| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Microbiology and Iowa Interdisciplinary Immunology Program, University of Iowa, Iowa City, IA 52242;
Department of Animal Science, Iowa State University, Ames, IA 52242; and
U.S. Department of Agriculture, Agricultural Research Service, Roman L. Hruska U.S. Meat Animal Research Center, Clay Center, NE 68933
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The VH repertoire of swine is encoded by <20
VH genes (17), a single
JH (18), and almost exclusively by
two DH segments (19, 20, 21). VDJ
rearrangements are first recovered from the liver of 30-day-old
fetuses, and in the remaining 84 days of gestation the monotonous usage
VHA, VHB,
VHC, and VHE (the fetal
VH genes) and two DH
segments account for approximately 80% of the preimmune VDJ repertoire
in all major lymphoid tissues (20). If
VHF usage is included (Table I
), >90% of total
VH usage can be accounted for by just five
VH genes. Since there is virtually no somatic
mutation in fetal life (Ref. 19 and this report), the
combinatorial heavy chain preimmune repertoire of the piglet is derived
from 8–10 nonmutated combinations. Considering that all heavy chain V
region gene segments in human and mice can be potentially used, the
combinatorial repertoire of swine is conservatively <1% of that in
humans and mice (22). While fetal rabbits also use a small
number of VH genes and a single
VH (VH1) >80% of the
time, these are combinatorially joined with eight
DH and two JH segments
(23, 24). Since fetal and newborn piglets appear capable
of producing Abs to a broad range of Ags (25, 26), it
raises the question as to how so few VDJ recombinations are able to
encode such an apparently broad Ab repertoire. Theoretically, such a
highly restricted combinatorial diversity could be offset by 1)
variable light chain diversity, 2) junctional diversity in
complementarity-determining region 3
(CDR3),4 3) gene
conversion of the fetal VH genes, 4) somatic
hypermutations as in the sheep V
, or 5) a combination of these
mechanisms. CDR3 has been shown to play a major role in the specificity
of the Ab binding site (27), and experiments by Xu and
Davis (28) have shown that a mouse with a single
VH transgene can make responses to all Ags
provided full CDR3 diversity is still possible. Thus, we have chosen to
initially address the second theoretical possibility by examining >200
CDR3 sequences recovered from fetal piglets ranging from 30–110 days
of age. In addition, VDJs from various lymphoid tissues were analyzed
for their CDR3 spectratype (length). Based on N region addition, our
finding suggest that TdT is active from the time of first VDJ
rearrangement, and that >90% of the sequences contain no somatic
mutations. While fetal piglets tend to first use the shortest of two
DH segment, the longer DH
segment is more extensively trimmed so the segment length of both
DH segments in CDR3 is the same. Spectratypic and
sequence analyses failed to show any significant increase in the length
of CDR3 during fetal life.
|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
White crossbred (WC) gilts (one-quarter Yorkshire, one-quarter Chester White, one-quarter Large White, one-quarter Landrace) from the Roman L. Hruska U.S. Meat Animals Research Center and Yorkshire and Meishan F1 crosses from Iowa State University were used in the study. Animals were hand-mated and scheduled for slaughter and collection of 23-, 26-,28-, 30-, 40-, 50-, 60-, 70-, 90-, and 110-day fetuses. Gestation in swine is 114 days. All gilts were healthy and normal at slaughter, and fetuses were immediately removed from the gravid uterus. Fetal liver was collected from 23-, 26-, 28-, 30-, and 40-day-old fetuses. Spleen samples and a variety of lymphoid tissues were collected from 40-day-old and older fetuses. We also include in our study a noninductive site of the mucosal immune system (parotid gland) that depends on B cell immigration (29) and a controversial B cell tissue, the thymus. The results summarize data for >30 fetuses of different ages.
Amplification and cloning of VDJs and CDR3
Since all swine VH genes are members of a single, highly homologous family (17) and have a single JH (18), VDJ rearrangement can be amplified from DNA or cDNA using an FR1 primer (recognizing a sequence shared by all swine VH genes) and an anti-JH primer. The approximately 500-bp product was then cloned into pBluescript and grown in XL-1 Blue cells, and individual recombinant clones were selected and transferred to a master filter as described previously (19, 20). These were then hybridized with a 32P-labeled pan-VH probe to confirm that each clone contains a VDJ insert and with gene-specific oligonucleotide probes to determine VH gene usage (20). In animals older than 50 days DNA was prepared from whole tissues, whereas in younger fetuses leukocytes were first prepared as previously described (30), since cells containing rearranged VDJ are rare at 30 days (M. Sinkora et al., unpublished observations).
Length analysis (spectrotypic analysis) of CDR3
The CDR3 segments of the uncloned PCR products described above
were amplified using a FR3-A+ primer
(gtttctttgagaaccgaagacacggc) and a 32P-labeled
anti-JH primer (tgaggacacgacgacttcaa). Use of
the FR3-A+ primer yields PCR products of uniform
length in >90% of the amplicons (31, 32), thus reducing
shadow band formation during spectratyping. The products were separated
on 6% polyacrylamide sequencing gels, the gels were dried and then
scanned using a Hewlett-Packard Instant Imager (Palo Alto, CA), and the
results were displayed directly (see Figs. 1, 2A, and 5). To confirm that
the CDR3 spectratypes obtained were not artifacts of PCR, the CDR3
product of an initial porcine CDR3 amplification was repeatedly
amplified. This procedure resulted in no PCR-dependent changes in CDR3
spectratype (Fig. 1A). We conclude that the CDR3
spectratypes seen on sequencing gels (Figs. 1, 2, and 5) are an
accurate reflection of cell numbers and the distribution of CDR3s
lengths in vivo.5
|
|
|
The distribution and relative concentration of CDR3 lengths were
quantified by scanning (Fig. 2
B) using the Hewlett-Packard
Electronic Autoradiography Program (Packard Imager version 2.05 for
Windows 95).
Sequence analysis of CDR3
The CDR3 region of 213 randomly selected VDJ clones from the
fetal liver of 30- and 40-day-old fetuses and the spleen of 60-, 70-,
90-, and 110-day-old (essentially newborn) fetuses were sequenced using
previously described methods (19). CDR3 sequences were
compared as previously described (21) in terms of total
length, P and N nucleotide additions both 5' and 3' of
DH, DH usage,
DH length, and DH reading
frame usage (Fig. 3 and Table I). Data
were compared with those obtained from 42 sequences from 6-wk-old
germfree piglets (Table I).
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Spectratypic analysis revealed a oligoclonal repertoire in the
30-day-old fetal liver with prominent CDR3 lengths of 42–45 bp in most
animals (Fig. 1B), but also with prominent 36–39 lengths in
some animals (Figs. 1B and 2). The oligoclonal spectratype
of the 30-day-old liver was a common feature of all but one of nine
30-day-old fetal livers examined (Fig. 1B; animal 1
excepted). These spectratypic results are consistent with the mean CDR3
length determined by sequence analysis (Figs. 3 and 4B). However, CDR3s as long as
66 nucleotides and as short as 12 were also present at 30 days (Figs. 1B and 2). The polynucleotide spectrum had the appearance of
a repertoire selected for the proliferation of B cells carrying a
single in-frame rearrangement (only every third polynucleotide is
present; Figs. 1B and 2A). This contrasts with a
totally nonselected repertoire (see thymus; Fig. 5) or the spectratype from the spleen of
older fetuses, e.g., 110 days, in which out-of-frame rearrangements are
routinely observed (Fig. 2A). This observation is further
described below. Evidence that the prominent CDR3 lengths comprising
the oligoclonal spectratype in the day 30 fetal liver (Figs. 1B and 2B) represent expansion of certain clones
was also consistent with data on the random recovery of duplicate
clones (Table I). The random recovery of duplicate clones before 70
days indicated that the B cell compartment is small early in
development.
|
B). However, at 50 days the fetal liver was
polyclonal and would have appeared nearly Gaussian in profile were it
not for the short 12-bp CDR3, which was also prominent in spleen from
50- to 60-day-old animals (Fig. 2B) as well in the parotid
gland of older animals (Fig. 5B).
The spleen in 40-day-old fetuses is poorly developed to the extent that
it is difficult to recover in all fetuses. Although the spleen is
morphologically well developed by day 50, lymphocyte cellularity is low
(30), and the CDR3 spectratype of rearranged VDJs from 50-
to 70-day-old fetal spleen remains oligoclonal in contrast to fetal
liver, which is polyclonal by 50 days. Not until 90 days does the
splenic CDR3 profile appear polyclonal and Gaussian. Coincident with
the appearance of a polyclonal profile in older fetuses, the short
12-bp CDR3 is no longer prominent in any major lymphoid tissue tested,
but can still be seen in the parotid gland (Figs. 2 and 5B).
N region additions were similar in number during fetal development, and point mutations were rare
The analysis of the CDR3 sequences presented in Fig. 3 is
graphically summarized in Fig. 4. Results indicate that N region
additions were of the same magnitude at 30 days as at 110 days (Fig. 4D). P nucleotide additions were seldom seen either 5' or 3'
of DH. We found no evidence for D-D
rearrangements, for mini-DH sequences, or that
short homology segments had been inserted. There was no increase in the
frequency of point mutation with age, and overall, >90% of all CDR3s
were nonmutated (Fig. 4A).
DHB is the most JH-proximal
DH segment in swine (J. Sun et al., unpublished
observations) (18). In germline configuration,
DHB is comprised of 28 nucleotides, whereas
DHA is comprised of 36 nucleotides. In 30-day-old
fetal liver, nearly two-thirds of the B cells randomly sampled used
DHB, but its proportional usage decreased with
fetal age (Fig. 4C). Although usage of the shorter
DH decreased gradually during fetal development,
there was no age-dependent change in the length of CDR3 (Fig. 3). This
constancy in length appeared to result from greater trimming of the
longer DHA, such that the actual lengths of
DHA and DHB used in CDR3
were not significantly different (Table I). Usage of reading frame 1
(RF1) increased in late term fetuses and was also seen in 6-wk-old
germfree piglets (Table I), although RF1 is nonproductive in both
DH segments due to a stop codon.
The proportion of in-frame rearrangements6 decreased in late gestation
VDJ clones recovered from 30- to 70-day-old fetuses were nearly
90% in-frame compared with 65% in newborn germfree piglets and 74%
in 110-day-old fetuses (Table I). The latter values straddle the
expected value of approximately 71% if VDJ rearrangement and cell
survival are merely random. This age-associated increase in
nonproductive rearrangement was also apparent from spectratypic
analyses (Fig. 2A). The heavy bands spaced at
three-nucleotide intervals in Figs. 1, 2, and 5 are the in-frame
sequences as determined by comparison with the CDR3 length standards
provided. Spectratypes showing out-of-frame rearrangements are
especially prominent in 110-day-old fetal spleen (Figs. 2A
and 5A) in the mesenteric lymph nodes (MLN) of some animals
(Fig. 5A) and in the 90- and 110-day-old parotid gland (Fig. 5B). Surprisingly, the bone marrow, which is regarded as a
primarily B cell tissue in mammals and where unselected pre-B cells
should be found, shows few out-of-frame rearrangements (Fig. 5A). Scanning spectratypes generated on gels allowed to run
longer allowed us to estimate that about 40% of all B cells in tissues
from older fetuses carried such rearrangements (data not shown).
Thus, both spectratypic and sequence analysis show that B cells
with nonproductive rearrangements are rare before 70 days of fetal life
(Fig. 2, A and B).
CDR3 diversity was highly conserved among diverse lymphoid tissues and among individuals
Figs. 1B and 2 show that the earliest VDJ
rearrangements (30- to 40-day-old fetal liver) have CDR3s as diverse in
length as older fetuses, but decidedly more oligoclonal. Clones bearing
prominent CDR3 lengths of 36–45 bp in the youngest fetuses persisted
throughout fetal development (Fig. 4B). When the CDR3
spectratype of VDJs from diverse lymphoid tissues of 90- and
110-day-old fetuses were compared, the same broad spectrum of CDR3
lengths was seen in all samples tested, including even the parotid
gland, but excluding the thymus (Fig. 5). In typical secondary lymphoid
tissues of 110-day-old animals, nonproductive rearrangements were
universally present. While the spectratype of CDR3 in the bone marrow,
spleen, IPP, and MLNs of 110-day-old fetuses differs little among four
unrelated animals (Fig. 5A) the parotid gland of unrelated
individuals exhibited animal differences (Fig. 5B). As
indicated above, the frequency of nonproductive rearrangements was also
quite conspicuous in the parotid glands from 90- and 110-day-old
fetuses, but not in the parotid glands of three 6-wk-old animals (Fig. 5). Also prominent in the fetal parotid was the 12-bp CDR3.
The CDR3 spectratype from thymus indicated the absence of selection for in-frame rearrangements
The spectratype of CDR3 in the fetal porcine thymus was the only
one resembling the pattern expected if VDJ rearrangement was random and
no selective proliferation of B cells with productive rearrangements
had occurred. This pattern also persisted into adulthood (Fig. 5A).
VH usage favors VHA and VHB
Although the focus of the current study was on the diversity of
fetal CDR3, sequence and hybridization analyses of VDJs were consistent
with our earlier report in showing the VHA and
VHB are the predominant VH
genes used during fetal life by piglets and generally account for about
50% of all VH usage (20) (Table I).
VHD was rarely encountered and, as we earlier
speculated, may be an allelic variant of VHC
(20). We also recovered chimeric VDJs, but with higher
frequently in early fetal life when the B cell compartment was small
(Table I). Evidence for the small size of the B cell compartment at
this time is supported by the high frequency of duplicate clones that
were recovered (Table I).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fig. 2 shows that the CDR3 spectratype is oligoclonal in the 30-day-old
fetal liver. This was true in nearly all animals tested (Fig. 1B; animal 1 excepted) and is not particularly surprising,
since the fetal liver at 30 days is the first site at which VDJ
rearrangement is detected (20). This oligoclonal pattern
suggests that the preimmune B cell compartment at 30 days is small, an
observation supported by the high proportion of duplicate clones
recovered (Table I).
Noteworthy is that while the CDR3 spectratype in fetal liver is polyclonal by day 50, that of fetal spleen remains oligoclonal to at least day 70. While the oligoclonality of early fetal liver may simply be a consequence of the size of the B cell compartment, the oligoclonal pattern in spleen may result from selection by some intrinsic ligand. We believe that this is likely, since after 50 days there is a marked expansion of the B cell (34) and peripheral T cell (29) compartments so that a polyclonal splenic spectratype would be expected if immigration and proliferation had been random.
While short CDR3s are the hallmark of early pre-B cells in humans
(35, 36), we found no evidence that short CDR3s were
predominant in early fetal life and progressively increased in length
during development (Fig. 4). The increased length of CDR3 in adult vs
fetal mice and humans has been ascribed to the absence or limited use
of N region additions during fetal life (36, 37, 38, 39) and the
use of shorter DH or JH
segments in fetal life (39, 40). In the fetal pig N region
additions are the same length at 30 days as they are at 110 days (Fig. 4D). In fact, the mean CDR3 length at 30 days (Fig. 4B) is only one codon shorter than reported for adult humans
(40) and is the same length as we have observed in both
colonized isolator piglets and adults (21). Consistent
with studies in mice (39) and humans (16, 36, 40), piglets also first use their shortest
DH segment (DHB; Fig. 4D). The preferential usage of DHB in
the earliest VDJ rearrangements is consistent with the usage of a
JH-proximal DH segment as
reported in rabbits (24), humans (37, 37, 41, 42), and mice (43, 44). The preferential use of RF1
in the VDJ of fetal mice (44) and of RF3 in newborn
rabbits (23) was not observed in swine. However, we
previously reported that RF1 of both DHA and
DHB contains a stop codon (19), so
all arrangements using RF1 are nonproductive (Table I). The reason why
we observed greater RF1 usage in late term and GF piglets than in very
early gestation fetuses is unexplained. While a higher usage of RF1
could lead to a higher proportion of nonproductive rearrangements, it
does not explain the lower proportion of in-frame rearrangements
observed at this time. Since it has been shown by some
(45), but not all (40), that TdT expression
abrogates RF bias, our finding of random/nearly equal usage of RF2 and
RF3 in fetal piglets (Table I) may not be surprising. Our failure to
observe changes in CDR3 length or N region additions compared with mice
and human is consistent with the view that TdT in fetal piglets is
fully active at the earliest time at which VDJ rearrangement occurs
during embryological development.
Although we found no progressive age-dependent change from short to
longer CDR3 during development, we did find a 12-bp CDR3 that occurred
in fetal liver, fetal spleen, and fetal parotid B cells, but was absent
or no longer prominent in the CDR3 repertoire of lymphoid
tissues/organs of older fetuses. It is possible that such very short
CDR3s characterize early B cell lymphogenesis, but disappear from the
spectratype due to lack of positive selection. Consistent with idea, we
recovered triplicate clones from 40-day-old fetal liver that had
DHA truncated to four nucleotides (clone 3; Fig. 3). VDJs with highly truncated DH segments are
very often recovered from fetal thymus (J. Sun and M. Sinkora,
unpublished observations). If the unselected CDR3 profile of thymus
(Fig. 5A) reflects B cell lymphogenesis in this organ (see
below), the occurrence of such short CDR3s may reflect unselected B
cells that should be rare among B cells in older fetuses. Since it is
generally believed that the parotid depends on immigration of B cells
from especially secondary mucosal lymphoid tissues, e.g., Peyers
patches, early immigrants may be unselected, thus explaining the 12-bp
CDR3 found in VDJs from this organ even in late term fetuses. In fact,
VDJs are difficult to recover from the parotid before day 90 and are
highly oligoclonal (data not shown).
It has been shown in studies of mice and humans, that CDR3 length is
regulated during rearrangement or by selection during development
(40). This is also true in swine, in that 1) CDR3 lengths
of 36–45 bp dominate the 30-day spectratype (Fig. 2B); 2)
the mean CDR3 length does not change during 84 days of fetal
development (Fig. 4B); and 3) the longer porcine
DHA is trimmed during usage in CDR3 to the same
length as the shorter DHB (Table I).
Although swine are also artiodactyls, the extremely long CDR3s reported
for cattle (46, 47) are not seen in the preimmune
repertoire of the piglet. Another phylogenetic discontinuity is our
failure to find that somatic point mutation contributes to repertoire
diversity in the fetal piglets (Fig. 4A), although this has
been reported to be a major Ag-independent mechanism in the -chains
of other artiodactyles, such as sheep and cattle (6, 8, 11). Apart from the idea that -chain diversification may be
regulated differently from heavy chain diversity, it seems increasingly
clear that phylogeny is not a reliable indicator of the pattern or
mechanism of repertoire development among mammals
(48).
The fact that maternal regulatory factors are unable to cross the swine
placenta probably does not explain the different features of CDR3 in
fetal piglets vs those in mice and humans. For example, it seems
unlikely that suppression of TdT activity in fetal mice and in early
gestation human fetuses is due to maternal factors, although we could
not identify studies that directly tested this hypothesis. The apparent
early intrinsic onset of TdT activity in fetal piglets may have evolved
as a compensatory mechanism in a species with limited combinatorial
diversity. On the other hand, reported differences in CDR3s between
fetal and adult mice or humans is quite likely another matter, and some
differences may be the result of extrinsic factors acting on the fetal
immune system, since these cannot or have not been controlled in rodent
and primate studies. In the piglet we have already shown that there are
no differences in VH usage,
DH usage, or the characteristics of CDR3 in
piglets reared germfree for 6 wk in an isolator (21). On
the other hand, both colonized isolator piglets and adults use
DHA two or three times more frequently than
DHB, suggesting that pronounced
DHA usage is a marker for diversification of the
VDJ repertoire in swine as is increased CDR3 length due to N region
additions 3' of DH (21). In fetal
piglets we observed a trend to greater DHA usage
during development, but unlike colonized or conventional animals, no
increase in N region additions was seen (Fig. 4D). Other
differences between fetal and adult mice may be intrinsic. For example,
the decline in VH 81X usage (a
DH-proximal VH gene) in
adult mice occurs before surface Ig is expressed on pre-B cells
(49). Interestingly, this decline parallels a decrease in
the ratio of productive/nonproductive rearrangements (50).
This decline is exactly what we observed in fetal piglets (Table I),
whereas Tunyaplin and Knight (51) observed the opposite
effect in rabbits. In piglets, this decline is also paralleled by the
tendency to shift from usage of DHB to
DHA. This decline in the frequency of in-frame
rearrangements may suggest that 1) cells carrying both nonproductive
and in-frame rearrangements are inhibited in proliferation; 2)
rearrangement is nonstoichastic and differentially regulated during
ontogeny in fetal liver vs bone marrow; 3) rearrangements in the swine
variable heavy chain locus in fetal liver may follow a pattern
reminiscent of the TCR
rearrangement, in which multiple attempts can
be made on the same chromosome (52, 53); or 4) a mechanism
may have evolved in swine that favors repair or rescue of an
out-of-frame rearrangement before switching to the use of the second
chromosome. In support of the second possibility, it is interesting
that usage of nonproductive RF1 increases as the proportion of in-frame
rearrangements decreases (Table I), suggesting more stringent control
of early VDJ rearrangements. The third possibility is inconsistent with
the known organization of the porcine
VH-DH-JH
locus, because swine have only a single JH
(18) so that progressive rearrangement attempts in this
locus, as described for TCR, would be impossible. Various
permutations of the last possibility have been recently discussed by
Nemazee (22).
The thymus is not regarded as a B cell organ, although reports of the
occurrence of B cells in the thymus date back 35 yr (54).
Within this time span, the presence of thymic B cells, plasma cells,
and/or their products has been shown in cattle (55),
humans (56), swine (19, 57), and mice
(58). Our observations on the nature of the VDJs recovered
from the porcine thymus are consistent with the idea that cells
expressing productive rearrangements have not been selected. This is
especially surprising, since even in bone marrow, a known site of B
cell lymphogenesis in the fetal piglet (J. Sinkora et al., unpublished
observations) selection is apparent (Fig. 5). Therefore, such a
spectratype can be interpreted to mean that 1) such cells represent an
epiphenomenon in which B cell precursors that migrate to the thymus do
not encounter selection pressures for those with in-frame
rearrangements; 2) the observed spectratype is derived from thymocytes
that have rearranged their heavy chain Ig segments and carry them in a
nonfunctional state; or 3) the thymus is a true site of B cell
lymphogenesis, and our studies have captured pro-B cells before
selection and/or migration to other sites where selection occurs. Ig,
specifically Ig DJ rearrangements, have been reported in human
thymocytes (59, 60). To rule out the second possibility in
swine, we bulk-sorted thymocytes from a late term fetus and T cells
from spleen. We could not identify any developing peripheral T cells
containing VDJ rearrangements (data not shown). Therefore, we conclude
that the VDJ rearrangements in the thymus of fetal piglets are indeed
associated with the B cell lineage, consistent with the recent report
by Akashi et al. that B cell lymphogenesis occurs in the mouse thymus
(61).
Gene conversion is an attractive mechanism for increasing VDJ diversity in species that use few VH genes. However, experimental evidence to support this idea, beyond data obtained by PCR-independent studies in chickens and rabbits, is ambiguous. This is especially true since we show elsewhere that when homologous templates are amplified in the same PCR, a surprisingly high proportion of the resultant VDJs are in vitro chimeras resulting entirely from PCR (62).
Based on the recovery of <200 unique CDR3 sequences associated with only five nonmutated VH genes, junctional diversity in CDR3 accounts for >95% of repertoire diversity during fetal life in piglets. This diversity is associated with no change in length and with only a gradual change in DH usage. Since no maternal factors cross the swine placenta, the subtle changes we did observe in CDR3, such as the gradual shift from DHB to DHA usage and the decline in the proportion of in-frame rearrangements in late gestation, are intrinsic features of the developing preimmune repertoire in this species. The CDR3 length distribution before 50 days of fetal age is oligoclonal in fetal liver and is polyclonal in all lymphoid tissues of older fetuses as well as in the parotid. This may explain the ability of fetal piglets to make Abs to a broad spectrum of Ags during the second half of gestation (25, 26). Considering the limited combinatorial diversity and lack of somatic mutation in fetal piglets, our results are consistent with the views of Davies et al. regarding both Ab (28) and T cell repertoires (63), in that junctional diversity in CDR3 is responsible for most VDJ diversity and perhaps Ab specificity. Interestingly, in sharks, where VDJ rearrangement does not occur and variable regions are encoded by approximately 200 tandomly arrayed VDJs that are already rearranged in the germline, Ab diversity in these elasmobranches is predominately encoded in CDR3 (64). Thus, a species with very restricted combinatorial diversity and those lacking it altogether are still able to generate a diverse Ab repertoire using CDR3 alone.
|
|
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Mention of trade names is necessary to report factually on available data; however, the U.S. Department of Agriculture neither guarantees nor warrants the standard of the product, and the use of the name by the U.S. Department of Agriculture implies no approval of the product to the exclusion of others that may also be suitable.
3 Address correspondence and reprint requests to Dr. J. E. Butler, Department of Microbiology and Iowa Interdisciplinary Immunology Program, University of Iowa, Iowa City, IA 52242.
4 Abbreviations used in this paper: CDR3, complementarity-determining region 3; RF1, reading frame 1; MLN, mesenteric lymph node; IPP, ileal Peyer’s patches.
5 Since a single band seen on a sequencing gel, e.g., 51 bp (Fig. 2B), may represent many different clones of equal CDR3', the term oligoclonal is used here in the vernacular to denote only length distribution.
6 In some literature, the terms in-frame rearrangement and productive rearrangement are used synonymously. Since RF1 in swine contains stop codons in both DHA and DHB, use of the term in-frame rearrangement is more accurate.
Received for publication June 5, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
diversification in cattle. J. Immunol. 161:5438.
/
thymocytes during ontogeny of pigs: a flow cytometry study. J. Immunol. 165:1832. and C repertoire. J. Immunol. 150:1348.[Abstract]
-chain genes maximize the production of useful thymocytes. J. Exp. Med. 178:615. recombination contain in-frame rearrangements: evidence of continued V(D)J recombination in TCR+ thymocytes. Int. Immunol. 5:80.
/ß T cell receptors. Annu. Rev. Immunol. 16:532.
light chain: generation of diversity in the absence of gene rearrangement. Proc. Natl. Acad. Sci. USA 90:9882.This article has been cited by other articles:
|
|
 |
|
  J. E. Butler, N. Wertz, P. Weber, and K. M. Lager Porcine Reproductive and Respiratory Syndrome Virus Subverts Repertoire Development by Proliferation of Germline-Encoded B Cells of All Isotypes Bearing Hydrophobic Heavy Chain CDR3 J. Immunol., February 15, 2008; 180(4): 2347 - 2356. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Butler, C. D. Lemke, P. Weber, M. Sinkora, and K. M. Lager Antibody Repertoire Development in Fetal and Neonatal Piglets: XIX. Undiversified B Cells with Hydrophobic HCDR3s Preferentially Proliferate in the Porcine Reproductive and Respiratory Syndrome J. Immunol., May 15, 2007; 178(10): 6320 - 6331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Butler, P. Weber, and N. Wertz Antibody Repertoire Development in Fetal and Neonatal Piglets. XIII. Hybrid VH Genes and the Preimmune Repertoire Revisited J. Immunol., October 15, 2006; 177(8): 5459 - 5470. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Butler and N. Wertz Antibody Repertoire Development in Fetal and Neonatal Piglets. XVII. IgG Subclass Transcription Revisited with Emphasis on New IgG3 J. Immunol., October 15, 2006; 177(8): 5480 - 5489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Souto-Carneiro, G. P. Sims, H. Girschik, J. Lee, and P. E. Lipsky Developmental Changes in the Human Heavy Chain CDR3 J. Immunol., December 1, 2005; 175(11): 7425 - 7436. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Butler, D. H. Francis, J. Freeling, P. Weber, and A. M. Krieg Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens J. Immunol., November 15, 2005; 175(10): 6772 - 6785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Butler, N. Wertz, J. Sun, H. Wang, P. Chardon, F. Piumi, and K. Wells Antibody Repertoire Development in Fetal and Neonatal Pigs. VII. Characterization of the Preimmune {kappa} Light Chain Repertoire J. Immunol., December 1, 2004; 173(11): 6794 - 6805. [Abstract] [Full Text] [PDF]
|
|
