon}4 rather than within C{epsilon}3 (Table IIGo), stretching from IgE C{epsilon}4 aa 524–532. Thus, to confirm the eventual existence of an epitope for BSW17 within C{epsilon}4, we tested the binding of BSW17 and a panel of other monoclonal anti-IgE Abs to different C{epsilon} domains displayed on the surface of phages. For this purpose, anti-human IgE mAbs were immobilized on nitrocellulose strips and incubated with 1011 CFU phage particles displaying different C{epsilon} domains. As shown in Table IIIGo, phage particles displaying C{epsilon}4 (PhC{epsilon}1–4, PhC{epsilon}4) specifically bound to both anti-C{epsilon}4 Abs (Le27 and 11-4) but not the anti-C{epsilon}3 mAb 4F4. Similarly, PhC{epsilon}2 reacted only with anti-C{epsilon}2 Abs but not with anti-C{epsilon}3 or anti-C{epsilon}4 Abs. Importantly, phage particles displaying C{epsilon}4 (PhC{epsilon}1–4, PhC{epsilon}4) also bound to the anti-C{epsilon}3 mAb BSW17. In contrast, no reaction between BSW17 and PhC{epsilon}2 was observed. Taken together, these results suggested the presence of an epitope for BSW17 within the C{epsilon}4 domain of IgE.


View this table:
[in this window]
[in a new window]
  		Table II. Alignment of mimotope peptides with C{epsilon}4 by pattern similarity

 

View this table:
[in this window]
[in a new window]
  		Table III. Binding of phage-displayed single or multiple Fc{epsilon} constant domains to monoclonal anti-IgE Abs

 
Screening of BSW17 with random peptide phage display libraries

Our previous domain mapping of BSW17 suggested that the actual epitope most likely resides within C{epsilon}3 (13, 17). Thus, the data presented above prompted us to screen for mimotopes in other types of peptide phage display libraries than used previously (16) to gain a more detailed information on the structure of the epitope recognized by BSW17 on human IgE. Several phage display peptide libraries of varying complexity were pooled and screened against immobilized BSW17 (Table IVGo). After three rounds of panning, highly specific clones were isolated, which were exclusively recognized by BSW17 (data not shown). Twenty independent clones were sequenced, and their inserts were aligned with the Fc{epsilon} chain sequence. Eighteen of twenty clones analyzed had an insert length of 10 amino acids and showed high sequence homology to amino acids 397–402 of IgE, a region within C{epsilon}3, (Table VGo). All clones showed a conserved VxxxWx motif, which is also found in the C{epsilon}3 domain (aa 397 and 401). This putative epitope recognized by BSW17 within the C{epsilon}3 domain overlaps with the putative binding site of IgE to the {alpha}-chain of Fc{epsilon}RI as reported by Presta et al. (2) and Henry et al. (4). The remaining 2 binding clones had an insert length of 15 amino acids with no apparent homology to the primary IgE sequence (data not shown); therefore, they were not included into further analysis.


View this table:
[in this window]
[in a new window]
  		Table IV. Phage display libraries used for panning

 

View this table:
[in this window]
[in a new window]
  		Table V. Sequence of phage clones with homology to IgE-C{epsilon}3

 
Chemically synthesized mimotopes and C{epsilon}3-derived peptide PRALMRSTTKTSGPR are recognized by BSW17

To exclude any contribution of phage proteins to the interaction of the isolated peptides with BSW17 and, most importantly, to demonstrate that BSW17 recognizes both (C{epsilon}3 and C{epsilon}4) regions, BSW17 was tested for binding to chemically synthesized C{epsilon}3 and C{epsilon}4 mimotopes as well as to the linear sequences identical with the putative epitopes on IgE as deduced by sequence homology analysis (Fig. 1GoA). Because previous experiments revealed that BSW17 was not able to recognize these mimotope peptides when immobilized to microtiter plate wells using a standard alkaline coating procedure (data not shown), mimotope peptides were covalently coupled to the activated polystyrene surface of DNA-BIND plates as described in Materials and Methods and incubated with increasing amounts of BSW17. The linear C{epsilon}3 epitope (C3E) was only weakly recognized by BSW17, and no binding to the linear C{epsilon}3 mimotope (C3M) as compared with the nonspecific glycine background was observed. In contrast, C{epsilon}4 mimotopes and epitopes (C4E, C4M-lin, C4M-circ) all were bound by BSW17. The C3E shows some weak binding at a high concentration of BSW17 Ab (20 µg) in one experiment but not in the second (Fig. 1Go). Similar results have been obtained in identical experiments, and C3E binding was always slightly above background but with variable intensity at high concentrations of BSW17 Ab. Currently, we do not have an explanation for this phenomenon.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 1. A, Recognition of chemically synthesized mimotope peptides by BSW17. A 100-ng sample of each peptide was chemically coupled to wells of DNA-BIND plates, incubated (in duplicates) with increasing amounts of BSW17, and developed with anti-mouse IgG-HRP. Variations of duplicates were generally <±0.05. B, Recognition of chemically synthesized C{epsilon}3-derived peptide 453PRALMRSTTKTSGPR467 by BSW17. Binding was compared with C{epsilon}3 epitope (C3E), to linear C{epsilon}4 mimotope (C4 M-lin) and to the C{epsilon}3-derived control peptide 370PSTFTL375 located at the amino-terminal part of C{epsilon}3. The experimental protocol was the same as for A. Variations of duplicates were generally <±0.07.

 
The domain mapping experiments shown in Table IGo indicated that amino acids belonging to the carboxyl-terminal region of the C{epsilon}3 domain might also contribute to BSW17 binding. Therefore, a peptide comprising this region of C{epsilon}3 was chemically synthesized (453PRALMSTTKTSGPR467) and tested for recognition by BSW17 (Fig. 1GoB). As a negative control, a C{epsilon}3-derived peptide (370PSPFTL375) located at the amino-terminal region of C{epsilon}3 was included in testing. As shown in Fig. 1GoB, specific binding was demonstrated only for C4 M-lin and for peptide 453PRALMSTTKTSGPR467, indicating that the 453PRALMSTTKTSGPR467 sequence within C{epsilon}3 also contributes to the BSW17 epitope.

IgE or phage-displayed mimotopes inhibit binding of BSW17 to mimotopes/epitopes

To confirm the specificity of the interaction of BSW17 with the mimotopes/epitopes, inhibition assays using IgE-PS or phage-displayed mimotopes as inhibitors were performed. As shown in Fig. 2GoA, the C{epsilon}4 epitope and the C{epsilon}4 mimotope were bound by BSW17. Similarly, the C{epsilon}3 mimotope was also bound by BSW17. This finding is in contrast to Fig. 1GoA, where the directly coupled C{epsilon}3 mimotope was not bound by BSW17 and indicates that the C{epsilon}3 mimotope as well as the C{epsilon}3 epitope, when covalently coupled to DNA-BIND plates, do not present a conformation which allows binding of BSW17. Importantly, preincubation of BSW17 with 20 µg/ml IgE-PS efficiently inhibited the binding of BSW17 to all three KLH-coupled peptides as well as to IgE-PS itself.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 2. A, Inhibition by IgE-PS of the interaction of BSW17 with KLH-coupled mimotopes/epitopes and IgE-PS. KLH-coupled mimotopes/epitope (10 µg/ml) or IgE-PS (5 µg/ml) were coated onto ELISA plates and incubated with BSW17 (5 µg/ml) complexed with IgE-PS (20 µg/ml). Bound BSW17 was detected with HRP-labeled anti-mouse Ab. Background values (no BSW17 added) are subtracted. B, Inhibition by phage-displayed mimotopes of the interaction of BSW17 with KLH-coupled mimotopes. BSW17 was incubated with phage particles for formation of immune complexes and subsequently used in an ELISA assay on plates coated with either KLH or KLH-coupled mimotopes for 2 h. As a control, BSW17 was incubated with a phage clone displaying a peptide not recognized by BSW17 (irrelevant). Bound BSW17 was detected with HRP-labeled anti-mouse Ab.

 
Subsequently, C{epsilon}3 mimotopes and C{epsilon}4 mimotopes were used in a cross-inhibition assay. For this purpose, immune complexes of BSW17 with a 10-fold excess of phage particles displaying either the C{epsilon}4 or the C{epsilon}3 mimotope were preformed before incubation with KLH-coupled mimotope coated to ELISA plates (Fig. 2GoB). An almost complete inhibition of binding to both KLH-coupled mimotopes was observed in the presence of either the C{epsilon}4 or the C{epsilon}3 mimotope displaying phage particles. Some inhibition of BSW17 binding to CE4 was observed in the presence a control phage displaying a peptide not recognized by BSW17 (irrelevant mimotope, a linear 9-mer mimotope recognized by mAb Le27 (16)) probably due to unspecific adsorption of phage particles to the coated proteins. The cross-inhibition clearly demonstrates that each of the mimotopes inhibits binding of BSW17 to the other mimotope, although the mimotopes have no obvious homology to each other and mimic two different structures in the Fc{epsilon} of IgE.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have used phage display peptide libraries to identify putative regions on human IgE recognized by the anti-human IgE mAb BSW17. Based on alignment of the mimotope peptide sequences with the sequence of human IgE, our results indicate that BSW17 recognizes regions in C{epsilon}3 as well as in C{epsilon}4. Our findings may explain the experimentally observed characteristics of BSW17.

The parts involved within IgE C{epsilon}3 and C{epsilon}4 are incorporated in the homology-based model of IgE Fc shown in Fig. 3GoA. Both regions of the putative BSW17 epitope as defined by homology analysis of peptides isolated from peptide libraries (Fig. 3GoA, red, blue) are surface exposed and accessible from the same direction in this model. They are separated from each other by a distance of 20–30 Å, allowing formation of a complex epitope covering an area of 400–900 Å2, which is in accordance with published crystallographic data obtained for discontinuous epitopes (27, 28, 29, 30). Furthermore, according to this three-dimensional model, the peptide 453PRALMRSTTKTSGPR467 within the C{epsilon}3 domain (drawn in light green in Fig. 3GoA), which is also recognized by BSW17, is surface exposed and resides within the "steric environment" of the postulated conformational BSW17 epitope. Importantly, the mimotope sequences mapping to a region within C{epsilon}3 (C{epsilon}3 epitopes) (Fig. 3GoA, red), covering the region Val397-Gly406, and the 453PRALMRSTTKTSGPR467 peptide (Fig. 3GoA, light green) contain four (Arg403, Ser405, Arg454, Met457) of nine amino acids which by alanine scanning mutagenesis have been identified to be directly involved in binding of IgE to Fc{epsilon}RI. All nine amino acids contributing to this putative IgE binding site as described in Refs. 2 and 4 are shown in Fig. 3GoB in dark green.



View larger version (122K):
[in this window]
[in a new window]
  		FIGURE 3. Three dimensional structural model of the putative BSW17 epitope. The model is based on computer-generated atomic coordinates for Fc{epsilon} retrieved from the Brookhaven database and visualized for BSW17 epitope alignment using Weblab Viewer software. A, Regions identified on human IgE that are recognized by BSW17. The C{epsilon}3 epitope part, Val397-Gly406, is red, the C{epsilon}4 epitope part, Lys524-Val532, is blue. The peptide Pro453-Arg467 (light green) is also recognized by BSW17. B, Regions on IgE responsible for binding to Fc{epsilon}RI {alpha} and for mediator release. The amino acid residues Arg403, Ser405, Lys407, Arg420, Glu441, Arg454, Met457 (2 ), Pro360 and Arg361 (4 ) have been demonstrated to be involved in Fc{epsilon}RI and are shown in dark green. The peptide Lys524-Val532 postulated to be involved in IgE-mediated mast cell degranulation (31 ) is orange.

 
The C{epsilon}4 mimotope sequences can be aligned with region Lys524-Val532 (shown in blue in Fig. 3GoA) which forms a surface-exposed loop. This concurs with the identification of mimotopes only from a C-C constrained circular library but not from an analogous library displaying linear peptides. A peptide mapping to exactly the same C{epsilon}4 region (drawn in Fig. 3GoB in orange) has already been described and characterized earlier (31, 32). The authors proposed that this region within C{epsilon}4 might be involved in mast cell triggering (33). This hypothesis gained some support by that fact, that a serum generated against this decapeptide of IgE-C{epsilon}4 inhibited histamine release from rat mast cells (34). These findings have remained controversial. However, others showed that disturbance of C{epsilon}4 can interfere with binding of IgE to Fc{epsilon}RI even though C{epsilon}4 is not directly involved in receptor binding (35).

In summary, data compiled in this paper provide the molecular basis to explain the observed biological characteristics of BSW17 (12, 13, 14, 15, 17). Binding to C{epsilon}3 (as shown in Ref. 17 and this study) may explain how BSW17 can remove IgE from Fc{epsilon}RI (13) and prevent resensitization of the receptor (13, 17). Furthermore binding to the C{epsilon}4 part of the epitope (as shown in Ref. 16 and this study) may explain why BSW17, although nonanaphylactogenic (13), recognizes receptor-bound IgE. This feature is unique to BSW17 compared with other nonanaphylactogenic anti-IgE mAbs (36, 37). Binding to C{epsilon}4 might as well contribute to the inability of BSW17 to provoke mediator release (12, 31).

Nevertheless, the identification of BSW17-binding regions within IgE C{epsilon}3 and C{epsilon}4 allows two interpretations: either BSW17 recognizes a large conformational epitope spanning over parts of the C{epsilon}3 and the C{epsilon}4 domain as outlined above; or BSW17 recognizes two distinct epitopes on the same molecule, i.e., IgE. This phenomenon, referred to as intramolecular cross-reactivity, has been reported for T cells (38) as well as for Abs directed against diphtheria toxin (39) or Plasmodium falciparum (40). The principle of intramolecular cross-reactivity may also help to explain how nonrepetitive Ags are able to cross-link B cell receptors, a mandatory event for B cell activation (38, 39, 40). Structural organization of the C{epsilon}3 epitope (Val397-Gly406) and the C{epsilon}4 epitope (Lys524-Val532) allows the interpretation that both epitopes could be simultaneously bound by one molecule of BSW17. However, to bind to the two epitopes simultaneously on the same CH chain of IgE, the Fab part of BSW17 would have to bind at a very narrow angle. Alternatively, to bind one epitope on each of the two CH chains of the same IgE molecule, the Fab part of BSW17 would have to wrap itself around the IgE molecule. Nevertheless, our cross-inhibition experiments showing that the C{epsilon}3 mimotope is able to inhibit the binding of BSW17 to C{epsilon}4 mimotope (Fig. 2GoB) and vice versa may indicate the presence of two independent epitopes. However, we do not have enough evidence for either hypothesis; therefore, we cannot draw a final conclusion about which of the two hypotheses is correct.

As shown in Table IIIGo, PhC{epsilon}1–4 containing the C{epsilon}3 domain was not recognized by the anti-C{epsilon}3 mAb 4F4. Similarly, we have previously observed that C{epsilon}3 recombinantly produced in E. coli was not recognized by 4F4 and by BSW17 (Ref. 17 and unpublished observation). However, an anti-C{epsilon}3 mAb (termed 8E7/H8) raised against recombinant C{epsilon}3 was shown to also recognize heat-denatured IgE (41). Thus, it may be speculated that recombinant C{epsilon}3 as well as phage-displayed C{epsilon}3 were not properly folded, thereby adopting a structure similar to heat-denatured IgE. This might also explain why PhC{epsilon}1–4 was not recognized by anti-C{epsilon}2 Abs 11-2 and 11-5 (Table IIIGo). From these observations, we conclude that the positive signals obtained for the reaction of BSW17 with PhC{epsilon}1–4 (and with PhC{epsilon}4) were due to recognition of C{epsilon}4 rather than C{epsilon}3.

Because binding of BSW17 to chemically synthesized C{epsilon}3 and C{epsilon}4 mimotope peptides coupled to KLH can be univocally demonstrated (Fig. 2Go), these conjugates might function as immunogens. Our own experimental data (16) have shown that immunization of rabbits with phage particles displaying the C{epsilon}4 mimotope induces Abs directed against human IgE. Mimotopes or mimotope/carrier conjugates are anticipated to represent structures that are "foreign" enough to the human immune system to elicit a strong immune response by immunization, but structurally similar enough to human IgE to specifically induce BSW17-like anti-IgE (auto) Abs. Induction of nonanaphylactogenic anti-IgE Abs should inhibit IgE-mediated responses and subsequently the occurrence of allergic reactions.


   Footnotes
 
1 This study was supported by Swiss National Foundation Grant 3100-052469/97 to B.M.S. Back

2 M.P.R. and A.W.Z. contributed equally to this work. Back

3 Current address: Loyola University of Chicago, Cardinal Bernardin Cancer Center, Oncology Institute, 2160 South First Avenue, Maywood, IL 60153. Back

4 Current address: Department of Biology, Leidy Laboratories, University of Pennsylvania, 415 South University Avenue, Philadelphia, PA 19104-6018. Back

5 Address correspondence and reprint requests to Dr. Franz Kricek, Novartis Forschungsinstitut GmbH, Postfach 80, Brunner Strasse 59, A-1235 Wien, Austria. Back

6 Abbreviations used in this paper: RaP, rabbit anti-phage Ab; PBS-C, PBS containing 1.5 mg/ml casein; KLH, keyhole limpet hemocyanin. Back

Received for publication December 30, 1999. Accepted for publication May 8, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sutton, B. J., H. J. Gould. 1993. The human IgE network. Nature 366:421.[Medline]
  2. Presta, L., R. Shields, L. O’ Connell, S. Lahr, J. Porter, C. Gorman, P. Jardieu. 1994. The binding site on human immunoglobulin E for its high affinity receptor. J. Biol. Chem. 269:26368.[Abstract/Free Full Text]
  3. Helm, B. A., I. Sayers, A. Higginbottom, D. Cantarelli-Machado, Y. Ling, K. Ahmad, E. A. Padlan, A. P. Wilson. 1996. Identification of the high affinity receptor binding region in human immunoglobulin E. J. Biol. Chem. 271:7494.[Abstract/Free Full Text]
  4. Henry, J. H., J. P. D. Cook, J. M. McDonnell, G. A. Mackay, J. Shi, B. J. Sutton, H. J. Gould. 1997. Participation of the N-terminal region of C{epsilon}3 in the binding of human IgE to its high-affinity receptor Fc{epsilon}RI. Biochemistry 36:15568.[Medline]
  5. Riske, F., J. Hakimi, M. Mallamaci, M. Griffin, B. Pilson, N. Tobkes, P. Lin, W. Danho, J. Kochan, R. Chizzonite. 1991. High affinity human IgE receptor (Fc{epsilon}RI): analysis of functional domains of the {alpha}-subunit with monoclonal antibodies. J. Biol. Chem. 266:11245.[Abstract/Free Full Text]
  6. Robertson, M. W.. 1993. Phage and Escherichia coli expression of the human high affinity immunoglobulin E receptor {alpha}-subunit ectodomain. J. Biol. Chem. 268:12736.[Abstract/Free Full Text]
  7. Mallamaci, M. A., R. Chizzonite, M. Griffin, M. Nettleton, J. Hakimi, W. H. Tsien, J. Kochan. 1993. Identification of sites on the human Fc{epsilon}RI{alpha} subunit which are involved in binding human and rat IgE. J. Biol. Chem. 268:22076.[Abstract/Free Full Text]
  8. Hulett, M. D., I. F. C. McKenzie, P. M. Hogarth. 1993. Chimeric Fc receptors identify immunoglobulin-binding regions in human Fc{gamma}RII and Fc{epsilon}RI. Eur. J. Immunol. 23:640.[Medline]
  9. Cook, J. P. D., A. J. Henry, J. M. McDonnell, R. J. Owens, B. J. Sutton, H. J. Gould. 1997. Identification of contact residues in the IgE binding site of human Fc{epsilon}RI{alpha}. Biochemistry 36:15579.[Medline]
  10. Helm, B. A., A. C. Spivey, E. A. Padlan. 1997. Peptide blocking of IgE/receptor interaction: possibilities and pitfalls. Allergy 52:1155.[Medline]
  11. Knutti-Mueller, J. M., B. M. Stadler, C. M. Magnusson, A. L. DeWeck. 1986. Human IgE synthesis in vitro: detection with monoclonal antibodies. Allergy 41:457.[Medline]
  12. Kings, M. A., M. C. Conroy, B. M. Stadler, C. G. Magnusson, F. Skvaril, A. L. DeWeck. 1986. Histamine release from human leukocytes by anti-IgE antibodies: influence of multiple or single epitope recognition. Diagn. Immunol. 4:89.[Medline]
  13. Rudolf, M. P., K. Furukawa, S. Miescher, M. Vogel, F. Kricek, B. M. Stadler. 1996. Effect of anti-IgE antibodies on Fc{epsilon}RI-bound IgE. J. Immunol. 157:5646.[Abstract]
  14. Staempfli, M. R., S. Miescher, I. Aebischer, A. W. Zuercher, B. M. Stadler. 1994. Inhibition of human IgE synthesis by anti-IgE antibodies requires divalent recognition. Eur. J. Immunol. 24:2161.[Medline]
  15. Stadler, B. M, M. P. Rudolf, M. Vogel, S. Miescher, A. W. Zuercher, F. Kricek. 1997. Can active immunization redirect an anti-IgE immune response?. Int. Arch. Allergy Immunol. 113:216.[Medline]
  16. Rudolf, M. P., M. Vogel, F. Kricek, C. Ruf, A. W. Zuercher, R. Reuschel, M. Auer, S. M. Miescher, B. M. Stadler. 1998. Epitope specific antibody response to IgE by mimotope immunization. J. Immunol. 160:3315.[Abstract/Free Full Text]
  17. Miescher, S., M. Vogel, M. R. Staempfli, E. Wasserbauer, F. Kricek, S. Vorburger, B. M. Stadler. 1994. Domain-specific anti-IgE antibodies interfere with IgE binding to Fc{epsilon}RII. Int. Arch. Allergy Immunol. 105:75.[Medline]
  18. Vogel, M., S. Miescher, C. Biaggi, B. M. Stadler. 1994. Human anti-IgE antibodies by repertoire cloning. Eur. J. Immunol. 24:1200.[Medline]
  19. Nechansky, A., E. Pursch, F. Effenberger, F. Kricek. 1997. Characterization of monoclonal antibodies directed against the {alpha}-subunit of the human IgE high-affinity receptor. Hybridoma 16:441.[Medline]
  20. Vassella, C. C., A. L. DeWeck, B. M. Stadler. 1990. Influence of IgE fragments on IgE determination. Int. Arch. Allergy Appl. Immunol. 92:272.[Medline]
  21. Nechansky, A., C. Ruf, F. Kricek. 1997. In vitro expression of PCR fragments: A convenient tool for generating purified recombinant proteins in analytical amounts. Methods Mol. Cell. Biol. 6:94.
  22. Kang, A. S., C. F. Barbas, K. D. Janda, S. J. Benkovic, R. A. Lerner. 1988. Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proc. Natl. Acad. Sci. USA 88:4363.[Abstract/Free Full Text]
  23. Hong, C. S., B. M. Stadler, M. Wälti, A. L. DeWeck. 1986. Dot-immunobinding assay with monoclonal anti-IgE antibodies for the detection and quantitation of human IgE. J. Immunol. Methods 95:195.[Medline]
  24. B. K. Kay, and G. Winter, and J. McCafferty, eds. Phage Display of Peptides and Proteins: a Laboratory Manual 1998 Academic Press, San Diego.
  25. Helm, B. A., Y. Ling, C. Teale, E. A. Padlan, M. Bruggemann. 1991. The nature and importance of the inter-{epsilon}chain disulfide bonds in human IgE. Eur. J. Immunol. 21:1543.[Medline]
  26. Felici, F.. 1991. Selection of antibody ligands from a large library of oligonucleotides expressed on a multivalent exposition vector. J. Mol. Biol. 222:301.[Medline]
  27. Amit, A. G., S. E. Mariuzza, E. Philips, R. J. Poljal. 1986. Three-dimensional structure of an antigen-antibody complex at 2.8 Å resolution. Science 233:747.[Abstract/Free Full Text]
  28. Sheriff, S., E. W. Silverton, E. A. Padlan, G. H. Cohen, S. J. Smith, B. C. Finzel, D. R. Davies. 1987. Three-dimensional structure of an antigen-antibody complex. Proc. Natl. Acad. Sci. USA 84:8075.[Abstract/Free Full Text]
  29. Colman, P. M., W. G. Laver, J. N. Varghese, A. T. Baker, P. A. Tulloch, G. M. Air, R. G. Webster. 1987. Three-dimensional structure of a complex of antibody with influenza virus neuraminidase. Nature 326:358.[Medline]
  30. Padlan, E. A., E. W. Silverton, S. Sheriff, G. H. Cohen, S. J. Smith Gill, D. R. Davies. 1989. Structure of an antibody-antigen complex: crystal structure of the HyHEL-10 Fab-lysozyme complex. Proc. Natl. Acad. Sci. USA 86:5938.[Abstract/Free Full Text]
  31. Stanworth, D. R., J. W. Coleman, Z. Khan. 1984. Essential structural requirements for triggering of mast cells by a synthetic peptide comprising a sequence in the C{epsilon}4 domain of human IgE. Mol. Immunol. 21:243.[Medline]
  32. Drake-Lee, H., V. Jones, I. Lewin, S. Nayyar, A. Wells, D. R. Stanworth. 1996. Levels of substance P and IgE decapeptide in nasal polyp fluid an matching sera: a preliminary study. J. Laryngol. Otol. 110:225.[Medline]
  33. Stanworth, D. R.. 1971. Immunoglobulin E (reagin) and allergy. Nature 233:310.[Medline]
  34. Stanworth, D. R., V. M. Jones, I. V. Lewine, S. Nayyar. 1990. Allergy treatment with a peptide vaccine. Lancet 338:1279.
  35. Schwarzbaum, S., A. Nissim, I. Alkalay, M. C. Ghozi, D. G. Schindler, Y. Bergman, Z. Eshhar. 1989. Mapping of murine IgE epitopes involved in IgE-Fc{epsilon} receptor interactions. Eur. J. Immunol. 19:1015.[Medline]
  36. Presta, L. G., S. J. Lahr, R. L. Shields, J. P. Porter, C. M. Gorman, B. M. Fendly, P. M. Jardieu. 1993. Humanization of an antibody directed against human IgE. J. Immunol. 151:2623.[Abstract]
  37. Kolbinger, F., J. Saldanha, N. Hardman, M. M. Bendig. 1993. Humanization of a mouse anti-human IgE antibody: a potential therapeutic for IgE-mediated allergies. Protein Eng. 6:971.[Abstract/Free Full Text]
  38. Hagerty, D. T., P. M. Allen. 1995. Intramolecular mimicry. Identification and analysis of two cross-reactive epitopes within a single protein. J. Immunol. 155:2993.[Abstract]
  39. Autran, B., F. Triebel, M. Viguier, M. Jolivet, P. Falmagne, P. Debre. 1987. Monoclonal B-cell response to diphtheria toxoid: evidence for cross-reactive epitopes. Immunology 60:531.[Medline]
  40. Sharma, P., A. Kumar, B. Singh, A. Bhardawaj, V. N. Sailaja, A. Kushwaha, P. Malhotra, V. S. Chauhan. 1998. Characterization of protective epitopes in a highly conserved Plasmodium falciparum antigenic protein containing repeats of acidic basic residues. Infect. Immun. 66:2895.[Abstract/Free Full Text]
  41. Pachlopnik, J. M., M. R. Staempfli, M. P. Rudolf, I. Aebischer, F. Kricek, S. M. Miescher, B. M. Stadler. 1998. Antigen interaction and heat inactivation exposes new epitopes on human IgE. Int. Arch. Allergy. Immunol. 117:231.[Medline]
  42. Scott, J. K., G. P. Smith. 1990. Searching for peptide ligands with an epitope library. Science 249:386.[Abstract/Free Full Text]
  43. Christian, R. B., R. N. Zuckermann, J. M. Kerr, L. Wang, B. A. Malcolm. 1992. Simplified methods for construction, assessment and rapid screening of peptide libraries in bacteriophage. J. Mol. Biol. 227:711.[Medline]
  44. Stoute, J. A., W. R. Ballou, N. Kolodny, C. D. Deal, R. A. Wirtz, L. E. Lindler. 1995. Induction of humoral immune response against Plasmodium falciparum sporozoites by immunization with a synthetic peptide mimotope whose sequence was derived from screening a filamentous phage epitope library. Infect. Immun. 63:934.[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rudolf2 3, M. P.
Right arrow Articles by Kricek, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rudolf2 3, M. P.
Right arrow Articles by Kricek, F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS