| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
*
Medicine/Rheumatology and
Immunology, Mayo Clinic and Foundation, Rochester, MN 55905
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, exhibit autoreactivity, and have
cytolytic function. The mechanisms facilitating the expansion and
longevity of CD4+CD28null T cell clones in vivo
are unknown. Here, we report that CD4+CD28null,
but not CD4+CD28+, T cells express MHC class
I-recognizing receptors normally found on NK cells.
CD4+CD28null T cells preferentially expressed
killer cell activating receptors (KAR), often in the absence of killer
cell inhibitory receptors. Cross-linking of KAR molecules enhanced the
proliferative response to TCR-mediated stimulation, but not the
cytolytic function of CD4+CD28null T cells,
suggesting different signaling pathways in CD4 T cells and NK cells.
Triggering of KAR signaling led to the phosphorylation of several
cellular targets, although the pattern of phosphorylation differed from
that induced by the TCR. Aberrant expression of KAR molecules in the
absence of inhibitory receptors and in the appropriate HLA setting may
lead to the clonal outgrowth of autoreactive
CD4+CD28null T cells commonly seen in
rheumatoid arthritis. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, have given rise to
the hypothesis that these unusual T cells have a role in pathogenic
immune responses (8, 9, 10). To understand the contribution of CD4+CD28null T cells to disease, it is important to know how these cells proliferate and function despite a deficiency of CD28. Previous studies have shown that CD4+CD28null cells require costimulatory signals for optimal proliferative responses, but not cytokine production (10). The molecular nature of the implicated costimulatory pathway has not been defined, except that it requires cell-cell contact and does not involve CD80 or CD86. Identification of the costimulatory molecules involved in optimizing CD28null T cell proliferation would be critical in the attempt to understand the longevity and clonal outgrowth of these cells.
CD4+CD28null cells express perforin and granzyme B and exhibit TCR-mediated cytotoxicity (11). These cells can express CD11b and CD57 (3, 6), cell surface markers that are generally not found on CD4 T cells but are found on NK cells. In contrast to NK cells, they lack the CD16 molecule. To explore how the activation of CD4+CD28null T cells is regulated, we have now examined CD4 T cells in RA patients for the expression of a new class of MHC class I-recognizing receptors that are preferentially found on NK cells and that deliver either inhibitory or stimulatory signals (12, 13, 14, 15, 16). Stimulatory and inhibitory NK receptors possess similar extracellular domains but differ in their transmembrane and cytoplasmic sequences (13, 14, 17). Two distinct types of MHC-recognizing human receptors have been identified. Killer cell inhibitory receptors (KIR) and killer cell activating receptors (KAR) belong to the Ig family (18, 19), and C-type lectin molecules (NKG2 polypeptides) are expressed as heterodimers with the CD94 molecule (20, 21). CD94/NKG2 receptors recognize HLA-E molecules (22, 23, 24), whereas the KIR/KAR family includes multiple receptors with specificities for different HLA-A, -B, and -C alleles and the HLA-G molecule (13, 14, 17, 18, 19). KIR receptors have also been described on T cells, where they are usually restricted to a subset of CD8 memory T cells (25, 26, 27). In this paper, we report that in RA patients, KIR/KAR receptors are expressed on CD4+CD28null, but not CD4+CD28+, T cells. More importantly, CD4+CD28null T cell clones from RA patients were characterized by the preferential and sometimes exclusive expression of KARs and the absence of inhibitory CD94/NKG2 receptors and KIRs. These stimulatory receptors functioned as costimulatory molecules in proliferative responses but did not enhance the cytotoxic effector function of these cells. Therefore, KAR-mediated signals may contribute to the oligoclonal expansion of CD4+CD28null cells in vivo and may have a role in the dysregulated immune responses of RA patients.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PBMC were obtained from 10 patients with seropositive RA according to the 1988 American College of Rheumatology criteria (28). This protocol was approved by the Mayo Clinic internal review board, and all patients gave written, informed consent. All patients had an expanded subset of CD4+CD28null T cells. Patients were typed for their HLA-C alleles by PCR and oligonucleotide hybridization (Dynal, Lake Success, NY). CD4+CD28null T cell clones were generated from PBMC of three patients by limiting dilution cloning in IL-2-containing medium as recently described (3). TCR ß chains were sequenced, and clones were selected that expressed a sequence clonally expanded in the peripheral blood in vivo. T cell clones from RA patient H have been described (29). Human NK cells were cloned and passaged as previously described (30).
Flow cytometry
PBMC and CD4 T cell clones were incubated with anti-CD94 (HP3B1, gift from Miguel Lopez-Botet, Hospital de la Princesa, Universidad Autonoma de Madrid, Madrid, Spain), DX9 (anti-KIR3DL1, gift from Lewis Lanier, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA), EB6 (anti-KIR2DL1/KIR2DS1, Beckman Coulter, Miami, FL), GL183 (anti-KIR2DL2/KIR2DL3/KIR2DS2, Beckman Coulter), or control mouse IgG1 (Zymed, South San Francisco, CA). After washing, the cells were stained with FITC-conjugated goat anti-mouse Ig (Becton Dickinson, San Jose, CA) and peridin chlorophyll protein-conjugated anti-CD4 and PE-conjugated anti-CD28 or PE-conjugated anti-CD16 mAb (Becton Dickinson).
PCR amplification and sequencing
Total RNA from T cell clones was extracted using TRIzol reagent (Life Technologies, Grand Island, NY). cDNA was amplified with a primer set amplifying all known KIR receptor sequences (GGAGCTCCTATGACATGTACC and GACAGGGCTGTTGTCTCCCTA). Amplified products were cloned using the TA cloning kit (Invitrogen, San Diego, CA) and sequenced. Sequences were matched with known KIR and KAR sequences (19, 31, 32). In addition, cDNA was amplified with the KIR family member-specific primer sets as described by Uhrberg et al., and the amplified product was directly sequenced (31). The nomenclature suggested by E. Long, L. Lanier, and M. Colonna was used as reported by Uhrberg et al. (31). According to this nomenclature, all KIR and KAR sequences have the KIR prefix; inhibitory members with a long cytoplasmic tail are designated KIR DL, and stimulatory members with a short cytoplasmic domain are designated KIR DS. The following primer sets were used to amplify DAP12 and ß-actin sequences: DAP12, CAGTTGCTCTACGGTGAGC and TGTGTGTTGAGG TCGCTG; and ß-actin, ATGGCCACGGCTGCTTCCAGC and CAGGAGGAGCAATGATCTTGAT. To determine whether T cell clones express the AV24/BV11 TCR commonly expressed in CD1-restricted NK T cells, the following primers were used: TCR AV24, GATATACAGCAACTCTGGATGCA and GGCAGACAGACTTGTCACTGGAT; and TCR BV11, TCAACAGTCTCCAGAATAAGGACG and GTGGGAGATCTCTGCTTCTG.
Cytotoxicity assay
T cell clones were stimulated with immobilized anti-CD3 (OKT3, CRL 8001, American Type Culture Collection, Manassas, VA) in the presence of accessory cells and were examined after 5 days for cytotoxic activity in a 51Cr release assay. Serial dilutions of T cell clones were incubated with 1 x 104 Fc receptor-expressing P815 target cells in the presence of 0.5 µg/ml anti-CD3, 0.5 µg/ml anti-CD3 plus 10 µg/ml GL183, or 10 µg/ml GL183 only. Supernatants were harvested after 4 h. NK clones expressing either the DX9-reactive inhibitory KIR3DL1 or the GL183-reactive stimulatory KIR2DS2 receptor were assayed for cytotoxic activity using anti-CD16 instead of anti-CD3. Results were given as the mean percent specific lysis of assay triplicates. Spontaneous lysis was <15% of maximal lysis for all experiments.
Proliferation assay
Anti-CD3 (10 µg/ml) together with either control IgG1 or GL183 (each 20 µg/ml) were adsorbed on 96-well flat-bottom plates. In selected experiments, plates were coated with rabbit anti-mouse IgG and then incubated with serial dilutions of anti-CD3 (5–50 ng/ml) followed by incubation with GL183, L368 (anti-ß2-microglobulin, HB 149, American Type Culture Collection), or control IgG (each 200 ng/ml). T cell clones (2 x 104/well) were stimulated on the plastic-immobilized Abs in the presence of 2 U/ml IL-2. Microcultures were pulsed with 1 µCi of [3H]thymidine for the last 16 h of a 72-h culture. All results were expressed as the mean ± SD of triplicate cultures.
Vaccinia virus infection
CD4+CD28null T cells were infected for 5 h at a ratio of 20:1 (viral PFU:T cell ratio) with recombinant vaccinia virus containing the KIR2DS2 cDNA sequence or with control virus containing the vector sequence only. Cell surface expression of KIR2DS2 was confirmed using flow cytometry.
Phosphotyrosine assay
The signaling activity of KIR2DS2 receptor was analyzed by phosphotyrosine Western blotting. T cell clones were incubated with 5 µg/ml anti-CD3 or 5 µg/ml GL183 on ice for 15 min. The Abs were cross-linked using rabbit anti-mouse IgG for 10 min at 37°C. The cells were lysed in 50 mM Tris (pH 8.0), 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% deoxycholic acid, and 0.1 mM orthovanadate on ice for 10 min. Clarified lysates were collected and analyzed by SDS-PAGE, and then transferred to a polyvinylidene difluoride membrane. The membrane was blotted with phosphotyrosine Ab 4G10 (Upstate Biotechnology, Lake Placid, NY). The blot was detected using HRP-conjugated goat anti-mouse IgG and enhanced chemiluminescence reagents (Amersham Pharmacia Biotech, Arlington Heights, IL).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To assess KIR and CD94/NKG2 expression on
CD4+CD28+ and
CD4+CD28null T cells, PBMC
from 10 patients with RA who had expanded numbers of
CD4+CD28null T cells
(2.3–19.4%) were analyzed. Two p50/p58 KIRs (GL183, EB6) and one p70
KIR (DX9) were examined. The expression of C-type lectin receptors was
assessed using anti-CD94. All 10 patients expressed at least one of
the three KIR members on CD4 T cells. Three individuals also expressed
CD94; KIR and CD94 expression were exclusively found on
CD4+CD28null, but not on
CD4+CD28+, T cells (Fig. 1
). Healthy individuals
(n = 8) who had <1%
CD4+CD28null T cells did
not express either CD94 or any of the KIR members on CD4 T cells (data
not shown). We also analyzed two normal individuals who were known to
have an expanded subset of
CD4+CD28null T cells. KIR
expression in these two normal individuals was comparable to that in RA
patients.
|
In contrast to CD94, cell surface expression of KIR/KARs on
CD4+CD28null T cells was at
a similar level as that on CD16+ NK cells. A
representative flow cytometry experiment is shown in Fig. 2. In this particular patient, 
30% of
the CD4+CD28null T cells
expressed KIRs or KARs that are recognized by GL183.
CD4+CD28null T cell
clones established from this patient also expressed the KIRs and KARs
recognized by GL183 at similar levels. This indicates that the KIRs and
KARs found on CD4+CD28null
T cells are expressed at levels that may be functional.
|
To determine the profile of receptor expression on individual clones, CD4+CD28null T cell clones were established from three of the RA patients. T cell clones were selected that expressed a TCR sequence also found in unseparated peripheral blood CD4+ T cells, suggesting that these clones were expanded in vivo. All T cell clones analyzed were positive for CD3 and CD4 and lacked CD16 and CD28; none of the clones expressed CD94.
The available KIR-specific Abs are only specific for certain
subfamilies. To obtain more complete information on the spectrum of
KIRs and KARs expressed by these T cell clones, PCR was used to amplify
a fragment of the known p50/58 and p70 KIR receptor sequences. The PCR
products were cloned, sequenced, and matched with known KIR sequences
(34). Expression of the respective KIR was confirmed using
subfamily-specific primers as described by Uhrberg et al.
(31). Results are shown in Table I. Each clone expressed between one and
three different NK receptors. At least one stimulatory receptor was
found on seven of the eight T cell clones. Five T cell clones
exclusively expressed stimulatory receptors, and clone H1.10 expressed
three KARs. All seven clones had a receptor encoded by the KIR2DS2
gene. This gene product has been shown to recognize HLA-C allotypes
characterized by a Ser in position 77 and an Asn in position 80 (C1
allotype) (35). Only one T cell clone, H1.67,
concomitantly expressed an inhibitory receptor that recognizes the same
C1 allotype as KIR2DS2. Three clones expressed the KIR2DS4 receptor.
None of the clones expressed an inhibitory or stimulatory receptor for
the C2 allotype. All three patients from whom the T cell clones were
derived expressed a C1 allotype (Table I), suggesting that the KIR2DS2
receptors could be functional in vivo.
|
All CD4+CD28null T
cell clones displayed TCR-triggered cytotoxic activity in a redirected
cytotoxicity assay. A representative example is shown in Fig. 3 for clones HD1.1 and HD2, both of which
effectively killed P815 target cells by anti-CD3-mediated killing.
Surprisingly, although both clones expressed a stimulatory KIR2DS2
receptor recognized by Ab GL183 and no inhibitory KIRs (Fig. 2
and
Table I), they were not able to kill target cells bearing the GL183 Ab
(Fig. 3). Also, the GL183 Ab was not able to enhance the
anti-CD3-mediated killing. These findings were in contrast to the
results obtained with NK clones expressing KAR receptors. NK clones
expressing a KAR (i.e., GL183-reactive KIR2DS2), but not clones
expressing a KIR (i.e., DX9-reactive KIR3DL1), exhibited
cytotoxicity for GL183-labeled P815 target cells. These results suggest
that the functional consequences of triggering KARs are different in
CD4+CD28null T cells and NK
cells.
|
The failure of KIR2DS2 cross-linking to induce cytotoxicity raised
the question of whether this receptor is functional in
CD4+CD28null T cells. In NK
cells, the KIR2DS2 protein has been shown to non-covalently associate
with the disulfide-bonded homodimer DAP12 (36). DAP12
contains an immunoreceptor tyrosine-based activation motif in its
cytoplasmic domain. Phosphorylated DAP12 binds Syk protein tyrosine
kinases, suggesting that it is intimately involved in the cellular
activation cascade (37). To analyze whether
CD4+CD28null T cell clones
express DAP12, cDNA from the eight
CD4+CD28null T cell clones
and from five CD4+CD28+
control clones were amplified with DAP12-specific primers. All
CD28null clones and two of the five
CD28+ clones expressed DAP12 mRNA (Fig. 4). These two CD28+
clones were negative for KIRs and CD94.
|
To address the question of whether
CD4+CD28null T cells have
the machinery to transmit KIR2DS2 signals, a
CD4+CD28nullKIR2DS2+
T cell clone from patient HD, HD4–12, was stimulated with
anti-CD3 or GL183 followed by analysis of the tyrosine
phosphorylation patterns. Similar to the HD clones shown in Fig. 3, HD4–12 expressed a GL183 Ag that was not functional in Ab-mediated
cytolysis. In repeated experiments, cross-linking with GL183 induced
phosphorylation of several cellular substrates (data not
shown); however, the clone exhibited a high background
tyrosine phosphorylation, suggesting continual activation even in the
absence of anti-CD3 or GL183. We therefore transfected KIR2DS2 into
a CD4+CD28null T cell clone
from the same patient that lacked the cell surface expression of
receptors recognized by GL183. Transfection with KIR2DS2 was sufficient
to obtain cell surface expression that was detectable by GL183 (Fig. 5). Transfected clones were stimulated by
cross-linking with either anti-CD3 or GL183, and lysates were
analyzed using phosphotyrosine Abs (Fig. 6). Both stimulation conditions yielded
an increase in the phosphotyrosine content of several cellular
substrates. Affected substrates after anti-CD3 stimulation had
apparent masses of 150, 110, 80, 55, 40, and 20 kDa. Stimulation with
GL183 resulted in tyrosine phosphorylation of a more restricted set of
substrates, particularly a protein with an apparent mass of 55
kDa.
|
|
To analyze whether the stimulatory receptors regulate cell
activities distinct from cytotoxicity, T cells were stimulated with
suboptimal concentrations of immobilized anti-CD3, and
proliferative responses in the presence of immobilized control IgG or
GL183 were determined (Fig. 7).
Stimulation of the
CD4+CD28null or
CD4+CD28+ T cell clones by
GL183 in the absence of anti-CD3 did not elicit any proliferation
above the background activity. GL183 in the presence of anti-CD3
increased the proliferative response of all three
CD4+CD28null T cell clones
compared with that in the control cultures. It did not influence the
proliferation of the two control clones that were negative for KIR2DS2.
Costimulatory activity of GL183 was observed at concentrations of
anti-CD3 that alone were not stimulatory, as shown for clone
HD4–12 in Fig. 7. This increase in proliferation was not observed when
HD4–12 was incubated with immobilized anti-CD3 and L368, an
anti-ß2-microglobulin Ab (data not shown).
This indicates that the increased proliferation was specific and was
not due to increased trapping of the cells to the Ab-coated plates.
These results demonstrated that stimulatory KARs are functional on
CD4+CD28null T cells.
They promoted proliferation, although they did not enhance their
cytotoxic activity.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
KIRs, as well as CD94/NKG2 receptors, were first described as receptors on NK cells that transduced negative signals to block NK cell-mediated killing and have been generally accepted as the molecular basis of the "missing self" hypothesis (39). NK cells are believed to survey the tissue for the presence of MHC class I molecules that are normally ubiquitously expressed. If MHC class I molecules are mutated or down-regulated, NK cells have the potential to be released from the inhibitory function of the receptors and to kill. Subsequent studies have shown that some receptor homologues promote rather than inhibit killing (13, 17). These receptors signal by associating with the disulfide-linked homodimer DAP12 (36), leading to the phosphorylation of immunoreceptor tyrosine-based activation motif in the cytoplasmic domain of DAP12 and the subsequent binding and activation of Syk (37).
Stimulatory as well as inhibitory MHC class I-recognizing receptors can be found on T cells. However, in most individuals, expression is limited to CD8 T cells (25, 26). Several authors have demonstrated that inhibitory receptors modulate the TCR-mediated function of CD8 T cells (27). Interestingly, CD94/NKG2A, but not KIRs, could be induced on CD8 T cells by IL-15, IL-10, and TGF-ß, with subsequent inhibition of cytotoxic activity (40). MHC class I-recognizing receptors on CD8 T cells may therefore serve an immunosuppressive function that is regulated by cytokines in the microenvironment (41). In contrast, Mandelboim et al. (42) have demonstrated that KARs on CD4 T cells provide costimulatory signals. These authors speculated that the ubiquitous presence of MHC class I molecules triggering costimulatory signals in these CD4 T cells could have an important role in initiating and sustaining immune responses, including autoimmune responses.
The data presented here demonstrate that the expression of MHC class I-binding receptors on T cells is limited to individuals who have an expanded subset of CD4+CD28null T cells. CD4+CD28null cells are virtually absent in the majority of healthy individuals (2), suggesting that KAR-mediated costimulatory functions are unlikely to be of general relevance for T cell-dependent immune responses. Rather, expansion of the CD4+CD28null T cells is a characteristic finding in patients with RA, particularly in patients with systemic complications. In these patients, the expression of KARs on CD4 T cells in the setting of the appropriate MHC class I Ag could facilitate the evolution of an autoimmune response by providing costimulatory signals, thereby lowering the threshold for low affinity recognition of autoantigens. In support of this concept, CD4+CD28null T cell clones isolated from RA patients as well as from IDDM patients have been found to display autoreactivity to autologous monocytes (3, 5). Because KIRs/KARs are polymorphic and bind to a family of highly polymorphic MHC class I molecules, the question arises of whether appropriate receptor-ligand pairs are available in RA patients. T cell clones presented here preferentially expressed KIR2DS2. This receptor is predicted to interact with a polymorphic site on HLA-Cw*03 and *07 molecules that were expressed in the RA patients from whom these clones were isolated.
The relationship between
CD4+CD28null T cells and
classical CD4 T cells and NK T cells is not understood. NK T cells have
been best characterized in murine systems where they represent a
separate lineage of T cells with unique specificity, selection
mechanisms, and function (43). In humans, these cells
express an invariant TCR 
-chain (AV24-AJQ or AJ281), frequently use
the TCR BV11 element, and recognize Ag in restriction to CD1
(44). We determined TCRAV and BV gene segment usage in 20
CD4+CD28null T cell clones,
including the clones presented here, and none of them expressed the TCR
characteristic for NK T cells (data not shown). Alternatively,
CD4+CD28null T cells may
derive from CD4+CD28+ T
cells. Indeed, we have previously found the same clone in both the
CD28+ and CD28null
fractions (3). Moreover, CD28 expression is down-regulated
with replicative senescence (45).
The repertoire of MHC class I-recognizing receptors on
CD4+CD28null T cells was
different from that on NK cells, suggesting different selection
mechanisms. Valiante et al. have characterized 100 NK clones each
from two healthy individuals and have found that individual clones
expressed between two and nine different receptors (32).
By far, the most frequent receptor was the inhibitory lectin receptor
CD94/NKG2A. In contrast, all
CD4+CD28null T cell clones
lacked this receptor. CD94/NKG2 receptors recognize the HLA-E molecule
(22, 23, 24), which has limited sequence polymorphism. The
CD94/NKG2A receptor has been postulated to provide a dominant negative
signal and to control the effects of stimulatory receptors coexpressed
on the same cell (32). The lack of expression of this
important inhibitory receptor on
CD4+CD28null T cells adds
additional support to the idea that they are biased toward the
expression of stimulatory receptors. Moreover, inhibitory KIRs were
distinctly infrequent, and five of the eight T cell clones exclusively
expressed a stimulatory KAR. Only H1.67 coexpressed the stimulatory
KIR2DS2 and the inhibitory KIR2DL3, both of which putatively recognize
the same HLA-C allotype. One additional clone expressed the
KIR2DL4 receptor that, in contrast to other receptors, has only one
YxxL motif in its cytoplasmic domain and recognizes HLA-G. In contrast,
in the study by Valiante et al., none of the NK clones expressed
stimulatory receptors in the absence of inhibitory receptors
(32).
One of the striking findings of this study was that cross-linking of the KIR2DS2 receptor on CD4+CD28null T cell clones with GL183 Ab did not induce cytotoxic activity or enhance TCR-mediated cytotoxicity. The T cell clones lacked inhibitory receptors that could also be recognized by GL183, such as KIR2DL3, excluding the possibility that a stimulatory signal was neutralized. Stimulatory receptors have been shown to signal through DAP12, which has been reported to not be transcribed in CD4 T cells (36). To rule out the possibility that CD4+CD28null T cells lacked this important signaling molecule, we amplified DAP12-specific sequences. All the CD4+CD28null T cell clones and even two of the CD4+CD28+ T cell clones expressed DAP12 mRNA. The presence of DAP12 transcripts as demonstrated by PCR is, however, not sufficient to allow conclusions about the amount of functional DAP12 protein. Signaling of KIR2DS2 was confirmed in experiments demonstrating that cross-linking of the receptor induced tyrosine phosphorylation of particular cellular substrates. This suggests that KIR2DS2 is functional and that the increased proliferation with KIR2DS2 triggering is the result of stimulatory signals. However, the phosphorylation pattern was clearly different compared with anti-CD3 stimulation, consistent with the interpretation that KIR2DS2 stimulation does not amplify or mimic TCR stimulation and therefore does not enhance cytotoxic activity. Of particular interest, no lower m.w. phosphorylation product that might represent phosphorylated DAP12 was detected after KIR2DS2 stimulation. Indeed, preliminary data have indicated that KIR2DS2 triggering in CD4 T cells is not sufficient to induce calcium mobilization (data not shown). Signaling events downstream of DAP12, or perhaps even an alternate adaptor molecule, may explain the apparent functional differences between NK cells and CD4 T cells. Based upon these data, it could be speculated that KIR2DS2-mediated signals do not influence the TCR-dependent signaling pathway leading to cytotoxic responses, but interfere with cellular events regulating proliferation.
In summary, expression of KIR/KAR receptors is a characteristic finding for CD4 T cells that are deficient for the CD28 molecule. The functional consequences of MHC class I-recognizing receptors on CD4+CD28null T cells in RA patients appear to be biased toward stimulatory events. Whereas the coexpression of inhibitory and stimulatory receptors on NK cells results in the dominance of immunosuppressive signals, the unopposed expression of stimulatory receptors on CD4+CD28null cells should result in immunostimulation. Cross-linking of KARs enhanced the proliferation of CD4+CD28null cells, providing a possible explanation for the propensity of these cells to form large clonal populations in vivo. The over-representation of KARs on the expanded clonotypes of RA patients may be the result of peripheral selection with such KAR-expressing cells having a survival advantage. Because the emergence of CD4+CD28null-expanded clonotypes has been characteristically found in patients with autoimmune disorders, it is possible that the combination of KAR-mediated signals and suboptimal TCR-mediated stimulation is sufficient to facilitate the expansion of autoreactive T cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 T.N. and M.R.S. contributed equally to the manuscript.
3 Address correspondence and reprint requests to Dr. Jörg J. Goronzy, Mayo Clinic, 401 Guggenheim Building, 200 First Street SW, Rochester, MN 55905.
4 Abbreviations used in this paper: RA, rheumatoid arthritis; IDDM, insulin-dependent diabetes mellitus; KAR, killer cell activating receptor; KIR, killer cell inhibitory receptor.
Received for publication December 29, 1999. Accepted for publication May 4, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
24+ CD4-CD8- T cells. J. Exp. Med. 186:109.This article has been cited by other articles:
|
|
 |
|
  D. Basu, Y. Liu, A. Wu, S. Yarlagadda, G. J. Gorelik, M. J. Kaplan, A. Hewagama, R. C. Hinderer, F. M. Strickland, and B. C. Richardson Stimulatory and Inhibitory Killer Ig-Like Receptor Molecules Are Expressed and Functional on Lupus T Cells J. Immunol., September 1, 2009; 183(5): 3481 - 3487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Chen, F. Bai, L. Sokol, J. Zhou, A. Ren, J. S. Painter, J. Liu, D. A. Sallman, Y. A. Chen, J. A. Yoder, et al. A critical role for DAP10 and DAP12 in CD8+ T cell-mediated tissue damage in large granular lymphocyte leukemia Blood, April 2, 2009; 113(14): 3226 - 3234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. van Bergen, E. M. C. Kooy-Winkelaar, H. van Dongen, F. A. van Gaalen, A. Thompson, T. W. J. Huizinga, M. C. W. Feltkamp, R. E. M. Toes, and F. Koning Functional Killer Ig-Like Receptors on Human Memory CD4+ T Cells Specific for Cytomegalovirus J. Immunol., April 1, 2009; 182(7): 4175 - 4182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Lowe, M. A. Cook, S. J. Bowman, D. C. Briggs, and the UK Sjogren's Interest Group Association of killer cell immunoglobulin-like receptors with primary Sjogren's syndrome Rheumatology, April 1, 2009; 48(4): 359 - 362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Merck, R. B. Voyle, and H. R. MacDonald Ly49D Engagement on T Lymphocytes Induces TCR-Independent Activation and CD8 Effector Functions That Control Tumor Growth J. Immunol., January 1, 2009; 182(1): 183 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. V. Goverdhan, S. I. Khakoo, H. Gaston, X. Chen, and A. J. Lotery Age-Related Macular Degeneration Is Associated with the HLA-Cw*0701 Genotype and the Natural Killer Cell Receptor AA Haplotype Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 5077 - 5082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Tang, B. Grzywacz, H. Wang, N. Kataria, Q. Cao, J. E. Wagner, B. R. Blazar, J. S. Miller, and M. R. Verneris Umbilical Cord Blood T Cells Express Multiple Natural Cytotoxicity Receptors after IL-15 Stimulation, but Only NKp30 Is Functional J. Immunol., October 1, 2008; 181(7): 4507 - 4515. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Fourmentraux-Neves, A. Jalil, S. Da Rocha, C. Pichon, S. Chouaib, G. Bismuth, and A. Caignard Two opposite signaling outputs are driven by the KIR2DL1 receptor in human CD4+ T cells Blood, September 15, 2008; 112(6): 2381 - 2389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Li, C. M. Weyand, and J. J. Goronzy Epigenetic mechanisms of age-dependent KIR2DL4 expression in T cells J. Leukoc. Biol., September 1, 2008; 84(3): 824 - 834. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. van Stijn, A. T. Rowshani, S. L. Yong, F. Baas, E. Roosnek, I. J. M. ten Berge, and R. A. W. van Lier Human Cytomegalovirus Infection Induces a Rapid and Sustained Change in the Expression of NK Cell Receptors on CD8+ T Cells J. Immunol., April 1, 2008; 180(7): 4550 - 4560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Remtoula, A. Bensussan, and A. Marie-Cardine Cutting Edge: Selective Expression of Inhibitory or Activating Killer Cell Ig-Like Receptors in Circulating CD4+ T Lymphocytes J. Immunol., March 1, 2008; 180(5): 2767 - 2771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. N. Tran, S. G. Thacker, D. M. Louie, J. Oliver, P. T. White, J. L. Endres, A. G. Urquhart, K. C. Chung, and D. A. Fox Interactions of T Cells with Fibroblast-Like Synoviocytes: Role of the B7 Family Costimulatory Ligand B7-H3 J. Immunol., March 1, 2008; 180(5): 2989 - 2998. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Singh, I. Colmegna, X. He, C. M. Weyand, and J. J. Goronzy Synoviocyte Stimulation by the LFA-1-Intercellular Adhesion Molecule-2-Ezrin-Akt Pathway in Rheumatoid Arthritis J. Immunol., February 1, 2008; 180(3): 1971 - 1978. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Pascal, E. Yamada, M. P. Martin, G. Alter, M. Altfeld, J. A. Metcalf, M. W. Baseler, J. W. Adelsberger, M. Carrington, S. K. Anderson, et al. Detection of KIR3DS1 on the Cell Surface of Peripheral Blood NK Cells Facilitates Identification of a Novel Null Allele and Assessment of KIR3DS1 Expression during HIV-1 Infection J. Immunol., August 1, 2007; 179(3): 1625 - 1633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Garrido, F. Ruiz-Cabello, P. Barcena, Y. Sandberg, J. Canton, M. Lima, A. Balanzategui, M. Gonzalez, M. A. Lopez-Nevot, A. W. Langerak, et al. Monoclonal TCR-V 13.1+/CD4+/NKa+/CD8 /+dim T-LGL lymphocytosis: evidence for an antigen-driven chronic T-cell stimulation origin Blood, June 1, 2007; 109(11): 4890 - 4898. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E Steer, F. M K Williams, B. Kato, J. P Gardner, P. J Norman, M. A Hall, M. Kimura, R. Vaughan, A. Aviv, and T. D Spector Reduced telomere length in rheumatoid arthritis is independent of disease activity and duration Ann Rheum Dis, April 1, 2007; 66(4): 476 - 480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C Duftner, C Dejaco, W Kullich, A Klauser, C Goldberger, A Falkenbach, and M Schirmer Preferential type 1 chemokine receptors and cytokine production of CD28- T cells in ankylosing spondylitis Ann Rheum Dis, May 1, 2006; 65(5): 647 - 653. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Poggi, S. Negrini, M. R. Zocchi, A.-M. Massaro, L. Garbarino, S. Lastraioli, L. Gargiulo, L. Luzzatto, and R. Notaro Patients with paroxysmal nocturnal hemoglobinuria have a high frequency of peripheral-blood T cells expressing activating isoforms of inhibiting superfamily receptors Blood, October 1, 2005; 106(7): 2399 - 2408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Marleau and N. Sarvetnick T cell homeostasis in tolerance and immunity J. Leukoc. Biol., September 1, 2005; 78(3): 575 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Williams, A. R. Bateman, and S. I. Khakoo HANGING IN THE BALANCE: KIR and Their Role in Disease Mol. Interv., August 1, 2005; 5(4): 226 - 240. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Duftner, R. Seiler, P. Klein-Weigel, H. Gobel, C. Goldberger, C. Ihling, G. Fraedrich, and M. Schirmer High Prevalence of Circulating CD4+CD28- T-Cells in Patients With Small Abdominal Aortic Aneurysms Arterioscler Thromb Vasc Biol, July 1, 2005; 25(7): 1347 - 1352. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Xu, A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy Distinct Transcriptional Control Mechanisms of Killer Immunoglobulin-like Receptors in Natural Killer (NK) and in T Cells J. Biol. Chem., June 24, 2005; 280(25): 24277 - 24285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. van Bergen, A. Thompson, A. van der Slik, T. H. M. Ottenhoff, J. Gussekloo, and F. Koning Phenotypic and Functional Characterization of CD4 T Cells Expressing Killer Ig-Like Receptors J. Immunol., December 1, 2004; 173(11): 6719 - 6726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Snyder, T. Nakajima, P. J. Leibson, C. M. Weyand, and J. J. Goronzy Stimulatory Killer Ig-Like Receptors Modulate T Cell Activation through DAP12-Dependent and DAP12-Independent Mechanisms J. Immunol., September 15, 2004; 173(6): 3725 - 3731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Wagner, M. Pierer, M. Wahle, F. Moritz, S. Kaltenhauser, and H. Hantzschel Ex Vivo Homeostatic Proliferation of CD4+ T Cells in Rheumatoid Arthritis Is Dysregulated and Driven by Membrane-Anchored TNF{alpha} J. Immunol., August 15, 2004; 173(4): 2825 - 2833. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Rajalingam, P. Parham, and L. Abi-Rached Domain Shuffling Has Been the Main Mechanism Forming New Hominoid Killer Cell Ig-Like Receptors J. Immunol., January 1, 2004; 172(1): 356 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. O. Schonland, C. Lopez, T. Widmann, J. Zimmer, E. Bryl, J. J. Goronzy, and C. M. Weyand Premature telomeric loss in rheumatoid arthritis is genetically determined and involves both myeloid and lymphoid cell lineages PNAS, November 11, 2003; 100(23): 13471 - 13476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Groh, A. Bruhl, H. El-Gabalawy, J. L. Nelson, and T. Spies Stimulation of T cell autoreactivity by anomalous expression of NKG2D and its MIC ligands in rheumatoid arthritis PNAS, August 5, 2003; 100(16): 9452 - 9457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Strauss, I. Knape, I. Melzner, and K.-M. Debatin Constitutive Caspase Activation and Impaired Death-Inducing Signaling Complex Formation in CD95-Resistant, Long-Term Activated, Antigen-Specific T Cells J. Immunol., August 1, 2003; 171(3): 1172 - 1182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nakajima, O. Goek, X. Zhang, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand De Novo Expression of Killer Immunoglobulin-Like Receptors and Signaling Proteins Regulates the Cytotoxic Function of CD4 T Cells in Acute Coronary Syndromes Circ. Res., July 25, 2003; 93(2): 106 - 113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Stewart, J. van Bergen, and J. Trowsdale Different and Divergent Regulation of the KIR2DL4 and KIR3DL1 Promoters J. Immunol., June 15, 2003; 170(12): 6073 - 6081. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Snyder, M. Lucas, E. Vivier, C. M. Weyand, and J. J. Goronzy Selective Activation of the c-Jun NH2-terminal Protein Kinase Signaling Pathway by Stimulatory KIR in the Absence of KARAP/DAP12 in CD4+ T Cells J. Exp. Med., February 17, 2003; 197(4): 437 - 449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Spaggiari, P. Contini, A. Dondero, R. Carosio, F. Puppo, F. Indiveri, M. R. Zocchi, and A. Poggi Soluble HLA class I induces NK cell apoptosis upon the engagement of killer-activating HLA class I receptors through FasL-Fas interaction Blood, December 1, 2002; 100(12): 4098 - 4107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Dulphy, C. Rabian, C. Douay, O. Flinois, S. Laoussadi, J. Kuipers, R. Tamouza, D. Charron, and A. Toubert Functional modulation of expanded CD8+ synovial fluid T cells by NK cell receptor expression in HLA-B27-associated reactive arthritis Int. Immunol., May 1, 2002; 14(5): 471 - 479. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Komocsi, P. Lamprecht, E. Csernok, A. Mueller, K. Holl-Ulrich, U. Seitzer, F. Moosig, A. Schnabel, and W. L. Gross Peripheral Blood and Granuloma CD4+CD28- T Cells Are a Major Source of Interferon-{gamma} and Tumor Necrosis Factor-{alpha} in Wegener's Granulomatosis Am. J. Pathol., May 1, 2002; 160(5): 1717 - 1724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Snyder, L.-O. Muegge, C. Offord, W. M. O'Fallon, Z. Bajzer, C. M. Weyand, and J. J. Goronzy Formation of the Killer Ig-Like Receptor Repertoire on CD4+CD28null T Cells J. Immunol., April 15, 2002; 168(8): 3839 - 3846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nakajima, S. Schulte, K. J. Warrington, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand T-Cell-Mediated Lysis of Endothelial Cells in Acute Coronary Syndromes Circulation, February 5, 2002; 105(5): 570 - 575. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Allen, T. Raine, A. Haude, J. Trowsdale, and M. J. Wilson Cutting Edge: Leukocyte Receptor Complex-Encoded Immunomodulatory Receptors Show Differing Specificity for Alternative HLA-B27 Structures J. Immunol., November 15, 2001; 167(10): 5543 - 5547. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P Lamprecht, F Moosig, E Csernok, U Seitzer, A Schnabel, A Mueller, and W L Gross CD28 negative T cells are enriched in granulomatous lesions of the respiratory tract in Wegener's granulomatosis Thorax, October 1, 2001; 56(10): 751 - 757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-H. Yen, B. E. Moore, T. Nakajima, D. Scholl, D. J. Schaid, C. M. Weyand, and J. J. Goronzy Major Histocompatibility Complex Class I-Recognizing Receptors Are Disease Risk Genes in Rheumatoid Arthritis J. Exp. Med., May 21, 2001; 193(10): 1159 - 1168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Greer, M. C. Kinney, and T. P. Loughran Jr. T Cell and NK Cell Lymphoproliferative Disorders Hematology, January 1, 2001; 2001(1): 259 - 281. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
). Cross-linking of GL183 did not induce
cytotoxic activity (
), nor did it modulate cytotoxic activity in the
presence of anti-CD3 (
) in the T cell clones, although they
expressed KIR2DS2 in the absence of inhibitory receptors (see Fig. 2
) or
isotype-matched control Ig (
) and suboptimal concentrations of IL-2
(2 U/ml; upper panel). GL183 enhanced the
anti-CD3-induced proliferative response of the three
CD4+CD28null clones (HD3, KV1, and H1.16), but
not that of the CD4+CD28+ control clones (T3.2
and JP3). Cross-linking of GL183 in the absence of anti-CD3 was not
sufficient to induce T cell proliferation above background (<1000
cpm). Costimulatory activity of GL183 was observed at suboptimal
anti-CD3 concentrations that were 100- to 1000-fold lower than the
amount of Ab required for stimulation with anti-CD3 alone. A
representative titration experiment is shown for clone HD4–12 in the
lower panel. An increase in proliferation was not
observed when the clone was stimulated with a combination of L368 and
anti-CD3 (data not shown).