|
|
||||||||
CUTTING EDGE |
Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
An alternative approach to develop T-dependent responses to
carbohydrate Ags is the use of peptide or polypeptide surrogates of
carbohydrates. Carbohydrate-mimicking peptides could significantly
improve vaccines against infectious pathogens or tumor cells
(4). Peptides that mimic carbohydrate structure have
significant advantages as vaccines compared with carbohydrate-protein
conjugates. Most notably, peptides can be engineered to induce Th1
responses by their incorporation into DNA plasmids for vaccination. The
induction of a Th1-like response is the predominant response to DNA
vaccines (5, 6). It is now accepted that Th1-dominant
immunity, which is regulated by IL-12 and IFN-
, plays a pivotal role
in the eradication of tumors in vivo and in mediating pathogen
clearance. Therefore, immunization with peptide mimotope-encoding
minigenes can provide a cellular-associated response to carbohydrate
Ags not achievable by PS conjugates alone. Redirection of the immune
response to a Th1-like profile may augment vaccine responsiveness to
these otherwise challenging Ags. Here, we report for the first time
that peptide mimotopes constructed into DNA plasmids can prime for the
induction of a carbohydrate Th1-associated IgG2a cross-reactive immune
response. The feasibility of immunization with peptide-mimotope DNA
plasmids (minigene) was investigated in mice by studying whether
minigene vaccination can prime for the induction of Th1-associated
IgG2a Ab cross-reactive with the human tumor-associated Histo-Blood
group-related neolactoseries Ag Lewis Y (LeY). A Th1 response with the
expression of the IgG2a isotype is a desirable response as IgG2a Abs
are opsonizing and complement fixing.
| Materials and Methods |
|---|
|
|
|---|
Oligonucleotides were synthesized and inserted into pcDNA3 or
pcDNA1 vectors. In the design of pcDNAggi and pcDNAari, we included a
leader (7) and Th epitope (8) in the
beginning of the peptide sequence. The plasmid pcDNAggi was generated
by inserting the leader sequence oligonucleotide
AGCTTCCACCATGAGGTACATGATTTTAGGCTTGCTCGCCCTTGCGGCAGTCTGCAGCGC
between the restriction sites HindIII and NotI in
the polylinker region. The T1 and peptide mimotope-encoded
oligonucleotide
GGCCGCGAAGCAGATCATCAACATGTGGCAGGAGGTGGGCAAGGCCATGTACGCCGGCGGCATCTACTGGCGCTACGACATCTACTGGCGCTACGACATCTACTGGAGGTACGACTAAT
was further cloned into the NotI and XbaI sites.
The later oligonucleotide was replaced by
GGCCGCGAAGCAGATCATCAACATGTGGCAGGAGGTGGGCAAGGCCATGTACGCCCGCATCTACTACCGCTACGACGGCTTCGCCTACTAAT
to generate the pcDNAari plasmid. All inserts were sequenced after
construction. Plasmids were grown in Escherichia coli DH5
strain. DNA was purified using a maxi prep kit (Qiagen, Valencia, CA).
Plasmid pVHSOL was generated in pcDNA1 (Invitrogen, San Diego, CA) in
the same way as pcDNAari but without the leader and the Th
epitope-encoding sequences. The gene expression of both vectors is
under the control of the CMV promoter. Expression is virtually the same
for the vectors according to the manufacturer. The cloning of IL-4 and
Il-12 genes was previously described (9).
DNA and carbohydrate immunizations
The quadriceps of muscles of mice were injected as described earlier (9). Briefly, each BALB/c mouse (groups of four) received two i.m. injections (3 wk apart) with 100 µg of each DNA construct resuspended in 100 µl of PBS and 0.25% bupivacaine-HCl (Sigma, St. Louis, MO). For carbohydrate boost, mice were injected i.p. with 40 µg of LeY and incorporated into polyacrylamide matrix (GlycoTech, Rockville, MD) along with 20 µg QS-21 (Aquila Biopharmaceuticals, Farmingham MA).
ELISA
To assess LeY reactivity of collected serum, standard ELISA was performed as described previously (10). Wells were coated with 0.2 µg/well of LeY. After blocking with 0.5% FCS in PBS, serum samples were added to each well in triplicate. Goat anti-mouse IgG/or IgM conjugated with HRP (Sigma) was used as secondary Ab. For isotype detection, we used Immunopure mAb isotyping kit I (Pierce, Rockford, IL) based on the manufacturer instruction. To prepare a standard curve to quantify the amount of IgG isotypes, plates were coated with mouse serum, and IgG reactivity was assessed using different concentrations of isotype-specific Abs (10). In addition, we quantified the LeY activity of the serum as calculated from a standard curve generated concurrently using the LeY-reactive IgG2a Ab BR55-2 (10).
Cell-based assays
Splenocytes from experimental and control animals were used for detection of T cell proliferation as described (9). Several peptides were used in these assays that include peptide 106 with the sequence GGIYWRYDIYWRYDIYWRYD. This peptide was synthesized as a multiple Ag peptide (Research Genetics, Huntsville, AL) as described previously (10). Briefly, cells were incubated without or with peptides, and after 3 days of incubation 1 µCi of [3H]thymidine was added to each well for another 1618 h. Cells were harvested and counted on a Betaplate liquid scintillation counter (Wallac, Gaithersburg, MD). Cytotoxic activity was measured by a standard 5-h 51Cr release assay (9). To calculate specific lysis of targets, the percent lysis of nonspecific targets (p815 cells; American Type Culture Collection, Manassas, VA) was subtracted from the percent lysis of specific targets (peptide-pulsed p815 cells). Peptide-pulsed targets were prepared by incubating p815 cells with 1 mM concentration of the 106 peptide for 18 h at 37°C. CD8+ T cells were removed from the splenocytes by treatment with anti-CD8 mAb (53-6.7) (PharMingen, San Diego, CA) followed by incubation with rabbit complement. Complement-dependent cytotoxicity (CDC) was measured using the LeY-expressing human tumor cell line MCF7 (American Type Culture Collection) and human complement (Sigma) as previously described (10). The anti-LeY mAb BR55-2 was used as a positive control and for IgG standardization (10).
Statistical analysis
Data were expressed as arithmetic mean ± SD and analyzed by the Statview 4.1 program (Abacus Concepts, Berkeley, CA). Data were analyzed for normal distribution, and the statistical significance of the difference between groups was determined by the two-tailed Students t test.
| Results |
|---|
|
|
|---|
Plasmids pcDNAari and pcDNAggi (Table I
) were designed to express chimeric
peptides that include a secretory leader sequence, a T cell epitope
from HIV-1 gp120 (referred to as the T1 peptide; Ref. 8),
and respective carbohydrate mimotope-encoding sequences that mimic the
meningococcal group C capsular PS of Neisseria
meningitidis (11), Lewis Ags expressed on tumor
cells (10) and mannosyl, lactoseries, and sialyl residues
on HIV-1 gp120 (12). It was rationalized that the leader
sequence would allow exogenous expression with the inclusion of the T
cell epitope to augment T cell help. In plasmid pVHSOL, we cloned only
the peptide mimic sequence of pcDNAari without the leader and T1
seqeunces.
|
DNA vaccination results in LeY cross-reactive immune response
Separate groups of animals were immunized with the respective
constructs and 3 wk after the immunization, serum reactivity with LeY
was quantified by ELISA. Results with 10-fold diluted serum showed a
statistically significant increase in the reactivity of IgG Ab after
immunization with these constructs. No IgM was detected. Mice were
again immunized at week 3, and the titration of anti-LeY immune
response at week 5 was determined (Table II
). The LeY cross-reactivity was
persistent to a 1:256 dilution for serum from pcDNAggi-immunized
animals, which is statistically significant (p
< 0.05) compared with serum from control vector-immunized mice.
Immunization with pcDNAggi induced a consistently growing LeY
cross-reactive response that appears superior to the other two
plasmids. The mimotope in pcDNAggi reflects a repetitive Ag, which is
typically more immunogenic (14) or the peptide represents
a better mimic of the LeY epitope. Isotyping and quantitation of serum
Abs of pcDNAggi-immunized mice for subsequent weeks indicate a LeY
cross-reactive IgG2a-dominant response compared with IgG1 and IgG2b,
which is indicative of a Th1 immune response (Fig. 1
). At week 7, IgG2a showed a 10-fold
increase compared with preimmune serum with a concentration of 0.12
µg/ml. However, IgG production dropped significantly after week 7.
These results are in agreement with other reports, where a predominant
IgG2a response is generated following i.m. DNA immunization. Again, no
IgM was detected.
|
|
DNA priming and protein boosting can enhance the production and
functionality of induced Ab. Here, we tested this boost strategy with
carbohydrate Ag. Minigene-primed mice and a vector-injected control
group were boosted with 40 µg of polyvalent synthetic LeY with QS-21
on week 8 and bled on week 9 and 11. Minigene immunization induced the
formation of LeY cross-reactive memory cells that were rapidly and
specifically stimulated upon encounter with LeY (Table II
). Enhancement
of IgG was persistent with a statistically significant difference
compared with vector alone-primed/LeY-boosted mice. Anti-LeY reactivity
of serum from pcDNAggi-primed/LeY-boosted mice increased more than
three times in titer from 1 to 256 (before boost) to 1 to 800 titer
(after boost) (Table II
). As expected, boosting with LeY led to an
enhanced anti-LeY IgM response (data not shown). IgM levels
increased a week after immunization and dropped 3 wk after the
immunization.
We also determined the isotype components at week 11 (Fig. 2
). IgG2a remained the predominant
component of the immune response, with a 4-fold higher titer for
pcDNAggi compared with the two other minigenes (Table II
), suggesting
that the WRYDI-containing peptide better mimics LeY. The IgG level
slightly increased up to 5 wk after carbohydrate boost (not shown).
These data suggest mimotope-encoded DNA immunization generates a memory
B cell population that can be expanded by the nominal Ag boost. In
bacterial model systems, animals primed with carbohydrate-conjugated
vaccines demonstrate a booster response after secondary immunization
with either carbohydrate or carbohydrate-conjugate (15).
It is suggested that the same general phenomenon can be observed upon
priming with mimotope-encoded DNA followed by carbohydrate boosting.
Priming with mimotopes of pathogen (or tumor)-associated carbohydrate
Ags followed by boosting with cognate or nominal carbohydrate Ag allows
desired memory cells to be established that could be effective to
thwart early infection or metastasis.
|
The functional property of the induced serum from
pcDNAggi-immunized mice was tested in CDC assays against the
LeY-expressing human breast tumor cell line MCF7 in the presence of
human complement (Fig. 3
A).
The IgG2a anti-LeY mAb BR55-2 (10) served as a
positive control (Fig. 3
B) and to assess the relative
effective anti-LeY-reactive concentration of mimotope-induced Ab.
The lowest statistically significant titer before boosting that
mediated CDC (p < 0.01) displayed an effective
concentration of mimotope-induced IgG2a of about 0.14 µg/ml compared
with BR55-2 (Fig. 3
B). After boost, the percentage of
cytotoxicity was enhanced (p < 0.001) to an
effective concentration of about 0.22 µg/ml compared with BR55-2
(Fig. 3
B).
|
CTL recognize target proteins as short peptides presented by MHC
class I restriction elements. However, there is also evidence for
peptide-independent TCR recognition of target proteins and nonprotein
structures. How such T cell responses are generated is presently
unclear. Carbohydrate-reactive T cells have been described
(16, 17, 18). T cells induced by a carbohydrate mimic has been
shown to cross-react with a protein Ag expressed on tumor cells
(19). It maybe possible that peptide mimics can expand T
cells that are reactive with naturally processed glycopeptides.
Consequently, we asked if DNA immunization with peptide mimics could
lead to T cell responses as predicted by analysis of MHC class I and
class II binding profiles (Table I
).
Several relevant peptides including peptide 106 were used to stimulate
T cells. We did not observe any significant differences between
immunized groups in T cell proliferation (data not shown). To further
determine whether augmentation of Th activity would affect the
magnitude of the immune response, we coimmunized additional groups of
mice with the plasmids in Table I
along with plasmids encoding IL-12
and IL-4. Coimmunization with either cytokine-encoding plasmid did not
influence any further the Ab response to LeY relative to that
previously shown with peptide-encoded plasmid alone. However, we
observed a significantly higher T cell proliferation of splenocytes
derived from mice immunized with the pcDNAggi plasmid with
coimmunization with IL-12 (data not shown). Detected IFN-
released
(not shown) in supernatant collected from in vitro peptide-activated
splenocytes again supported Th1-type activation consistent with the
observed IgG2a production. Expectedly, the Th1 response leads to a high
cytotoxic T lymphocyte activity against peptide-pulsed class
I+ class II- mastocytoma
P815 target cells in coimmunized animals (Fig. 4
). As expected, the removal of
CD8+ T cells resulted in the suppression of
specific lysis enhancement observed with coimmunization of IL-12 gene
(Fig. 4
). Parental P815 cells were not lysed. We did not detect any
enhancement in T cell proliferation, CTL, or Ab response upon
coimmunization with IL-4, exactly as previously reported
(20).
|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint request to Dr. Thomas Kieber-Emmons, Department of Pathology and Laboratory Medicine, Room 280, John Morgan Building, 36th and Hamilton Walk, Philadelphia, PA 19104-6082. ![]()
3 Abbreviations used in this paper: PS, polysaccharide; LeY, Lewis Y; CDC, complement-dependent cytotoxicity. ![]()
Received for publication March 22, 2000. Accepted for publication May 15, 2000.
| References |
|---|
|
|
|---|
, IL-12, or IL-18 gene adjuvants. J. Med. Primatol. 28:214.[Medline]
This article has been cited by other articles:
![]() |
C. Lo Passo, A. Romeo, I. Pernice, P. Donato, A. Midiri, G. Mancuso, M. Arigo, C. Biondo, R. Galbo, S. Papasergi, et al. Peptide Mimics of the Group B Meningococcal Capsule Induce Bactericidal and Protective Antibodies after Immunization J. Immunol., April 1, 2007; 178(7): 4417 - 4423. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fest, N. Huebener, S. Weixler, M. Bleeke, Y. Zeng, A. Strandsby, R. Volkmer-Engert, C. Landgraf, G. Gaedicke, A. B. Riemer, et al. Characterization of GD2 Peptide Mimotope DNA Vaccines Effective against Spontaneous Neuroblastoma Metastases Cancer Res., November 1, 2006; 66(21): 10567 - 10575. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Luo, E. Ko, J. C.-f. Hsu, X. Wang, and S. Ferrone Targeting Melanoma Cells with Human High Molecular Weight-Melanoma Associated Antigen-Specific Antibodies Elicited by a Peptide Mimotope: Functional Effects J. Immunol., May 15, 2006; 176(10): 6046 - 6054. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Beninati, A. Midiri, G. Mancuso, C. Biondo, M. Arigo, E. Gerace, S. Papasergi, M. Gambuzza, M. Boretti, W. Magliani, et al. Antiidiotypic DNA vaccination induces serum bactericidal activity and protection against group B meningococci J. Exp. Med., January 23, 2006; 203(1): 111 - 118. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. H. Park, J. H. Youn, I.-H. Choi, M. H. Nahm, S. J. Kim, and J.-S. Shin Anti-Idiotypic Antibody as a Potential Candidate Vaccine for Neisseria meningitidis Serogroup B Infect. Immun., October 1, 2005; 73(10): 6399 - 6406. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Monzavi-Karbassi, C. Artaud, F. Jousheghany, L. Hennings, J. Carcel-Trullols, S. Shaaf, S. Korourian, and T. Kieber-Emmons Reduction of Spontaneous Metastases through Induction of Carbohydrate Cross-Reactive Apoptotic Antibodies J. Immunol., June 1, 2005; 174(11): 7057 - 7065. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Luo, J. C.-f. Hsu, C.-Y. Tsao, E. Ko, X. Wang, and S. Ferrone Differential Immunogenicity of Two Peptides Isolated by High Molecular Weight-Melanoma-Associated Antigen-Specific Monoclonal Antibodies with Different Affinities J. Immunol., June 1, 2005; 174(11): 7104 - 7110. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bolesta, A. Kowalczyk, A. Wierzbicki, P. Rotkiewicz, B. Bambach, C.-Y. Tsao, I. Horwacik, A. Kolinski, H. Rokita, M. Brecher, et al. DNA Vaccine Expressing the Mimotope of GD2 Ganglioside Induces Protective GD2 Cross-reactive Antibody Responses Cancer Res., April 15, 2005; 65(8): 3410 - 3418. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhang, P. H. H. Lopez, C. Y. Li, N. R. Mehta, J. W. Griffin, R. L. Schnaar, and K. A. Sheikh Anti-ganglioside antibody-mediated neuronal cytotoxicity and its protection by intravenous immunoglobulin: implications for immune neuropathies Brain, May 1, 2004; 127(5): 1085 - 1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Beninati, S. Arseni, G. Mancuso, W. Magliani, S. Conti, A. Midiri, C. Biondo, L. Polonelli, and G. Teti Protective Immunization against Group B Meningococci Using Anti-Idiotypic Mimics of the Capsular Polysaccharide J. Immunol., February 15, 2004; 172(4): 2461 - 2468. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cunto-Amesty, T. K. Dam, P. Luo, B. Monzavi-Karbassi, C. F. Brewer, T. C. Van Cott, and T. Kieber-Emmons Directing the Immune Response to Carbohydrate Antigens J. Biol. Chem., August 3, 2001; 276(32): 30490 - 30498. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |