| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B Activation and TNF-
Gene Transcription Induced by Hypoxia and Endotoxin1
Section of Pulmonary and Critical Care Medicine, Department of Medicine, University of Chicago, Chicago, IL 60637
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B stimulates the transcription of
proinflammatory cytokines including TNF-
. LPS (endotoxin) and
hypoxia both induce NF-B activation and TNF- gene transcription.
Furthermore, hypoxia augments LPS induction of TNF- mRNA. Previous
reports have indicated that antioxidants abolish NF-B activation in
response to LPS or hypoxia, which suggests that reactive oxygen species
(ROS) are involved in NF-B activation. This study tested whether
mitochondrial ROS are required for both NF-B activation and the
increase in TNF- mRNA levels during hypoxia and LPS. Our results
indicate that hypoxia (1.5% O2) stimulates NF-B and
TNF- gene transcription and increases ROS generation as measured by
the oxidant sensitive dye 2',7'-dichlorofluorescein diacetate in murine
macrophage J774.1 cells. The antioxidants
N-acetylcysteine and pyrrolidinedithiocarbamic acid
abolished the hypoxic activation of NF-B, TNF- gene
transcription, and increases in ROS levels. Rotenone, an inhibitor of
mitochondrial complex I, abolished the increase in ROS signal, the
activation of NF-B, and TNF- gene transcription during hypoxia.
LPS stimulated NF-B and TNF- gene transcription but not ROS
generation in J774.1 cells. Rotenone, pyrrolidinedithiocarbamic acid,
and N-acetylcysteine had no effect on the LPS
stimulation of NF-B and TNF- gene transcription, indicating that
LPS activates NF-B and TNF- gene transcription through a
ROS-independent mechanism. These results indicate that mitochondrial
ROS are required for the hypoxic activation of NF-B and TNF- gene
transcription, but not for the LPS activation of
NF-B. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, through a receptor-
mediated signaling pathway (6, 7). TNF- under
physiological conditions has an important role in maintaining
hemodynamics, host defense, and repair of tissue injury
(8). However, during a systemic inflammatory response to
LPS, the unregulated release of TNF- into the circulation results in
circulatory dysfunction, increased endothelial permeability, and
inflammation in multiple organs, including the lung
(9, 10, 11). Lung gas exchange failure and circulatory
disturbances can lead to hypotension and tissue hypoxia, which can
exacerbate the LPS-induced release of TNF- and result in worsening
of the sepsis syndrome (12, 13, 14).
The transcription factor NF-B mediates the LPS-induced release of
TNF- at the cellular level (15). Hypoxia also
stimulates NF-B activation and TNF- gene transcription
(16, 17, 18, 19, 20). The activated form of NF-B is a heterodimer,
which usually consists of two proteins, a p65 subunit and a p50 subunit
(21). Both subunits of NF-B are members of the
NF-B/Rel family of transcription factors, which also includes c-Rel,
RelB, and p52. The activity of NF-B is regulated by an inhibitor,
IB, which forms a complex with NF-B in the cytoplasm and
inhibits the nuclear localization of the dimer (22). When
cells receive signals that activate NF-B, IB is phosphorylated
and degraded through an ubiquitin proteasome pathway (23).
The degradation of IB triggers the translocation of NF-B from
the cytoplasm to the nucleus and activates the transcription of
specific target genes. However, it is still unclear how diverse stimuli
regulate IB phosphorylation and subsequent degradation resulting
in NF-B activation. One common mechanism for the activation of
NF-B proposes a requirement for an increase in reactive oxygen
species (ROS). Hydrogen peroxide exposure can rapidly activate NF-B,
and the thiol reductant pyrrolidinedithiocarbamic acid (PDTC), an
effective antioxidant, can block NF-B activation in response to LPS,
TNF-, and active phorbol ester in a number of different cell lines
(24, 25). The antioxidant N-actylcysteine (NAC)
blocks activation of NF-B by hypoxia (26). However,
these previous reports did not measure endogenous ROS production or
describe the source of ROS generation required for the activation of
NF-B by hypoxia or LPS (27). Recently, mitochondria
have been described as a major source of ROS in response to specific
stimuli that include hypoxia (28). In the present study,
we tested whether ROS generated by the mitochondrial electron transport
chain are required for the hypoxic and LPS activation of NF-B and
for the induction of TNF- mRNA in the J774.1 murine macrophage
cell line.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
J774.1 cells were cultured on glass coverslips, 35-mm petri dishes, or T-75 flasks to 70–90% confluence in RPMI with penicillin (100 U/ml), streptomycin (100 µg/ml), and 5% heat-inactivated FCS (Life Technologies, Gaithersburg, MD). Hypoxic conditions were achieved by as previously described (28). ROS generation was assessed using the oxidant-sensitive probes 2',7'-dichlorofluorescein diacetate (DCFH-DA, 10 µM, Molecular Probes, Eugene, OR) or dihydroethidium (DHE, 10 µM, Molecular Probes) (28).
Electrophoretic mobility shift assay (29)
Nuclear extracts were prepared from cells by lysing them in a hypotonic solution (10 mM KCl, 10 mM HEPES, protease cocktail inhibitors (Boehringer Mannheim, Indianapolis, IN), 1 mM PMSF, freshly added) and centrifuged at 14,000 rpm. Subsequently, the pellet was suspended in a solution containing 400 mM KCl, 20 mM HEPES, 25% (v/v) glycerol, 0.2 mM EDTA, and 1.5 mM MgCl2, pH 7.8. The solution was centrifuged to pellet the nuclei debris, and the proteins in the supernatant were used to perform Western blot analysis. To perform electrophoretic mobility shift assays, the supernatant was diluted with 2 volumes of a solution containing 20 mM HEPES, 25% glycerol (v/v), 0.2 mM EDTA, and 1.5 mM MgCl2, pH 7.8. The DNA binding reactions were performed at room temperature in buffer containing 20 mM HEPES, 100 mM KCl, 1 mM EDTA, 1 µg calf thymus DNA, 50,000 dpm labeled probe, 10% glycerol, and 5 µg nuclear extracts in a volume of 25 µl at pH 7.8. The oligonucleotide probe used in the binding reactions consisted of the sequence 5'-AGCTTCAGAGGGGACTTTCCGAGAGG-3'; 3'- AGTCTCCCCTGAAAGGCTCTCCAGCT-5'.
The probe was labeled with
[-32P]dGTP (800 Ci/mol) and
[-32P]dCTP (800 Ci/mol) by Klenow
polymerase. The specificity of NF-B DNA binding activity was
determined by supershift analysis with p65 Abs. All reaction mixtures
were electrophoresed on 4% nondenaturing polyacrylamide gel.
Subsequently, the gels were dried and autoradiographed.
Northern analysis
Total cellular RNA (tcRNA) was isolated from J774.1 cells using
the RNA isolation kit (Qiagen, Chatsworth, CA) according to the
manufacturer’s protocol. Equal aliquots (10 µg) of each tcRNA sample
were denatured and electrophoresed on a 1.2% agarose-formaldehyde gel.
In preparation for transfer, the gel was soaked in 0.2 M NaOH for 15
min followed by 45 min in solution containing 1.5 M sodium chloride and
0.15 M sodium citrate. The gel was blotted by capillary transfer to
Hybond-N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ)
for 24–36 h. After the transfer, RNA was cross-linked to the membrane
under UV light. Prehybridization of the blots was conducted in
prehybridization solution (Life Technologies), for 2–4 h at 65°C.
Blots were then transferred to hybridization solution (1.0 M sodium
chloride, 0.1 M sodium citrate, 0.01 M EDTA, pH 8.0; 5x Denhardt’s
solution; 0.5% SDS; 100 µg/ml sheared, denatured salmon sperm DNA;
Life Technologies), and denatured 32P-labeled
TNF- probe was added. Hybridization was allowed to proceed overnight
(16–24 h) at 65°C. After hybridization, membranes were washed twice
for 5 min at room temperature (0.3 M sodium chloride, 0.03 M sodium
citrate, 0.1% SDS), twice for 20 min at 65°C (0.015 M sodium
chloride, 0.0015 M sodium citrate, 0.1% SDS), once for 15 min at room
temperature (0.015 M sodium chloride, 0.0015 M sodium citrate, 0.1%
SDS), and once for 10 min at room temperature (0.3 M sodium chloride
and 0.03 M sodium citrate). Northern blots were analyzed by
autoradiography.
Preparation of 32P-labeled TNF- probe
The probe for TNF- was obtained by RT-PCR. The following
primer sequences were extracted from the cDNA sequence for murine
TNF- (30): 5'GAGCAGCTGGAGTGGCTGCTGAG 3'(sense), and 5'
TAGACCTGCCCGGACTCCGC 3'(antisense). Using these primers and tcRNA
isolated from LPS (100 ng/ml)-treated J774.1 cells as the template, a
379-bp fragment was amplified. For Northern hybridizations, the PCR
product was gel purified, and 25–50 ng were
32P-labeled by random primer labeling using DNA
Labeling Beads (dCTP) (Amersham Pharmacia Biotech).
Cytokine immunoassays
TNF- was measured in supernatants of J774.1 cells by ELISA,
as described by manufacturer’s directions (R&D Systems,
Minneapolis, MN).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
LPS has been shown to cause an increase in cellular oxidative
stress (31). However, whether this increase in ROS
reflects a direct response to LPS or an indirect response to
LPS-induced cytokine release remains controversial (31).
To assess whether LPS directly induces generation of ROS, murine
macrophage J774.1 cells were placed in a flowthrough chamber on an
inverted microscope under normoxic conditions (15%
O2) in the presence of LPS (1 µg/ml) and
DCFH-DA (10 µM) for 90 min. The DCFH-DA dye can be oxidized to the
fluorescent compound 2'7'-dichlorofluorescein (DCF) by hydrogen
peroxide within cells (32). LPS failed to increase the
oxidation of the DCFH dye during 90 min, indicating no increase in ROS
(Fig. 1
A). To assess whether
prolonged exposure to LPS induces ROS, J774.1 cells were placed in
35-mm petri dishes and incubated with LPS at different concentrations
in the presence of DCFH-DA. At various time points, the medium was
aspirated, and the cells were lysed and centrifuged to remove debris.
Afterward, the fluorescence in the supernatant was measured. LPS
increased oxidation of DCFH during 6–18 h in a dose-dependent manner
(Fig. 1B). The increase in DCF fluorescence was abolished in
the presence of the antioxidants NAC (500 µM) and PDTC (10 µM)
(Fig. 2A). Both antioxidants
maintain reduced levels of glutathione, thereby enhancing the
scavenging of hydrogen peroxide. To determine whether the LPS induction
of ROS by LPS required de novo protein synthesis, J774.1 cells were
incubated for 18 h in the presence of cycloheximide, a protein
synthesis inhibitor. The LPS-induced increase in DCF fluorescence was
attenuated in the presence of cycloheximide (25 µg/ml), indicating
that LPS generation of ROS requires de novo protein synthesis (Fig. 2A). Previous studies have shown that TNF- increases
generation of ROS (33). Indeed, TNF- production
progressively increased during 18 h (Fig. 2B), and the
LPS increase in DCF fluorescence was attenuated in the presence of
TNF--neutralizing Ab. These data indicate that LPS does not increase
ROS acutely (within 90 min), but LPS does induce ROS generation during
6–18 h by stimulating the secretion of TNF- that acts in an
autocrine fashion on the cell surface receptors.
|
|
C). Apocynin (300 µM), a NADPH oxidase inhibitor, did not
abolish the increase in DCF fluorescence in response to prolonged
exposure to LPS (Fig. 2C). Rotenone (1 µg/ml), an
inhibitor of electron transport that acts at complex I, abolished the
increase in DCF fluorescence in response to LPS (Fig. 2C).
By contrast, antimycin A (1 µg/ml), an inhibitor of electron
transport at the downstream end of complex III, did not alter the
increase in DCF fluorescence. These results indicate that the site of
mitochondrial ROS generation during prolonged exposure is between
complex I and complex III. Hypoxia increases mitochondrial ROS generation
Intracellular ROS generation during hypoxia was measured using
DCFH-DA in J774.1 cells placed in a flowthrough chamber on an inverted
microscope. J774.1 cells demonstrated an increase in DCF fluorescence
in response to hypoxia (1.5% O2) (Fig. 3A). The antioxidants NAC or
PDTC and DPI abolished the increase in DCF signal in response to
hypoxia (Fig. 3B). Previous studies in Hep3B cells showed
that hypoxia increases superoxide generation as a result of electron
flux through mitochondrial complex III (28). In J774.1
cells, rotenone abolished the increase in DCF signal observed during
hypoxia. (Fig. 3B). By contrast, antimycin A further
augmented the hypoxia-induced increase in DCF fluorescence (Fig. 3B). The NADPH oxidase inhibitor apocynin did not abolish
the hypoxic increase in DCF signal (Fig. 3B). To further
demonstrate that hypoxia stimulates mitochondrial ROS production,
J774.1 cells were incubated with DHE in the presence of hypoxia and
various inhibitors. DHE undergoes oxidation to fluorescent ethidium in
the presence of superoxide (36). Fig. 3C shows
that hypoxia increases ethidium fluorescence, indicating an increase in
superoxide generation. The hydrogen peroxide-scavenging antioxidants
NAC and PDTC did not affect the hypoxic increase in ethidium
fluorescence. By contrast, rotenone abolished the increase in
superoxide generation. Collectively, these results demonstrate that
hypoxia directly induces mitochondrial ROS in J774.1 cells.
|
B DNA binding activity independent
of de novo protein synthesis
LPS and hypoxia independently have been shown to activate NF-B
DNA binding (17). To demonstrate this in J774.1 cells,
NF-B DNA-binding activity was assessed using an electrophoretic
mobility shift assay. Nuclear extracts prepared from J774.1
cells exposed to either LPS (100 ng/ml) or hypoxia (1.5%
O2) for 2 h contained a protein complex
capable of binding a DNA probe containing a NF-B binding site (Fig. 4). LPS and hypoxia both demonstrated
bands containing the p65 subunit in the protein complex as demonstrated
by supershift analysis (Fig. 4). Neither the hypoxia nor the
LPS-induced NF-B DNA-binding activity was abolished in the presence
of cycloheximide (25 µg/ml) (Fig. 4). The hypoxia-induced NF-B DNA
binding activity was less evident than the LPS-induced NF-B
DNA-binding activity. Hypoxia did not augment the LPS-induced NF-B
DNA-binding activity. These results indicate that both hypoxia and LPS
independently stimulate NF-B DNA binding activity without de novo
protein synthesis.
|
B DNA binding and TNF- mRNA
during LPS
LPS activation of NF-B DNA-binding activity has been suggested
to require an increase in ROS (37, 38). These reports
relied on the observation that antioxidants such as PDTC or NAC
abolished the LPS activation of NF-B DNA-binding activity. However,
our current observations indicated that LPS does not directly increase
ROS generation. To clarify the role of ROS in LPS induction of NF-B
DNA-binding activity, J774.1 cells were exposed to LPS (100 ng/ml) for
2 h at various concentrations of PDTC. Fig. 5a shows that 500 µM PDTC was required
to abolish NF-B DNA-binding activity. Yet PDTC is an effective
antioxidant at concentrations of 10 µM. To clarify the role of ROS in
LPS-induced transcription, NF-B DNA-binding activity
and TNF- mRNA levels were examined in J774.1 cells. The
antioxidants NAC (500 µM) and PDTC (10 µM) failed to abolish
NF-B DNA binding activity and TNF- mRNA levels in response to LPS
(Fig. 5, B and C). The mitochondrial inhibitors
rotenone and antimycin A did not affect NF-B DNA-binding activity or
TNF- mRNA levels in response to LPS (Fig. 5, B and
C). Apocynin, a NADPH oxidase inhibitor, and DPI, an
inhibitor of a wide range of flavoproteins, also did not alter
LPS-induced NF-B DNA-binding activity and TNF- mRNA levels (Fig. 5, B and C). These results indicate that LPS
activates NF-B DNA-binding activity independently of an increase
in ROS.
|
B DNA binding and TNF- mRNA requires
an increase in ROS
Previous studies have shown that NAC abolishes hypoxia-induced
NF-B DNA-binding activity (26). In the present study,
the antioxidants NAC (500 µM) and PDTC (10 µM) abolished NF-B
DNA-binding activity and TNF- mRNA levels in J774.1 cells exposed to
hypoxia (Fig. 6). To determine the
dependence of the hypoxic response on mitochondrial ROS production,
J774.1 cells were exposed to hypoxia in the presence of rotenone or
antimycin A. Rotenone abolished NF-B DNA-binding activity in
response to hypoxia, whereas antimycin A maintained the hypoxic
induction of NF-B DNA binding activity (Fig. 6). These results are
consistent with rotenone decreasing the hypoxic increase in ROS
generation by limiting electron flux into complex III, the site of
mitochondrial ROS generation. Antimycin A also inhibits electron
transport, but at a site downstream of the location of ROS generation,
thereby augmenting ROS generation. DPI abolished NF-B DNA-binding
activity and TNF- mRNA levels in response to hypoxia. By contrast,
apocynin had no effect on the hypoxic induction of NF-B DNA-binding
activity and TNF- mRNA levels. These results indicate that the
hypoxic induction of NF-B DNA-binding activity and TNF- mRNA
levels requires mitochondrial ROS generation.
|
TNF- mRNA levels and TNF- release were measured in J774.1
cells exposed to hypoxia, LPS, and LPS plus hypoxia. Hypoxia stimulated
TNF- mRNA levels and TNF- release from J774.1 cells but
10-fold less than LPS (Fig. 7A). Interestingly, hypoxia
augmented LPS induction of TNF- mRNA levels and TNF- release
(Fig. 7B). NAC and PDTC abolished both the response to
hypoxia alone and the augmentation of LPS-induced TNF- mRNA levels
and TNF- release from J774.1 cells by hypoxia (Fig. 7, A
and B). Rotenone and DPI both abolished the hypoxic
augmentation of LPS-induced TNF- mRNA levels. Antimycin A and
apocynin did not alter the hypoxic augmentation of LPS-induced TNF-
mRNA levels. These results are consistent with the hypothesis that the
hypoxic signaling pathway requires an increase in mitochondrial
ROS.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
acts as a signaling element in the pathophysiology of the
systemic inflammatory response in critically ill patients. LPS is
thought to be the principal causative agent for the regulated release
of cytokines associated with sepsis and is derived from the outer
membrane of Gram-negative bacteria. LPS released from bacteria in blood
or tissues interacts with serum factors, such as LPS-binding protein,
which interacts with the membrane receptor CD14 on cells. Binding to
CD14 leads to the activation of kinases that result in NF-B
activation (39, 40). How does CD14 binding lead to kinase
activation? One suggestion has been that a burst of intracellular ROS
is generated, leading to the activation of kinases and thus NF-B
(41, 42). The evidence for cellular oxidative signaling
involvement in the activation of NF-B is based on three
observations: 1) antioxidants such as PDTC and NAC abolish LPS-induced
activation of NF-B (37, 38, 34); 2) in vitro
administration of H2O2 to
cells stimulates activation of NF-B (43); 3) NAC blocks
activation of NF-B in animal models of ARDS and has been reported to
improve lung function in patients with adult respiratory distress
syndrome (44, 45, 46). One concern regarding these studies is
that unusually high concentrations of NAC (>10 mM) and PDTC (>100
µM) were required to abolish NF-B activation. Moreover, there was
no direct evidence that LPS leads to an increase in ROS generation over
the time period required to observe NF-B activation. In the present
study, we examined the relationship between cellular oxidative stress
and NF-B activation in response to LPS. The data indicate that LPS
does not require an increase in ROS generation for NF-B activation
and the subsequent expression of TNF- mRNA. There was no observable
increase in ROS generation over the time period required to observe
NF-B activation. The antioxidant PDTC abolished LPS-induced NF-B
activity at 500 µM. However, PDTC is an effective ROS scavenger at
the minimal concentration of 10 µM. Thus, at higher doses it is
likely that PDTC is interfering in NF-B DNA-binding activity in
response to LPS rather than through the attenuation of ROS generation.
PDTC may target kinase activation. Many kinases contain cysteine
residues that are likely to be redox sensitive to a thiol reductant
such as PDTC. The antioxidant NAC also did not affect LPS activation of
NF-B or subsequent TNF- expression at an antioxidant dose (500
µM) that was effective in abolishing the oxidant signaling during
hypoxia as indicated by the DCFH dye. Moreover, LPS-induced NF-B
activity and TNF- mRNA expression were not altered in the presence
of specific inhibitors of NADPH oxidase and mitochondrial electron
transport, which suggests that key ROS-generating systems did not
participate in the signaling pathway.
Previous studies have indicated that macrophages challenged with LPS
exhibit an increase in oxidative stress (47). This effect
could have been mediated by release of TNF- or nitric oxide. Because
LPS did not show an increase in oxidative signaling during the
acute period (2 h) required to elicit NF-B activation, we tested
whether prolonged exposure of LPS would increase ROS generation. The
ROS measurements in response to LPS during 2 h were done in a
flowthrough chamber; therefore, any released cytokines would have been
carried away rather than allowed to accumulate. Longer exposure to LPS
(12–18 h) in a static petri dish did elicit an increase in ROS
generation. This response was due to the autocrine effect of TNF- on
the cell membrane receptor because the ROS increase was abolished in
the presence of TNF--neutralizing Ab. Furthermore, mitochondrial
complex I inhibitors abolished the LPS induced increase in ROS during
18 h. Previous reports have indicated that TNF- increases ROS
at complex III of the mitochondrial electron transport chain
(48). Thus, LPS does not directly induce ROS, but over
time LPS induces ROS through de novo synthesis of TNF- acting on
complex III within mitochondrial electron transport chain (Fig. 8).
|
B and release of cytokines including TNF-. In the present
study, we demonstrate that hypoxia increases NF-B DNA-binding
activity and TNF- mRNA levels. The hypoxic activation of NF-B and
subsequent TNF- mRNA gene transcription require increases in
mitochondrial ROS generation. Previous studies have reported that
mitochondrial complex III can function as an important site of
superoxide generation during hypoxia (28). Evidence for
mitochondrial ROS regulation of NF-B during hypoxia rests on the
following observations. Hypoxia increased NF-B DNA-binding activity
and ROS generation in the presence of cycloheximide, indicating that
hypoxia does not require de novo factors such as TNF-. The
antioxidants NAC and PDTC abolished the hypoxic increase in DCF
fluorescence, NF-B DNA-binding activity, and TNF- mRNA levels.
The specific mitochondrial complex I inhibitor rotenone abolished the
increase in DCF fluorescence, NF-B DNA-binding activity and TNF-
mRNA levels during hypoxia. By contrast, the mitochondrial complex III
inhibitor antimycin A did not abolish the increase in ROS signaling,
NF-B DNA-binding activity, and TNF- mRNA levels during hypoxia.
The observation that rotenone abolished ROS signaling, NF-B
activation, and TNF- mRNA expression during hypoxia whereas
antimycin A preserved these responses during hypoxia indicates that
mitochondrial ATP is not required for the response, because both
inhibitors block electron transport and abolish oxidative
phosphorylation. These results indicate that mitochondrial ROS are
required for the activation of NF-B DNA-binding activity and TNF-
mRNA levels during hypoxia (Fig. 8).
Under physiological conditions, low levels of cytokines have important
roles in maintaining vascular function, in host defense, and in
controlling the repair of tissue injury. However, during systemic
sepsis or in response to experimental LPS challenge, the uncontrolled
release of cytokines into the circulation contributes to the
circulatory dysfunction and may precipitate the development of organ
injury in multiple organs. Why is the activation of NF-B by hypoxia
potentially important in this scheme? The activation of NF-B by
hypoxia and the subsequent local cytokine release is part of the normal
repair of local tissue injury and thus an adaptive function. For
example, localized tissue hypoxia may contribute to the activation of
NF-B and local cytokine release, which could be important in
controlling the infectious process and enhancing wound healing. By
contrast, during systemic inflammatory states associated with sepsis,
hypoxia could augment the excessive release of cytokines that are
already stimulated by LPS. Our data support this hypothesis by
demonstrating that LPS stimulates TNF- release 10-fold more than
hypoxia alone in macrophages. However, hypoxia significantly augments
the LPS-induced release of TNF-. Antioxidants attenuated the hypoxic
augmentation of LPS-induced release of TNF-, as did inhibitors of
the proximal regions of the mitochondrial electron transport chain.
Interestingly, hypoxia did not augment LPS-induced NF-B DNA-binding
activity, although hypoxia did augment TNF- mRNA expression. This
suggests that hypoxia may activate transcription factors other than
NF-B that play a role in the hypoxic amplification of LPS induction
of TNF- mRNA levels. Collectively, these studies reveal that hypoxic
amplification of LPS gene transcription relies on signaling pathways
that involve mitochondrial ROS.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Navdeep S. Chandel, Division of Pulmonary and Critical Medicine, Department of Medicine, Northwestern University, Tarry Building 14-707, 300 East Superior Street, Chicago, IL 60611-3010.
3 Abbreviations used in this paper: MOSF, multiple organ system failure; DCF, 2'7'-dichlorofluorescein; DCFH-DA, 2',7'-dichlorofluorescin diacetate; DHE, dihydroethidium; ROS, reactive oxygen species; NAC, N-acetylcysteine; PDTC, pyrrolidinedithiocarbamic acid; tcRNA, total cellular RNA; DPI, diphenyleneidonium.
Received for publication December 8, 1999. Accepted for publication April 24, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B: a pivotal transcription factor in chronic inflammatory diseases. N. Engl. J. Med. 336:1066. by human alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 14:170.[Abstract]
B expression. Am. J. Physiol. 276:L909.B through the phosphorylation of IB on tyrosine residues. Cancer Res. 54:1425.B and NF-IL6 in cardiac myocytes. Cardiovasc. Res. 42:104.B induction during in vivo hypoxia in dorsocaudal brain stem of rat: effect of MK-801 and L-NAME. J. Appl. Physiol. 85:372.. J. Biol. Chem. 274:19447.B: ten years after. Cell 87:13.[Medline]
B/IB family: intimate tales of association and dissociation. Genes Dev. 9:2723.B activation: the IB kinase revealed?. Cell 91:299.[Medline]
B transcription factor and HIV-1. EMBO J. 10:2247.[Medline]
B activation. Transplantation 63:466.[Medline]
B activation in T cells. Free Radic. Biol. Med. 25:346.[Medline]
B Affinity, specificity, Zn2+ dependence, and differential half-site recognition. J. Biol. Chem. 266252..
B activation in intact cells. J. Exp. Med. 175:1181.B mobilization and TNF production in human monocytes. J. Immunol. 151:6986.[Abstract]
B, a mediator of lipopolysaccharide effects. Immunobiology 187:233.[Medline]
B: an oxidative stress-responsive transcription factor of eukaryotic cells. Free Radic. Res. Commun. 17:221.[Medline]
B the sensor of oxidative stress?. FASEB J. 13:1137.B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 12:2005.[Medline]
B activation and neutrophilic lung inflammation. J. Immunol. 157:1630.[Abstract]
. EMBO J. 12:3095.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S. Tassi, S. Carta, R. Vene, L. Delfino, M. R. Ciriolo, and A. Rubartelli Pathogen-Induced Interleukin-1{beta} Processing and Secretion Is Regulated by a Biphasic Redox Response J. Immunol., July 15, 2009; 183(2): 1456 - 1462. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Li, T. Kaifu, M. Obinata, and T. Takai Peroxiredoxin III-deficiency Sensitizes Macrophages to Oxidative Stress J. Biochem., April 1, 2009; 145(4): 425 - 427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Zmijewski, E. Lorne, S. Banerjee, and E. Abraham Participation of mitochondrial respiratory complex III in neutrophil activation and lung injury Am J Physiol Lung Cell Mol Physiol, April 1, 2009; 296(4): L624 - L634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. F. Moreira, I. M. Larrayoz, J. W. Lee, and I. R. Rodriguez 7-Ketocholesterol Is Present in Lipid Deposits in the Primate Retina: Potential Implication in the Induction of VEGF and CNV Formation Invest. Ophthalmol. Vis. Sci., February 1, 2009; 50(2): 523 - 532. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Zmijewski, E. Lorne, X. Zhao, Y. Tsuruta, Y. Sha, G. Liu, G. P. Siegal, and E. Abraham Mitochondrial Respiratory Complex I Regulates Neutrophil Activation and Severity of Lung Injury Am. J. Respir. Crit. Care Med., July 15, 2008; 178(2): 168 - 179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Lahat, M. A. Rahat, A. Kinarty, L. Weiss-Cerem, S. Pinchevski, and H. Bitterman Hypoxia enhances lysosomal TNF-{alpha} degradation in mouse peritoneal macrophages Am J Physiol Cell Physiol, July 1, 2008; 295(1): C2 - C12. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Jantsch, D. Chakravortty, N. Turza, A. T. Prechtel, B. Buchholz, R. G. Gerlach, M. Volke, J. Glasner, C. Warnecke, M. S. Wiesener, et al. Hypoxia and Hypoxia-Inducible Factor-1{alpha} Modulate Lipopolysaccharide-Induced Dendritic Cell Activation and Function J. Immunol., April 1, 2008; 180(7): 4697 - 4705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. H. Elsasser, T. J. Caperna, C-J. Li, S. Kahl, and J. L. Sartin Critical control points in the impact of the proinflammatory immune response on growth and metabolism J Anim Sci, April 1, 2008; 86(14_suppl): E105 - E125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Battaglia, S. Delfino, E. Merello, M. Puppo, R. Piva, L. Varesio, and M. C. Bosco Hypoxia transcriptionally induces macrophage-inflammatory protein-3{alpha}/CCL-20 in primary human mononuclear phagocytes through nuclear factor (NF)-{kappa}B J. Leukoc. Biol., March 1, 2008; 83(3): 648 - 662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Mizukami, Y. Kohgo, and D. C. Chung Hypoxia Inducible Factor-1 Independent Pathways in Tumor Angiogenesis Clin. Cancer Res., October 1, 2007; 13(19): 5670 - 5674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Lluis, F. Buricchi, P. Chiarugi, A. Morales, and J. C. Fernandez-Checa Dual Role of Mitochondrial Reactive Oxygen Species in Hypoxia Signaling: Activation of Nuclear Factor-{kappa}B via c-SRC and Oxidant-Dependent Cell Death Cancer Res., August 1, 2007; 67(15): 7368 - 7377. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. Cummins, E. Berra, K. M. Comerford, A. Ginouves, K. T. Fitzgerald, F. Seeballuck, C. Godson, J. E. Nielsen, P. Moynagh, J. Pouyssegur, et al. Prolyl hydroxylase-1 negatively regulates I{kappa}B kinase-beta, giving insight into hypoxia-induced NF{kappa}B activity PNAS, November 28, 2006; 103(48): 18154 - 18159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Garrean, X.-P. Gao, V. Brovkovych, J. Shimizu, Y.-Y. Zhao, S. M. Vogel, and A. B. Malik Caveolin-1 Regulates NF-{kappa}B Activation and Lung Inflammatory Response to Sepsis Induced by Lipopolysaccharide J. Immunol., October 1, 2006; 177(7): 4853 - 4860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Canton, A. Skyschally, R. Menabo, K. Boengler, P. Gres, R. Schulz, M. Haude, R. Erbel, F. Di Lisa, and G. Heusch Oxidative modification of tropomyosin and myocardial dysfunction following coronary microembolization Eur. Heart J., April 1, 2006; 27(7): 875 - 881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Murdoch, M. Muthana, and C. E. Lewis Hypoxia Regulates Macrophage Functions in Inflammation J. Immunol., November 15, 2005; 175(10): 6257 - 6263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Lluis, A. Morales, C. Blasco, A. Colell, M. Mari, C. Garcia-Ruiz, and J. C. Fernandez-Checa Critical Role of Mitochondrial Glutathione in the Survival of Hepatocytes during Hypoxia J. Biol. Chem., February 4, 2005; 280(5): 3224 - 3232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Walmsley, C. Print, N. Farahi, C. Peyssonnaux, R. S. Johnson, T. Cramer, A. Sobolewski, A. M. Condliffe, A. S. Cowburn, N. Johnson, et al. Hypoxia-induced neutrophil survival is mediated by HIF-1{alpha}-dependent NF-{kappa}B activity J. Exp. Med., January 3, 2005; 201(1): 105 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. B. Waypa and P. T. Schumacker Hypoxic pulmonary vasoconstriction: redox events in oxygen sensing J Appl Physiol, January 1, 2005; 98(1): 404 - 414. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Tsai, M. Wang, J. M. Pitcher, K. K. Meldrum, and D. R. Meldrum Hypoxic pulmonary vasoconstriction and pulmonary artery tissue cytokine expression are mediated by protein kinase C Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1215 - L1219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Minoguchi, T. Tazaki, T. Yokoe, H. Minoguchi, Y. Watanabe, M. Yamamoto, and M. Adachi Elevated Production of Tumor Necrosis Factor-{alpha} by Monocytes in Patients With Obstructive Sleep Apnea Syndrome Chest, November 1, 2004; 126(5): 1473 - 1479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Ali, D. P. Pearlstein, C. E. Mathieu, and P. T. Schumacker Mitochondrial requirement for endothelial responses to cyclic strain: implications for mechanotransduction Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L486 - L496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. M. Matuschak, A. J. Lechner, Z. Chen, S. Todi, T. M. Doyle, and L. L. Loftis Hypoxic suppression of E. coli-induced NF-{kappa}B and AP-1 transactivation by oxyradical signaling Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2004; 287(2): R437 - R445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bowers, C. Cool, R. C. Murphy, R. M. Tuder, M. W. Hopken, S. C. Flores, and N. F. Voelkel Oxidative Stress in Severe Pulmonary Hypertension Am. J. Respir. Crit. Care Med., March 15, 2004; 169(6): 764 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. H. Kim, V. J. Johnson, T.-Y. Shin, and R. P. Sharma Selenium Attenuates Lipopolysaccharide-Induced Oxidative Stress Responses Through Modulation of p38 MAPK and NF-{kappa}B Signaling Pathways Experimental Biology and Medicine, February 1, 2004; 229(2): 203 - 213. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Song, J. A. Kellum, H. Kaldas, and M. P. Fink Evidence That Glutathione Depletion Is a Mechanism Responsible for the Anti-Inflammatory Effects of Ethyl Pyruvate in Cultured Lipopolysaccharide-Stimulated RAW 264.7 Cells J. Pharmacol. Exp. Ther., January 1, 2004; 308(1): 307 - 316. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Demasi, L. G. Cleland, R. J. Cook-Johnson, G. E. Caughey, and M. J. James Effects of Hypoxia on Monocyte Inflammatory Mediator Production: DISSOCIATION BETWEEN CHANGES IN CYCLOOXYGENASE-2 EXPRESSION AND EICOSANOID SYNTHESIS J. Biol. Chem., October 3, 2003; 278(40): 38607 - 38616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Casillan, N. C. Gonzalez, J. S. Johnson, D. R. S. Steiner, and J. G. Wood Mesenteric microvascular inflammatory responses to systemic hypoxia are mediated by PAF and LTB4 J Appl Physiol, June 1, 2003; 94(6): 2313 - 2322. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.A. Rabinovich, M. Figueras, E. Ardite, N. Carbo, T. Troosters, X. Filella, J.A. Barbera, J.C. Fernandez-Checa, J.M. Argiles, and J. Roca Increased tumour necrosis factor-{alpha} plasma levels during moderate-intensity exercise in COPD patients Eur. Respir. J., May 1, 2003; 21(5): 789 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. T. Higgins, J. H. Wang, P. Dockery, P. E. Cleary, and H. P. Redmond Induction of Angiogenic Cytokine Expression in Cultured RPE by Ingestion of Oxidized Photoreceptor Outer Segments Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1775 - 1782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Takano, A. Meneshian, E. Sheikh, Y. Yamakawa, K. B. Wilkins, E. A. Hopkins, and G. B. Bulkley Rapid upregulation of endothelial P-selectin expression via reactive oxygen species generation Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H2054 - H2061. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Evans, I. D. Goldfine, B. A. Maddux, and G. M. Grodsky Oxidative Stress and Stress-Activated Signaling Pathways: A Unifying Hypothesis of Type 2 Diabetes Endocr. Rev., October 1, 2002; 23(5): 599 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. V. Naidu, B. Krishnadasan, K. Byrne, A. L. Farr, M. Rosengart, E. D. Verrier, and M. S. Mulligan Regulation of chemokine expression by cyclosporine a in alveolar macrophages exposed to hypoxia and reoxygenation Ann. Thorac. Surg., September 1, 2002; 74(3): 899 - 905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Samavati, M. M. Monick, S. Sanlioglu, G. R. Buettner, L. W. Oberley, and G. W. Hunninghake Mitochondrial KATP channel openers activate the ERK kinase by an oxidant-dependent mechanism Am J Physiol Cell Physiol, July 1, 2002; 283(1): C273 - C281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Pearlstein, M. H. Ali, P. T. Mungai, K. L. Hynes, B. L. Gewertz, and P. T. Schumacker Role of Mitochondrial Oxidant Generation in Endothelial Cell Responses to Hypoxia Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 566 - 573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Chandel, P. T. Schumacker, and R. H. Arch Reactive Oxygen Species Are Downstream Products of TRAF-mediated Signal Transduction J. Biol. Chem., November 9, 2001; 276(46): 42728 - 42736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. S. Steiner, N. C. Gonzalez, and J. G. Wood Leukotriene B4 promotes reactive oxidant generation and leukocyte adherence during acute hypoxia J Appl Physiol, September 1, 2001; 91(3): 1160 - 1167. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. T. Sylvester Hypoxic Pulmonary Vasoconstriction : A Radical View Circ. Res., June 22, 2001; 88(12): 1228 - 1230. [Full Text] [PDF]
|
|
|
|
|
|
L. Connelly, M. Palacios-Callender, C. Ameixa, S. Moncada, and A. J. Hobbs Biphasic Regulation of NF-{{kappa}}B Activity Underlies the Pro- and Anti-Inflammatory Actions of Nitric Oxide J. Immunol., March 15, 2001; 166(6): 3873 - 3881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sanlioglu, C. M. Williams, L. Samavati, N. S. Butler, G. Wang, P. B. McCray Jr., T. C. Ritchie, G. W. Hunninghake, E. Zandi, and J. F. Engelhardt Lipopolysaccharide Induces Rac1-dependent Reactive Oxygen Species Formation and Coordinates Tumor Necrosis Factor-alpha Secretion through IKK Regulation of NF-kappa B J. Biol. Chem., August 3, 2001; 276(32): 30188 - 30198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Pearlstein, M. H. Ali, P. T. Mungai, K. L. Hynes, B. L. Gewertz, and P. T. Schumacker Role of Mitochondrial Oxidant Generation in Endothelial Cell Responses to Hypoxia Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 566 - 573. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
