The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeffery, K. J. M.
Right arrow Articles by Bangham, C. R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeffery, K. J. M.
Right arrow Articles by Bangham, C. R. M.
The Journal of Immunology, 2000, 165: 7278-7284.
Copyright © 2000 by The American Association of Immunologists

The Influence of HLA Class I Alleles and Heterozygosity on the Outcome of Human T Cell Lymphotropic Virus Type I Infection1

Katie J. M. Jeffery2,*, Asna A. Siddiqui2,*, Mike Bunce{dagger}, Alun L. Lloyd{ddagger}, Alison M. Vine*, Aviva D. Witkover*, Shuji Izumo§, Koichiro Usuku, Kenneth I. Welsh{dagger}, Mitsuhiro Osame|| and Charles R. M. Bangham3,*

* Department of Immunology, Imperial College School of Medicine, St. Mary’s, London, United Kingdom; {dagger} Oxford Transplant Centre, Nuffield Department of Surgery, Churchill Hospital, Oxford, United Kingdom; {ddagger} Princeton Institute for Advanced Study, Princeton, NJ 08540; § Division of Molecular Pathology, Centre for Chronic Viral Diseases, Department of Medical Informatics, and || Third Department of Internal Medicine, Faculty of Medicine, Kagoshima University, Kagoshima, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The inflammatory disease human T cell lymphotropic virus type I (HTLV-I)-associated myelopathy (HAM/TSP) occurs in only 1–2% of HTLV-I-infected individuals and is associated with a high provirus load of HTLV-I. We hypothesize that a person’s risk of developing HAM/TSP depends upon the efficiency of their immune response to the virus, which differs between individuals because of polymorphism in genes that influence this response. Previously we showed that the possession of HLA-A*02 was associated with a lower risk of HAM/TSP, and with a lower provirus load in healthy carriers of HTLV-I. However, HLA-A*02 did not account for all the observed difference in the risk of HAM/TSP. Here we present evidence, in the same study population in Japan, that HLA-Cw*08 was also associated with disease protection (probability value, two-tailed test = 0.002) and with a lower proviral load in healthy carriers. Possession of the A*02 and/or Cw*08 genes prevented 36% of potential HAM/TSP cases. In contrast, HLA-B*5401 was associated with a higher susceptibility to HAM/TSP (probability value, two-tailed test = 0.0003) and with a higher provirus load in HAM/TSP patients. At a given provirus load, B*5401 appeared to increase the risk of disease. The fraction of HAM/TSP cases attributable to B*5401 was 17%. Furthermore, individuals who were heterozygous at all three HLA class I loci have a lower HTLV-I provirus load than those who were homozygous at one or more loci. These results are consistent with the proposal that a strong class I-restricted CTL response to HTLV-I reduces the proviral load and hence the risk of disease.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The inflammatory disease, human T cell lymphotropic virus type 1 (HTLV-I)4-associated myelopathy/tropical spastic paraparesis (HAM/TSP), is caused by infection with HTLV-I. Of the 10–20 million people infected with the virus, ~95% remain healthy carriers (HCs), 2–3% develop HAM/TSP, and another 1–2% develop an aggressive adult T cell leukemia. The factors that cause these different manifestations of HTLV-I infection are not yet fully understood. The immune response to the virus is characterized by a chronically activated CTL response in most infected people, and a strong Ab response. The CTL response is directed mainly at the HTLV-I protein Tax, a powerful transactivator of viral transcription (1, 2, 3). Tax also transactivates many host cell genes, for example, IL-2 and IL-2 receptor (4, 5). A major risk factor for HAM/TSP is the proviral load; the median proviral load is 16 times higher in HAM/TSP patients than in HCs (6). A high HTLV-I proviral load is also associated with an increased risk of progression to disease (6, 7). However, we have suggested that CTLs might be able to limit replication of the virus and so determine the provirus load and the risk of proinflammatory disease (8, 9).

It is possible that HTLV-I-specific CTLs exert both protective and inflammatory effects. There is a precedent for this in influenza virus infection in the mouse, where the anti-influenza CTL protected against disease after a low dose of virus, but exacerbated viral pathology at a high dose (10). There is also evidence that HTLV-I-specific CTL could contribute to the inflammation seen in HAM/TSP. Inflammatory cytokines and chemokines, including IFN-{gamma} and TNF, are produced by the frequent HTLV-I-specific CD8+ T cells in peripheral blood and in spinal cord lesions (11, 12, 13, 14). Such CD8+ T cells could cause bystander damage to cells in the CNS (11, 15).

However, frequent and chronically activated HTLV-I-specific CTLs have been found in HCs as well as in HAM/TSP patients (2, 16, 17, 18). We suggested that CTLs were protective in HCs because the tax gene, which encodes the dominant CTL target Ag (1, 2, 3), was subject to positive selection in these individuals (19). Recently we have shown that freshly isolated, naturally infected CD4+ cells capable of expressing Tax were rapidly killed by virus-specific CTLs in vitro using a perforin-dependent mechanism. This is consistent with the view that the CTLs efficiently destroy HTLV-I-infected cells in vivo and so protect against inflammatory diseases such as HAM/TSP (20).

Host genetic factors are major determinants of susceptibility to infectious disease (21); the HLA complex plays a particularly important role. We have taken an interest in HLA class I associations with HTLV-I-associated diseases because of the presence of a powerful CTL response in HTLV-I infection. Previous HLA studies in HTLV-I infection have found an association between DRB1*0101 and other genes on the HLA-B*0702-Cw*0702-DRB1*0101-DQB1*0501 haplotype and susceptibility to HAM/TSP in the Japanese population (22, 23, 24). In a recent case-control study, we showed that the MHC class I gene HLA-A*02 conferred protection from HAM/TSP; possession of HLA-A*02 halved the odds of HAM/TSP for a person infected with HTLV-I, and the A*02 allele prevented ~28% of potential cases in the study population (18). These observations suggested that A*02-restricted CTL are particularly efficient at recognizing Tax, and we found that A*02-positive HCs had a provirus load one-third that of A*02-negative carriers (18). Furthermore, the increased susceptibility to HAM/TSP associated with the DRB1*0101 haplotype was evident only in A*02-negative subjects. Therefore, we conclude that host genetic factors do indeed influence both a person’s provirus load and the risk of HAM/TSP.

The first aim of this study was to examine the frequency of class I alleles in the study population that showed a suggestive difference between patients and controls (0.05 < 2p <= 0.10; where 2p denotes probability value in a two-tailed test) in our initial study (Cw*08, A*11). Because the class I-restricted T cell response appears to play an important part in deciding the outcome of HTLV-1 infection, we also wished to test the hypothesis that heterozygosity at HLA class I loci is protective in HTLV-I infection. An individual who has two different alleles at each HLA locus can present a wider repertoire of antigenic peptides to the CTL than a homozygote. This could result in a more efficient CTL response to HTLV-I, a lower proviral load, and a lower risk of disease. Heterozygote advantage has recently been demonstrated in HIV (for class I loci) (25, 26) and hepatitis B infection (for class II loci) (27).

Our results show that HLA-Cw*08 protects against HAM/TSP and is associated with an almost 4-fold reduction in provirus load. The Cw*08 effect was independent of and additive to the A*02 effect shown previously. HLA-B*5401 was associated with an increase in the risk of disease and a higher provirus load in HAM/TSP patients. The protective effect of A*02 seen previously had no effect on the susceptibility to HAM/TSP associated with B*5401. The results also demonstrate a significant effect of HLA class I heterozygosity; HAM/TSP patients heterozygous at all three class I loci had a lower proviral load than individuals homozygous at one or more class I loci.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Study population

Two hundred thirty-three cases of HAM/TSP were compared with 202 randomly selected HTLV-I-seropositive asymptomatic blood donors (HCs) from the Kagoshima Red Cross Blood Transfusion Service. All cases and controls were of Japanese ethnic origin and resided in Kagoshima Prefecture, Japan. The diagnosis of HAM/TSP was made according to World Health Organization diagnostic criteria (28).

HLA class I typing

A staged study was performed. In stage 1, 100 cases of HAM/TSP and 100 HCs were studied. In the first 50 cases and 56 controls, PCR-sequence-specific primer (PCR-SSP) reactions were performed to detect all known HLA-A, -B, and -C specificities in an allele- or group-specific manner (96 reactions) (29). The remaining 50 cases and 44 controls were typed with a restricted set of 48 PCR-SSP reactions designed to detect all the HLA-A, -B, and -C specificities that 1) occurred at a gene frequency of >=5%, or 2) were associated with an odds ratio (OR) of HAM/TSP of <=0.5 or >=2.0 in the first 50 cases and 56 controls. The results of this initial study, which showed that HLA-A*02 is associated with disease protection, and the haplotype B*0702-Cw*0702-DRB1*0101-DQB1*0501 is associated with susceptibility, have already been published (18).

Stage 2 of the study was designed to test the hypotheses that 1) further class I alleles and 2) HLA class I heterozygosity are associated with protection against HAM/TSP or a reduction in provirus load. We chose to restrict the analysis of the further class I typing to those alleles that showed a suggestive difference in frequency (0.05 < 2p <= 0.10) in stage 1 and those in linkage disequilibrium with alleles associated with disease protection/susceptibility.

HLA heterozygosity study

To determine the heterozygosity in the HLA loci, we conducted a complete HLA class I typing on each subject. Initially, a reduced number of PCR-SSP reactions were performed, as above, to detect all the common alleles. Then, at any class I locus that appeared to be homozygous from the stage 1 or 2 study, the class I HLA typing was completed at each locus to detect the rarer alleles. For the purposes of the heterozygosity study, each locus was studied to the type level only (e.g., HLA-A*02 rather than HLA-A*0201). We compared the HAM/TSP risk and proviral load between individuals who were heterozygous at all three class I loci and those who were homozygous at one or more loci. The power of statistical tests of heterozygosity at individual class I loci was limited by the small number of subjects involved.

Class I subtyping

Following an initial analysis of our results, PCR-SSP reactions were designed to differentiate Cw*0801 from Cw*0803/0806 (30), B*4006 from B*4002, and B*5401 from B*5507. The design of SSPs was based on published gene sequences (31) updated from HLA informatics pages available on the internet (http://www.anthonynolan.com/HIG/index.html). PCR methods were as previously described (29).

Class II typing

DRB1 and DQB1 typing was performed as previously described (18).

Detection of single nucleotide polymorphisms in the TNF-{alpha} promoter region

A 314-bp fragment of the TNF-{alpha} 5' flanking region (incorporating the T-1031C, C-863A, and C-857T single nucleotide polymorphism (SNP) sites (32), was amplified by primary PCR (primers 5' agggatatgtgatggactcac; 5' tattccatacctggaggtcc, designed in house) (GenBank accession number M16441) and sequenced using dRhodamine terminator chemistry (Perkin-Elmer, Norwalk, CT) on an automated DNA sequencer (ABI 377; Perkin-Elmer). A total of 209 HAM/TSP patients and 195 HCs were screened.

Proviral load measurement

The HTLV-I provirus load in PBMC was measured at one time point in all patients and HCs, as described elsewhere (6, 18). A quantitative PCR was performed using an ABI 7700 sequence detector (Perkin-Elmer). The lower limit of detection was one copy of HTLV-I (tax) per 104 PBMC.

Statistical analysis

The {chi}2 test, Mann-Whitney U test, and the OR (GraphPad, San Diego, CA) were used for statistical analysis. Where the number of observations was <20 in any category, Fisher’s Exact test was used for a 2 x 2 table. The Bonferroni method (33) was used to correct for multiple comparisons. The prevented fraction of disease (Fp), i.e., the fraction of potential cases of disease in the study population that is prevented by a specified factor, was calculated as previously described (18). The population attributable risk, i.e., the fraction of observed cases of disease that is attributable to a specified factor, was calculated according to Schlesselman (34). To calculate the risk of HAM/TSP at a given proviral load, Bayes’ theorem of conditional probabilities was used, as detailed in Bangham et al. (8). For clarity, probability levels are cited as follows: 2p denotes the results of two-tailed tests, and p denotes a one-tailed test (e.g., 2p = 0.002).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The age and sex distributions of the patient and control groups were as previously described (18). Although there was an excess of females in the HAM/TSP group and an absence of subjects under 16 or over 65 from the control (blood donation) group, the frequency of occurrence of individual HLA alleles was unaffected by age and sex (data not shown).

HLA-Cw*08 was associated with a lower risk of HAM/TSP and a lower proviral load

Alleles selected from stage 1 for stage 2 of the study were Cw*08 (2p = 0.087, OR = 0.42, 95% confidence interval (CI) = 0.17–1.04) (Table IGo) and A*11 (2p = 0.09, OR = 2.07, 95% CI = 0.96–4.45). It was necessary to confirm these associations not only because of the large number of alleles tested for, but because they were not significant at p < 0.05. We proceeded to test these associations in an independent sample. The excess of A*11-positive subjects seen in the HAM/TSP subjects in stage 1 was not maintained in stage 2 or in the cohort as a whole (45 of 233 HAM/TSP A*11+; 31 of 202 HCs A*11+, 2p = 0.33). However, in the second stage of the study, and overall, the genotype frequency of HLA-Cw*08 was significantly lower among the cases of HAM/TSP compared with the controls (Table IGo). The possession of HLA-Cw*08 was associated with a >2-fold reduction in the odds of HAM/TSP (2p = 0.002, OR = 0.42, 95% CI = 0.25–0.73). Given this OR and the observed frequency of Cw*08 in Kagoshima, we can estimate the proportion of potential cases of HAM/TSP that are prevented by the presence of Cw*08 (the Fp; Ref. 18). Here, Fp = 12.6% (±3.7% SD). We then tested the hypothesis that if a gene is associated with protection from disease, it is also associated with a reduction in provirus load in HCs of the virus, as the risk of developing disease is dependent on the provirus load (6, 7). There was a significant reduction in median provirus load of almost 4-fold associated with Cw*08 in the HCs (2p = 0.046, Mann-Whitney U statistic) (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table I. HLA-Cw*08 reduced the odds of HAM/TSPa

 

View this table:
[in this window]
[in a new window]
 
Table II. HLA-Cw*08 and subtype Cw*0801 were associated with a lower median provirus load in HCsa

 
Cw*08 subtyping was conducted to see whether there was an association between protection against HAM/TSP and a particular subtype. Subtypes detected were Cw*0801, Cw*0802, and Cw*0803/06. The genotype frequencies were as follows; Cw*0801: HAM/TSP 9.4%, HCs 18.3%; Cw*0802: HAM/TSP 0%, HCs 0.5%; Cw*0803/06: HAM/TSP 0.9%, HCs 2.5%. The predominant allele, HLA-Cw*0801, was significantly associated with disease protection in comparison with Cw*08-negative subjects (2p = 0.008, OR = 0.45, 95% CI = 0.26–0.80) and an almost 5-fold reduction in provirus load in the HCs (2p = 0.028, Mann-Whitney U statistic) (Table IIGo).

The protective effect of Cw*08 was independent of and additive to the effect of A*02

Three lines of evidence suggest that the effect of HLA-Cw*08 was independent of and additive to those of A*02: 1) A*02 and Cw*08 were not in significant linkage disequilibrium in the HCs (data not shown); 2) Cw*08 reduced the odds of disease in A*02-negative subjects (2p = 0.013) (Table IIIGo) and A*02 reduced the odds of disease in Cw*08-negative subjects (2p < 0.0001, OR = 0.41, 95% CI = 0.26–0.63) (data not shown); and 3) Cw*08 was associated with a >3-fold reduction in median provirus load in both A*02-positive and -negative HCs using the Mann-Whitney U statistic (median proviral load in A*02-positive subjects: Cw*08+ 6.0 and Cw*08- 25.7 copies/104 PBMC, p = NS; A*02-negative subjects: Cw*08+ 15.8 and Cw*08- 53.7 copies/104 PBMC, p = NS).


View this table:
[in this window]
[in a new window]
 
Table III. HLA-Cw*08 reduced the odds of HAM/TSP in A*02-negative subjectsa

 
Possession of Cw*08 was sufficient to explain the association of other alleles in linkage disequilibrium with Cw*08

HLA-Cw*08 has been reported to be in linkage disequilibrium in the Japanese population with A*02, A*2402, A*2601, and B*48, and with the haplotype B*4006-DRB1*0901-DQB1*0303-DPB1*0201 (35, 36). In this study we found Cw*08 to be in significant linkage disequilibrium in both the HAM/TSP and HC populations with A*26, B*48, B*4006, DRB1*0901, and DQB1*0303 (data not shown). HLA-B*48 was associated with a reduction in the odds of HAM/TSP (2p = 0.037, corrected p-NS, OR = 0.39). However, there was no effect of B*48 on provirus load in HCs. Cw*08 was found more frequently than B*48, and B*48 occurred in only three HAM/TSP patients and no HCs in the absence of Cw*08. We conclude that the association of B*48 with disease protection is due to its strong linkage disequilibrium with Cw*08. Other alleles found to be in linkage disequilibrium in this population had no effect on the odds of disease either by themselves or in association with Cw*08.

Heterozygosity at HLA class I loci was associated with a lower proviral load of HTLV-I

We hypothesized that individuals who were heterozygous at all three HLA class I loci would have a lower provirus load than individuals who were homozygous at one or more loci, and this was indeed the case in the HAM/TSP patients (2p = 0.017, Mann-Whitney U statistic) (Table IVGo). In the HCs the proviral load was significantly lower in association with full heterozygosity only at a one-tailed level (p = 0.039, Mann-Whitney U statistic) (Table IVGo). In addition, homozygosity at the HLA-C locus was associated with a higher provirus load in the HAM/TSP patients (proviral load: heterozygous at HLA-C 530.9 copies/104 PBMC, homozygous at HLA-C 861.0 copies/104 PBMC, 2p = 0.018, Mann-Whitney U statistic). The effect of class I heterozygosity on proviral load was too small to have a significant effect on odds of HAM/TSP (p = NS, OR = 0.98).


View this table:
[in this window]
[in a new window]
 
Table IV. Heterozygosity at all three HLA class I loci was associated with a lower proviral load of HTLV-I in HAM/TSP patientsa

 
HLA-B*54 was associated with increased susceptibility to HAM/TSP and a higher proviral load of HTLV-I

In a parallel study of non-HLA candidate genes in the development of HAM/TSP we identified a suggestive increase in the frequency of HAM/TSP patients carrying the TNF -857T allele (p = 0.08, OR = 1.46, 95% CI 0.98–2.19). The results from the analysis of the other TNF promoter polymorphisms will be presented separately (C. Bangham, A. Vine, A. Witkover, Y. Furukawa, A. Lloyd, K. Jeffery, A. Siddiqui, K. Usuku, and M. Osame. Manuscript in preparation). TNF -857T is in linkage disequilibrium with B*5401 and DRB1*0405 in the Japanese (32) (extended haplotype A*2402-Cw*0102-B*5401- DRB1*0405-DQB1*0401; Ref. 36). Therefore, we examined the alleles in linkage disequilibrium with TNF -857T. B*5401 was significantly associated with disease susceptibility (2p = 0.0003 uncorrected, OR = 2.51) (Table VGo). A correction factor of 48 was applied to the p value for B*5401 to reflect the number of alleles tested for, to avoid artifacts due to multiple comparisons (33); the p value remains significant at 2p = 0.014. None of the other alleles in the extended haplotype described above had a significant association with disease (for A*24: 2p = 0.145; Cw*01: 2p = 0.150; DRB1*0405: 2p = 0.289; DQB1*0401: 2p = 0.123). The population-attributable risk of B*5401, i.e., the fraction of cases of HAM/TSP that were attributable to B*5401, was 16.8% (95% CI = 8.3–24.4%). Table VGo also shows that B*5401 was associated with disease susceptibility in both HLA-A*02-positive and HLA-A*02-negative populations. Conversely, A*02 was not associated with disease protection in the B*5401-positive population, but remained highly significantly associated in the B*5401-negative population (2p = 0.0001).


View this table:
[in this window]
[in a new window]
 
Table V. B*5401 is associated with an increased odds of HAM/TSPa

 
As well as being associated with disease susceptibility, B*5401 was also associated with a significantly higher provirus load in all HAM/TSP patients, and also in the A*02-negative HAM/TSP patients, although these increases were no longer significant after correction for multiple comparisons (Table VIGo). In our previous study, a significantly lower provirus load was seen in association with A*02 in the HCs. In this study the possession of A*02 was associated with a lower proviral load (>4-fold) in the B*5401-negative HCs, but in the presence of B*5401 no change in the A*02-associated provirus load was seen (Table VIGo).


View this table:
[in this window]
[in a new window]
 
Table VI. HTLV-I provirus load associated with HLA-B*5401 in the presence or absence of HLA-A*02a

 
Possession of B*5401 was associated with increased susceptibility to HAM/TSP in Cw*08-negative subjects (2p = 0.0025, OR = 2.27, 95% CI = 1.34–3.84) but not in Cw*08-positive subjects. Conversely, possession of Cw*08 was associated with protection against HAM/TSP in B*5401-negative subjects (2p = 0.0062, OR = 0.43, 95% CI = 0.24–0.78). Cw*08 did not appear to protect in B*5401-positive subjects; however, the power of this test was limited by a small number of B*5401-positive, Cw*08-positive subjects.

B*5401 was associated with a higher risk of HAM/TSP at a given HTLV-I load

The data on provirus load can be used to calculate the risk (prevalence) of HAM/TSP at a given provirus load (Fig. 1Go). As can be seen from Fig. 1Go, at a given provirus load, possession of HLA-B*5401 appeared to increase the risk of developing HAM/TSP.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. The risk of HAM/TSP is increased by HLA-B*54 at a given proviral load, when the proviral load exceeds a threshold of ~300 copies/10,000 PBMC (log10 300 {cong} 2.5). To calculate the risk of HAM/TSP at a given proviral load, Bayes’ theorem of conditional probabilities was used as previously described (8 18 ). P(HAM|L) denotes the risk of HAM/TSP at a given provirus load. nd, Not detected.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study demonstrates a protective effect of Cw*08 against HAM/TSP in HTLV-I-infected individuals, and that class I MHC heterozygosity is associated with a reduction in HTLV-I provirus load. The results of this and our previous study (18) suggest that a strong CTL response is protective in HTLV-I infection. There is conflicting evidence on the role of CTLs in HTLV-I infection (8, 37). Recently we have shown that freshly isolated autologous CD8+ T cells rapidly kill Tax-expressing naturally HTLV-I-infected CD4+ cells by a perforin-dependent mechanism and, furthermore, that there is a negative correlation between the frequency of Tax-11-19-specific CD8+ T cells and the percentage of CD4+ T cells in the peripheral blood of HTLV-I-infected patients (20). These results favor the interpretation that CTLs are protective in HTLV-I infection. However, it is possible to reconcile both a protective and a pathogenic effect of the CTL response (38).

The level of HLA-C expression on the cell surface is ~10% of the level of expression of HLA-A and -B (39), and the nonsynonymous nucleotide substitution rate in the peptide binding region of HLA-C has also been reported to be lower in HLA-C than in HLA-A or -B (40). However, several naturally occurring HLA-C-restricted CTL responses directed against viral Ags, in particular HIV, have been described (41, 42), including an HLA-C-restricted immunodominant CTL response (43) and Cw8-restricted CTL clones (44). In addition, HLA-C disease associations have been found, the most significant being the association of Cw*06 with psoriasis (45, 46), but there have been few clear demonstrations of HLA-C associations with infectious disease (25, 47). The development of molecular typing methods for HLA-C alleles (30, 48) has recently overcome the difficulties of detecting the serologically blank HLA-C alleles, and it is now clear that HLA-C locus heterozygosity can be as high as HLA-A locus heterozygosity (36). Therefore, it is likely that HLA-C contributes significantly to protection against certain viral infections. Our data show a higher provirus load in association with homozygosity at the HLA-C locus in HAM/TSP patients; this argues for an important role of HLA-C in Ag presentation. Why did we not detect an association between HLA-C and disease protection in stage I of the study? The Fp associated with HLA-Cw*08 (12.6%) was less than half of that seen in association with HLA-A*02 (28.2%) (18). This is because Cw*08 has a lower gene frequency than A*02 in the Japanese population (35, 36, 49). The reduced odds of disease seen in association with Cw*08 and A*02 were of the same magnitude (OR = 0.42 and 0.43, respectively).

Possession of Cw*08 reduced the risk of HAM/TSP in the Japanese HTLV-I-infected population in a way that is both additive to, and independent of, the protective effect of HLA-A*02. In addition, Cw*08 and A*02 were each independently associated with a reduction in provirus load in the asymptomatic carriers of the virus. The likely explanation for this effect with A*02 is that HTLV-I-infected lymphocytes are efficiently recognized by A2-restricted CTL and eliminated (18). We propose that the protective effects of Cw*08 are mediated by a similar mechanism. Experiments are in progress to define the epitopes of the HTLV-I Ags presented by Cw*08.

In this study, we tested the hypothesis that class I HLA heterozygosity is beneficial in HTLV-I infection. The class I-restricted T cell response exerts selection pressure on the viral population, which mutates rapidly; successive mutations may lead to eventual escape from effective immune control (50, 51). Therefore, heterozygosity at the class I loci, which allows a broader CTL response to develop (52), may allow a more effective CTL control of viral replication (25) and delay the development of CTL escape mutants (53). The results presented here show that in both asymptomatic carriers (one-tailed level of significance) and HAM/TSP patients, individuals who are fully heterozygous at HLA class I loci had a significantly lower provirus load than individuals homozygous at one or more class I loci. HLA class I heterozygosity was not significantly associated with protection from disease in this study but this may have been due to limitations on sample size. Logistic regression analysis (data not shown) confirmed that individuals who were fully heterozygous at HLA class I loci had a significantly lower provirus load, even after the effects of HLA-A*02 and Cw*08 are accounted for. The analysis of heterozygosity in this study was performed at the HLA type level, rather than at the subtype or allele level, because HLA subtypes bind and present to immune effector cells a broadly similar range of epitopes. Also, there is increasing evidence that certain apparently unrelated MHC proteins have very similar specificities in terms of the main anchor residues of their peptide ligands, and it is possible to place up to 70% of HLA-A and -B alleles into one of four HLA supertypes: A2, A3, B7, and B44 (54). Further grouping of alleles in functional categories based on shared peptide binding regions may increase success in searching for disease associations (55).

Many polymorphic loci might influence susceptibility to HAM/TSP. TNF is a strong candidate gene because the expression of this proinflammatory cytokine is induced by HTLV-I Tax protein (56). In this study there was a nonsignificant increase in the frequency of individuals with HAM/TSP carrying the TNF -857T allele. Other groups have observed that apparent TNF -857T associations with diabetes mellitus or rheumatoid arthritis are better accounted for by alleles in linkage disequilibrium with TNF -857T, namely, B*5401 and DRB1*0405 (57, 58).

In this study B*5401 was significantly associated with susceptibility to HAM/TSP, and none of the other loci in the haplotype described in Results was significantly associated with disease. HLA-B*5401 is found almost exclusively in East Asians (59). Hatta et al. (60) have recently suggested that this B*54-associated haplotype is particularly common in the Ryukyuan population, who form one of the important ancestral populations of Okinawa and Kyushu in Southern Japan. Associations have also been described between B*5401 and other inflammatory conditions in Japan, including hepatitis C (61, 62) and diffuse panbronchiolitis (63, 64). The HLA-associated susceptibility gene associated with diffuse panbronchiolitis has been mapped to a 200-kb region, 300 kb telomeric of the HLA-B locus (65). As well as the described linkage disequilibrium with TNF -857T, B*5401 is also known to be in linkage disequilibrium with the centromeric MHC class I chain-related gene A (MICA) allele MICA*012 in the Japanese population (66). The recent publication of the complete sequence and gene map of the MHC revealed only pseudogenes in the 46-kB region between HLA-B and MICA (67). Therefore, it will be necessary to test the hypothesis that the effects associated with B*5401 in HTLV-I infection are due to MICA polymorphisms.

Our data (Table VIGo) show that B*5401 was associated with a higher proviral load in HAM/TSP patients and that it abolished the A*02-associated reduction in provirus load in HCs (18). However, even after the proviral load was taken into account, B*5401 appeared to be associated with a significantly increased risk of HAM/TSP (Fig. 1Go). Thus, B*5401 appeared to increase the risk of HAM/TSP both through an effect on provirus load and through an additional effect that is independent of provirus load. The susceptibility to HAM/TSP associated with B*5401 appeared to overcome the protective effect associated with A*02, and the reduction in provirus load associated with A*02 in HCs was only seen in the B*5401-negative population. These observations suggest that the B*5401-associated susceptibility effect was dominant over the A*02-associated protective effect. The reason for the association between B*5401 and HAM/TSP remains uncertain. Because the B*5401-containing haplotype is also associated with a number of other inflammatory conditions (see above), which are not necessarily associated with HTLV-I infection, we suggest that B*5401 or a closely linked gene contributes to inflammation in an Ag-nonspecific manner.

Although the observed differences in proviral load associated with the presence of individual HLA alleles in this study were statistically significant, and in the direction consistent with their effects on the risk of HAM/TSP, the differences between the median values are sometimes small (Tables IIGo, IVGo, and VIGo). However, the median proviral load in HAM/TSP patients was only 16-fold higher than that of HCs (6) and logistic regression analysis (A. L. Lloyd, unpublished data) shows that the 4-fold reduction in proviral load associated with HLA-Cw*08 is associated with a 2.4-fold reduction in the odds of HAM/TSP, in close agreement with the OR calculation (Table IGo). The proviral load differences associated with B*5401 (Table VIGo) are smaller, therefore the biological significance is less clear. However, because the risk of HAM/TSP rises rapidly when the proviral load exceeds an apparent threshold of ~1 copy per 100 PBMCs (6), a small rise in load might be accompanied by a substantial increase in the risk of HAM/TSP.

In conclusion, we have now found three class I alleles to be independently associated with development of HAM/TSP, two associated with protection (A*02 and Cw*08) and one with susceptibility (B*5401), and a susceptibility haplotype (Cw*0702-B*0702-DRB1*0101-DQB1*0501) within which DRB1*0101 appears to have the strongest effect (18). Furthermore, we have demonstrated an effect of HLA class-I heterozygosity in lowering provirus load, which is known to be an important factor in the risk of developing disease. These associations may not be replicated in other populations whose HLA frequencies differ from those in this Japanese population; for example, B*5401 occurs almost exclusively in East Asian populations. However, A*02 was also significantly associated with a lower prevalence of HAM/TSP in a small population of Afro-Caribbean origin in London (18). Other genetic factors that are important in the immune response to viruses may also be important in influencing the outcome of HTLV-I infection. The pathogenesis of HAM/TSP remains unknown, but these data on the association of HLA class I alleles with disease susceptibility/protection favor the interpretation that a strong CTL response in HTLV-I infection is beneficial.


    Acknowledgments
 
We thank the staff and blood donors of the Kagoshima Red Cross Blood Center, and the staff and patients of the Third Department of Internal Medicine, Kagoshima University, Kagoshima, Japan, for valuable samples.


    Footnotes
 
1 This work was supported by the Program for Promotion of Fundamental Studies in Health Sciences of the Organization for Pharmaceutical Safety and Research (OPSR) (Japan), and the Wellcome Trust (to C.R.M.B., K.J.M.J., A.A.S., A.M.V., and A.D.W.). Back

2 K.J.M.J. and A.A.S. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Charles R. M. Bangham, Department of Immunology, Imperial College School of Medicine, St. Mary’s, Norfolk Place, London, W2 1PG, U.K. Back

4 Abbreviations used in this paper: HTLV-I, human T cell lymphotropic virus type I; HAM/TSP, HTLV-I associated myelopathy/tropical spastic paraparesis; HCs, healthy carriers; OR, odds ratio; 2p, probability value, two-tailed test; CI, confidence interval; Fp, prevented fraction of disease; SSP, sequence-specific primer; MICA, MHC class I chain-related gene A. Back

Received for publication May 15, 2000. Accepted for publication September 21, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jacobson, S., H. Shida, D. E. McFarlin, A. S. Fauci, S. Koenig. 1990. Circulating CD8+ cytotoxic T lymphocytes specific for HTLV-I pX in patients with HTLV-I associated neurological disease. Nature 348:245.[Medline]
  2. Parker, C., S. Daenke, S. Nightingale, C. Bangham. 1992. Activated, HTLV-I-specific cytotoxic T-lymphocytes are found in healthy seropositives as well as in patients with tropical spastic paraparesis. Virology 188:628.[Medline]
  3. Kannagi, M., S. Harada, I. Maruyama, H. Inoko, H. Igarashi, G. Kuwashima, S. Sato, M. Morita, M. Kidokoro, M. Sugimoto, et al 1991. Predominant recognition of human T cell leukemia virus type I (HTLV-I) pX gene products by human CD8+ cytotoxic T cells directed against HTLV- I-infected cells. Int. Immunol. 3:761.[Abstract/Free Full Text]
  4. Inoue, J., M. Seiki, T. Taniguchi, S. Tsuru, M. Yoshida. 1986. Induction of interleukin 2 receptor gene expression by p40x encoded by human T-cell leukemia virus type 1. EMBO J. 5:2883.[Medline]
  5. Okayama, A., N. Tachibana, S. Ishihara, Y. Nagatomo, K. Murai, M. Okamoto, T. Shima, K. Sagawa, H. Tsubouchi, S. Stuver, N. Mueller. 1997. Increased expression of interleukin-2 receptor {alpha} on peripheral blood mononuclear cells in HTLV-I tax/rex mRNA-positive asymptomatic carriers. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 15:70.[Medline]
  6. Nagai, M., K. Usuku, W. Matsumoto, D. Kodama, N. Takenouchi, T. Moritoyo, S. Hashiguchi, M. Ichinose, C. R. Bangham, S. Izumo, M. Osame. 1998. Analysis of HTLV-I proviral load in 202 HAM/TSP patients and 243 asymptomatic HTLV-I carriers: high proviral load strongly predisposes to HAM/TSP. J. Neurovirol. 4:586.[Medline]
  7. Taylor, G. P., J. H. Tosswill, E. Matutes, S. Daenke, S. Hall, B. J. Bain, R. Davis, D. Thomas, M. Rossor, C. R. Bangham, J. N. Weber. 1999. Prospective study of HTLV-I infection in an initially asymptomatic cohort. J. Acquir. Immune Defic. Syndr. 22:92.
  8. Bangham, C. R., S. E. Hall, K. J. Jeffery, A. M. Vine, A. Witkover, M. A. Nowak, D. Wodarz, K. Usuku, M. Osame. 1999. Genetic control and dynamics of the cellular immune response to the human T-cell leukaemia virus, HTLV-I. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 354:691.[Abstract/Free Full Text]
  9. Bangham, C., A. Kermode, S. Hall, S. Daenke. 1996. The cytotoxic T-lymphocyte response to HTLV-I: the main determinant of disease?. Semin. Virol. 7:41.
  10. Moskophidis, D., D. Kioussis. 1998. Contribution of virus-specific CD8+ cytotoxic T cells to virus clearance or pathologic manifestations of influenza virus infection in a T cell receptor transgenic mouse model. J. Exp. Med. 188:223.[Abstract/Free Full Text]
  11. Kubota, R., T. Kawanishi, H. Matsubara, A. Manns, S. Jacobson. 1998. Demonstration of human T lymphotropic virus type I (HTLV-I) tax-specific CD8+ lymphocytes directly in peripheral blood of HTLV-I-associated myelopathy/tropical spastic paraparesis patients by intracellular cytokine detection. J. Immunol. 161:482.[Abstract/Free Full Text]
  12. Ijichi, S., S. Izumo, K. Eiraku, R. Machigashira, M. Kubota, M. Nagai, N. Ikegami, N. Kashio, I. Umehara, I. Maruyama, M. Osame. 1993. An autoaggressive process against bystander tissues in HTLV-I-infected individuals: a possible pathomechanism of HAM/TSP. Med. Hypotheses 41:542.[Medline]
  13. Elovaara, I., S. Koenig, A. Y. Brewah, R. M. Woods, T. Lehky, S. Jacobson. 1993. High human T cell lymphotropic virus type 1 (HTLV-1)-specific precursor cytotoxic T lymphocyte frequencies in patients with HTLV-1-associated neurological disease. J. Exp. Med. 177:1567.[Abstract/Free Full Text]
  14. Biddison, W. E., R. Kubota, T. Kawanishi, D. D. Taub, W. W. Cruikshank, D. M. Center, E. W. Connor, U. Utz, S. Jacobson. 1997. Human T cell leukemia virus type I (HTLV-I)-specific CD8+ CTL clones from patients with HTLV-I-associated neurologic disease secrete proinflammatory cytokines, chemokines, and matrix metalloproteinase. J. Immunol. 159:2018.[Abstract]
  15. Levin, M. C., T. J. Lehky, A. N. Flerlage, D. Katz, D. W. Kingma, E. S. Jaffe, J. D. Heiss, N. Patronas, H. F. McFarland, S. Jacobson. 1997. Immunologic analysis of a spinal cord-biopsy specimen from a patient with human T-cell lymphotropic virus type I-associated neurologic disease. N. Engl. J. Med. 336:839.[Free Full Text]
  16. Parker, C. E., S. Nightingale, G. P. Taylor, J. Weber, C. R. Bangham. 1994. Circulating anti-Tax cytotoxic T lymphocytes from human T-cell leukemia virus type I-infected people, with and without tropical spastic paraparesis, recognize multiple epitopes simultaneously. J. Virol. 68:2860.[Abstract/Free Full Text]
  17. Daenke, S., A. G. Kermode, S. E. Hall, G. Taylor, J. Weber, S. Nightingale, C. R. Bangham. 1996. High activated and memory cytotoxic T-cell responses to HTLV-1 in healthy carriers and patients with tropical spastic paraparesis. Virology 217:139.[Medline]
  18. Jeffery, K. J., K. Usuku, S. E. Hall, W. Matsumoto, G. P. Taylor, J. Procter, M. Bunce, G. S. Ogg, K. I. Welsh, J. N. Weber, et al 1999. HLA alleles determine human T-lymphotropic virus-I (HTLV-I) proviral load and the risk of HTLV-I-associated myelopathy. Proc. Natl. Acad. Sci. USA 96:3848.[Abstract/Free Full Text]
  19. Niewiesk, S., S. Daenke, C. E. Parker, G. Taylor, J. Weber, S. Nightingale, C. R. Bangham. 1994. The transactivator gene of human T-cell leukemia virus type I is more variable within and between healthy carriers than patients with tropical spastic paraparesis. J. Virol. 68:6778.[Abstract/Free Full Text]
  20. Hanon, E., S. Hall, G. P. Taylor, M. Saito, R. Davis, Y. Tanaka, K. Usuku, M. Osame, J. N. Weber, C. R. Bangham. 2000. Abundant tax protein expression in CD4+ T cells infected with human T-cell lymphotropic virus type I (HTLV-I) is prevented by cytotoxic T lymphocytes. Blood 95:1386.[Abstract/Free Full Text]
  21. Hill, A. V. S.. 1998. The immunogenetics of human infectious diseases. Annu. Rev. Immunol. 16:593.[Medline]
  22. Usuku, K., S. Sonoda, M. Osame, S. Yashiki, K. Takahashi, M. Matsumoto, T. Sawada, K. Tsuji, M. Tara, A. Igata. 1988. HLA haplotype-linked high immune responsiveness against HTLV-I in HTLV-I-associated myelopathy: comparison with adult T-cell leukemia/lymphoma. Ann. Neurol. 23:(Suppl.):143.
  23. Sonoda, S., T. Fujiyoshi, S. Yashiki. 1996. Immunogenetics of HTLV-I/II and associated diseases. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 13:S119.
  24. Nishimura, Y., R. Okubo, S. Minato, Y. Itoyama, I. Goto, M. Mori, K. Hirayama, T. Sasazuki. 1991. A possible association between HLA and HTLV-I-associated myelopathy (HAM) in Japanese. Tissue Antigens 37:230.[Medline]
  25. Carrington, M., G. W. Nelson, M. P. Martin, T. Kissner, D. Vlahov, J. J. Goedert, R. Kaslow, S. Buchbinder, K. Hoots, S. J. O’Brien. 1999. HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage. Science 283:1748.[Abstract/Free Full Text]
  26. Tang, J., C. Costello, I. P. Keet, C. Rivers, S. Leblanc, E. Karita, S. Allen, R. A. Kaslow. 1999. HLA class I homozygosity accelerates disease progression in human immunodeficiency virus type 1 infection. AIDS Res. Hum. Retroviruses 15:317.[Medline]
  27. Thursz, M. R., H. C. Thomas, B. M. Greenwood, A. V. Hill. 1997. Heterozygote advantage for HLA class-II type in hepatitis B virus infection [letter]. [Published erratum appears in 1998 Nat. Genet. 18:88.]. Nat Genet 17:11.[Medline]
  28. Osame, M.. 1990. Review of WHO Kagoshima meeting and diagnostic guidelines for HAM/TSP. W. A. Blattner, ed. Human Retrovirology: HTLV 191. Raven Press, New York.
  29. Bunce, M., C. M. O’Neill, M. C. N. M. Barnardo, P. Krausa, M. J. Browning, P. J. Morris, K. I. Welsh. 1995. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 and DQb1 by PCR with 144 primer mixes utilizing sequence-specific primers (PCR-SSP). Tissue Antigens 46:355.[Medline]
  30. Bunce, M., M. C. Barnardo, J. Procter, S. G. Marsh, C. Vilches, K. I. Welsh. 1997. High resolution HLA-C typing by PCR-SSP: identification of allelic frequencies and linkage disequilibria in 604 unrelated random U.K. Caucasoids and a comparison with serology [Corrected and republished article originally printed in 1996 Tissue Antigens 48:680.]. Tissue Antigens 50:100.[Medline]
  31. Bodmer, J. G., S. G. Marsh, E. D. Albert, W. F. Bodmer, R. E. Bontrop, D. Charron, B. Dupont, H. A. Erlich, R. Fauchet, B. Mach, et al 1997. Nomenclature for factors of the HLA system, 1996. Tissue Antigens 49:297.[Medline]
  32. Higuchi, T., N. Seki, S. Kamizono, A. Yamada, A. Kimura, H. Kato, K. Itoh. 1998. Polymorphism of the 5'-flanking region of the human tumor necrosis factor (TNF)-{alpha} gene in Japanese. Tissue Antigens 51:605.[Medline]
  33. Bland, J. M., D. G. Altman. 1995. Multiple significance tests: the Bonferroni method. Br. Med. J. 310:170.[Free Full Text]
  34. Schlesselman, J. J.. 1982. Case-Control Studies Oxford University Press, Oxford.
  35. Ando, H., N. Mizuki, R. Ando, Y. Miyata, S. Miyata, K. Wakisaka, H. Inoko. 1996. HLA-C genotyping in the Japanese population by the PCR-SSP method. Tissue Antigens 48:55.[Medline]
  36. Tokunaga, K., Y. Ishikawa, A. Ogawa, H. Wang, S. Mitsunaga, S. Moriyama, L. Lin, M. Bannai, Y. Watanabe, K. Kashiwase, et al 1997. Sequence-based association analysis of HLA class I and II alleles in Japanese supports conservation of common haplotypes. Immunogenetics 46:199.[Medline]
  37. Hollsberg, P.. 1999. Mechanisms of T-cell activation by human T-cell lymphotropic virus type I. Microbiol. Mol. Biol. Rev. 63:308.[Abstract/Free Full Text]
  38. Asquith, B., C. R. M. Bangham. 2000. The role of cytotoxic T lymphocytes in human T-cell lymphotropic virus type 1 infection. J. Theor. Biol. 207:65.[Medline]
  39. Snary, D., C. J. Barnstable, W. F. Bodmer, M. J. Crumpton. 1977. Molecular structure of human histocompatibility antigens: the HLA-C series. Eur. J. Immunol. 7:580.[Medline]
  40. Hughes, A. L., M. Nei. 1988. Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335:167.[Medline]
  41. Johnson, R. P., A. Trocha, T. M. Buchanan, B. D. Walker. 1993. Recognition of a highly conserved region of human immunodeficiency virus type 1 gp120 by an HLA-Cw4-restricted cytotoxic T-lymphocyte clone. J. Virol. 67:438.[Abstract/Free Full Text]
  42. Littaua, R. A., M. B. Oldstone, A. Takeda, C. Debouck, J. T. Wong, C. U. Tuazon, B. Moss, F. Kievits, F. A. Ennis. 1991. An HLA-C-restricted CD8+ cytotoxic T-lymphocyte clone recognizes a highly conserved epitope on human immunodeficiency virus type 1 gag. J. Virol. 65:4051.[Abstract/Free Full Text]
  43. Goulder, P. J., M. Bunce, G. Luzzi, R. E. Phillips, A. J. McMichael. 1997. Potential underestimation of HLA-C-restricted cytotoxic T-lymphocyte responses [letter]. AIDS 11:1884.[Medline]
  44. Sipsas, N. V., S. A. Kalams, A. Trocha, S. He, W. A. Blattner, B. D. Walker, R. P. Johnson. 1997. Identification of type-specific cytotoxic T lymphocyte responses to homologous viral proteins in laboratory workers accidentally infected with HIV-1. J. Clin. Invest. 99:752.[Medline]
  45. Tiilikainen, A., A. Lassus, J. Karvonen, P. Vartiainen, M. Julin. 1980. Psoriasis and HLA-Cw6. Br. J. Dermatol. 102:179.[Medline]
  46. Bhalerao, J., A. M. Bowcock. 1998. The genetics of psoriasis: a complex disorder of the skin and immune system. Hum. Mol. Genet. 7:1537.[Abstract/Free Full Text]
  47. Lekstrom-Himes, J. A., P. Hohman, T. Warren, A. Wald, J. M. Nam, T. Simonis, L. Corey, S. E. Straus. 1999. Association of major histocompatibility complex determinants with the development of symptomatic and asymptomatic genital herpes simplex virus type 2 infections. J. Infect. Dis. 179:1077.[Medline]
  48. Bunce, M., K. I. Welsh. 1994. Rapid DNA typing for HLA-C using sequence-specific primers (PCR-SSP): identification of serological and non-serologically defined HLA-C alleles including several new alleles. Tissue Antigens 43:7.[Medline]
  49. Hashimoto, M., T. Kinoshita, M. Yamasaki, H. Tanaka, T. Imanishi, H. Ihara, Y. Ichikawa, T. Fukunishi. 1994. Gene frequencies and haplotypic associations within the HLA region in 916 unrelated Japanese individuals. Tissue Antigens 44:166.[Medline]
  50. Phillips, R. E., S. Rowland-Jones, D. F. Nixon, F. M. Gotch, J. P. Edwards, A. O. Ogunlesi, J. G. Elvin, J. A. Rothbard, C. R. Bangham, C. R. Rizza, et al 1991. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 354:453.[Medline]
  51. McMichael, A. J., R. E. Phillips. 1997. Escape of human immunodeficiency virus from immune control. Annu. Rev. Immunol. 15:271.[Medline]
  52. Doherty, P. C., R. M. Zinkernagel. 1975. A biological role for the major histocompatibility antigens. Lancet 1:1406.[Medline]
  53. Weidt, G., W. Deppert, O. Utermohlen, J. Heukeshoven, F. Lehmann-Grube. 1995. Emergence of virus escape mutants after immunization with epitope vaccine. J. Virol. 69:7147.[Abstract]
  54. Sidney, J., H. M. Grey, R. T. Kubo, A. Sette. 1996. Practical, biochemical and evolutionary implications of the discovery of HLA class I supermotifs. Immunol. Today 17:261.[Medline]
  55. Hughes, A. L., M. Yeager, M. Carrington. 1996. Peptide binding function and the paradox of HLA disease associations. Immunol. Cell Biol. 74:444.[Medline]
  56. Seki, N., K. Yamaguchi, A. Yamada, S. Kamizono, S. Sugita, C. Taguchi, M. Matsuoka, H. Matsumoto, S. Nishizaka, K. Itoh, M. Mochizuki. 1999. Polymorphism of the 5'-flanking region of the tumor necrosis factor (TNF)-{alpha} gene and susceptibility to human T-cell lymphotropic virus type I (HTLV-I) uveitis. J. Infect. Dis. 180:880.[Medline]
  57. Hamaguchi, K., A. Kimura, N. Seki, T. Higuchi, S. Yasunaga, M. Takahashi, T. Sasazuki, Y. Kusuda, T. Okeda, K. Itoh, T. Sakata. 2000. Analysis of tumor necrosis factor-{alpha} promoter polymorphism in type 1 diabetes: HLA-B and -DRB1 alleles are primarily associated with the disease in Japanese. Tissue Antigens 55:10.[Medline]
  58. Seki, N., S. Kamizono, A. Yamada, T. Higuchi, H. Matsumoto, F. Niiya, A. Kimura, K. Tsuchiya, R. Suzuki, Y. Date, et al 1999. Polymorphisms in the 5'-flanking region of tumor necrosis factor-{alpha} gene in patients with rheumatoid arthritis. Tissue Antigens 54:194.[Medline]
  59. Imanishi, T., T. Akaza, A. Kimura, K. Tokunaga, T. Gojobori. 1992. Allele and haplotype frequencies for HLA and complement loci in various ethnic groups. K. Tsuji, and M. Aizawa, and T. Sasazuki, eds. In HLA 1991 1:1065. Oxford University Press, New York.
  60. Hatta, Y., J. Ohashi, T. Imanishi, H. Kamiyama, M. Iha, T. Simabukuro, A. Ogawa, H. Tanaka, T. Akaza, T. Gojobori, et al 1999. HLA genes and haplotypes in Ryukyuans suggest recent gene flow to the Okinawa Islands. Hum. Biol. 71:353.[Medline]
  61. Kuzushita, N., N. Hayashi, T. Moribe, K. Katayama, T. Kanto, S. Nakatani, T. Kaneshige, T. Tatsumi, A. Ito, K. Mochizuki, et al 1998. Influence of HLA haplotypes on the clinical courses of individuals infected with hepatitis C virus. Hepatology 27:240.[Medline]
  62. Kikuchi, I., A. Ueda, K. Mihara, O. Miyanaga, H. Machidori, E. Ishikawa, K. Tamura. 1998. The effect of HLA alleles on response to interferon therapy in patients with chronic hepatitis C. Eur. J. Gastroenterol. Hepatol. 10:859.[Medline]
  63. Sugiyama, Y., S. Kudoh, H. Maeda, H. Suzaki, F. Takaku. 1990. Analysis of HLA antigens in patients with diffuse panbronchiolitis. Am. Rev. Respir. Dis. 141:1459.[Medline]
  64. Keicho, N., K. Tokunaga, K. Nakata, Y. Taguchi, A. Azuma, M. Bannai, M. Emi, N. Ohishi, Y. Yazaki, S. Kudoh. 1998. Contribution of HLA genes to genetic predisposition in diffuse panbronchiolitis. Am. J. Respir. Crit. Care Med. 158:846.[Abstract/Free Full Text]
  65. Keicho, N., J. Ohashi, G. Tamiya, K. Nakata, Y. Taguchi, A. Azuma, N. Ohishi, M. Emi, M. H. Park, H. Inoko, et al 2000. Fine localization of a major disease-susceptibility locus for diffuse panbronchiolitis. Am. J. Hum. Genet. 66:501.[Medline]
  66. Katsuyama, Y., M. Ota, H. Ando, S. Saito, N. Mizuki, J. Kera, S. Bahram, Y. Nose, H. Inoko. 1999. Sequencing based typing for genetic polymorphisms in exons, 2, 3 and 4 of the MICA gene. Tissue Antigens 54:178.[Medline]
  67. The MHC Sequencing Consortium. 1999. Complete sequence and gene map of a human histocompatibility complex. Nature 401:921.[Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
S. L. Manuel, T. D. Schell, E. Acheampong, S. Rahman, Z. K. Khan, and P. Jain
Presentation of human T cell leukemia virus type 1 (HTLV-1) Tax protein by dendritic cells: the underlying mechanism of HTLV-1-associated neuroinflammatory disease
J. Leukoc. Biol., November 1, 2009; 86(5): 1205 - 1216.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kattan, A. MacNamara, A. G. Rowan, H. Nose, A. J. Mosley, Y. Tanaka, G. P. Taylor, B. Asquith, and C. R. M. Bangham
The Avidity and Lytic Efficiency of the CTL Response to HTLV-1
J. Immunol., May 1, 2009; 182(9): 5723 - 5729.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
B. Woelfing, A. Traulsen, M. Milinski, and T. Boehm
Does intra-individual major histocompatibility complex diversity keep a golden mean?
Phil Trans R Soc B, January 12, 2009; 364(1513): 117 - 128.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. H. Sabouri, K. Usuku, D. Hayashi, S. Izumo, Y. Ohara, M. Osame, and M. Saito
Impaired function of human T-lymphotropic virus type 1 (HTLV-1)-specific CD8+ T cells in HTLV-1-associated neurologic disease
Blood, September 15, 2008; 112(6): 2411 - 2420.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Enose-Akahata, U. Oh, C. Grant, and S. Jacobson
Retrovirally induced CTL degranulation mediated by IL-15 expression and infection of mononuclear phagocytes in patients with HTLV-I-associated neurologic disease
Blood, September 15, 2008; 112(6): 2400 - 2410.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Toulza, A. Heaps, Y. Tanaka, G. P. Taylor, and C. R. M. Bangham
High frequency of CD4+FoxP3+ cells in HTLV-1 infection: inverse correlation with HTLV-1-specific CTL response
Blood, May 15, 2008; 111(10): 5047 - 5053.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. J. Stoffels and H. G. Spencer
An Asymmetric Model of Heterozygote Advantage at Major Histocompatibility Complex Genes: Degenerate Pathogen Recognition and Intersection Advantage
Genetics, March 1, 2008; 178(3): 1473 - 1489.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. Ilmonen, D. J. Penn, K. Damjanovich, L. Morrison, L. Ghotbi, and W. K. Potts
Major Histocompatibility Complex Heterozygosity Reduces Fitness in Experimentally Infected Mice
Genetics, August 1, 2007; 176(4): 2501 - 2508.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Asquith, Y. Zhang, A. J. Mosley, C. M. de Lara, D. L. Wallace, A. Worth, L. Kaftantzi, K. Meekings, G. E. Griffin, Y. Tanaka, et al.
In vivo T lymphocyte dynamics in humans and the impact of human T-lymphotropic virus 1 infection
PNAS, May 8, 2007; 104(19): 8035 - 8040.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
Y.-M. A. Chen, S.-Y. Liang, Y.-P. Shih, C.-Y. Chen, Y.-M. Lee, L. Chang, S.-Y. Jung, M.-S. Ho, K.-Y. Liang, H.-Y. Chen, et al.
Epidemiological and Genetic Correlates of Severe Acute Respiratory Syndrome Coronavirus Infection in the Hospital with the Highest Nosocomial Infection Rate in Taiwan in 2003
J. Clin. Microbiol., February 1, 2006; 44(2): 359 - 365.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. Asquith, A. J. Mosley, A. Barfield, S. E. F. Marshall, A. Heaps, P. Goon, E. Hanon, Y. Tanaka, G. P. Taylor, and C. R. M. Bangham
A functional CD8+ cell assay reveals individual variation in CD8+ cell antiviral efficacy and explains differences in human T-lymphotropic virus type 1 proviral load
J. Gen. Virol., May 1, 2005; 86(5): 1515 - 1523.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. H. Sabouri, M. Saito, K. Usuku, S. N. Bajestan, M. Mahmoudi, M. Forughipour, Z. Sabouri, Z. Abbaspour, M. E. Goharjoo, E. Khayami, et al.
Differences in viral and host genetic risk factors for development of human T-cell lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis between Iranian and Japanese HTLV-1-infected individuals
J. Gen. Virol., March 1, 2005; 86(3): 773 - 781.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Vine, A. G. Heaps, L. Kaftantzi, A. Mosley, B. Asquith, A. Witkover, G. Thompson, M. Saito, P. K. C. Goon, L. Carr, et al.
The Role of CTLs in Persistent Viral Infection: Cytolytic Gene Expression in CD8+ Lymphocytes Distinguishes between Individuals with a High or Low Proviral Load of Human T Cell Lymphotropic Virus Type 1
J. Immunol., October 15, 2004; 173(8): 5121 - 5129.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
F. Umehara, S. Nagatomo, K. Yoshishige, M. Saito, Y. Furukawa, K. Usuku, and M. Osame
Chronic progressive cervical myelopathy with HTLV-I infection: Variant form of HAM/TSP?
Neurology, October 12, 2004; 63(7): 1276 - 1280.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. R. M. Bangham
The immune control and cell-to-cell spread of human T-lymphotropic virus type 1
J. Gen. Virol., December 1, 2003; 84(12): 3177 - 3189.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. K. C. Goon, T. Igakura, E. Hanon, A. J. Mosley, B. Asquith, K. G. Gould, G. P. Taylor, J. N. Weber, and C. R. M. Bangham
High Circulating Frequencies of Tumor Necrosis Factor Alpha- and Interleukin-2-Secreting Human T-Lymphotropic Virus Type 1 (HTLV-1)-Specific CD4+ T Cells in Patients with HTLV-1-Associated Neurological Disease
J. Virol., September 1, 2003; 77(17): 9716 - 9722.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
J J Z. Imirizaldu, J C G. Esteban, I R. Axpe, T P. Concha, F V. Juanes, I A. Susaeta, and J M C. Carranceja
Post-transplantation HTLV-1 myelopathy in three recipients from a single donor
J. Neurol. Neurosurg. Psychiatry, August 1, 2003; 74(8): 1080 - 1084.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Penn, K. Damjanovich, and W. K. Potts
MHC heterozygosity confers a selective advantage against multiple-strain infections
PNAS, August 20, 2002; 99(17): 11260 - 11264.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. C. M. Boon, G. de Mutsert, Y. M. F. Graus, R. A. M. Fouchier, K. Sintnicolaas, A. D. M. E. Osterhaus, and G. F. Rimmelzwaan
The Magnitude and Specificity of Influenza A Virus-Specific Cytotoxic T-Lymphocyte Responses in Humans Is Related to HLA-A and -B Phenotype
J. Virol., January 15, 2002; 76(2): 582 - 590.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeffery, K. J. M.
Right arrow Articles by Bangham, C. R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeffery, K. J. M.
Right arrow Articles by Bangham, C. R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS