|
|
||||||||



*
Department of Immunology, Imperial College School of Medicine, St. Marys, London, United Kingdom;
Oxford Transplant Centre, Nuffield Department of Surgery, Churchill Hospital, Oxford, United Kingdom;
Princeton Institute for Advanced Study, Princeton, NJ 08540;
§
Division of Molecular Pathology, Centre for Chronic Viral Diseases,
¶
Department of Medical Informatics, and
||
Third Department of Internal Medicine, Faculty of Medicine, Kagoshima University, Kagoshima, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
95% remain healthy carriers (HCs), 23% develop HAM/TSP,
and another 12% develop an aggressive adult T cell leukemia. The
factors that cause these different manifestations of HTLV-I infection
are not yet fully understood. The immune response to the virus is
characterized by a chronically activated CTL response in most infected
people, and a strong Ab response. The CTL response is directed mainly
at the HTLV-I protein Tax, a powerful transactivator of viral
transcription (1, 2, 3). Tax also transactivates many
host cell genes, for example, IL-2 and IL-2 receptor (4, 5). A major risk factor for HAM/TSP is the proviral load; the
median proviral load is 16 times higher in HAM/TSP patients than in HCs
(6). A high HTLV-I proviral load is also associated with
an increased risk of progression to disease (6, 7).
However, we have suggested that CTLs might be able to limit replication
of the virus and so determine the provirus load and the risk of
proinflammatory disease (8, 9).
It is possible that HTLV-I-specific CTLs exert both protective and
inflammatory effects. There is a precedent for this in influenza virus
infection in the mouse, where the anti-influenza CTL protected
against disease after a low dose of virus, but exacerbated viral
pathology at a high dose (10). There is also evidence that
HTLV-I-specific CTL could contribute to the inflammation seen in
HAM/TSP. Inflammatory cytokines and chemokines, including IFN-
and
TNF, are produced by the frequent HTLV-I-specific
CD8+ T cells in peripheral blood and in spinal
cord lesions (11, 12, 13, 14). Such CD8+ T
cells could cause bystander damage to cells in the CNS (11, 15).
However, frequent and chronically activated HTLV-I-specific CTLs have been found in HCs as well as in HAM/TSP patients (2, 16, 17, 18). We suggested that CTLs were protective in HCs because the tax gene, which encodes the dominant CTL target Ag (1, 2, 3), was subject to positive selection in these individuals (19). Recently we have shown that freshly isolated, naturally infected CD4+ cells capable of expressing Tax were rapidly killed by virus-specific CTLs in vitro using a perforin-dependent mechanism. This is consistent with the view that the CTLs efficiently destroy HTLV-I-infected cells in vivo and so protect against inflammatory diseases such as HAM/TSP (20).
Host genetic factors are major determinants of susceptibility to
infectious disease (21); the HLA complex plays a
particularly important role. We have taken an interest in HLA class I
associations with HTLV-I-associated diseases because of the presence of
a powerful CTL response in HTLV-I infection. Previous HLA studies in
HTLV-I infection have found an association between DRB1*0101
and other genes on the
HLA-B*0702-Cw*0702-DRB1*0101-DQB1*0501 haplotype and
susceptibility to HAM/TSP in the Japanese population
(22, 23, 24). In a recent case-control study, we showed that
the MHC class I gene HLA-A*02 conferred protection from
HAM/TSP; possession of HLA-A*02 halved the odds of HAM/TSP
for a person infected with HTLV-I, and the A*02 allele
prevented
28% of potential cases in the study population
(18). These observations suggested that
A*02-restricted CTL are particularly efficient at
recognizing Tax, and we found that A*02-positive HCs had a
provirus load one-third that of A*02-negative carriers
(18). Furthermore, the increased susceptibility to HAM/TSP
associated with the DRB1*0101 haplotype was evident only in
A*02-negative subjects. Therefore, we conclude that host
genetic factors do indeed influence both a persons provirus load and
the risk of HAM/TSP.
The first aim of this study was to examine the frequency of class I
alleles in the study population that showed a suggestive difference
between patients and controls (0.05 < 2p
0.10;
where 2p denotes probability value in a two-tailed test) in
our initial study (Cw*08, A*11). Because the class
I-restricted T cell response appears to play an important part in
deciding the outcome of HTLV-1 infection, we also wished to test the
hypothesis that heterozygosity at HLA class I loci is protective in
HTLV-I infection. An individual who has two different alleles at each
HLA locus can present a wider repertoire of antigenic peptides to the
CTL than a homozygote. This could result in a more efficient CTL
response to HTLV-I, a lower proviral load, and a lower risk of
disease. Heterozygote advantage has recently been demonstrated in HIV
(for class I loci) (25, 26) and hepatitis B infection (for
class II loci) (27).
Our results show that HLA-Cw*08 protects against HAM/TSP and is associated with an almost 4-fold reduction in provirus load. The Cw*08 effect was independent of and additive to the A*02 effect shown previously. HLA-B*5401 was associated with an increase in the risk of disease and a higher provirus load in HAM/TSP patients. The protective effect of A*02 seen previously had no effect on the susceptibility to HAM/TSP associated with B*5401. The results also demonstrate a significant effect of HLA class I heterozygosity; HAM/TSP patients heterozygous at all three class I loci had a lower proviral load than individuals homozygous at one or more class I loci.
| Materials and Methods |
|---|
|
|
|---|
Two hundred thirty-three cases of HAM/TSP were compared with 202 randomly selected HTLV-I-seropositive asymptomatic blood donors (HCs) from the Kagoshima Red Cross Blood Transfusion Service. All cases and controls were of Japanese ethnic origin and resided in Kagoshima Prefecture, Japan. The diagnosis of HAM/TSP was made according to World Health Organization diagnostic criteria (28).
HLA class I typing
A staged study was performed. In stage 1, 100 cases of HAM/TSP
and 100 HCs were studied. In the first 50 cases and 56 controls,
PCR-sequence-specific primer (PCR-SSP) reactions were performed to
detect all known HLA-A, -B, and -C specificities in an allele- or
group-specific manner (96 reactions) (29). The remaining
50 cases and 44 controls were typed with a restricted set of 48 PCR-SSP
reactions designed to detect all the HLA-A, -B, and -C specificities
that 1) occurred at a gene frequency of
5%, or 2) were associated
with an odds ratio (OR) of HAM/TSP of
0.5 or
2.0 in the first 50
cases and 56 controls. The results of this initial study, which showed
that HLA-A*02 is associated with disease protection, and the
haplotype B*0702-Cw*0702-DRB1*0101-DQB1*0501 is associated
with susceptibility, have already been published (18).
Stage 2 of the study was designed to test the hypotheses that 1)
further class I alleles and 2) HLA class I heterozygosity are
associated with protection against HAM/TSP or a reduction in provirus
load. We chose to restrict the analysis of the further class I typing
to those alleles that showed a suggestive difference in frequency
(0.05 < 2p
0.10) in stage 1 and those in
linkage disequilibrium with alleles associated with disease
protection/susceptibility.
HLA heterozygosity study
To determine the heterozygosity in the HLA loci, we conducted a complete HLA class I typing on each subject. Initially, a reduced number of PCR-SSP reactions were performed, as above, to detect all the common alleles. Then, at any class I locus that appeared to be homozygous from the stage 1 or 2 study, the class I HLA typing was completed at each locus to detect the rarer alleles. For the purposes of the heterozygosity study, each locus was studied to the type level only (e.g., HLA-A*02 rather than HLA-A*0201). We compared the HAM/TSP risk and proviral load between individuals who were heterozygous at all three class I loci and those who were homozygous at one or more loci. The power of statistical tests of heterozygosity at individual class I loci was limited by the small number of subjects involved.
Class I subtyping
Following an initial analysis of our results, PCR-SSP reactions were designed to differentiate Cw*0801 from Cw*0803/0806 (30), B*4006 from B*4002, and B*5401 from B*5507. The design of SSPs was based on published gene sequences (31) updated from HLA informatics pages available on the internet (http://www.anthonynolan.com/HIG/index.html). PCR methods were as previously described (29).
Class II typing
DRB1 and DQB1 typing was performed as previously described (18).
Detection of single nucleotide polymorphisms in the TNF-
promoter region
A 314-bp fragment of the TNF-
5' flanking region
(incorporating the T-1031C, C-863A, and C-857T single nucleotide
polymorphism (SNP) sites (32), was amplified by primary
PCR (primers 5' agggatatgtgatggactcac; 5' tattccatacctggaggtcc,
designed in house) (GenBank accession number M16441) and sequenced
using dRhodamine terminator chemistry (Perkin-Elmer, Norwalk, CT) on an
automated DNA sequencer (ABI 377; Perkin-Elmer). A total of 209 HAM/TSP
patients and 195 HCs were screened.
Proviral load measurement
The HTLV-I provirus load in PBMC was measured at one time point in all patients and HCs, as described elsewhere (6, 18). A quantitative PCR was performed using an ABI 7700 sequence detector (Perkin-Elmer). The lower limit of detection was one copy of HTLV-I (tax) per 104 PBMC.
Statistical analysis
The
2 test, Mann-Whitney U
test, and the OR (GraphPad, San Diego, CA) were used for statistical
analysis. Where the number of observations was <20 in any category,
Fishers Exact test was used for a 2 x 2 table. The Bonferroni
method (33) was used to correct for multiple comparisons.
The prevented fraction of disease (Fp), i.e., the fraction of potential
cases of disease in the study population that is prevented by a
specified factor, was calculated as previously described
(18). The population attributable risk, i.e., the fraction
of observed cases of disease that is attributable to a specified
factor, was calculated according to Schlesselman (34). To
calculate the risk of HAM/TSP at a given proviral load, Bayes theorem
of conditional probabilities was used, as detailed in Bangham et al.
(8). For clarity, probability levels are cited as follows:
2p denotes the results of two-tailed tests, and p
denotes a one-tailed test (e.g., 2p = 0.002).
| Results |
|---|
|
|
|---|
HLA-Cw*08 was associated with a lower risk of HAM/TSP and a lower proviral load
Alleles selected from stage 1 for stage 2 of the study were
Cw*08 (2p = 0.087, OR = 0.42, 95%
confidence interval (CI) = 0.171.04) (Table I
) and A*11
(2p = 0.09, OR = 2.07, 95% CI = 0.964.45).
It was necessary to confirm these associations not only because of the
large number of alleles tested for, but because they were not
significant at p < 0.05. We proceeded to test these
associations in an independent sample. The excess of
A*11-positive subjects seen in the HAM/TSP subjects in stage
1 was not maintained in stage 2 or in the cohort as a whole (45 of 233
HAM/TSP A*11+; 31 of 202 HCs
A*11+, 2p = 0.33). However,
in the second stage of the study, and overall, the genotype frequency
of HLA-Cw*08 was significantly lower among the cases of
HAM/TSP compared with the controls (Table I
). The possession of
HLA-Cw*08 was associated with a >2-fold reduction in the
odds of HAM/TSP (2p = 0.002, OR = 0.42, 95%
CI = 0.250.73). Given this OR and the observed frequency of
Cw*08 in Kagoshima, we can estimate the proportion of potential cases
of HAM/TSP that are prevented by the presence of Cw*08 (the Fp; Ref.
18). Here, Fp = 12.6% (±3.7% SD). We then tested
the hypothesis that if a gene is associated with protection from
disease, it is also associated with a reduction in provirus load in HCs
of the virus, as the risk of developing disease is dependent on the
provirus load (6, 7). There was a significant reduction in
median provirus load of almost 4-fold associated with Cw*08
in the HCs (2p = 0.046, Mann-Whitney U
statistic) (Table II
).
|
|
The protective effect of Cw*08 was independent of and additive to the effect of A*02
Three lines of evidence suggest that the effect of
HLA-Cw*08 was independent of and additive to those of
A*02: 1) A*02 and Cw*08 were not in
significant linkage disequilibrium in the HCs (data not shown); 2)
Cw*08 reduced the odds of disease in
A*02-negative subjects (2p = 0.013) (Table III
) and A*02 reduced the odds
of disease in Cw*08-negative subjects (2p <
0.0001, OR = 0.41, 95% CI = 0.260.63) (data not shown);
and 3) Cw*08 was associated with a >3-fold reduction in
median provirus load in both A*02-positive and -negative HCs
using the Mann-Whitney U statistic (median proviral load in
A*02-positive subjects: Cw*08+
6.0 and Cw*08- 25.7
copies/104 PBMC, p = NS;
A*02-negative subjects: Cw*08+
15.8 and Cw*08- 53.7
copies/104 PBMC, p =
NS).
|
HLA-Cw*08 has been reported to be in linkage disequilibrium in the Japanese population with A*02, A*2402, A*2601, and B*48, and with the haplotype B*4006-DRB1*0901-DQB1*0303-DPB1*0201 (35, 36). In this study we found Cw*08 to be in significant linkage disequilibrium in both the HAM/TSP and HC populations with A*26, B*48, B*4006, DRB1*0901, and DQB1*0303 (data not shown). HLA-B*48 was associated with a reduction in the odds of HAM/TSP (2p = 0.037, corrected p-NS, OR = 0.39). However, there was no effect of B*48 on provirus load in HCs. Cw*08 was found more frequently than B*48, and B*48 occurred in only three HAM/TSP patients and no HCs in the absence of Cw*08. We conclude that the association of B*48 with disease protection is due to its strong linkage disequilibrium with Cw*08. Other alleles found to be in linkage disequilibrium in this population had no effect on the odds of disease either by themselves or in association with Cw*08.
Heterozygosity at HLA class I loci was associated with a lower proviral load of HTLV-I
We hypothesized that individuals who were heterozygous at all
three HLA class I loci would have a lower provirus load than
individuals who were homozygous at one or more loci, and this was
indeed the case in the HAM/TSP patients (2p = 0.017,
Mann-Whitney U statistic) (Table IV
). In the HCs the proviral load was
significantly lower in association with full heterozygosity only at a
one-tailed level (p = 0.039, Mann-Whitney
U statistic) (Table IV
). In addition, homozygosity at the
HLA-C locus was associated with a higher provirus load in the HAM/TSP
patients (proviral load: heterozygous at HLA-C 530.9
copies/104 PBMC, homozygous at HLA-C 861.0
copies/104 PBMC, 2p = 0.018,
Mann-Whitney U statistic). The effect of class I
heterozygosity on proviral load was too small to have a significant
effect on odds of HAM/TSP (p = NS, OR =
0.98).
|
In a parallel study of non-HLA candidate genes in the development
of HAM/TSP we identified a suggestive increase in the frequency of
HAM/TSP patients carrying the TNF -857T allele
(p = 0.08, OR = 1.46, 95% CI 0.982.19).
The results from the analysis of the other TNF promoter polymorphisms
will be presented separately (C. Bangham, A. Vine, A. Witkover, Y.
Furukawa, A. Lloyd, K. Jeffery, A. Siddiqui, K. Usuku, and M. Osame.
Manuscript in preparation). TNF -857T is in
linkage disequilibrium with B*5401 and DRB1*0405
in the Japanese (32) (extended haplotype
A*2402-Cw*0102-B*5401- DRB1*0405-DQB1*0401; Ref.
36). Therefore, we examined the alleles in linkage
disequilibrium with TNF -857T. B*5401
was significantly associated with disease susceptibility
(2p = 0.0003 uncorrected, OR = 2.51) (Table V
). A correction factor of 48 was applied
to the p value for B*5401 to reflect the number
of alleles tested for, to avoid artifacts due to multiple comparisons
(33); the p value remains significant at
2p = 0.014. None of the other alleles in the extended
haplotype described above had a significant association with disease
(for A*24: 2p = 0.145; Cw*01:
2p = 0.150; DRB1*0405: 2p =
0.289; DQB1*0401: 2p = 0.123). The
population-attributable risk of B*5401, i.e., the fraction
of cases of HAM/TSP that were attributable to B*5401, was
16.8% (95% CI = 8.324.4%). Table V
also shows that
B*5401 was associated with disease susceptibility in both
HLA-A*02-positive and HLA-A*02-negative
populations. Conversely, A*02 was not associated with
disease protection in the B*5401-positive population, but
remained highly significantly associated in the
B*5401-negative population (2p =
0.0001).
|
|
B*5401 was associated with a higher risk of HAM/TSP at a given HTLV-I load
The data on provirus load can be used to calculate the risk
(prevalence) of HAM/TSP at a given provirus load (Fig. 1
). As can be seen from Fig. 1
, at a
given provirus load, possession of HLA-B*5401 appeared to
increase the risk of developing HAM/TSP.
|
| Discussion |
|---|
|
|
|---|
The level of HLA-C expression on the cell surface is
10% of the
level of expression of HLA-A and -B (39), and the
nonsynonymous nucleotide substitution rate in the peptide binding
region of HLA-C has also been reported to be lower in HLA-C than in
HLA-A or -B (40). However, several naturally occurring
HLA-C-restricted CTL responses directed against viral Ags, in
particular HIV, have been described (41, 42), including an
HLA-C-restricted immunodominant CTL response (43) and
Cw8-restricted CTL clones (44). In addition, HLA-C disease
associations have been found, the most significant being the
association of Cw*06 with psoriasis (45, 46),
but there have been few clear demonstrations of HLA-C associations with
infectious disease (25, 47). The development of molecular
typing methods for HLA-C alleles (30, 48) has recently
overcome the difficulties of detecting the serologically blank HLA-C
alleles, and it is now clear that HLA-C locus heterozygosity can be as
high as HLA-A locus heterozygosity (36). Therefore, it is
likely that HLA-C contributes significantly to protection against
certain viral infections. Our data show a higher provirus load in
association with homozygosity at the HLA-C locus in HAM/TSP patients;
this argues for an important role of HLA-C in Ag presentation. Why did
we not detect an association between HLA-C and disease protection in
stage I of the study? The Fp associated with HLA-Cw*08
(12.6%) was less than half of that seen in association with
HLA-A*02 (28.2%) (18). This is because
Cw*08 has a lower gene frequency than A*02 in the
Japanese population (35, 36, 49). The reduced odds of
disease seen in association with Cw*08 and A*02
were of the same magnitude (OR = 0.42 and 0.43, respectively).
Possession of Cw*08 reduced the risk of HAM/TSP in the Japanese HTLV-I-infected population in a way that is both additive to, and independent of, the protective effect of HLA-A*02. In addition, Cw*08 and A*02 were each independently associated with a reduction in provirus load in the asymptomatic carriers of the virus. The likely explanation for this effect with A*02 is that HTLV-I-infected lymphocytes are efficiently recognized by A2-restricted CTL and eliminated (18). We propose that the protective effects of Cw*08 are mediated by a similar mechanism. Experiments are in progress to define the epitopes of the HTLV-I Ags presented by Cw*08.
In this study, we tested the hypothesis that class I HLA heterozygosity is beneficial in HTLV-I infection. The class I-restricted T cell response exerts selection pressure on the viral population, which mutates rapidly; successive mutations may lead to eventual escape from effective immune control (50, 51). Therefore, heterozygosity at the class I loci, which allows a broader CTL response to develop (52), may allow a more effective CTL control of viral replication (25) and delay the development of CTL escape mutants (53). The results presented here show that in both asymptomatic carriers (one-tailed level of significance) and HAM/TSP patients, individuals who are fully heterozygous at HLA class I loci had a significantly lower provirus load than individuals homozygous at one or more class I loci. HLA class I heterozygosity was not significantly associated with protection from disease in this study but this may have been due to limitations on sample size. Logistic regression analysis (data not shown) confirmed that individuals who were fully heterozygous at HLA class I loci had a significantly lower provirus load, even after the effects of HLA-A*02 and Cw*08 are accounted for. The analysis of heterozygosity in this study was performed at the HLA type level, rather than at the subtype or allele level, because HLA subtypes bind and present to immune effector cells a broadly similar range of epitopes. Also, there is increasing evidence that certain apparently unrelated MHC proteins have very similar specificities in terms of the main anchor residues of their peptide ligands, and it is possible to place up to 70% of HLA-A and -B alleles into one of four HLA supertypes: A2, A3, B7, and B44 (54). Further grouping of alleles in functional categories based on shared peptide binding regions may increase success in searching for disease associations (55).
Many polymorphic loci might influence susceptibility to HAM/TSP. TNF is a strong candidate gene because the expression of this proinflammatory cytokine is induced by HTLV-I Tax protein (56). In this study there was a nonsignificant increase in the frequency of individuals with HAM/TSP carrying the TNF -857T allele. Other groups have observed that apparent TNF -857T associations with diabetes mellitus or rheumatoid arthritis are better accounted for by alleles in linkage disequilibrium with TNF -857T, namely, B*5401 and DRB1*0405 (57, 58).
In this study B*5401 was significantly associated with susceptibility to HAM/TSP, and none of the other loci in the haplotype described in Results was significantly associated with disease. HLA-B*5401 is found almost exclusively in East Asians (59). Hatta et al. (60) have recently suggested that this B*54-associated haplotype is particularly common in the Ryukyuan population, who form one of the important ancestral populations of Okinawa and Kyushu in Southern Japan. Associations have also been described between B*5401 and other inflammatory conditions in Japan, including hepatitis C (61, 62) and diffuse panbronchiolitis (63, 64). The HLA-associated susceptibility gene associated with diffuse panbronchiolitis has been mapped to a 200-kb region, 300 kb telomeric of the HLA-B locus (65). As well as the described linkage disequilibrium with TNF -857T, B*5401 is also known to be in linkage disequilibrium with the centromeric MHC class I chain-related gene A (MICA) allele MICA*012 in the Japanese population (66). The recent publication of the complete sequence and gene map of the MHC revealed only pseudogenes in the 46-kB region between HLA-B and MICA (67). Therefore, it will be necessary to test the hypothesis that the effects associated with B*5401 in HTLV-I infection are due to MICA polymorphisms.
Our data (Table VI
) show that B*5401 was associated with a
higher proviral load in HAM/TSP patients and that it abolished the
A*02-associated reduction in provirus load in HCs
(18). However, even after the proviral load was taken into
account, B*5401 appeared to be associated with a
significantly increased risk of HAM/TSP (Fig. 1
). Thus,
B*5401 appeared to increase the risk of HAM/TSP both
through an effect on provirus load and through an additional effect
that is independent of provirus load. The susceptibility to HAM/TSP
associated with B*5401 appeared to overcome the protective
effect associated with A*02, and the reduction in provirus
load associated with A*02 in HCs was only seen in the
B*5401-negative population. These observations suggest that
the B*5401-associated susceptibility effect was dominant
over the A*02-associated protective effect. The reason for
the association between B*5401 and HAM/TSP remains
uncertain. Because the B*5401-containing haplotype is also
associated with a number of other inflammatory conditions (see above),
which are not necessarily associated with HTLV-I infection, we suggest
that B*5401 or a closely linked gene contributes to
inflammation in an Ag-nonspecific manner.
Although the observed differences in proviral load associated with the
presence of individual HLA alleles in this study were statistically
significant, and in the direction consistent with their effects on the
risk of HAM/TSP, the differences between the median values are
sometimes small (Tables II
, IV
, and VI
). However, the median proviral
load in HAM/TSP patients was only 16-fold higher than that of HCs
(6) and logistic regression analysis (A. L. Lloyd,
unpublished data) shows that the 4-fold reduction in proviral load
associated with HLA-Cw*08 is associated with a 2.4-fold
reduction in the odds of HAM/TSP, in close agreement with the OR
calculation (Table I
). The proviral load differences associated with
B*5401 (Table VI
) are smaller, therefore the biological
significance is less clear. However, because the risk of HAM/TSP rises
rapidly when the proviral load exceeds an apparent threshold of
1
copy per 100 PBMCs (6), a small rise in load might be
accompanied by a substantial increase in the risk of HAM/TSP.
In conclusion, we have now found three class I alleles to be independently associated with development of HAM/TSP, two associated with protection (A*02 and Cw*08) and one with susceptibility (B*5401), and a susceptibility haplotype (Cw*0702-B*0702-DRB1*0101-DQB1*0501) within which DRB1*0101 appears to have the strongest effect (18). Furthermore, we have demonstrated an effect of HLA class-I heterozygosity in lowering provirus load, which is known to be an important factor in the risk of developing disease. These associations may not be replicated in other populations whose HLA frequencies differ from those in this Japanese population; for example, B*5401 occurs almost exclusively in East Asian populations. However, A*02 was also significantly associated with a lower prevalence of HAM/TSP in a small population of Afro-Caribbean origin in London (18). Other genetic factors that are important in the immune response to viruses may also be important in influencing the outcome of HTLV-I infection. The pathogenesis of HAM/TSP remains unknown, but these data on the association of HLA class I alleles with disease susceptibility/protection favor the interpretation that a strong CTL response in HTLV-I infection is beneficial.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 K.J.M.J. and A.A.S. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Charles R. M. Bangham, Department of Immunology, Imperial College School of Medicine, St. Marys, Norfolk Place, London, W2 1PG, U.K. ![]()
4 Abbreviations used in this paper: HTLV-I, human T cell lymphotropic virus type I; HAM/TSP, HTLV-I associated myelopathy/tropical spastic paraparesis; HCs, healthy carriers; OR, odds ratio; 2p, probability value, two-tailed test; CI, confidence interval; Fp, prevented fraction of disease; SSP, sequence-specific primer; MICA, MHC class I chain-related gene A. ![]()
Received for publication May 15, 2000. Accepted for publication September 21, 2000.
| References |
|---|
|
|
|---|
on peripheral blood mononuclear cells in HTLV-I tax/rex mRNA-positive asymptomatic carriers. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 15:70.[Medline]
gene in Japanese. Tissue Antigens 51:605.[Medline]
gene and susceptibility to human T-cell lymphotropic virus type I (HTLV-I) uveitis. J. Infect. Dis. 180:880.[Medline]
promoter polymorphism in type 1 diabetes: HLA-B and -DRB1 alleles are primarily associated with the disease in Japanese. Tissue Antigens 55:10.[Medline]
gene in patients with rheumatoid arthritis. Tissue Antigens 54:194.[Medline]
This article has been cited by other articles:
![]() |
T. Kattan, A. MacNamara, A. G. Rowan, H. Nose, A. J. Mosley, Y. Tanaka, G. P. Taylor, B. Asquith, and C. R. M. Bangham The Avidity and Lytic Efficiency of the CTL Response to HTLV-1 J. Immunol., May 1, 2009; 182(9): 5723 - 5729. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Woelfing, A. Traulsen, M. Milinski, and T. Boehm Does intra-individual major histocompatibility complex diversity keep a golden mean? Phil Trans R Soc B, January 12, 2009; 364(1513): 117 - 128. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Sabouri, K. Usuku, D. Hayashi, S. Izumo, Y. Ohara, M. Osame, and M. Saito Impaired function of human T-lymphotropic virus type 1 (HTLV-1)-specific CD8+ T cells in HTLV-1-associated neurologic disease Blood, September 15, 2008; 112(6): 2411 - 2420. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Enose-Akahata, U. Oh, C. Grant, and S. Jacobson Retrovirally induced CTL degranulation mediated by IL-15 expression and infection of mononuclear phagocytes in patients with HTLV-I-associated neurologic disease Blood, September 15, 2008; 112(6): 2400 - 2410. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Toulza, A. Heaps, Y. Tanaka, G. P. Taylor, and C. R. M. Bangham High frequency of CD4+FoxP3+ cells in HTLV-1 infection: inverse correlation with HTLV-1-specific CTL response Blood, May 15, 2008; 111(10): 5047 - 5053. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Stoffels and H. G. Spencer An Asymmetric Model of Heterozygote Advantage at Major Histocompatibility Complex Genes: Degenerate Pathogen Recognition and Intersection Advantage Genetics, March 1, 2008; 178(3): 1473 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ilmonen, D. J. Penn, K. Damjanovich, L. Morrison, L. Ghotbi, and W. K. Potts Major Histocompatibility Complex Heterozygosity Reduces Fitness in Experimentally Infected Mice Genetics, August 1, 2007; 176(4): 2501 - 2508. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Asquith, Y. Zhang, A. J. Mosley, C. M. de Lara, D. L. Wallace, A. Worth, L. Kaftantzi, K. Meekings, G. E. Griffin, Y. Tanaka, et al. In vivo T lymphocyte dynamics in humans and the impact of human T-lymphotropic virus 1 infection PNAS, May 8, 2007; 104(19): 8035 - 8040. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. A. Chen, S.-Y. Liang, Y.-P. Shih, C.-Y. Chen, Y.-M. Lee, L. Chang, S.-Y. Jung, M.-S. Ho, K.-Y. Liang, H.-Y. Chen, et al. Epidemiological and Genetic Correlates of Severe Acute Respiratory Syndrome Coronavirus Infection in the Hospital with the Highest Nosocomial Infection Rate in Taiwan in 2003 J. Clin. Microbiol., February 1, 2006; 44(2): 359 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Asquith, A. J. Mosley, A. Barfield, S. E. F. Marshall, A. Heaps, P. Goon, E. Hanon, Y. Tanaka, G. P. Taylor, and C. R. M. Bangham A functional CD8+ cell assay reveals individual variation in CD8+ cell antiviral efficacy and explains differences in human T-lymphotropic virus type 1 proviral load J. Gen. Virol., May 1, 2005; 86(5): 1515 - 1523. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Sabouri, M. Saito, K. Usuku, S. N. Bajestan, M. Mahmoudi, M. Forughipour, Z. Sabouri, Z. Abbaspour, M. E. Goharjoo, E. Khayami, et al. Differences in viral and host genetic risk factors for development of human T-cell lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis between Iranian and Japanese HTLV-1-infected individuals J. Gen. Virol., March 1, 2005; 86(3): 773 - 781. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Vine, A. G. Heaps, L. Kaftantzi, A. Mosley, B. Asquith, A. Witkover, G. Thompson, M. Saito, P. K. C. Goon, L. Carr, et al. The Role of CTLs in Persistent Viral Infection: Cytolytic Gene Expression in CD8+ Lymphocytes Distinguishes between Individuals with a High or Low Proviral Load of Human T Cell Lymphotropic Virus Type 1 J. Immunol., October 15, 2004; 173(8): 5121 - 5129. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Umehara, S. Nagatomo, K. Yoshishige, M. Saito, Y. Furukawa, K. Usuku, and M. Osame Chronic progressive cervical myelopathy with HTLV-I infection: Variant form of HAM/TSP? Neurology, October 12, 2004; 63(7): 1276 - 1280. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. M. Bangham The immune control and cell-to-cell spread of human T-lymphotropic virus type 1 J. Gen. Virol., December 1, 2003; 84(12): 3177 - 3189. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. C. Goon, T. Igakura, E. Hanon, A. J. Mosley, B. Asquith, K. G. Gould, G. P. Taylor, J. N. Weber, and C. R. M. Bangham High Circulating Frequencies of Tumor Necrosis Factor Alpha- and Interleukin-2-Secreting Human T-Lymphotropic Virus Type 1 (HTLV-1)-Specific CD4+ T Cells in Patients with HTLV-1-Associated Neurological Disease J. Virol., September 1, 2003; 77(17): 9716 - 9722. [Abstract] [Full Text] [PDF] |
||||
![]() |
J J Z. Imirizaldu, J C G. Esteban, I R. Axpe, T P. Concha, F V. Juanes, I A. Susaeta, and J M C. Carranceja Post-transplantation HTLV-1 myelopathy in three recipients from a single donor J. Neurol. Neurosurg. Psychiatry, August 1, 2003; 74(8): 1080 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Penn, K. Damjanovich, and W. K. Potts MHC heterozygosity confers a selective advantage against multiple-strain infections PNAS, August 20, 2002; 99(17): 11260 - 11264. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. M. Boon, G. de Mutsert, Y. M. F. Graus, R. A. M. Fouchier, K. Sintnicolaas, A. D. M. E. Osterhaus, and G. F. Rimmelzwaan The Magnitude and Specificity of Influenza A Virus-Specific Cytotoxic T-Lymphocyte Responses in Humans Is Related to HLA-A and -B Phenotype J. Virol., January 15, 2002; 76(2): 582 - 590. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |