| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
*
Department of Pathology, University of Pennsylvania School of Dental Medicine, Philadelphia, PA 19104; and Departments of
Medicine and
Immunology, Duke University Medical Center, Durham, NC 27710
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
activation, mitgen-activated protein kinase
kinase-mediated ERK phosphorylation, and calcineurin-mediated
activation of NFAT. Furthermore, fMLP, but not C5a, stimulated NFAT
activation in HMC-1 cells. These data indicate that chemoattractant
receptors induce chemokine production in HMC-1 cells with a selectivity
that depends on the level of receptor expression, the length of their
signaling time, and the synergistic interaction of multiple signaling
pathways, including extracellular signal-regulated kinase
phosphorylation, sustained Ca2+ mobilization and NFAT
activation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The signaling pathways and biological responses activated by fMLP and
C5a receptors (FR and C5aR) have been studied in the most detail in
human neutrophils. However, very little information is available on the
signaling pathways activated by C3aR. In neutrophils, both FR and C5aR
couple to the same pertussis toxin (ptx)-sensitive G proteins to
activate similar biological responses, such as superoxide generation
and the release of proteolytic enzymes (3, 6, 7). The
biochemical events that follow FR and C5aR activation in neutrophils
include the activation of phospholipase C, phosphoinositol 3-kinase
(PI3 kinase), increased association of Src family of protein kinases
with p21ras, and activation of p42/p44
mitogen-activated protein kinases (MAPK), known as extracellular
signal-regulated kinases (ERKs) (6, 8, 9). The
transcription factor NF-
B is activated by fMLP and C5a in
neutrophils, and this activation is associated with IL-8 production
(4, 5). The transcription factor NFAT regulates the
activation of cytokine genes in Ag-stimulated T cells and mast cells
(10, 11). Whether NFAT is activated by GPCR in leukocytes
and what biological response it performs are not known.
The purpose of the present study was to determine whether GPCRs could activate the production of cytokines and to delineate the signaling pathways involved in this process. We have used a human mast cell line, HMC-1 cells, which is a rich source of chemokines (12), as a model for GPCR activation. Although this cell line natively expresses C3aR and C5aR at low levels, it does not express FR. Therefore, we developed this cell line to stably express physiologic levels of FR. We found that fMLP stimulated a sustained Ca2+ mobilization, whereas the responses to C3a or C5a were transient. Using this system, we demonstrate that fMLP induces the expression and release of the chemokines macrophage inflammatory protein (MIP)-1ß and monocyte chemoattractant protein (MCP)-1. Furthermore, we have dissected the signaling pathways activated by GPCRs in HMC-1 cells and made the novel observations that their ability to stimulate chemokine production depends on the level of receptor expression, the length of signaling time, and the synergistic interaction of ERK phosphorylation, sustained Ca2+ mobilization and NFAT activation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
FMLP, wortmannin, bisindolylmaleimide (GF 109203X), PD98059,
fluphenazine, and A23187 were purchased from Calbiochem (La Jolla, CA).
[3H]fMLP (53.6 Ci/mmol) was obtained from New
England Nuclear (Boston, MA). [
-32P]ATP was
purchased from ICN Radiochemicals (Irvine, CA). Recombinant C5a and
8-(4-chlorophenylthio)-cAMP (cpt-cAMP) were purchased from Sigma (St.
Louis, MO). PMA, indo-1/AM, and pluoronic acid were obtained from
Molecular Probes (Eugene, OR). Rabbit anit-ERK-1, anti-ERK-2, and
anti-phospho-Elk-1 Abs were obtained from Santa Cruz Biotechnology
(Santa Cruz, CA), and rabbit anti-phospho-ERK Ab was purchased from
New England Biolabs (Beverly, MA). 12CA5 Ab was obtained from Roche
(Indianapolis, IN). Purified C3a was obtained from Advanced Research
Technologies (San Diego, CA). The ptx was obtained from List
Biologicals (Campbell, CA). The ECL Western blotting analysis kit was
purchased from Amersham (Arlington Heights, IL). All tissue culture
reagents were purchased from Life Technologies (Gaithersburg,
MD).
Cell culture and transfection
The human mast cell line HMC-1 was established from a patient suffering from mast cell leukemia and was provided by Dr. J. H. Butterfield (Mayo Clinic, Rochester, MN). HMC-1 cells were cultured in IMDM supplemented with 10% FCS, glutamine (2 mM), penicillin (100 U/ml), and streptomycin (100 µg/ml). For transfection, cells were washed twice in Earle’s modified Eagle’s medium supplemented with 50 mM HEPES and 20% FBS. Cells were resuspended in the same medium at a density of 5 x 107/ml, and 1 x 107 cells were electroporated (Gene Pulser, Bio-Rad, Hercules, CA) at 250 V and a capacitance of 500 microfarad in the presence of a mammalian expression vector pcDNA3 (10 µg) containing cDNA encoding hemagglutinin (HA)-tagged fMLP receptor (HA-FR) (13). The culture medium was replaced with fresh medium containing 1 mg/ml geneticin (G418) 24 h after transfection. Two weeks after electroporation, the antibiotic resistant cells were analyzed for cell surface expression of HA-FR by flow cytometry, and the top 3% of cells expressing the receptor were sorted by FACS and cultured for use in this study.
Radioligand binding
Binding of [3H]fMLP to intact HMC-1 cells expressing HA-FR was conducted on 1 x 106 cells in 200 µl of HEPES-buffered saline supplemented with 1% BSA at 4°C for 4 h. Cells were collected by vacuum filtration on Whatman GF/C filters (Clifton, NJ) and washed four times with ice-cold saline, then dried filters were counted in scintillation fluid (13).
Calcium measurements
HMC-1 cells (3 x 106) were loaded with 1 µM indo-1/AM in the presence of 1 µM pluronic acid for 30 min at room temperature. Cells were washed and resuspended in 1.5 ml of HEPES-buffered saline. Intracellular Ca2+ measurements were conducted in a Perkin-Elmer fluorescence spectrophotometer (model 650-19, Norwalk, CT) with an excitation wavelength of 355 nm and an emission wavelength of 410 nm. Maximum and minimum fluorescence values were determined in the presence of 0.1% Triton X-100 and 20 mM Tris-HCl (pH 8.0)/5 mM EGTA, respectively. Intracellular Ca2+ concentrations were calculated using the following formula: [Ca2+] = Kd (F - Fmin)/Fmax - F) (13, 14).
Analysis of cytokine mRNA expression by RNase protection assay (RPA)
HMC-1 cells (8 x 106/3 ml of
complete growth medium) were exposed to fMLP, C3a, or C5a, incubated at
37°C for 1–15 h, collected, centrifuged, and washed with PBS. Total
RNA was extracted and quantitated by absorbance at 260 nm. Cytokine
mRNAs encoding IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10,
IL-13, IL-14, IL-15, TNF-, TNF-ß, LTß, IFN-ß, IFN-,
TGF-ß1, TGF-ß2, TGF-ß3, G-CSF, M-CSF, GM-CSF, stem cell factor,
leukocyte inhibitory factor, oncostatin M, lymphotaetin, MCP-1,
MIP-1 (CCL3), MIP-1ß, I-309 (CCL1), IFN, -inducible protein of
10 kDa (IP-10, CXCL10), and RANTES (CCL5) were detected using the
RiboQuant Multiprobe RPA template sets hCK-1, hCK-3, hCK-4, and hCK-5
(PharMingen, San Diego, CA). 32P-labeled
riboprobes were generated according to the manufacturer’s
recommendations and were hybridized overnight with 10 µg of RNA
samples. The hybridized RNA was treated with RNase and purified
according to the manufacturer’s recommendations. The samples were
electrophoresed in 6% polyacrylamide gels, the gels were dried and
exposed, and protected fragments were quantified by phosphorimager
analysis.
Assay of chemokine protein production by ELISA
For measurement of chemokine protein release, HMC-1 cells were
resuspended in fresh complete growth medium (1 x
106/ml), and cells were stimulated with C3a, C5a,
or fMLP for 6 h (unless otherwise stated). Supernatants were
collected from centrifuged samples and were stored frozen at -80°C
until analysis. Chemokine protein levels were quantified by sandwich
ELISA using matched Ab pairs. ELISA plates (Costar, Cambridge, MA) were
coated with 400 ng/well of capture Ab (14215.41 for MIP-1 (R&D
Systems, Minneapolis, MN), 24006.111 for MIP-1ß (R&D Systems),
6217.11 for IL-8 (R&D Systems), and B69–2 for MCP-1 (PharMingen)) in
PBS overnight at 4°C, blocked with blocking buffer (PBS containing
1% BSA, 5% sucrose, and 0.05% NaN3) for 2
h at room temperature, and washed with washing buffer (0.05% Tween-20
in PBS). Samples (100 µl) and standards were incubated for 2 h
at room temperature, washed, and incubated with 20 ng/ml polyclonal
biotinylated Abs to MIP-1 (R&D Systems), MIP-1ß (R&D Systems),
IL-8 (R&D Systems), or MCP-1 (PharMingen) for 2 h at room
temperature. After washing, 0.1 ng/ml streptavidin-HRP (Zymed, South
San Francisco, CA) was added for 20 min at room temperature, washed,
and developed with tetramthylbenzidine peroxidase substrate
(Kirkegaard & Perry Laboratories, Gaithersburg, MD) for 20 min. The
peroxidase reaction was stopped by adding 0.5 volumes of 1 M phosphoric
acid. The plate was read at 450 nm in an ELISA plate reader (Anthos,
Durham, NC).
Phosphorylation of ERK-1/ERK-2
HMC-1 cells (1 x 106/sample) were stimulated with fMLP (1 µM) or C3a (10 nM) in HEPES-buffered saline, and the reaction was stopped at different time periods by the addition of a 3-fold excess of ice-cold PBS containing 1 mM sodium orthovanadate. Cells were harvested by centrifugation and resuspended in 50 µl of lysis buffer of the following composition: 150 mM NaCl, 50 mM Tris (pH 8.0), 1.0% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 5 mM EDTA, 10 mM sodium fluoride, 10 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 10 µg/ml leupeptin, 100 µg/ml 1-chloro-3-tosylamido-4-phenyl-2-butanone, 50 µg/ml 1-chloro-3-tosylamido-7-amino-2-heptanone, and 10 µg/ml PMSF. The samples were centrifuged (10,000 x g, 10 min) to remove insoluble debris, and the supernatant was mixed with an equal volume of 2x SDS sample buffer and heated to 90°C for 10 min. Samples were electrophoresed in 10% SDS-polyacrylamide gels and transferred onto a nitrocellulose filter. The filter was treated with 3% nonfat milk in PBS and incubated with an Ab specific for phosphorylated ERK-1/ERK-2. The reaction was detected by enhanced chemiluminescence. The membrane was stripped and reprobed with an Ab that reacts with unphosphorylated ERK-1 or ERK-2.
Construction of HA-C3aR and transient transfection in HMC-1 cells
A nucleotide sequence encoding the nine-amino acid HA peptide (YPYDVPDYA) was inserted between the N-terminal initiator methionine and the second amino acid of C3aR by PCR. The 5' oligonucleotide, in a 5'-3' order, contained six miscellaneous bases, six bases encoding BamHI, three bases encoding methionine, 27 bases encoding the HA tag, and 27 bases complementary to the cDNA of the C3aR encoding aa 2–10 of the receptor. The 3'-oligonucleotide was complementary to the C-terminal seven amino acids and a stop codon with a 5' HindIII and ligated into a mammalian expression vector, pRK5 (13). Transient transfection of HMC-1 cells with empty vector (mock) or vector containing cDNA encoding HA-C3aR was performed as described above for FR, but the cells were used 16–18 h after transfection. Mock or C3aR-transfected cells were incubated with 12CA5 Ab followed by FITC-labeled goat anti-mouse IgG. The cells were washed, and receptor expression was analyzed by flow cytometry.
Nuclear extracts and EMSA
Nuclear extracts were prepared according to the method of Shreiber et al. (15) with some modification. HMC-1 cells (1 x 107) were treated with or without fMLP (1 µM) or C5a (100 nM) for 1 h at 37°C. Cells were washed in PBS and resuspended in 10 ml of ice-cold buffer A (10 mM HEPES (pH 7.6), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.75 mM spermidine, 1 mM DTT, 0.5 mM PMSF, 1 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 µg/ml pepstatin) and incubated for 15 min on ice. Nonidet P-40 was added from a 10% stock solution to a final concentration of 0.6%, and the sample was vortexed for 10 s. Samples were centrifuged at 3,000 rpm for 10 min at 4°C, and the nuclei were resuspended in 10 ml of buffer C (20 mM HEPES (pH 7.6), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.5 mM PMSF, 1 µg/ml aprotinin, and 2 µg/ml pepstatin). Suspensions were agitated for 30 min at 4°C, and nuclear extracts were separated from debris by centrifugation at 15,000 x g for 15 min at 4°C. Nuclear extracts were frozen at -70°C in aliquots containing 20% glycerol.
NFATc and AP-1 consensus and mutant double-stranded oligonucleotides
were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
Top-strand sequences are NFATc consensus site
5'-CGCCAAAGAGGAAAATTTGTTTCATA, NFATc mutant site
5'CGCCCAAAGCTTAAAATTTGTTTCATA, and AP-1 consensus site
5'-CGCTTGATGACTACAGCCGGAA. Annealed binding sites were radiolabeled
using T4 polynucleotide kinase and
[-32P]ATP. Radiolabeled oligonucleotides
were purified by electrophoresis through an 8% polyacrylamide gel,
overnight elution from gel slices at 37°C, concentration using an
Elutip-d (Schleicher & Schuell, Keene, NH), and ethanol precipitation.
EMSAs were performed as described previously (16) with
some modifications. Nuclear extracts (3 µg) were incubated with 1
µg of poly(dI-dC) carrier in a 25-µl reaction mix containing 10 mM
Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, and 5% glycerol
for 30 min either at room temperature (to test Ab inhibition) or at
4°C (to test oligonucleotide competition). For Ab inhibition
experiments, 0.2 µg of goat affinity-purified anti-NFATc
(SC-1149X, Santa Cruz Biotechnology) or goat control IgG was included
in the incubation. For oligonucleotide competition experiments,
unlabeled oligonucleotides (250 fmol) were included in the incubation.
Labeled binding site probes (5 fmol, 
5–6 x
104 cpm) were then added for an additional 20 min
of incubation at 4°C. Samples were electrophoresed through a 4%
polyacrylamide gel containing 22.5 mM Tris-borate and 0.5 mM EDTA at
4°C.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
HMC-1 cells, which endogenously express receptors for C3a and C5a
at low levels, were stably transfected with cDNA encoding HA-FR. The
transfectants were analyzed for their ability to bind
[3H]fMLP and to mobilize
Ca2+ in response to fMLP. Saturation binding
studies revealed the presence of 54,354 ± 3,478 binding
sites/cell, which compares to 55,000–120,000 binding sites for
natively expressed receptors in human neutrophils (17, 18). As shown in Fig. 1
A, fMLP stimulated a
dose-dependent increase in peak Ca2+ mobilization
in transfected HMC-1 cells with an EC50 value of
80 nM, which is identical with the EC50 value
reported for fMLP-stimulated degranulation in rat basophilic leukemia
(RBL-2H3) cells expressing HA-FR (13). C3a and C5a also
stimulated dose-dependent increases in Ca2+
mobilization, but with EC50 values of 0.1 and 3.3
nM, respectively (Fig. 1A). Although the peak intracellular
Ca2+ mobilizations to all three ligands were
similar in magnitude, there were remarkable differences in their
ability to activate a sustained Ca2+
mobilization. Responses to all three stimulants reached a peak within
5 s after stimulation. However, C3a and C5a-induced
Ca2+ mobilizations returned to basal levels
within 2–3 min after stimulation. In contrast, fMLP-induced
Ca2+ mobilization remained elevated for the
duration of the experiment (up to 15 min). Ptx (100 ng/ml for 16
h) blocked Ca2+ mobilization to C3a, C5a, and
both the initial Ca2+ spike as well as the
sustained response to fMLP (data not shown).
|
To determine the effects of signaling through chemoattractant
receptors on cytokine expression, transfected HMC-1 cells were
stimulated for different time periods with a concentration of
chemoattractant that resulted in maximal Ca2+
mobilization; C3a (10 nM), C5a (100 nM), or fMLP (1 µM) and cytokine
mRNAs were quantified by RPA. Resting HMC-1 cells expressed no mRNAs
encoding cytokines IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, IL-10, IL-13,
IL-14, IFN-, oncostatin M, TGF-ß2, TGF-ß3, G-CSF, GM-CSF, or
stem cell factor as determined by RPA, and stimulation with C3a, C5a,
or fMLP did not induce their expression (not shown). HMC-1 cells
constitutively expressed low levels of mRNAs encoding the cytokines
IL-6, IL-15, leukocyte inhibitory factor, lymphotoxin ß, M-CSF, and
TGF-ß1, but their expression was not changed by
stimulation with C3a, C5a, or fMLP. For chemokines, neither
unstimulated nor chemoattractant-stimulated HMC-1 cells expressed
mRNAs for lymphotactin, I-309, INF--inducible protein of 10 kDa, or
RANTES (Fig. 2A). HMC-1 cells
did express low levels of MIP-1ß, MCP-1, and IL-8 transcripts.
Stimulation with fMLP, but not C3a or C5a, for 3 h caused an
up-regulation of MIP-1ß and MCP-1 mRNAs (31 ± 17-fold for
MIP-1ß and 10 ± 2-fold for MCP-1; n = 4; Fig. 2, A–C). This effect of fMLP was due to the activation of
its receptor, because fMLP did not stimulate this response in
untransfected cells (Fig. 2A). The effect of fMLP on
MIP-1 mRNA expression in this assay was not clear, but C3a or C5a
did not cause up-regulation of mRNA for MIP-1 (Fig. 2A).
|
, A and B). To determine whether
the up-regulation of mRNA by fMLP resulted in protein production,
supernatants from fMLP-, C3a-, and C5a-stimulated HMC-1 cells were
tested for MIP-1ß and MCP-1 proteins by ELISA. Unstimulated cells
secreted little or no MIP-1ß. However, stimulation of HMC-1 cells
with fMLP resulted in a time- and dose-dependent increase in MIP-1ß
protein production (Fig. 2, D and E). The
production of MIP-1ß was maximal at 6 h after stimulation and
declined thereafter (Fig. 2D). As for
Ca2+ mobilization, the EC50
for both fMLP-induced MIP-1ß mRNA up-regulation (Fig. 2C)
and protein release (Fig. 2E) was about 80 nM. Neither C3a
(10 nM) nor C5a (100 nM) stimulated MIP-1ß production in HMC-1 cells
either at the mRNA or protein level (Fig. 2, A,
B, and D). Neither C3a nor C5a, up to a
concentration of 1 µM, stimulated MIP-1ß production (data not
shown). In human lung mast cells and HMC-1 cells, MCP-1 is released
into the supernatant in a constitutive manner (19). We
also found that incubation of HMC-1 cells with medium alone for 6
h resulted in production of MCP-1 to a level of 195 ± 26
pg/106 cells. Stimulation of cells with fMLP for
6 h resulted in a net increase of 730 ± 143
pg/106 cells. Under this condition, neither fMLP,
C3a, nor C5a stimulated secretion of MIP-1, RANTES, or IL-8 proteins
in HMC-1 cells (data not shown). Roles of G protein, protein kinase C, and ERK phosphorylation in fMLP-induced MIP1-ß production in HMC-1 cells
FR couples to Gi-like G proteins in
leukocytes (13, 18, 20). To test the role of signaling
through Gi proteins in chemokine gene
expression, we incubated HMC-1 cells with ptx (100 ng/ml, overnight),
which inhibits signaling through Gi, and
stimulated cells with fMLP (1 µM) for 2 h (mRNA) and 6 h
(chemokine release). Ptx had no effect on basal responses, but almost
completely abolished both fMLP-stimulated mRNA induction and protein
release (Fig. 3). To determine which
signal transduction pathways may be involved in the generation of
chemokines by GPCR activation, we tested the effects of inhibitors of
protein kinase C (bisindolylmaleimide), PI3 kinase (wortmannin),
mitogen-activated protein kinase kinase (MEK) (PD98059), and a
membrane-permeable cAMP analogue, cpt-cAMP, an activator of PKA.
Bisindolylmaleimide had no effect on fMLP-induced chemokine production
at either the mRNA or protein level (Fig. 3). Stimulation of cells with
PMA and the Ca2+ ionophore A23187 resulted in a
much greater level of MIP-1ß production than that in fMLP-stimulated
cells (net increase of 
2000 pg/106 cells
compared with 300 pg/106 cells).
Bisindolylmaleimide, which had no effect on fMLP-induced chemokine
production, inhibited the response to PMA/A23187 by >95% (not shown).
Cpt-cAMP (1 mM) or PD98059 (100 µM) caused substantial inhibition of
fMLP-induced MCP-1 and MIP-1ß mRNA up-regulation as well as MIP-1ß
protein release (Fig. 3). Wortmannin partially blocked fMLP-induced
responses. These data suggest that the ability of fMLP to stimulate the
expression of MCP-1 and MIP-1ß genes in HMC-1 cells requires
GPCR-mediated activation of MAPK, but not protein kinase C.
|
, fMLP caused
phosphorylation of both ERK-1 and ERK-2. The response reached a peak
within 1 min after stimulation and was sustained for up to 15 min.
Although C3a also caused an increase in ERK phosphorylation within 1
min, this response was transient and returned to basal within 5 min
after stimulation (Fig. 4). The effects of the MEK-1 inhibitor PD98059
on fMLP-stimulated MIP-1ß production, phosphorylation of both ERK and
its downstream effector Elk-1 were tested. As shown in Fig. 5, PD98059 inhibited fMLP-induced
MIP-1ß production, ERK and ELK-1 phosphorylation in a dose-dependent
manner. Ptx had no effect on basal ERK-2 phosphorylation, but
substantially inhibited the response to fMLP (Fig. 6). Bisindolylmaleimide had no effect on
fMLP-induced ERK phosphorylation (Fig. 6) or chemokine production (Fig. 3). Surprisingly, neither wortmannin nor cpt-cAMP inhibited
fMLP-induced ERK-2 phosphorylation (Fig. 6) despite the fact that they
blocked the chemokine response to fMLP (Fig. 3). These findings suggest
that fMLP-induced chemokine production involves synergistic interaction
of MAPK with another signaling pathway.
|
|
|
EGTA binds to extracellular Ca2+ and blocks
Ca2+ influx in response to receptor stimulation.
To test the role of extracellular Ca2+ on
fMLP-induced responses, HMC-1 cells were exposed to EGTA (5 mM) before
stimulation with the ligand. As shown in Fig. 7, A and B, EGTA
had no effect on the initial Ca2+ spike in
response to fMLP, but it blocked the sustained
Ca2+ mobilization. EGTA also completely inhibited
fMLP-stimulated MIP-1ß production (Fig. 7C). Calmodulin is
a signaling molecule that mediates the effects of
Ca2+ mobilization in many systems
(21). To test the role of
Ca2+-mediated signaling on MIP-1ß production,
HMC-1 cells were pretreated with a calmodulin inhibitor fluphenazine
before stimulation with fMLP. As shown in Fig. 7C,
fluophenazine almost completely blocked the response to fMLP.
|
40% of the cells expressed HA-tagged C3aR (Fig. 8A). As expected, C3a
stimulated a transient Ca2+ mobilization in
mock-transfected cells, but this response was more sustained in cells
transiently expressing C3aR (Fig. 8B). This sustained
Ca2+ response was associated with C3a-induced
MIP-1ß production (Fig. 8C). Similar data were obtained
with HMC-1 cells transiently expressing C5aR (not shown). These
findings suggest that the signaling pathway that synergizes with MAPK
activation for GPCR-induced chemokine production involves sustained
Ca2+ mobilization.
|
Given that elevation of intracellular calcium was a prominent
feature of the response to fMLP, we hypothesized that
Ca2+-dependent activation of calcineurin and,
subsequently, NFAT may also be involved in GPCR-induced chemokine gene
expression. Certainly, Ag stimulation of T cells and mast cells causes
calcineurin activation (23). We first tested the effect of
cyclosporin A (CsA), a potent inhibitor of calcineurin, on fMLP-induced
MIP-1ß production. CsA (100 nM) inhibited fMLP-induced MIP-1ß
production by 80 ± 3% (Fig. 9A). To test whether fMLP
stimulates NFAT activity, nuclear extracts from untreated and
fMLP-treated HMC-1 cells were used to perform EMSA. As shown in Fig. 9B, fMLP caused the up-regulation of a protein-DNA complex
consistent with NFAT activation. This complex formed with a wild-type
NFAT binding site (compare lanes 2 and 6), but
not with a mutant binding site (compare lanes 1 and
5). Moreover, unlabeled wild-type competitor blocked the
fMLP-induced complex formation, whereas the mutant competitor had no
effect (Fig. 9B, lanes 7 and 8). To
further test for specificity, the EMSA reaction was performed in the
presence of anti-NFAT or control Ab. Anti-NFAT Ab inhibited
formation of the fMLP-induced complex, whereas the control Ab did not
(Fig. 9C). Ag-stimulated cytokine gene expression involves
activation of both NFAT and AP-1. Therefore, we determined whether fMLP
also causes activation of AP-1 in HMC-1 cells. For these experiments
EMSA was first performed with nuclear extract from unstimulated HMC-1
cells. As shown in Fig. 9D (lane 1), AP-1
binding activity was detected in HMC-1 cell extracts. This activity
represents AP-1, as incubation with excess AP-1 oligonucleotide blocked
formation of the protein-DNA complex, but a nonspecific control
oligonucleotide had no effect. Unlike its effect on NFAT, fMLP had no
effect on the AP-1 response (Fig. 9D). To test whether C5a
stimulated transcription factor activation, nuclear extracts from fMLP-
and C5a-stimulated HMC-1 cells were compared for their ability to
stimulate NFAT and AP-1 activation. FMLP caused a 4.2 ± 0.02-fold
increase in NFAT activity, whereas C5a had no effect.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It is important to note that in leukocytes, FR are expressed at much
higher levels than C3aR or C5aR. For example, 50,000–120,000 FR are
present on neutrophils (17, 18). In contrast, C3aR
expression in monocytes, neutrophils, eosinophils, and basophils ranges
from 3,000 to 10,000 copies/cell (22). Also, basophils,
eosinophils, and HMC-1 cells express 15,000 C5aR/cell. Although most
leukocytes express FR, C3aR, and C5aR, the ability of these receptors
to stimulate biological responses has been well documented only in
human basophils. The differences in the biochemical and functional
properties of the GPCRs described herein for HMC-1 cells, which express
54, 354 ± 3,478 FR/cell, are very similar to those reported for
the same receptors in basophils. For example, as in basophils
(1), fMLP stimulated a sustained
Ca2+ mobilization, whereas the response to C5a
was transient (Fig. 1). Furthermore, fMLP causes leukotriene production
in basophils, whereas C3a or C5a has no effect (2, 24, 25). The findings in the present study that C3a and C5a
stimulate transient Ca2+ mobilization in HMC-1
cells and that overexpression of C3aR or C5aR leads to both a sustained
Ca2+ mobilization and MIP-1ß production
demonstrate that the ability of GPCR to stimulate chemokine production
depends on the level of receptor expression.
An interesting aspect of the present work was that although FR, C3aR, and C5aR all couple to the same ptx-sensitive G protein, the differences in their ability to stimulate chemokine production reflected the length of their signaling time. Thus, fMLP-stimulated chemokine production was associated with both sustained Ca2+ mobilization and ERK phosphorylation. Furthermore, C3a and C5a, which induced both transient Ca2+ mobilization and ERK phosphorylation, did not stimulate chemokine production. Evidence that fMLP-induced ERK phosphorylation was necessary for chemokine production was provided by the demonstration that ptx and PD98059, which respectively block G protein and MAPK activation, inhibited fMLP-induced ERK phosphorylation and chemokine production. Furthermore, fMLP stimulated the phosphorylation ELK-1, which is a transcription factor that is activated by ERK. In addition, PD980589 blocked fMLP-induced ELK-1 phosphorylation in a dose-dependent manner. These findings suggest that fMLP-induced chemokine production in HMC-1 cells is mediated via signaling pathways that include sustained Ca2+ mobilization and ERK phosphorylation.
The mechanism by which fMLP stimulates ERK phosphorylation in HMC-1
cells is not known. It is generally accepted that
Gi-coupled receptors use the ß subunits of G
protein to activate MAPK via a mechanism involving the following
pathway: Gß
SrcShc/Grb/SOSRasRafMEKERK
(26). In neutrophils, PI3 kinase is involved in
fMLP-induced ERK phosphorylation, possibly via its direct effect on MEK
(GßPI3 kinaseMEKERK) (8). Thus, cpt-cAMP and
wortmannin, which inhibit Raf-1 and PI3 kinase, respectively, block
fMLP-stimulated ERK phosphorylation in human neutrophils (8, 27). The finding in the present study that neither wortmannin
nor cAMP blocked fMLP-induced ERK phosphorylation in HMC-1 cells is
inconsistent with a role for Raf or PI3 kinase in MAPK activation in
this cell line. This type of inconsistency has recently been reported
for other receptors. For example, in CHO cells expressing CXCR1 and
CXCR2, IL-8-induced MAPK activation is mediated independently of Raf or
PI3 kinase (28). In Swiss-3T3 and COS-7 cells, epidermal
growth factor and lysophosphatidic acid-induced MAPK activities are
mediated in a Raf-1-independent and a cAMP-insensitive manner
(29). In PC12 cells, Ras-dependent MAPK activation also
does not require PI3 kinase or Raf activation (30). These
findings suggest the existence of a MEK kinase different from classic
Raf kinases that might be involved in ERK phosphorylation in HMC-1
cells and other cell types. The identity of this kinase and the
mechanism by which fMLP activates ERK phosphorylation remain to be
determined.
An important and unexpected finding of the present study was that
although cpt-cAMP and wortmannin had no effect on fMLP-stimulated ERK
phosphorylation, they blocked chemokine production in response to fMLP.
This raises the intriguing possibility that fMLP-stimulated chemokine
production involves synergistic interaction of ERK phosphorylation with
another signaling pathway. NFAT is a cytosolic transcription factor
that regulates the activation of cytokine genes in Ag-stimulated T
cells and mast cells (10, 11). Ag stimulation of these
cells results in a Ca2+-dependent activation of
the phosphatase calcineurin, which dephosphorylates NFAT. This
dephosphorylation allows NFAT to translocate to the nucleus, where it
combines with the AP-1 complex to regulate the transcription of early
cytokine genes (10, 23). The immunosuppressive drug CsA
inhibits cytokine gene expression by blocking calcineurin. Although
recent studies have shown that GPCR could activate NFAT in lymphoid
(31) and microglial cells (32), its
biological significance is not known. The demonstration herein that CsA
blocked fMLP-induced MIP-1ß production indicated that the signal
needed to synergize with ERK phosphorylation to induce chemokine
production might be the activation of NFAT (Fig. 7). This possibility
was supported by the finding that fMLP, but not C5a, stimulated NFAT
activation in nuclear extracts of HMC-1 cells. Although NFAT regulates
cytokine gene expression in Ag-stimulated mast cells and T cells, the
present study demonstrates a previously unrecognized role of this
transcription factor in GPCR-induced chemokine production.
In summary, we have used a human mast cell line that natively expresses
C3aR and C5aR at low levels and generated stable transfectants
expressing physiologic levels of FR as a model for GPCR activation.
Using this system we have shown that bacterial products such as fMLP
can induce cells of innate immunity to produce the proinflammatory
chemokines MIP-1ß and MCP-1 that may, in turn, recruit other
leukocytes to sites of infection. Furthermore, we have shown that the
selectivity of fMLP vs C3a or C5a to induce chemokine production is due
to the level of receptor expression, the length of their signaling
time, and the synergistic interaction of ERK phosphorylation, sustained
Ca2+ mobilization, and NFAT activation (see model
in Fig. 10).
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hydar Ali, Department of Pathology, University of Pennsylvania School of Dental Medicine, 4010 Locust Street, Philadelphia, PA 19104-6002.
3 Present address: Basel Institute for Immunology, Grenzacherstrasse 487, 4005 Basel, Switzerland.
4 Abbreviations used in this paper: GPCR, G protein-coupled receptor; FR, fMLP receptor; HA, hemagglutinin; HMC, human mast cell; MAPK, mitogen-activated protein kinase; MIP, macrophage inflammatory protein; MCP, monocyte chemotactic protein; ptx, pertussis toxin; PI3 kinase; phosphoinositol 3-kinase; cpt-cAMP, 8-(4-chlorophenylthio)-cAMP; RPA, RNase protection assay; CsA, cyclosporin A; ERK, extracellular signal-regulated kinase; MEK, mitogen-activated protein kinase kinase.
Received for publication April 17, 2000. Accepted for publication September 25, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B by fMet-Leu-Phe in myeloid cells. J. Biol. Chem. 272:7995.B activation is required for C5a-induced interleukin-8 gene expression in mononuclear cells. Blood 93:3241.
R1 regulation of the transcriptional activity of Elk-1 and NFAT in mast cells. J. Exp. Med. 185:43.
enhancer by functional cooperation between c-Myb and core-binding factors. Mol. Cell. Biol. 14:473.This article has been cited by other articles:
|
|
 |
|
  J. L. Stern and B. Slobedman Human Cytomegalovirus Latent Infection of Myeloid Cells Directs Monocyte Migration by Up-Regulating Monocyte Chemotactic Protein-1 J. Immunol., May 15, 2008; 180(10): 6577 - 6585. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H. Wei, Y. Yang, G. Wu, and L. J. Ignarro IL-4 and IL-13 upregulate ornithine decarboxylase expression by PI3K and MAP kinase pathways in vascular smooth muscle cells Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1198 - C1205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. J. Swindle, J. W. Coleman, F. R. DeLeo, and D. D. Metcalfe Fc{epsilon}RI- and Fc{gamma} Receptor-Mediated Production of Reactive Oxygen Species by Mast Cells Is Lipoxygenase- and Cyclooxygenase-Dependent and NADPH Oxidase-Independent J. Immunol., November 15, 2007; 179(10): 7059 - 7071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-S. Shin, C. P. Shelburne, C. Jin, E. A. LeFurgey, and S. N. Abraham Harboring of Particulate Allergens within Secretory Compartments by Mast Cells following IgE/Fc{epsilon}RI-Lipid Raft-Mediated Phagocytosis J. Immunol., November 1, 2006; 177(9): 5791 - 5800. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Purwar, M. Wittmann, J. Zwirner, M. Oppermann, M. Kracht, O. Dittrich-Breiholz, R. Gutzmer, and T. Werfel Induction of C3 and CCL2 by C3a in Keratinocytes: A Novel Autocrine Amplification Loop of Inflammatory Skin Reactions J. Immunol., October 1, 2006; 177(7): 4444 - 4450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Lin and J. A. Boyce IL-4 Regulates MEK Expression Required for Lysophosphatidic Acid-Mediated Chemokine Generation by Human Mast Cells J. Immunol., October 15, 2005; 175(8): 5430 - 5438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Feng, A. G. Mery, E. M. Beller, C. Favot, and J. A. Boyce Adenine Nucleotides Inhibit Cytokine Generation by Human Mast Cells through a Gs-Coupled Receptor J. Immunol., December 15, 2004; 173(12): 7539 - 7547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ahamed, R. T. Venkatesha, E. B. Thangam, and H. Ali C3a Enhances Nerve Growth Factor-Induced NFAT Activation and Chemokine Production in a Human Mast Cell Line, HMC-1 J. Immunol., June 1, 2004; 172(11): 6961 - 6968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, G. Hu, S.-W. Wang, Y. Li, R. Martin, K. Li, and Z. Yao Calcineurin/Nuclear Factors of Activated T Cells (NFAT)-activating and Immunoreceptor Tyrosine-based Activation Motif (ITAM)-containing Protein (CNAIP), a Novel ITAM-containing Protein That Activates the Calcineurin/NFAT-signaling Pathway J. Biol. Chem., May 2, 2003; 278(19): 16797 - 16801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Suzuki, C. Gomez-Guerrero, I. Shirato, O. Lopez-Franco, P. Hernandez-Vargas, G. Sanjuan, M. Ruiz-Ortega, T. Sugaya, K. Okumura, Y. Tomino, et al. Susceptibility to T Cell-Mediated Injury in Immune Complex Disease Is Linked to Local Activation of Renin-Angiotensin System: The Role of NF-AT Pathway J. Immunol., |
