The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kieber-Emmons, T.
Right arrow Articles by Weiner, D. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kieber-Emmons, T.
Right arrow Articles by Weiner, D. B.
The Journal of Immunology, 2000, 165: 623-627.
Copyright © 2000 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: DNA Immunization with Minigenes of Carbohydrate Mimotopes Induce Functional Anti-Carbohydrate Antibody Response1

Thomas Kieber-Emmons2, Behjatolah Monzavi-Karbassi, Bin Wang, Ping Luo and David B. Weiner

Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 References
 
To date, the generation of anti-carbohydrate Th1 immune responses, which would be useful for both tumor immunotherapy as well as in pathogen vaccine strategies, has been elusive. To augment Th1 immune responses to carbohydrate Ags, we describe results of DNA vaccination studies in mice using plasmids encoding designed peptide mimotopes (minigenes) of the neolactoseries Ag Lewis Y (LeY). In contrast to LeY immunization, immunization with mimotope-encoded plasmids induced LeY cross-reactive IgG2a Abs. Minigene immunization primed for a LeY-specific response that is rapidly activated upon encounter with nominal Ag upon subsequent boost. The resulting IgG2a response mediated complement-dependent cytotoxicity of a LeY-expressing human tumor cell line in the presence of human complement. These studies establish that peptide mimotopes of carbohydrate Ags encoded as DNA plasmids are novel immunogens providing a means to manipulate carbohydrate cross-reactive Th1 responses.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 References
 
Targeting carbohydrate Ags associated with either pathogens or expressed on tumor cells is a challenge in the design of effective vaccines. Carbohydrates are traditionally viewed as T cell-independent Ags with a number of unique and important immunological properties that are not encountered when inducing an immune response to protein (1). These properties have precluded the use of pure carbohydrate or polysaccharide (PS)3 vaccines in those patients most at risk. Conjugate vaccine technology has overcome some of the limitations of carbohydrates as vaccine Ags because of the T-dependent help conferred by the protein (2). Nevertheless, PS conjugates induce responses that are often deficient in many respects, including the lack of induction of the Th1-associated murine IgG2a isotype (3), while inducing predominately IgG1 and IgG3 isotypes.

An alternative approach to develop T-dependent responses to carbohydrate Ags is the use of peptide or polypeptide surrogates of carbohydrates. Carbohydrate-mimicking peptides could significantly improve vaccines against infectious pathogens or tumor cells (4). Peptides that mimic carbohydrate structure have significant advantages as vaccines compared with carbohydrate-protein conjugates. Most notably, peptides can be engineered to induce Th1 responses by their incorporation into DNA plasmids for vaccination. The induction of a Th1-like response is the predominant response to DNA vaccines (5, 6). It is now accepted that Th1-dominant immunity, which is regulated by IL-12 and IFN-{gamma}, plays a pivotal role in the eradication of tumors in vivo and in mediating pathogen clearance. Therefore, immunization with peptide mimotope-encoding minigenes can provide a cellular-associated response to carbohydrate Ags not achievable by PS conjugates alone. Redirection of the immune response to a Th1-like profile may augment vaccine responsiveness to these otherwise challenging Ags. Here, we report for the first time that peptide mimotopes constructed into DNA plasmids can prime for the induction of a carbohydrate Th1-associated IgG2a cross-reactive immune response. The feasibility of immunization with peptide-mimotope DNA plasmids (minigene) was investigated in mice by studying whether minigene vaccination can prime for the induction of Th1-associated IgG2a Ab cross-reactive with the human tumor-associated Histo-Blood group-related neolactoseries Ag Lewis Y (LeY). A Th1 response with the expression of the IgG2a isotype is a desirable response as IgG2a Abs are opsonizing and complement fixing.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 References
 
Construction of the expression vectors

Oligonucleotides were synthesized and inserted into pcDNA3 or pcDNA1 vectors. In the design of pcDNAggi and pcDNAari, we included a leader (7) and Th epitope (8) in the beginning of the peptide sequence. The plasmid pcDNAggi was generated by inserting the leader sequence oligonucleotide AGCTTCCACCATGAGGTACATGATTTTAGGCTTGCTCGCCCTTGCGGCAGTCTGCAGCGC between the restriction sites HindIII and NotI in the polylinker region. The T1 and peptide mimotope-encoded oligonucleotide GGCCGCGAAGCAGATCATCAACATGTGGCAGGAGGTGGGCAAGGCCATGTACGCCGGCGGCATCTACTGGCGCTACGACATCTACTGGCGCTACGACATCTACTGGAGGTACGACTAAT was further cloned into the NotI and XbaI sites. The later oligonucleotide was replaced by GGCCGCGAAGCAGATCATCAACATGTGGCAGGAGGTGGGCAAGGCCATGTACGCCCGCATCTACTACCGCTACGACGGCTTCGCCTACTAAT to generate the pcDNAari plasmid. All inserts were sequenced after construction. Plasmids were grown in Escherichia coli DH5{alpha} strain. DNA was purified using a maxi prep kit (Qiagen, Valencia, CA). Plasmid pVHSOL was generated in pcDNA1 (Invitrogen, San Diego, CA) in the same way as pcDNAari but without the leader and the Th epitope-encoding sequences. The gene expression of both vectors is under the control of the CMV promoter. Expression is virtually the same for the vectors according to the manufacturer. The cloning of IL-4 and Il-12 genes was previously described (9).

DNA and carbohydrate immunizations

The quadriceps of muscles of mice were injected as described earlier (9). Briefly, each BALB/c mouse (groups of four) received two i.m. injections (3 wk apart) with 100 µg of each DNA construct resuspended in 100 µl of PBS and 0.25% bupivacaine-HCl (Sigma, St. Louis, MO). For carbohydrate boost, mice were injected i.p. with 40 µg of LeY and incorporated into polyacrylamide matrix (GlycoTech, Rockville, MD) along with 20 µg QS-21 (Aquila Biopharmaceuticals, Farmingham MA).

ELISA

To assess LeY reactivity of collected serum, standard ELISA was performed as described previously (10). Wells were coated with 0.2 µg/well of LeY. After blocking with 0.5% FCS in PBS, serum samples were added to each well in triplicate. Goat anti-mouse IgG/or IgM conjugated with HRP (Sigma) was used as secondary Ab. For isotype detection, we used Immunopure mAb isotyping kit I (Pierce, Rockford, IL) based on the manufacturer instruction. To prepare a standard curve to quantify the amount of IgG isotypes, plates were coated with mouse serum, and IgG reactivity was assessed using different concentrations of isotype-specific Abs (10). In addition, we quantified the LeY activity of the serum as calculated from a standard curve generated concurrently using the LeY-reactive IgG2a Ab BR55-2 (10).

Cell-based assays

Splenocytes from experimental and control animals were used for detection of T cell proliferation as described (9). Several peptides were used in these assays that include peptide 106 with the sequence GGIYWRYDIYWRYDIYWRYD. This peptide was synthesized as a multiple Ag peptide (Research Genetics, Huntsville, AL) as described previously (10). Briefly, cells were incubated without or with peptides, and after 3 days of incubation 1 µCi of [3H]thymidine was added to each well for another 16–18 h. Cells were harvested and counted on a Betaplate liquid scintillation counter (Wallac, Gaithersburg, MD). Cytotoxic activity was measured by a standard 5-h 51Cr release assay (9). To calculate specific lysis of targets, the percent lysis of nonspecific targets (p815 cells; American Type Culture Collection, Manassas, VA) was subtracted from the percent lysis of specific targets (peptide-pulsed p815 cells). Peptide-pulsed targets were prepared by incubating p815 cells with 1 mM concentration of the 106 peptide for 18 h at 37°C. CD8+ T cells were removed from the splenocytes by treatment with anti-CD8 mAb (53-6.7) (PharMingen, San Diego, CA) followed by incubation with rabbit complement. Complement-dependent cytotoxicity (CDC) was measured using the LeY-expressing human tumor cell line MCF7 (American Type Culture Collection) and human complement (Sigma) as previously described (10). The anti-LeY mAb BR55-2 was used as a positive control and for IgG standardization (10).

Statistical analysis

Data were expressed as arithmetic mean ± SD and analyzed by the Statview 4.1 program (Abacus Concepts, Berkeley, CA). Data were analyzed for normal distribution, and the statistical significance of the difference between groups was determined by the two-tailed Student’s t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
References
 
Choice of peptides as DNA immunogens

Plasmids pcDNAari and pcDNAggi (Table IGo) were designed to express chimeric peptides that include a secretory leader sequence, a T cell epitope from HIV-1 gp120 (referred to as the T1 peptide; Ref. 8), and respective carbohydrate mimotope-encoding sequences that mimic the meningococcal group C capsular PS of Neisseria meningitidis (11), Lewis Ags expressed on tumor cells (10) and mannosyl, lactoseries, and sialyl residues on HIV-1 gp120 (12). It was rationalized that the leader sequence would allow exogenous expression with the inclusion of the T cell epitope to augment T cell help. In plasmid pVHSOL, we cloned only the peptide mimic sequence of pcDNAari without the leader and T1 seqeunces.


View this table:
[in this window]
[in a new window]
  		Table I. Plasmids used in this study

 
The T1 epitope is suggested to bind to both MHC class II and class I. MHC class I binding sequences can also be subsets of MHC class II binding peptides. Representative HLA binding predictions identify an H2-K (BALB/c) class I binding motif centered on two 9-mer sequences of the T1 peptide (Table IGo) (13). Likewise, the mimotope sequences encoded in pcDNAari and pcDNAggi contain 10-mer sequences predicted as class I binding peptides (Table IGo).

DNA vaccination results in LeY cross-reactive immune response

Separate groups of animals were immunized with the respective constructs and 3 wk after the immunization, serum reactivity with LeY was quantified by ELISA. Results with 10-fold diluted serum showed a statistically significant increase in the reactivity of IgG Ab after immunization with these constructs. No IgM was detected. Mice were again immunized at week 3, and the titration of anti-LeY immune response at week 5 was determined (Table IIGo). The LeY cross-reactivity was persistent to a 1:256 dilution for serum from pcDNAggi-immunized animals, which is statistically significant (p < 0.05) compared with serum from control vector-immunized mice. Immunization with pcDNAggi induced a consistently growing LeY cross-reactive response that appears superior to the other two plasmids. The mimotope in pcDNAggi reflects a repetitive Ag, which is typically more immunogenic (14) or the peptide represents a better mimic of the LeY epitope. Isotyping and quantitation of serum Abs of pcDNAggi-immunized mice for subsequent weeks indicate a LeY cross-reactive IgG2a-dominant response compared with IgG1 and IgG2b, which is indicative of a Th1 immune response (Fig. 1Go). At week 7, IgG2a showed a 10-fold increase compared with preimmune serum with a concentration of 0.12 µg/ml. However, IgG production dropped significantly after week 7. These results are in agreement with other reports, where a predominant IgG2a response is generated following i.m. DNA immunization. Again, no IgM was detected.


View this table:
[in this window]
[in a new window]
  		Table II. IgG titer in pooled sera of four mice in each experimental group1

 


View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 1. Serum response to minigene immunization. Serum from pcDNAggi-immunized mice (four per group) from week 2 to week 7 after first immunization were diluted 1:50, and quantitative LeY-reactive isotypes were assessed by anti-IgG1, IgG2a, and IgG2b Abs. The ratios were calculated as the amount (µg/ml) of LeY IgG isotypes in serum from pcDNAggi-immunized animals in a given week divided by that amount in preimmune serum. Error bars are calculated based on independent experiments.

 
DNA vaccination primes for carbohydrate-inducible IgG Ab response

DNA priming and protein boosting can enhance the production and functionality of induced Ab. Here, we tested this boost strategy with carbohydrate Ag. Minigene-primed mice and a vector-injected control group were boosted with 40 µg of polyvalent synthetic LeY with QS-21 on week 8 and bled on week 9 and 11. Minigene immunization induced the formation of LeY cross-reactive memory cells that were rapidly and specifically stimulated upon encounter with LeY (Table IIGo). Enhancement of IgG was persistent with a statistically significant difference compared with vector alone-primed/LeY-boosted mice. Anti-LeY reactivity of serum from pcDNAggi-primed/LeY-boosted mice increased more than three times in titer from 1 to 256 (before boost) to 1 to 800 titer (after boost) (Table IIGo). As expected, boosting with LeY led to an enhanced anti-LeY IgM response (data not shown). IgM levels increased a week after immunization and dropped 3 wk after the immunization.

We also determined the isotype components at week 11 (Fig. 2Go). IgG2a remained the predominant component of the immune response, with a 4-fold higher titer for pcDNAggi compared with the two other minigenes (Table IIGo), suggesting that the WRYDI-containing peptide better mimics LeY. The IgG level slightly increased up to 5 wk after carbohydrate boost (not shown). These data suggest mimotope-encoded DNA immunization generates a memory B cell population that can be expanded by the nominal Ag boost. In bacterial model systems, animals primed with carbohydrate-conjugated vaccines demonstrate a booster response after secondary immunization with either carbohydrate or carbohydrate-conjugate (15). It is suggested that the same general phenomenon can be observed upon priming with mimotope-encoded DNA followed by carbohydrate boosting. Priming with mimotopes of pathogen (or tumor)-associated carbohydrate Ags followed by boosting with cognate or nominal carbohydrate Ag allows desired memory cells to be established that could be effective to thwart early infection or metastasis.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 2. Isotype components as relative ratio of IgG2a to IgG1 and IgG2b after boost. The amount of IgG isotypes was quantified based on the mean level of serum (n = 4). IgG2a was divided by the mean (IgG1 + IgG2b) level in each immunization group. Blood was collected 3 wk after carbohydrate boost and diluted to 1:50. The naive group was also immunized with carbohydrate.

 
Induced IgG2a Ab mediates cell killing

The functional property of the induced serum from pcDNAggi-immunized mice was tested in CDC assays against the LeY-expressing human breast tumor cell line MCF7 in the presence of human complement (Fig. 3GoA). The IgG2a anti-LeY mAb BR55-2 (10) served as a positive control (Fig. 3GoB) and to assess the relative effective anti-LeY-reactive concentration of mimotope-induced Ab. The lowest statistically significant titer before boosting that mediated CDC (p < 0.01) displayed an effective concentration of mimotope-induced IgG2a of about 0.14 µg/ml compared with BR55-2 (Fig. 3GoB). After boost, the percentage of cytotoxicity was enhanced (p < 0.001) to an effective concentration of about 0.22 µg/ml compared with BR55-2 (Fig. 3GoB).



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 3. CDC assay with human MCF7 cells. A, This experiment was performed using serum from immunized mice before and 2 wk after carbohydrate boost. B, Titration of CDC-mediated killing of MCF7 cells using anti-LeY (BR55-2) Ab. ***, p < 0.001 and **, p < 0.01 compared with vector immunized animals using Student’s t test. *, p < 0.025 compared with pcDNAggi-immunized animals before boost using Student’s t test.

 
T cell responses

CTL recognize target proteins as short peptides presented by MHC class I restriction elements. However, there is also evidence for peptide-independent TCR recognition of target proteins and nonprotein structures. How such T cell responses are generated is presently unclear. Carbohydrate-reactive T cells have been described (16, 17, 18). T cells induced by a carbohydrate mimic has been shown to cross-react with a protein Ag expressed on tumor cells (19). It maybe possible that peptide mimics can expand T cells that are reactive with naturally processed glycopeptides. Consequently, we asked if DNA immunization with peptide mimics could lead to T cell responses as predicted by analysis of MHC class I and class II binding profiles (Table IGo).

Several relevant peptides including peptide 106 were used to stimulate T cells. We did not observe any significant differences between immunized groups in T cell proliferation (data not shown). To further determine whether augmentation of Th activity would affect the magnitude of the immune response, we coimmunized additional groups of mice with the plasmids in Table IGo along with plasmids encoding IL-12 and IL-4. Coimmunization with either cytokine-encoding plasmid did not influence any further the Ab response to LeY relative to that previously shown with peptide-encoded plasmid alone. However, we observed a significantly higher T cell proliferation of splenocytes derived from mice immunized with the pcDNAggi plasmid with coimmunization with IL-12 (data not shown). Detected IFN-{gamma} released (not shown) in supernatant collected from in vitro peptide-activated splenocytes again supported Th1-type activation consistent with the observed IgG2a production. Expectedly, the Th1 response leads to a high cytotoxic T lymphocyte activity against peptide-pulsed class I+ class II- mastocytoma P815 target cells in coimmunized animals (Fig. 4Go). As expected, the removal of CD8+ T cells resulted in the suppression of specific lysis enhancement observed with coimmunization of IL-12 gene (Fig. 4Go). Parental P815 cells were not lysed. We did not detect any enhancement in T cell proliferation, CTL, or Ab response upon coimmunization with IL-4, exactly as previously reported (20).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 4. . IL-12 coimmunization with pcDNAggi induces a significant CD8+-dependent CTL activity. Splenocytes were stimulated for 5 days. Cytotoxicity was measured on peptide-pulsed p815 cells as targets. {blacksquare}, pcDNAggi + IL-12; {blacktriangleup}, pcDNAggi + IL-12 (CD8+ cells depleted); •, pcDNAggi.

 
We observe that DNA immunizations with plasmids encoding peptide mimotopes of carbohydrate Ags induce carbohydrate cross-reactive humoral responses, albeit of low titer. Packaging of these epitopes into more effective T cell stimulators or presenting them as multivalent Ags (21) along with adjuvants that further potentiate Th1 response should improve the titers. IgG2a and IgG3 isotypes have been reported to be particularly effective in conferring protection against encapsulated organisms, and Th1 responses are associated with more efficacious tumor vaccination. It is clearly a unique property of this approach to induce a humoral carbohydrate cross-reactive, a Th, and a CTL response in one simple inoculation. It should be possible to further engineer peptides that mimic glycopeptides that are processed on native Ags to further augment T cell responses. It is also likely that engineering mimotopes into hybrid plasmids, which replace the model Th epitope with Th or CTL epitopes from a pathogen or tumor target itself, would be expected to build in a memory response that is relevant in the context of challenge.


   Acknowledgments
 
We thank Kaity Y. Lin, Shahram Shamloo, Matthew Kieber-Emmons, and Habib Rahbar for technical assistance in DNA purification and ELISAs. We thank Charlotte Read Kensil of Aquila Biopharmaceuticals for the QS-21.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant R01AI45133 (to T.K.E.). D.B.W. is supported by National Institutes of Health Grant SRO1 A135515-04A3. Back

2 Address correspondence and reprint request to Dr. Thomas Kieber-Emmons, Department of Pathology and Laboratory Medicine, Room 280, John Morgan Building, 36th and Hamilton Walk, Philadelphia, PA 19104-6082. Back

3 Abbreviations used in this paper: PS, polysaccharide; LeY, Lewis Y; CDC, complement-dependent cytotoxicity. Back

Received for publication March 22, 2000. Accepted for publication May 15, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 References
 

  1. Mond, J. J., A. Lees, C. M. Snapper. 1995. T cell-independent antigens type 2. Annu. Rev. Immunol. 13:655.[Medline]
  2. Ahmad, H., E. K. Chapnick. 1999. Conjugated polysaccharide vaccines. Infect. Dis. Clin. North Am. 13:113.[Medline]
  3. Buchanan, R. M., B. P. Arulanandam, D. W. Metzger. 1998. IL-12 enhances antibody responses to T-independent polysaccharide vaccines in the absence of T and NK cells. J. Immunol. 161:5525.[Abstract/Free Full Text]
  4. Shikhman, A. R., M. W. Cunningham. 1997. Trick and treat: toward peptide mimic vaccines. Nat. Biotechnol. 15:512.[Medline]
  5. Lai, W. C., M. Bennett. 1998. DNA vaccines. Crit. Rev. Immunol. 18:449.[Medline]
  6. Cohen, A. D., J. D. Boyer, D. B. Weiner. 1998. Modulating the immune response to genetic immunization. FASEB J. 12:1611.[Abstract/Free Full Text]
  7. Persson, H. H., H. Jornvall, J. Zabielski. 1980. Multiple mRNA species for the precursor to an adenovirus-encoded glycoprotein: identification and structure of the signal of the signal sequence. Proc. Natl. Acad. Sci. 77:6349.[Abstract/Free Full Text]
  8. Ahlers, J. D., T. Takeshita, D. Pendelton, J. A. Berzofsky. 1997. Enhanced immunogenecity of HIV-1 vaccine construct by modification of the native peptide sequence. Proc. Natl. Acad. Sci. USA 94:10856.[Abstract/Free Full Text]
  9. Kim, J. J., N. N. Trivedi, L. K. Nottingham, L. Morrison, A. Tsai, Y. Hu, S. Mahalingam, K. Dang, L. Ahn, N. K. Doyle, et al 1998. Modulation of amplitude and direction of in vivo immune response by co-adminstration of cytokine gene expression cassettes with DNA immunogens. Eur. J. Immunol. 28:1089.[Medline]
  10. Kieber-Emmons, T., P. Luo, J.-P. Qiu, T. Y. Chang, I. O, M. Blaszczyk-Thurin, Z. Steplewski. 1999. Vaccination with carbohydrate peptide mimotopes promotes anti-tumor responses. Nat. Biotechnol. 17:660.[Medline]
  11. Westerink, M. A. J., P. C. Giardina, M. A. Apicella, T. Kieber-Emmons. 1995. Peptide mimicry of the meningococcal group C capsular polysaccharide. Proc. Natl. Acad. Sci. USA 92:4021.[Abstract/Free Full Text]
  12. Agadjanyan, M., P. Luo, M. A. Westerink, L. A. Carey, W. Hutchins, Z. Steplewski, D. B. Weiner, T. Kieber- Emmons. 1997. Peptide mimicry of carbohydrate epitopes on human immunodeficiency virus. Nat. Biotechnol. 15:547.[Medline]
  13. Parker, K. C., M. A. Bednarek, J. E. Coligan. 1994. Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J. Immunol. 152:163.[Abstract]
  14. Fehr, T., M. F. Bachmann, E. Bucher, U. Kalinke, F. E. Di Padova, A. B. Lang, H. Hengartner, R. M. Zinkernagel. 1997. Role of repetitive antigen patterns for induction of antibodies against antibodies. J. Exp. Med. 185:1785.[Abstract/Free Full Text]
  15. Rubinstein, L. J., P. A. Garcia-Ojeda, F. Michon, H. J. Jennings, K. E. Stein. 1998. Murine immune responses to Neisseria meningitidis group C capsular polysaccharide and a thymus-dependent toxoid conjugate vaccine. Infect. Immun. 66:5450.[Abstract/Free Full Text]
  16. Jensen, T., P. Hansen, S. L. Galli, S. Mouritsen, K. Frische, E. Meinjohanns, M. Meldal, O. Werdelin. 1997. Carbohydrate and peptide specificity of MHC class II-restricted T cell hybridomas raised against an O-glycosylated self peptide. J. Immunol. 158:3769.[Abstract]
  17. Galli-Stampino, L., E. Meinjohanns, K. Frische, M. Meldal, T. Jensen, O. Werdelin, S. Mouritsen. 1997. T-cell recognition of tumor-associated carbohydrates: the nature of the glycan moiety plays a decisive role in determining glycopeptide immunogenicity. Cancer Res. 57:3214.[Abstract/Free Full Text]
  18. Forestier, C., E. Moreno, S. Meresse, A. Phalipon, D. Olive, P. Sansonetti, J. P. Gorvel. 1999. Interaction of Brucella abortus lipopolysaccharide with major histocompatibility complex class II molecules in B lymphocytes. Infect. Immun. 67:4048.[Abstract/Free Full Text]
  19. Apostolopoulos, V., M. S. Sandrin, I. F. McKenzie. 1999. Carbohydrate/peptide mimics: effect on MUC1 cancer immunotherapy. J. Mol. Med. 77:427.[Medline]
  20. Kim, J. J., L. K. Nottingham, A. Tsai, D. J. Lee, H. C. Maguire, J. Oh, T. Dentchev, K. H. Manson, M. S. Wyand, M. G. Agadjanyan, K. E. Ugen, D. B. Weiner. 1999. Antigen-specific humoral and cellular immune responses can be modulated in Rhesus macaques through the use of IFN-{gamma}, IL-12, or IL-18 gene adjuvants. J. Med. Primatol. 28:214.[Medline]
  21. Ulrich, R., D. Koletzki, S. Lachmann, A. Lundkvist, A. Zankl, A. Kazaks, A. Kurth, H. R. Gelderblom, G. Borisova, H. Meisel, D. H. Kruger. 1999. New chimaeric hepatitis B virus core particles carrying hantavirus (serotype Puumala) epitopes: immunogenicity and protection against virus challenge. J. Biotechnol. 73:141.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C. Lo Passo, A. Romeo, I. Pernice, P. Donato, A. Midiri, G. Mancuso, M. Arigo, C. Biondo, R. Galbo, S. Papasergi, et al.
Peptide Mimics of the Group B Meningococcal Capsule Induce Bactericidal and Protective Antibodies after Immunization
J. Immunol., April 1, 2007; 178(7): 4417 - 4423.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Fest, N. Huebener, S. Weixler, M. Bleeke, Y. Zeng, A. Strandsby, R. Volkmer-Engert, C. Landgraf, G. Gaedicke, A. B. Riemer, et al.
Characterization of GD2 Peptide Mimotope DNA Vaccines Effective against Spontaneous Neuroblastoma Metastases
Cancer Res., November 1, 2006; 66(21): 10567 - 10575.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
W. Luo, E. Ko, J. C.-f. Hsu, X. Wang, and S. Ferrone
Targeting Melanoma Cells with Human High Molecular Weight-Melanoma Associated Antigen-Specific Antibodies Elicited by a Peptide Mimotope: Functional Effects
J. Immunol., May 15, 2006; 176(10): 6046 - 6054.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
C. Beninati, A. Midiri, G. Mancuso, C. Biondo, M. Arigo, E. Gerace, S. Papasergi, M. Gambuzza, M. Boretti, W. Magliani, et al.
Antiidiotypic DNA vaccination induces serum bactericidal activity and protection against group B meningococci
J. Exp. Med., January 23, 2006; 203(1): 111 - 118.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
I. H. Park, J. H. Youn, I.-H. Choi, M. H. Nahm, S. J. Kim, and J.-S. Shin
Anti-Idiotypic Antibody as a Potential Candidate Vaccine for Neisseria meningitidis Serogroup B
Infect. Immun., October 1, 2005; 73(10): 6399 - 6406.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Monzavi-Karbassi, C. Artaud, F. Jousheghany, L. Hennings, J. Carcel-Trullols, S. Shaaf, S. Korourian, and T. Kieber-Emmons
Reduction of Spontaneous Metastases through Induction of Carbohydrate Cross-Reactive Apoptotic Antibodies
J. Immunol., June 1, 2005; 174(11): 7057 - 7065.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
W. Luo, J. C.-f. Hsu, C.-Y. Tsao, E. Ko, X. Wang, and S. Ferrone
Differential Immunogenicity of Two Peptides Isolated by High Molecular Weight-Melanoma-Associated Antigen-Specific Monoclonal Antibodies with Different Affinities
J. Immunol., June 1, 2005; 174(11): 7104 - 7110.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
E. Bolesta, A. Kowalczyk, A. Wierzbicki, P. Rotkiewicz, B. Bambach, C.-Y. Tsao, I. Horwacik, A. Kolinski, H. Rokita, M. Brecher, et al.
DNA Vaccine Expressing the Mimotope of GD2 Ganglioside Induces Protective GD2 Cross-reactive Antibody Responses
Cancer Res., April 15, 2005; 65(8): 3410 - 3418.
[Abstract] [Full Text] [PDF]

Home page
 BrainHome page
G. Zhang, P. H. H. Lopez, C. Y. Li, N. R. Mehta, J. W. Griffin, R. L. Schnaar, and K. A. Sheikh
Anti-ganglioside antibody-mediated neuronal cytotoxicity and its protection by intravenous immunoglobulin: implications for immune neuropathies
Brain, May 1, 2004; 127(5): 1085 - 1100.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Beninati, S. Arseni, G. Mancuso, W. Magliani, S. Conti, A. Midiri, C. Biondo, L. Polonelli, and G. Teti
Protective Immunization against Group B Meningococci Using Anti-Idiotypic Mimics of the Capsular Polysaccharide
J. Immunol., February 15, 2004; 172(4): 2461 - 2468.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Cunto-Amesty, T. K. Dam, P. Luo, B. Monzavi-Karbassi, C. F. Brewer, T. C. Van Cott, and T. Kieber-Emmons
Directing the Immune Response to Carbohydrate Antigens
J. Biol. Chem., August 3, 2001; 276(32): 30490 - 30498.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kieber-Emmons, T.
Right arrow Articles by Weiner, D. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kieber-Emmons, T.
Right arrow Articles by Weiner, D. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS