The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chung, D. H.
Right arrow Articles by Margulies, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, D. H.
Right arrow Articles by Margulies, D. H.
The Journal of Immunology, 2000, 165: 6922-6932.
Copyright © 2000 by The American Association of Immunologists

Mapping the Ligand of the NK Inhibitory Receptor Ly49A on Living Cells

Doo Hyun Chung*, Kannan Natarajan*, Lisa F. Boyd*, José Tormo{dagger}, Roy A. Mariuzza{ddagger}, Wayne M. Yokoyama§ and David H. Margulies1,*

* Molecular Biology Section, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; {dagger} Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Cientificas, Campus de la Universidad Autónoma de Madrid, Madrid, Spain; {ddagger} Center for Advanced Research in Biotechnology, University of Maryland Biotechnology Institute, Rockville, MD 20850; and § Division of Rheumatology, Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO 63110


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have used a recombinant, biotinylated form of the mouse NK cell inhibitory receptor, Ly49A, to visualize the expression of MHC class I (MHC-I) ligands on living lymphoid cells. A panel of murine strains, including MHC congenic lines, was examined. We detected binding of Ly49A to cells expressing H-2Dd, H-2Dk, and H-2Dp but not to those expressing other MHC molecules. Cells of the MHC-recombinant strain B10.PL (H-2u) not only bound Ly49A but also inhibited cytolysis by Ly49A+ effector cells, consistent with the correlation of in vitro binding and NK cell function. Binding of Ly49A to H-2Dd-bearing cells of different lymphoid tissues was proportional to the level of H-2Dd expression and was not related to the lineage of the cells examined. These binding results, interpreted in the context of amino acid sequence comparisons and the recently determined three-dimensional structure of the Ly49A/H-2Dd complex, suggest a role for amino acid residues at the amino-terminal end of the {alpha}1 helix of the MHC-I molecule for Ly49A interaction. This view is supported by a marked decrease in affinity of an H-2Dd mutant, I52 M, for Ly49A. Thus, allelic variation of MHC-I molecules controls measurable affinity for the NK inhibitory receptor Ly49A and explains differences in functional recognition in different mouse strains.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Natural killer cells serve as cytolytic effectors of the immune system to recognize and destroy tumor cells, intracellular parasite-infected cells, and incompatible bone marrow grafts (1, 2). They accomplish this crucial recognition function in part by balancing activating and inhibitory signals that are sensed by plasma membrane receptors for MHC class I (MHC-I)2 molecules (3). Among the best-studied NK receptors are those that mediate inhibition of NK activity, the NK inhibitory receptors, the prototype of which is the mouse molecule Ly49A. This type II cell surface homodimer delivers its inhibitory signal to the NK cell via the phosphorylation of its immunoreceptor tyrosine-based inhibition motif (ITIM) and the recruitment of Src homology 2 (SH2) containing tyrosine phosphatase-1 (SHP-1) phosphatase (4, 5, 6). Functional, binding, and structural studies indicate that a major ligand for Ly49A is the murine MHC-I molecule, H-2Dd, and show that Ly49A requires an H-2Dd ligand complexed with any of a number of known H-2Dd-binding peptides (7, 8). Other Ly49 family members, Ly49C and Ly49I, show specific MHC interactions, but in these cases the specificity also depends on particular peptides (9, 10). Similar peptide-specific interactions have been demonstrated for the NKG2/CD94 inhibitory receptors of the C-type lectin family as well as for inhibitory receptors of the Ig superfamily (11, 12, 13, 14).

Attempts to clarify the molecular basis of the MHC specificity and peptide dependence of the binding reaction have relied until recently on approaches based on in vitro NK functional assays, in vitro adherence assays, or in vivo assays such as tumor or bone marrow graft rejection. The production of recombinant forms of NK inhibitory receptors of the C-type lectin-like family has permitted the evaluation of binding parameters that govern the NK receptor/MHC interaction as well as high resolution structure determination of these receptors (11, 14, 15, 16, 17). Similar approaches have been applied effectively to the NK receptors of the Ig superfamily (18, 19, 20, 21, 22, 23).

We have recently described the in vitro expression and purification of soluble forms of Ly49A that are effective in both binding and structural studies (16, 17), and here we explore the use of a chemically biotinylated form for the analysis of the expression of the naturally expressed cell surface ligand of the molecule. We present a survey of transfected cell lines, lymphoid cell subsets, and different inbred mouse strains, and interpret the observed interactions in the context of the recently determined Ly49A/H-2Dd structure. Analysis of binding of several site-directed mutants of H-2Dd lends support to the importance of the structure at the amino-terminal end of the {alpha}1 helix for Ly49A interaction.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice and cells

BALB/c, C57BL/6, D8 (H-2Dd transgenic B6) (24), BALB.K, B10.A, B10.A(2R), B10.A(4R), B10.A(18R), B10.BR, B10.D2, B10.M, B10.P, B10.S, B10.S(9R), B10.PL, and B10.Q mice were raised under specific pathogen-free conditions and were obtained from Taconic Farms (Germantown, NY). C1498, an H-2b lymphoma, was obtained from the American Type Culture Collection (ATCC; Manassas, VA). The parental line and its H-2Dd, Ld, and Kd transfectants were maintained as described (25).

Production of H-2Dd and Ly49A and surface plasmon resonance binding studies

The extracellular portion of Ly49A extending from amino acid 67–262 (referred to previously as Ly49A EC; Ref. 16) was expressed in Escherichia coli as inclusion bodies, solubilized, refolded, and purified. For surface plasmon resonance experiments it was covalently coupled to the biosensor surface as previously described. For fluorescence detection, Ly49A was chemically biotinylated with sulfosuccinimidyl-6-(biotinamido)hexanoate (EZ-Link sulfo-NHS-LC-Biotin; Pierce, Rockford, IL) in 0.150 M NaCl and 0.1 M phosphate buffer, pH 7.2, following the manufacturer’s instructions. Unreacted sulfo-NHS-LC-Biotin was removed by dialysis. Gel filtration analysis of the biotinylated Ly49A revealed that there were no high m.w. aggregates following the biotinylation. The biotinylated form of this molecule is here referred to as bio-Ly49A. H-2Dd/peptide/ß2-microglobulin (ß2m) complexes were prepared by in vitro refolding of bacterially expressed and denatured H-2Dd heavy chain and ß2m in the presence of synthetic P18-I10 (RGPGRAFVTI) and further purification as described in detail elsewhere (26). The H-2Dd I52 M mutant was generated in the H-2Dd bacterial expression vector by site-directed mutagenesis using the Quickchange mutagenesis kit (Stratagene, La Jolla, CA) using the complementary synthetic oligonucleotides, 5'-CCGCGGGCGCGGTGGATGGAGCAGGAGGGGCCG, and 5'-CGGCCCCTCCTGCTCCATCCACCGCGCCCGCGG. The R50A and R169A mutants were also made, but despite good levels of expression, they failed to refold efficiently, precluding further purification and their use in binding studies. The onlymutant generated for bacterial expression that refolded well was I52 M, which was expressed, refolded with murine ß2m and synthetic P18-I10 (RGPGRAFVTI), and purified as described previously for the wild-type H-2Dd (26). This molecule was examined for binding to anti-H-2Dd mAbs 34-5-8 and 34-2-12 and to in vitro expressed and refolded Ly49A using BIAcore (BIAcore, Piscattaway, NJ) as described in detail previously (16). The refolded parental and mutant H-2Dd molecules had the same reactivity with both mAbs, and concentration/activity ratios were confirmed in each binding experiment by running the test MHC proteins against Ly49A as well as the two mAbs in parallel. Kinetic and steady-state data analysis was performed both on binding curves using BIAeval 3.0 (BIAcore). Representative binding experiments of several performed are shown.

Abs and flow cytometry analysis

The following Abs: anti-H-2Dd: 34-5-8, 34-2-12, 34-1-2, 23-5-21, 34-4-20, and 34-2-12; anti-H-2Db/Ld: 28-14-8; and anti-Ly49AB6: A1 (27) were all produced as tissue culture supernatants, purified on protein A- or protein G-Sepharose, and used as purified protein. Epitopes recognized by 34-2-12 and 28-14-8 have been mapped to the {alpha}3 domains of H-2Dd and H-2Db/Ld, respectively (28, 29), whereas the other anti-H-2Dd map to the amino-terminal {alpha}1 and/or {alpha}2 domains (30). FITC-conjugated 34-2-12, 15-5-5 (anti-H-2Dk), PE-conjugated anti-CD3{epsilon}, anti-NK1.1, anti-B220, streptavidin, and purified 3-25.8 (anti-H-2Dd) were purchased from PharMingen (San Diego, CA).

Cells (1 x 106) were incubated with a saturating amount (3–4.5 µg) of bio-Ly49A in 50 µl of PBS on ice for 30 min. Cells were washed once, streptavidin-PE was added for 30 min on ice, and the cells were washed once again before resuspension in PBS for cytometric analysis. For two-color staining, cells from thymus, spleen, lymph node, and bone marrow were incubated with FITC-conjugated 34-2-12 or PE-conjugated Abs to B220, CD3, and NK1.1, and with bio-Ly49A followed by CyChrome-conjugated streptavidin. To block mAb binding to Fc receptors, all samples were pretreated with anti-CD16/CD32 mAb. For competition experiments, cells were incubated with 10 µg of purified anti-H-2Dd mAb for 30 min. Alternatively, bio-Ly49A was mixed with 10 µg of anti-Ly49A before adding to cells. Cells were analyzed by FACScan (Becton Dickinson, Mountain View, CA), and data were processed with CellQuest software.

Functional NK cell assay

Four-day lymphokine-activated killer (LAK) NK effector cells were prepared by a procedure based upon that of Chadwick and Miller (31) and described in detail previously (32). Briefly, splenocytes were depleted of erythrocytes by hypotonic lysis, passed over nylon wool, and the nonadherent cells were cultured for 4 days in RPMI 1640 plus 10% FCS, supplements (including 50 µM 2-ME), and 400 ng/ml recombinant human IL-2 (Chiron, Emeryville, CA). For target cell preparation, splenocytes were cultured in medium containing 5% FCS, 2 mM glutamine, 20 mM HEPES, and 50 µM 2-ME for 24–30 h in 24-well plates (Falcon Plastics, Lincoln Park, NJ) at 2 x 106 cells/ml with 2 µg/ml Con A (Sigma, St. Louis, MO). On the day of assay, one-tenth volume of 1 M methyl {alpha}-D-mannopyranoside (Sigma) in RPMI 1640 or PBS was added to target cell cultures to block Con A sites before labeling for 1–2 h in 100 µl of 10 mCi/ml [51Cr]Na2CrO4 (Amersham, Arlington Heights, IL) in PBS. All points were determined in triplicate using 1 x 104 target cells per well at ratios indicated in the figures.

In vitro mutagenesis

Site directed mutants of H-2Dd for transfection were generated in a full-length H-2Dd cDNA subcloned in pcDNA-3 using the Quickchange mutagenesis kit (Stratagene). Oligonucleotides for the indicated mutants were: R50A, 5'-TATGAGCCGCGGGCGGCGTGGATAGAGCAGGAG, and 5'-CTCCTGCTCTATCCACGCCGCCCGCGGCTCATA; and for R169A, 5'TGCGTGGAGTGGCTCGCCAGATACCTGAAGAAC, and 5'-GTTCTTCAGGTATCTAAGGGCGAGCCACTCCACGCA. Following mutagenesis, all mutants were sequenced. Transfection of the mutant and parental H-2Dd vectors into C1498 (H-2b) cells was accomplished by electroporation, and stable clones were isolated following selection with G418.

Molecular modeling of the sites of H-2Dd/Ly49A interaction

The crystallographic coordinates of the complex of Ly49A with H-2Dd (protein data bank; Ref. 33 accession number, 1qo3; Ref. 17) were used to visualize the regions of interest of both H-2Dd and the NK receptor. Individual amino acid substitutions were introduced with QUANTA 97 (Molecular Simulations, Waltham, MA), and structures were visualized with SETOR (34) or GRASP (35).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Biotinylated soluble Ly49A protein stains cell surface H-2Dd molecules specifically

We previously reported the engineering of Ly49A molecules expressed in bacteria and refolded in vitro and demonstrated the specificity of their interaction with H-2Dd in surface plasmon resonance binding assays (16). Preliminary experiments indicated that such molecules, when biotinylated, effectively stained spleen cells of appropriate mouse strains. To confirm and extend these findings, we examined cell surface staining of each of the classical MHC-I molecules of the H-2d haplotype, H-2Kd, H-2Dd, and H-2Ld expressed on a cell of the H-2b background (Fig. 1Go). Analysis by flow cytometry showed substantial binding of bio-Ly49A to H-2Dd-transfected C1498 cells compared with cells treated with streptavidin-PE alone (Fig. 1GoA). In contrast to cells transfected with H-2Dd, those expressing H-2Ld or H-2Kd, as well as control parental C1498 cells, failed to stain with bio-Ly49A, confirming the specificity of the binding. Previous Ab studies have established that mAb 34-5-8, which binds a peptide-dependent but not peptide-specific epitope on the {alpha}1{alpha}2 domain of H-2Dd (36) and blocks the functional interaction of Ly49A with H-2Dd (3, 7, 8, 25). As expected, preincubation of H-2Dd-transfected C1498 cells with mAb 34-5-8 decreased the staining by bio-Ly49A in a dose-dependent manner (Fig. 1GoB). In functional experiments, 34-2-12, a mAb that binds an epitope unique to the {alpha}3 domain of H-2Dd (28, 29), fails to reverse the H-2Dd-dependent inhibition of NK cytotoxicity (3) and does not block adhesion of H-2Dd-transfectant C1498 to Ly49A-transfectant Chinese hamster ovary cells (25). Thus, we asked whether this mAb would block the binding of bio-Ly49A to the H-2Dd C1498 transfectant (Fig. 1GoB). As expected, this mAb failed to block the staining with bio-Ly49A, but surprisingly it augmented the ability of the H-2Dd-positive cells to stain with the bio-Ly49A. This increase is a dose-dependent effect (data not shown) and is not due to Ab-dependent activation of the C1498 transfectant because all incubations were performed on ice. This result most likely represents a difference in the spatial accessibility of the cell surface H-2Dd when bound by 34-2-12.



View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 1. Biotinylated Ly49A protein stains H-2Ddtransfectant cells specifically and is blocked by mAb 34-5-8. A, H-2Dd-, Kd-, and Ld-transfected C1498 and C1498 cells were stained with FITC-conjugated 34-2-12 mAb (left; dotted line, unstained cells; solid line, 34-2-12) and bio-Ly49A and streptavidin-PE (right). B, H-2Dd-transfected C1498 cells were preincubated with various concentrations of purified 34-5-8 mAb at 4°C for 30 min, washed with PBS, and then stained with bio-Ly49A and streptavidin-PE (left). In parallel, cells were preincubated with 34-2-12 at 10 µg (right). C, H-2Dd-transfected C1498 cells were exposed to bio-Ly49A following preincubation with the indicated anti-Ly49A mAbs, and then stained with streptavidin-PE as indicated.

 
Other mAbs with reactivity against H-2Dd were also used in similar competition experiments to explore the specificity of bio-Ly49A binding to H-2Dd molecules. Several mAb (34-1-2, 23-5.21, 34-4-20, and 3-25.8) showed partial inhibition of the interaction between Ly49A and H-2Dd, but 28-14-8 (an anti-H-2Db/Ld {alpha}3 domain mAb; Ref. 28, 29) failed to inhibit staining of H-2Dd-positive cells by bio-Ly49A (data not shown). These data are all consistent with the understanding that bio-Ly49A binds the {alpha}1{alpha}2 domain of H-2Dd on the cell surface.

Several mAbs directed against Ly49A have been mapped to the C-type lectin-like NK receptor domain (NKD) (3, 16, 27, 37, 38, 39). We asked whether these mAb would block the interaction of Ly49A with the H-2Dd expressed on transfected C1498 cells (Fig. 1GoC). mAb A1, which is specific for the C57BL/6 allele of Ly49A, significantly inhibited the cell surface interaction of bio-Ly49A and H-2Dd. Similarly, YE1/32 and YE1/48, which are not haplotype specific, also blocked the interaction. These data indicate that H-2Dd is bound by a site on bio-Ly49A that is closely related to that bound by each of these mAbs. YE1/48 fails to completely block the binding of bio-Ly49A, an observation consistent with the sites for these two molecules being only partially overlapping.

Soluble Ly49A protein stains lymph node cells from mouse strains expressing H-2Dd, H-2Dk, and H-2Dp molecules

The interaction of Ly49A with H-2Dd is well substantiated in a wide variety of functional and binding assays. In addition, interaction of Ly49A with H-2Dk has been demonstrated (9, 40). We wished to assess whether bio-Ly49A protein can detect lymph node cells expressing either H-2Dd or H-2Dk, and to survey normal cells from a variety of murine strains to determine the presence of a ligand for Ly49A distinct from H-2Dd and H-2Dk. In initial experiments, C57BL/6, D8, BALB.K, and B10.BR were stained with bio-Ly49A as visualized with PE-streptavidin (Fig. 2Go). Confirming our expectations, strains expressing either H-2Dd (BALB/c and D8) or H-2Dk (BALB.K and B10.BR) bound bio-Ly49A very well. In addition, the intra-MHC recombinant strain B10.S(9R), which has the K end of the MHC from H-2s and the D end from H-2d, stained well with this reagent (Fig. 3Go). B10.P, which has recently been shown to encode a molecule that serves in Ly49A NK cell recognition (41), showed a low, but clearly positive and consistent, level of binding (Fig. 3Go). A wider survey of murine strains was performed (see Table IGo), revealing interaction of bio-Ly49A with all of those strains expressing H-2Dd, H-2Dk, and H-2Dp. In contrast, lymph node cells from B6, B10.A(2R), B10.A(4R), B10.M, B10.S, and B10.Q did not stain. These data indicated that bio-Ly49A specifically distinguished cells expressing H-2Dd, H-2Dk, or H-2Dp from other cells that do not express these molecules. In particular, no interaction was seen with molecules of b, q, f, or s haplotypes. The intensity of staining of lymph node cells from B10.BR and BALB.K (H-2k) was lower than that from those strains expressing H-2Dd (Table IGo).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 2. Expression of H-2Dd and H-2Dk on lymph node cells from the indicated mouse strains. Lymph node cells from BALB/c, D8, BALB. K, and B10.BR mice were stained with FITC-conjugated 34-2-12 or 15-5-5 mAb (upper panels) for analyzing expression of H-2Dd and H-2Dk. Bio-Ly49A followed by streptavidin-PE profiles are shown in the lower panels. The dotted line indicates unstained cells in upper panel and cells stained with streptavidin-PE alone are shown in lower panel.

 


View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 3. MHC-I molecules stained by bio-Ly49A. Lymph node cells from various mouse strains were stained with bio-Ly49A followed by streptavidin-PE (solid line) and streptavidin-PE alone (dotted line). The upper panels represent one experiment, the lower panels another.

 

View this table:
[in this window]
[in a new window]
  		Table I. Staining of different mouse strains with bio-Ly49Aa

 
Although H-2u (B10.PL) is known to be a mouse strain with a natural intra-H-2 recombination, deriving its H-2D locus from the H-2d haplotype, the NK effector function of this strain has not been analyzed. Because our staining results indicated that B10.PL expressed a ligand for bio-Ly49A at a level comparable to that of B10.D2 (Fig. 4GoA), we investigated the role of H-2Dd as expressed in the B10.PL mouse using NK functional assays. Ly49A+ NK cells recognize H-2Dd in a developmental phase (40, 42, 43) as well as during target cell recognition (3, 44). To compare the NK cell recognition in both of these phases, we examined the cytotoxicity of LAK cells raised from both B10.D2 and B10.PL (Fig. 4GoB). As expected, B10.D2 effectors efficiently killed target Con A blasts of both ß2-m-/- and C57BL/6 strains. B10.D2 and B10.PL targets were resistant to NK lysis, presumably due to their expression of H-2Dd. Similarly, B10.PL effectors killed target Con A blasts of both ß2m-/- and C57BL/6 strains. These experiments indicate that the H-2Dd of B10.PL functions equivalently to that of H-2Dd of B10.D2 in NK cell recognition.



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4. Expression and functional analysis of NK cells from B10.D2 and B10.PL. A, Staining pattern of lymph node cells from B6, B10.PL, and B10.D2 with bio-Ly49A. Lymph node cells from the indicated mouse strains were stained with either bio-Ly49A (solid line) or a control-biotinylated soluble protein (dotted line) followed by streptavidin-PE. B, Four-day cultured LAK cells from B10.D2 and B10.PL mice were generated as described in Materials and Methods and tested on target Con A-activated lymphoblasts from the indicated strains.

 
Level of staining with bio-Ly49A directly correlates with level of expression of H-2Dd on the surface of cells of different lymphoid populations

The ligands for a number of NK receptors have been characterized, not only with respect to their MHC-I specificity, but also concerning their ability to discriminate different bound peptides (9, 10, 45). The Ly49A/H-2Dd interaction appears peptide dependent but not peptide specific (7, 8). Using bio-Ly49A we surveyed a variety of different lymphoid tissues and, using multiparameter flow cytometry, evaluated specific populations of cells for their expression of MHC-I, specific cell lineage markers, and the expression of the Ly49A ligand. If Ly49A were only to interact with a subset of cells, this would reflect on the specificity of the MHC/Ly49A interaction, or possibly indicate the presence of other ligands for this NK receptor. In addition, because different subsets of lymphoid cells (46, 47, 48) as well as cells at different stages of lymphocyte development or activation (49, 50, 51, 52, 53, 54) express different patterns of glycans on their cell surface molecules, effects of carbohydrate sequence and composition on Ly49A binding might be detected in such a survey of tissues. The potential role of carbohydrate in Ly49A recognition has been hypothesized because Ly49A is structurally related to the C-type lectins and because the conserved sites of N-asparaginyl carbohydrate moieties on murine MHC-I molecules at positions 86 and 176 are adjacent to the primary contact regions where Ly49A interacts with H-2Dd in the crystal structure (17). Cells from thymus, bone marrow, lymph node, and spleen of BALB/c (Fig. 5Go) and B10.PL (data not shown) mice were stained with bio-Ly49A. Although a significant proportion of thymic cells were low or negative for the H-2Dd {alpha}3 domain marker, 34-2-12, as well as for the Ly49A ligand, the relationship of 34-2-12 staining to staining with bio-Ly49A was linear. In addition, virtually all cells from the bone marrow, spleen, and lymph node stained as double positive for bio-Ly49A and H-2Dd (Fig. 5Go). Furthermore, when CD3+, B220+, or NK1.1+ cells from the spleen were gated, virtually 100% of each of these populations stained positively with bio-Ly49A (Fig. 3GoB). Thus, the relationship between the expression of Ly49A ligand and H-2Dd seems direct and appears unrelated to tissue-specific markers, at least concerning distinct compartments of the lymphoid system.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 5. Staining pattern of various lymphoid tissues and cell types using bio-Ly49A. A, Thymus, lymph node, spleen, and bone marrow cells from BALB/c mice were stained with bio-Ly49A followed by streptavidin-PE and FITC-conjugated 34-2-12 mAb. B, Spleen cells were stained with bio-Ly49A, CyChrome-conjugated streptavidin, and one of PE-conjugated anti-CD3{epsilon}, anti-B220, or anit-NK1.1. These data were analyzed among the CD3{epsilon}-, B220-, and NK1.1-positive cells of spleen, respectively. The dotted line indicates unstained cells.

 
Amino acid sequence comparisons of MHC-I molecules

Additional insight into the nature of the interaction between Ly49A and H-2Dd, H-2Dk, and H-2Dp, and the lack of binding to other molecules including H-2Ld, H-2Lq, and molecules of b, f, q, and s haplotypes can be obtained by alignment of amino acid sequences of these molecules at positions that have been shown to make contact with Ly49A in the crystal structure (see Table IIGo). The crystal structure of the Ly49A/H-2Dd complex is notable in that the Ly49A homodimer interacts at two distinct sites known as "site 1" and "site 2" on the H-2Dd molecule (17). These sites differ in that site 1 involves amino acid residues at the amino-terminal side of the {alpha}1 helix as well as residues at the carboxyl-terminal region of the {alpha}2 helix of H-2Dd, whereas site 2 lies beneath the platform formed by the {alpha}1 and {alpha}2 domains and encompasses a very large surface area. Neither binding nor functional analysis have yet resolved the relative contribution of the two sites for MHC binding and recognition.


View this table:
[in this window]
[in a new window]
  		Table II. Alignment of polymorphic amino acid sequences at positions of Ly49A/H-2Dd contact residuesa

 
The comparison shown in Table IIGo reveals that, of the D and L locus molecules that fail to bind Ly49A in our assay, Db, Dq, Ld, and Lq lack arginine (R) at both positions 50 and 169. Arginine alone at either 50 (Ds) or 169 (Df) is insufficient for this level of binding. Consideration of K locus allelic residues confirms the view that both Arg50 and Arg169 are necessary for Ly49A binding because Kd, Kq, Ks, and Ku lack at least one of these apparently critical residues. We cannot evaluate the contribution to binding of Ku because this molecule was examined only when Dd was coexpressed in the B10.PL, H-2u strain. The lack of binding by Kk and Kf, despite the conservation of arginine residues at both 50 and 169, can be explained by the residues at positions 173 and 174; glutamine (Q) and leucine (L) for Kk and glutamic acid (E) and arginine (R) for Kf seem to exercise some inhibitory or steric effect on the Ly49A/MHC interaction.

The sequence of H-2Kb is the most difficult to correlate with its known lack of functional activity and its failure to bind to Ly49A. Its sequence is identical with that of H-2Dd at site 1 positions 50, 55, 56, 169, 173, and 174. (Also, its residues at site 2 contacts: 121 and 138 are identical.) In addition, it differs at positions 2, 30, and 104 (site 2 contacts), serine (S), asparagine (N), and glutamic acid (E), respectively, in H-2Dd and proline (P), aspartic acid (D), and glycine (G) in H-2Kb. The only residue at or near the site 1 interface that differs between H-2Dd and H-2Kb is residue 52, a noncontact residue, which is isoleucine (I) in H-2Dd and methionine (M) in all the other H-2D and L alleles examined. Ks and Ku have isoleucine 52, but they lack the 50 and 169 arginine-arginine pair. Thus, the likely explanation for the lack of reactivity of H-2Kb with Ly49A is that molecules that have lysine (K) and asparagine (N) at 173 and 174 must have isoleucine (I) at 52. Molecules that have M at 52 appear to compensate for this with EL at 173 and 174. Overall, then, the analysis of the murine MHC-I molecules that bind bio-Ly49A suggests that the arginine residues at positions 50 and 169 are important for Ly49A interaction, but they alone are not sufficient for either for binding or for function. Effects of I or M at position 52 (not a contact residue) may be compensated for by the coexpressed residues at 173 and 174. In an effort to evaluate the contributions of some of these particular polymorphic residues, site-directed mutants of H-2Dd were generated and analyzed.

Analysis of mutants of H-2Dd

The simplest explanation for the allele-specific binding by Ly49A is that both arginines at residues 50 and 169 are required for Ly49A functional interaction and staining with bio-Ly49A. To test this possibility, we generated individual site directed mutants, changing arginine at position 50 to alanine, or arginine at position 169 to alanine in the expressed proteins. (Mutations to alanine were made to eliminate the positive contributions of the Arg50 and Arg169 without introducing additional constraints that might be imposed by the substitution of the polymorphic amino acids at these positions.) These mutations were generated in a full-length cDNA clone in an expression vector and stably transfected into C1498 cells. As shown in Fig. 6GoA, the intensity of staining of a population of transfectant cells expressing a homogeneous level of H-2Dd was slightly reduced for each of the two single point mutants. This suggests that the individual contribution of each of these amino acids may represent a relatively small proportion of the total binding energy as detected in the FACS staining. Ideally, we would also like to analyze the binding of soluble forms of each of these two mutants in vitro to establish a more accurate quantitation of the differences. Despite our efforts to engineer the mutant H-2Dd molecules in a soluble form in bacteria that could be used in binding studies, neither the R50A nor the R169A single mutants produced molecules that we could refold effectively to allow the necessary efficiency in purification. Therefore, we generated the in vitro mutant encoding I52 M for expression in bacteria, refolded the mutant protein with synthetic P18-I10 peptide and murine ß2m, and purified the mutant protein for binding studies.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 6. Binding of Ly49A to mutant H-2Dd molecules. A, Site-directed mutants of H-2Dd, R50A and R169A, were generated and expressed following transfection into C1498 cells as described in Materials and Methods. Bio-Ly49A staining of a narrowly gated homogeneous H-2Dd-positive population was plotted in the histogram. Nontransfected C1498 (solid line), positive control H-2Dd-transfectant (clone Dd-4) heavy line, H-2Ddm R50A (dotted line), and R169A (dashed line) were stained with both 34-2-12 (anti-Dd {alpha}3 domain) and bio-Ly49A as described in detail in Materials and Methods. B, Purified, bacterially expressed and in vitro refolded H-2Dd and its I52 M mutant (C) were tested for binding at the indicated concentrations to immobilized Ly49A in a surface plasmon resonance binding assay. Arrows indicate the initiation and termination of the injection of the solution phase analyte. Kd values were calculated from global analysis of kinetic curves and from Scatchard analysis of the steady-state binding levels.

 
As shown in Fig. 6Go, B and C, the binding of the wild-type H-2Dd/P18-I10 protein showed a characteristic dose-dependent pattern in the interaction with recombinant Ly49A as we have reported previously (16). Global curve-fitting analysis of the kinetics of binding revealed an equilibrium affinity constant for dissociation (Kd) of 9.7 µM, a value consistent with our previously reported results. In a parallel experiment, using the single point mutant I52 M H-2Dd/P18-I10 protein (Fig. 6GoC), the binding to the same Ly49A surface revealed an affinity of 27 µM, 2.8-fold weaker. Thus, the single amino acid substitution of a noncontact residue, isoleucine 52 substituted with methionine, leads to a small, but detectable and significant reduction in the affinity for the Ly49A NK inhibitory receptor.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The availability of engineered forms of NK receptors that accurately mimic the binding activities of their natural cell surface counterparts has allowed the measurement of in vitro binding parameters and has provided the substrate for crystallization and x-ray structure determination. In this paper we report the use of chemically biotinylated, recombinant Ly49A in a survey of the cell surface expression of the ligand for Ly49A on living lymphoid cells by flow cytometry. This recombinant Ly49A preserves the ability to interact with all anti-Ly49A mAbs that have been tested; it contains the full extracellular portion of the molecule, including the stem region and the NKD; and it is a noncovalent dimer with a dimerization constant of ~7 µM (16). The staining we have observed is specific, and analysis of cells transfected with genes encoding the classical MHC-I molecules of the d haplotype, H-2Kd, H-2Dd, and H-2Ld, confirmed the H-2Dd specificity of Ly49A. Staining with bio-Ly49A reveals a distribution pattern among different inbred mouse strains consistent with the previous assignment of H-2Dd and H-2Dk (40), which was based on the down-regulation of Ly49A expression in mice expressing these particular MHC-I molecules. In addition, our present studies confirm the recent identification of H-2Dp (41, 55) as a ligand for Ly49A. In an analysis of binding of multivalent MHC preparations ("tetramers") to various Ly49-transfectant cell lines and to cells of an Ly49A-transgenic mouse line, Ly49A was shown to bind to both H-2Dd and H-2Dk tetramers (9). In that study, both a cell-cell adhesion assay and an elegant functional inhibition assay revealed interaction of Ly49A with MHC of all haplotypes examined with the exception of H-2b. However, this functional assay was based on transgenic expression of Ly49A in T cells and it may not be fully representative of the normal interaction of Ly49A with MHC-I ligands. Our direct binding assay using recombinant bio-Ly49A failed to detect interaction with molecules of s, q, or f haplotype, suggesting the threshold of detection with our assay may be higher. Nevertheless, the direct binding of bio-Ly49A that we observe correlates well with the biologically significant, known interactions of Ly49A with H-2Dd, H-2Dk, and H-2Dp. In addition, binding of Ly49A to cells of the recombinant haplotype H-2u, expressed in B10.PL, correlated with H-2Dd-dependent function of B10.PL cells both as NK effectors and as NK targets.

It is informative to evaluate the pattern of the binding of Ly49A to various MHC molecules in the context of Ab blocking experiments and amino acid sequence alignments. It is also useful to consider these patterns in the context of the recently determined crystallographic structure of the H-2Dd/Ly49A complex (17). This structure revealed the homodimeric structure of the Ly49A NKD, as well as the interactions of the NKD with two distinct regions of H-2Dd. One subunit of the Ly49A homodimer interacted with amino acid residues at the amino terminus of the {alpha}1 helix and with carboxyl-terminal residues of the {alpha}2 helix of H-2Dd (site 1). The other major interface between Ly49A and H-2Dd (site 2) is between the second Ly49A subunit and an extensive region of the MHC molecule that lies beneath the floor of the peptide binding groove, making contact with residues of the {alpha}2, {alpha}3, and ß2m domains. The interface at site 1 is relatively small (994 Å2) but shows high shape complementarity as calculated by the algorithm of Lawrence and Colman (56) and reveals a number of interactions between oppositely charged residues. Site 2 is quite large (~3400 Å2) but has shape complementarity comparable to that of TCR/MHC interfaces and is in the same range as that of the CD2/CD58 complex (17). In our experiments, the binding to H-2Dd was blocked by the {alpha}1{alpha}2 domain-specific Ab, 34-5-8, but was not blocked, and was even augmented, by the {alpha}3 domain mAb 34-2-12. Because 34-5-8 reactivity maps to the {alpha}1{alpha}2 domain unit (28, 30) and is dependent on polymorphic amino acid residues of the amino-terminal part of the {alpha}2 domain (57, 58, 59), the blocking of the Ly49A interaction by 34-5-8, as well as the failure of 34-2-12 to block are consistent with the site 1 interaction. We believe that the site 1 interaction represents the trans interaction of Ly49A on an NK cell and H-2Dd on the target. Site 2 interactions are consistent with the observed cis effects of H-2Dd expression on Ly49A expression and function (60, 61, 62). In addition, site 2 interactions may play a role in multivalent binding in trans, between the NK cell and its target. Cell-cell adhesion and functional NK cell-target cell interaction may require interactions at both sites 1 and 2.

Several studies, analyzing the interaction of different MHC-I molecules with different members of the Ly49 family of NK receptors using adhesion or functional assays, provide some indication of the specificity of this recognition. Early examples of the H-2Dd and H-2Dk interaction with Ly49A were based on function and adhesion (63, 64, 65). The later study emphasized the importance of Ly49A density in mediating detectable adhesion. Two studies (7, 8) clearly indicated that the functional recognition of H-2Dd by the B6 allele of Ly49A required the presence of some H-2Dd-binding peptide to allow proper conformation of the MHC molecule. Although this correlated closely with the presence of the peptide-dependent 34-5-8 epitope, Orihuela et al. (7) demonstrated that preservation of the epitope with high levels of hß2m was insufficient for preserving the functional interaction with Ly49A. More recently, an analysis of H-2Kd/H-2Dd recombinant molecules (25) revealed that polymorphic amino acid residues in the {alpha}1 domain and the amino-terminal region of {alpha}2 of H-2Dd were most critical for Ly49A interaction. Double mutants of H-2Dd based on structural differences observed in the floor of the peptide binding groove between H-2Dd and the noninteracting H-2Db, converting residues 73 and 156 of Dd to the Db amino acids, had a clear effect in the natural resistance of mice to tumors bearing these substituted H-2Dd molecules (66). In a global survey of adhesion and binding, H-2Dd was shown to interact strongly with Ly49A, C, and G2, and that Ly49A and Ly49C, particularly, reveal broad specificity for different MHC molecules (9). In vitro binding studies using recombinant Ly49A and bacterially expressed H-2Dd (16) revealed interactions of modest affinity, but with high specificity for the MHC molecule. Recently, the analysis of the functional interaction of H-2Dd with two different receptors, Ly49A, an inhibitory receptor, and Ly49D, an activating receptor, has been reported, shedding light on differences in these interactions. Although a number of point mutants of H-2Dd showed little effect on the functional recognition by the inhibitory receptor Ly49A, the great majority of these had significant effects on Ly49D activation function (67). Although these results may be interpreted as indicative of qualitative differences in the interaction of the two NK receptors with the same ligand, these data may also be interpreted as revealing that Ly49A has a higher intrinsic affinity for H-2Dd than Ly49D, and thus is less sensitive to the effects of individual MHC substitutions.

Although it is difficult to consolidate all these results into a single coherent model, several features are consistent. The intrinsic affinity of the monomeric H-2Dd/Ly49A interaction is sufficiently high (6–26 µM) to account for the adhesion and functional effects seen in cell-cell assays (16). There is a requirement for some minimal surface density of Ly49A and H-2Dd to allow the detection of stable adhesion, a view consistent with the need for multivalent interactions, and revealed in threshold effects of adhesion as well as function (64). Mutants of H-2Dd that seem to have the greatest effects on Ly49A or Ly49D interactions are those that involve multiple amino acid residues of H-2Dd, whereas single amino acid substitutions seem to exert relatively mild effects in Ly49A/H-2Dd interactions. Thus, it appears that interactions of the Ly49A with H-2Dd in particular, and of Ly49 family members with MHC-I molecules in general, are not particularly sensitive to single amino acid changes in the MHC-I molecule, and rather function by sensing a global conformation of the MHC-I molecule.

Based on the reactivity pattern of staining with our biotinylated recombinant Ly49A protein, which is consistent with observed functional assays of Ly49A/MHC-I interactions, we focused our attention on amino acids 50 and 169 of the H-2Dd molecule, and examined cells transfected with the R50A or R169A mutated genes. These single point mutations showed slight, if any decrease in the staining profiles as compared with the parental H-2Dd transfectant (Fig. 6Go). In an effort to confirm the impression of a slightly lower level of binding, we attempted to engineer soluble analogs of R50A and R169A, but failed to obtain molecules that we could purify in a quantity sufficient for binding studies. Therefore, we directed our attention to the one amino acid residue in the general vicinity of site 1 that distinguishes the nonbinding H-2Kb from H-2Dd, residue 52, which is isoleucine in H-2Dd and methionine in H-2Kb. Recombinant H-2Dd protein bearing this mutation showed a reproducible decrease in apparent affinity for Ly49A at one-half to one-third the Kd value of the parental molecule.

Although it is surprising that a substitution of M for I at a buried residue near the interface would exert a major effect on the binding of Ly49A, there are examples of buried residue substitutions that have profound biological effects. One is the valine 97 to lysine substitution of the heat-labile enterotoxin of E. coli (68). A survey of "void regions" in the interior of proteins suggests that mutants affecting the molecular packing in protein interiors may contribute to function or stability (69). In the comparison of the structures of H-2Kb (which has M at 52) and H-2Dd (I at 52), we observe a moderate but significant conformational difference. When the {alpha}1/{alpha}2 domains of H-2Dd and H-2Kb are superimposed, consistent differences in the main chain atoms are observed around residues 52–54. One of the consequences of this shift in the main chain is that the carbonyl of residue 54 in H-2Kb is 1.8 Å away from its position in H-2Dd. This seems particularly significant when one considers that the only main chain-main chain hydrogen bond between Ly49A and H-2Dd is this one between residue 54 of H-2Kb and the backbone nitrogen of residue 248 of Ly49A. Looking at the {phi}-{psi} angles for residues in this region, we observe that the largest change occurs in the {phi} angle of residue 52 (from -104 to -75), a change which seems to propagate and probably gives rise to the shift in the carbonyl of residue 54. This conformation difference between H-2Kb and H-2Dd around residue 52 seems to be due to the lack of a branched side chain. This structural distortion is similar to that which results in differential affinity of CD8 for HLA-A2 as compared with HLA-Aw68, which has low affinity for CD8. This effect has been mapped to a polymorphism at residue 245 (A-V) where the larger valine side chain of HLA-Aw68 triggers a shift in the position of the CD8-binding loop (70).

To assist in the visualization of the contact residues, this region of the H-2Dd, H-2Db, and H-2Kb structures is shown in Figs. 7Go and 8Go. Fig. 7Go illustrates the conformation of residues R50, R169, K173, and N174 as well as I52 and Q54 of H-2Dd and compares this with the same region of the H-2Db and H-2Kb structures. It is clear that R169, K173, and R50 form a basic ridge available for interaction with Ly49A at site 1 (Fig. 7Go). Fig. 8Go shows a molecular surface representation of the same three molecules. It is clear that the Ly49A contact residues form a linear arrangement available for contacts with Ly49A. Db lacks the R50 and R169 charged anchor points, and K173 alone is insufficient to compensate for their loss. In the Kb structure it is not apparent why the alignment of the three residues is inadequate to permit the Ly49A to dock. We suggest that the substitution of M at position 52 of H-2Kb for the I of H-2Dd plays a critical role in this interaction. As noted above, the main chain-main chain hydrogen bond between the carbonyl of Q54 of Dd and the amine of V248 of Ly49A seems to be critically influenced by the presence or absence of I or M at position 52. This hydrogen bond is illustrated in Fig. 9Go.



View larger version (74K):
[in this window]
[in a new window]
  		FIGURE 7. Structure of H-2Dd, H-2Db, and H-2Kb in the region of site 1. X-ray coordinates of H-2Dd (Protein Data Bank number 1QO3) were displayed with SETOR (A and B). MHC-I heavy chain is depicted in blue and the light chain, ß2m, in pink. Bound peptide is in yellow. Domains are labeled. H-2Db (1HOC) and H-2Kb (2VAA) are shown for comparison.

 


View larger version (90K):
[in this window]
[in a new window]
  		FIGURE 8. Molecular surface representation of the site 1 residues. Molecular surfaces of Dd, Db, and Kb were displayed with GRASP (35 ). Left, Surface charge representations with blue (indicating basic) and red (showing acidic regions). Right, Bound peptide is colored light blue, residue 169 is red, 173 is green, 174 is blue, and 50 is magenta. Residue 52 has no surface-exposed regions.

 


View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 9. The single main chain-main chain hydrogen bond at the site 1 interface between Ly49A and H-2Dd. Residues Q247, V248, and F249 of Ly49A and W51, I52, E53, Q54, and E55 of H-2Dd were displayed from the 1QO3 structure using SETOR (34 ). Main chain hydrogen bonds in this region are shown with dotted lines.

 
Our study of the direct interaction of bio-Ly49A with naturally expressed MHC molecules on lymphoid tissues of a variety of genetically defined mouse strains offers another opportunity to gain insight into the physiological relevance of sites 1 and 2. The failure of 34-2-12 to block binding is consistent with functional data on the use of these Abs and is most consistent with site 1 (the trans interaction) being of crucial importance in functional recognition.

Another important aspect of our analysis using recombinant Ly49A to stain cell surfaces of a variety of different subsets of lymphoid cells is that the binding of Ly49A seems not to be greatly influenced by the particular subset of cells examined. Because different cell lineages have distinct glycan moieties attached to their cell surface molecules (71), and MHC-I molecules in particular exhibit distinct species of N-linked oligosaccharide moieties in the course of their biosynthesis (72), it is remarkable that Ly49A does not seem to discriminate different populations of lymphoid cells. This is consistent with the view that Ly49A primarily interacts with the protein structure of H-2Dd and is relatively insensitive to the nature of the bound carbohydrate.

In summary, we have shown that a recombinant, engineered bio-Ly49A protein specifically stains H-2Dd, H-2Dk, and H-2Dp molecules expressed on cell surfaces, and that the staining intensity for its ligands directly correlated with the expression level of these molecules. Comparison of sequences and structures of ligands bound suggests the importance of amino acids in the vicinity of contact site 1, a view supported by analysis of several point mutants of H-2Dd. The general strategy of using soluble Ly49 preparations for analysis of expression and function may be applicable to other members of the Ly49 family and of the larger C-type lectin-like superfamily.


   Acknowledgments
 
We appreciate the help of the members of our laboratories for reagents, encouragement, and criticism. We thank M. Nakamura for providing her manuscript before publication.


   Footnotes
 
1 Address correspondence and reprint requests to Dr. David H. Margulies, Molecular Biology Section, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, Building 10, Room 11N311, National Institutes of Health, Bethesda, MD 20892-1892. Back

2 Abbreviations used in this paper: MHC-I, MHC class I; ß2m, ß2-microglobulin; LAK, lymphokine-activated killer; NKD, NK receptor domain. Back

Received for publication February 16, 2000. Accepted for publication September 12, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, T. P. Salazar-Mather. 1999. Natural killer cells in antiviral defense: function and regulation by innate cytokines. Annu. Rev. Immunol. 17:189.[Medline]
  2. Lanier, L. L.. 1998. NK cell receptors. Annu. Rev. Immunol. 16:359.[Medline]
  3. Karlhofer, F. M., R. K. Ribaudo, W. M. Yokoyama. 1992. MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature 358:66.[Medline]
  4. Binstadt, B. A., K. M. Brumbaugh, P. J. Leibson. 1997. Signal transduction by human NK cell MHC-recognizing receptors. Immunol. Rev. 155:197.[Medline]
  5. Yokoyama, W. M.. 1999. Natural killer cells. W. E. Paul, ed. Fundamental Immunology 575. Lippincott, Philadelphia.
  6. Yokoyama, W. M.. 1997. What goes up must come down: the emerging spectrum of inhibitory receptors. J. Exp. Med. 186:1803.[Free Full Text]
  7. Orihuela, M., D. H. Margulies, W. M. Yokoyama. 1996. The natural killer cell receptor Ly-49A recognizes a peptide-induced conformational determinant on its major histocompatibility complex class I ligand. Proc. Natl. Acad. Sci. USA 93:11792.[Abstract/Free Full Text]
  8. Correa, I., D. H. Raulet. 1995. Binding of diverse peptides to MHC class I molecules inhibits target cell lysis by activated natural killer cells. Immunity 2:61.[Medline]
  9. Hanke, T., H. Takizawa, C. W. McMahon, D. H. Busch, E. G. Pamer, J. D. Miller, J. D. Altman, Y. Liu, D. Cado, F. A. Lemonnier, P. J. Bjorkman, D. H. Raulet. 1999. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11:67.[Medline]
  10. Franksson, L., J. Sundback, A. Achour, J. Bernlind, R. Glas, K. Kärre. 1999. Peptide dependency and selectivity of the NK cell inhibitory receptor Ly-49C. Eur. J. Immunol. 29:2748.[Medline]
  11. Brooks, A. G., F. Borrego, P. E. Posch, A. Patamawenu, C. J. Scorzelli, M. Ulbrecht, E. H. Weiss, J. E. Coligan. 1999. Specific recognition of HLA-E, but not classical, HLA class I molecules by soluble CD94/NKG2A and NK cells. J. Immunol. 162:305.[Abstract/Free Full Text]
  12. Posch, P. E., F. Borrego, A. G. Brooks, J. E. Coligan. 1998. HLA-E is the ligand for the natural killer cell CD94/NKG2 receptors. J. Biomed. Sci. 5:321.[Medline]
  13. Peruzzi, M., N. Wagtmann, E. O. Long. 1996. A p70 killer cell inhibitory receptor specific for several HLA-B allotypes discriminates among peptides bound to HLA-B*2705. J. Exp. Med. 184:1585.[Abstract/Free Full Text]
  14. Vales-Gomez, M., H. T. Reyburn, R. A. Erskine, M. Lopez-Botet, J. L. Strominger. 1999. Kinetics and peptide dependency of the binding of the inhibitory NK receptor CD94/NKG2-A and the activating receptor CD94/NKG2-C to HLA-E. EMBO J. 18:4250.[Medline]
  15. Boyington, J. C., A. N. Riaz, A. Patamawenu, J. E. Coligan, A. G. Brooks, P. D. Sun. 1999. Structure of CD94 reveals a novel C-type lectin fold: implications for the NK cell-associated CD94/NKG2 receptors. Immunity 10:75.[Medline]
  16. Natarajan, K., L. F. Boyd, P. Schuck, W. M. Yokoyama, D. Eilat, D. H. Margulies. 1999. Interaction of the NK cell inhibitory receptor Ly49A with H-2Dd: identification of a site distinct from the TCR site. Immunity 11:591.[Medline]
  17. Tormo, J., K. Natarajan, D. H. Margulies, R. A. Mariuzza. 1999. Crystal structure of a lectin-like natural killer cell receptor bound to its MHC class I ligand. Nature 402:623.[Medline]
  18. Vales-Gomez, M., H. T. Reyburn, R. A. Erskine, J. Strominger. 1998. Differential binding to HLA-C of p50-activating and p58-inhibitory natural killer cell receptors. Proc. Natl. Acad. Sci. USA 95:14326.[Abstract/Free Full Text]
  19. Rajagopalan, S., E. O. Long. 1997. The direct binding of a p58 killer cell inhibitory receptor to human histocompatibility leukocyte antigen (HLA)-Cw4 exhibits peptide selectivity. J. Exp. Med. 185:1523.[Abstract/Free Full Text]
  20. Fan, Q. R., L. Mosyak, C. C. Winter, N. Wagtmann, E. O. Long, D. C. Wiley. 1997. Structure of the inhibitory receptor for human natural killer cells resembles haematopoietic receptors. Nature 389:96.[Medline]
  21. Snyder, G. A., A. G. Brooks, P. D. Sun. 1999. Crystal structure of the HLA-Cw3 allotype-specific killer cell inhibitory receptor KIR2DL2. Proc. Natl. Acad. Sci. USA 96:3864.[Abstract/Free Full Text]
  22. Maenaka, K., T. Juji, D. I. Stuart, E. Y. Jones. 1999. Crystal structure of the human p58 killer cell inhibitory receptor (KIR2DL3) specific for HLA-Cw3-related MHC class I. Structure 7:391.[Medline]
  23. Chapman, T. L., A. P. Heikema, P. J. Bjorkman. 1999. The inhibitory receptor LIR-1 uses a common binding interaction to recognize class I MHC molecules and the viral homolog UL18. Immunity 11:603.[Medline]
  24. Bieberich, C., T. Yoshioka, K. Tanaka, G. Jay, G. Scangos. 1987. Functional expression of a heterologous major histocompatibility complex class I gene in transgenic mice. Mol. Cell Biol. 7:4003.[Abstract/Free Full Text]
  25. Matsumoto, N., R. K. Ribaudo, J. P. Abastado, D. H. Margulies, W. M. Yokoyama. 1998. The lectin-like NK cell receptor Ly-49A recognizes a carbohydrate-independent epitope on its MHC class I ligand. Immunity 8:245.[Medline]
  26. Li, H., K. Natarajan, E. L. Malchiodi, D. H. Margulies, R. A. Mariuzza. 1998. Three-dimensional structure of H-2Dd complexed with an immunodominant peptide from human immunodeficiency virus envelope glycoprotein 120. J. Mol. Biol. 283:179.[Medline]
  27. Nagasawa, R., J. Gross, O. Kanagawa, K. Townsend, L. L. Lanier, J. Chiller, J. P. Allison. 1987. Identification of a novel T cell surface disulfide-bonded dimer distinct from the {alpha}ß antigen receptor. J. Immunol. 138:815.[Abstract]
  28. Evans, G., D. Margulies, B. Shykind, J. Seidman, K. Ozato. 1982. Exon shuffling: mapping polymorphic determinants on hybrid mouse transplantation antigens. Nature 300:755.[Medline]
  29. McCluskey, J., J. A. Bluestone, J. E. Coligan, W. L. Maloy, D. H. Margulies. 1986. Serologic and T cell recognition of truncated transplantation antigens encoded by in vitro deleted class I major histocompatibility genes. J. Immunol. 136:1472.[Abstract]
  30. McCluskey, J., L. Boyd, M. Foo, J. Forman, D. H. Margulies, J. A. Bluestone. 1986. Analysis of hybrid H-2D and L antigens with reciprocally mismatched aminoterminal domains: functional T cell recognition requires preservation of fine structural determinants. J. Immunol. 137:3881.[Abstract]
  31. Chadwick, B. S., R. G. Miller. 1992. Hybrid resistance in vitro: possible role of both class I MHC and self peptides in determining the level of target cell sensitivity. J. Immunol. 148:2307.[Abstract]
  32. Chung, D. H., J. Dorfman, D. Plaksin, K. Natarajan, I. M. Belyakov, R. Hunziker, J. A. Berzofsky, W. M. Yokoyama, M. G. Mage, D. H. Margulies. 1999. NK and CTL recognition of a single chain H-2Dd molecule: distinct sites of H-2Dd interact with NK and TCR. J. Immunol. 163:3699.[Abstract/Free Full Text]
  33. Bernstein, F. C., T. F. Koetzle, G. J. Williams, Jr E. E. Meyer, M. D. Brice, J. R. Rodgers, O. Kennard, T. Shimanouchi, M. Tasumi. 1977. The Protein Data Bank: a computer-based archival file for macromolecular structures. J. Mol. Biol. 112:535.[Medline]
  34. Evans, S. V.. 1993. SETOR: hardware lighted three-dimensional solid model representations of macromolecules. J. Mol. Graphics 11:134.[Medline]
  35. Nicholls, A., K. A. Sharp, B. Honig. 1991. Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11:281.[Medline]
  36. Otten, G. R., E. Bikoff, R. K. Ribaudo, S. Kozlowski, D. H. Margulies, R. N. Germain. 1992. Peptide and ß2-microglobulin regulation of cell surface MHC class I conformation and expression. J. Immunol. 148:3723.[Abstract]
  37. Takei, F.. 1983. Two surface antigens expressed on proliferating mouse T lymphocytes defined by rat monoclonal antibodies. J. Immunol. 130:2794.[Abstract]
  38. Chan, P. Y., F. Takei. 1989. Molecular cloning and characterization of a novel murine T cell surface antigen, YE1/48. J. Immunol. 142:1727.[Abstract]
  39. Lian, R. H., Y. Li, S. Kubota, D. L. Mager, F. Takei. 1999. Recognition of class I MHC by NK receptor Ly-49C: identification of critical residues. J. Immunol. 162:7271.[Abstract/Free Full Text]
  40. Karlhofer, F. M., R. Hunziker, A. Reichlin, D. H. Margulies, W. M. Yokoyama. 1994. Host MHC class I molecules modulate in vivo expression of a NK cell receptor. J. Immunol. 153:2407.[Abstract]
  41. Olsson-Alheim, M. Y., J. Sundback, K. Kärre, C. L. Sentman. 1999. The MHC class I molecule H-2Dp inhibits murine NK cells via the inhibitory receptor Ly49A. J. Immunol. 162:7010.[Abstract/Free Full Text]
  42. Dorfman, J. R., D. H. Raulet. 1996. Major histocompatibility complex genes determine natural killer cell tolerance. Eur. J. Immunol. 26:151.[Medline]
  43. Held, W., J. R. Dorfman, M. F. Wu, D. H. Raulet. 1996. Major histocompatibility complex class I-dependent skewing of the natural killer cell Ly49 receptor reportoire. Eur. J. Immunol. 26:2286.[Medline]
  44. Karlhofer, F. M., R. K. Ribaudo, W. M. Yokoyama. 1992. The interaction of Ly-49 with H-2Dd globally inactivates natural killer cell cytolytic activity. Trans. Assoc. Am. Physicians 105:72.[Medline]
  45. Winter, C. C., J. E. Gumperz, P. Parham, E. O. Long, N. Wagtmann. 1998. Direct binding and functional transfer of NK cell inhibitory receptors reveal novel patterns of HLA-C allotype recognition. J. Immunol. 161:571.[Abstract/Free Full Text]
  46. Wagner, H., C. Hardt, R. Bartlett, M. Rollinghoff, K. Pfizenmaier. 1980. Intrathymic differentiation of cytotoxic T lymphocyte (CTL) precursors. I. The CTL immunocompetence of peanut agglutinin-positive (cortical) and negative (medullary) Lyt 123 thymocytes. J. Immunol. 125:2532.[Abstract]
  47. Baum, L. G., K. Derbin, N. L. Perillo, T. Wu, M. Pang, C. Uittenbogaart. 1996. Characterization of terminal sialic acid linkages on human thymocytes: correlation between lectin-binding phenotype and sialyltransferase expression. J. Biol. Chem. 271:10793.[Abstract/Free Full Text]
  48. Engelmann, S., O. Ebeling, R. Schwartz-Albiez. 1995. Modulated glycosylation of proteoglycans during differentiation of human B lymphocytes. Biochim. Biophys. Acta 1267:6.[Medline]
  49. London, J., S. Berrih, J. F. Bach. 1978. Peanut agglutinin. I. A new tool for studying T lymphocyte subpopulations. J. Immunol. 121:438.[Abstract/Free Full Text]
  50. London, J., S. Berrih, M. Papiernik. 1979. Peanut agglutinin. III. Study of T lymphocyte differentiation during murine ontogeny. Dev. Comp. Immunol. 3:343.[Medline]
  51. London, J.. 1980. Peanut agglutinin: VI. Identification of murine T lymphocyte subsets during ontogenesis by use of peanut agglutinin and Ly-6.2 antiserum. J. Immunol. 125:1702.[Abstract]
  52. Gillespie, W., J. C. Paulson, S. Kelm, M. Pang, L. G. Baum. 1993. Regulation of {alpha} 2,3-sialyltransferase expression correlates with conversion of peanut agglutinin PNA+ to PNA- phenotype in developing thymocytes. J. Biol. Chem. 268:3801.[Abstract/Free Full Text]
  53. Wu, W., J. A. Punt, L. Granger, S. O. Sharrow, K. P. Kearse. 1997. Developmentally regulated expression of peanut agglutinin PNA- specific glycans on murine thymocytes. Glycobiology 7:349.[Abstract/Free Full Text]
  54. Kearse, K. P., G. W. Hart. 1991. Lymphocyte activation induces rapid changes in nuclear and cytoplasmic glycoproteins. Proc. Natl. Acad. Sci. USA 88:1701.[Abstract/Free Full Text]
  55. Sentman, C. L., M. Y. Olsson-Alheim, U. Lendahl, K. Kärre. 1996. H-2Dp transgene alters natural killer cell specificity at the target and effector cell levels: comparison with an H-2Dd transgene. J. Immunol. 156:2423.[Abstract]
  56. Lawrence, M. C., P. M. Colman. 1993. Shape complementarity at protein/protein interfaces. J. Mol. Biol. 234:946.[Medline]
  57. Abastado, J. P., C. Jaulin, M. P. Schutze, P. Langlade-Demoyen, F. Plata, K. Ozato, P. Kourilsky. 1987. Fine mapping of epitopes by intradomain Kd/Dd recombinants. J. Exp. Med. 166:327.[Abstract/Free Full Text]
  58. Stroynowski, I., S. Clark, L. A. Henderson, L. Hood, M. McMillan, J. Forman. 1985. Interaction of {alpha}1 with {alpha}2 region in class I MHC proteins contributes determinants recognized by antibodies and cytotoxic T cells. J. Immunol. 135:2160.[Abstract]
  59. Sundback, J., M. C. Nakamura, M. Waldenstrom, E. C. Niemi, W. E. Seaman, J. C. Ryan, K. Kärre. 1998. The {alpha}2 domain of H-2Dd restricts the allelic specificity of the murine NK cell inhibitory receptor Ly-49A. J. Immunol. 160:5971.[Abstract/Free Full Text]
  60. Kåse, A., M. H. Johansson, M. Y. Olsson-Alheim, K. Kärre, P. Höglund. 1998. External and internal calibration of the MHC class I-specific receptor Ly49A on murine natural killer cells. J. Immunol. 161:6133.[Abstract/Free Full Text]
  61. Olsson-Alheim, M. Y., M. Salcedo, H. G. Ljunggren, K. Kärre, C. L. Sentman. 1997. NK cell receptor calibration: effects of MHC class I induction on killing by Ly49Ahigh and Ly49Alow NK cells. J. Immunol. 159:3189.[Abstract]
  62. Olsson, M. Y., K. Karre, C. L. Sentman. 1995. Altered phenotype and function of natural killer cells expressing the major histocompatibility complex receptor Ly-49 in mice transgenic for its ligand. Proc. Natl. Acad. Sci. USA 92:1649.[Abstract/Free Full Text]
  63. Daniels, B. F., M. C. Nakamura, S. D. Rosen, W. M. Yokoyama, W. E. Seaman. 1994. Ly-49A, a receptor for H-2Dd, has a functional carbohydrate recognition domain. Immunity 1:785.[Medline]
  64. Kane, K. P.. 1994. Ly-49 mediates EL4 lymphoma adhesion to isolated class I major histocompatibility complex molecules. J. Exp. Med. 179:1011.[Abstract/Free Full Text]
  65. Chang, C. S., L. Shen, D. E. Gong, K. P. Kane. 1996. Major histocompatibility complex class I-dependent cell binding to isolated Ly-49A: evidence for high-avidity interaction. Eur. J. Immunol. 26:3219.[Medline]
  66. Waldenstrom, M., J. Sundback, M. Y. Olsson-Alheim, A. Achour, K. Kärre. 1998. Impaired MHC class I (H-2Dd)-mediated protection against Ly-49A+ NK cells after amino acid substitutions in the antigen binding cleft. Eur. J. Immunol. 28:2872.[Medline]
  67. Nakamura, M. C., S. Hayashi, E. C. Niemi, J. C. Ryan, W. E. Seaman. 2000. Activating Ly-49D and inhibitory Ly-49A natural killer cell receptors demonstrate distinct requirements for interaction with H2-Dd. J. Exp. Med. 192:447.[Abstract/Free Full Text]
  68. Merritt, E. A., S. Sarfaty, M. Pizza, M. Domenighini, R. Rappuoli, W. G. Hol. 1995. Mutation of a buried residue causes loss of activity but no conformational change in the heat-labile enterotoxin of Escherichia coli. Nat. Struct. Biol. 2:269.[Medline]
  69. Williams, M. A., J. M. Goodfellow, J. M. Thornton. 1994. Buried waters and internal cavities in monomeric proteins. Protein Sci. 3:1224.[Medline]
  70. Gao, G. F., J. Tormo, U. C. Gerth, J. R. Wyer, A. J. McMichael, D. I. Stuart, J. I. Bell, E. Y. Jones, B. K. Jakobsen. 1997. Crystal structure of the complex between human CD8{alpha}{alpha} and HLA-A2. Nature 387:630.[Medline]
  71. Marth, J. D.. 1999. Chapter 34 515. Glycosylation changes in ontogeny and cell activation. In Essentials of Glycobiology. A. Varki, R. Cummings, J. Esko, H. Freeze, G. Hart, and J. Marth, eds. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  72. Hayes, B. K., F. Esquivel, J. R. Bennink, J. W. Yewdell, A. Varki. 1995. Structure of the N-linked oligosaccharides of MHC class I molecules from cells deficient in the antigenic peptide transporter: implications for the site of peptide association. J. Immunol. 155:3780.[Abstract]



This article has been cited by other articles:


Home page
 BloodHome page
E. T. Durkin, K. A. Jones, D. Rajesh, and A. F. Shaaban
Early chimerism threshold predicts sustained engraftment and NK-cell tolerance in prenatal allogeneic chimeras
Blood, December 15, 2008; 112(13): 5245 - 5253.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. J. Lavender, H. H. Chau, and K. P. Kane
Distinctive Interactions at Multiple Site 2 Subsites by Allele-Specific Rat and Mouse Ly49 Determine Functional Binding and Class I MHC Specificity
J. Immunol., November 15, 2007; 179(10): 6856 - 6866.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. L. Rogers, A. Rouhi, F. Takei, and D. L. Mager
A Role for DNA Hypomethylation and Histone Acetylation in Maintaining Allele-Specific Expression of Mouse NKG2A in Developing and Mature NK Cells
J. Immunol., July 1, 2006; 177(1): 414 - 421.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Radaev, M. Kattah, Z. Zou, M. Colonna, and P. D. Sun
Making Sense of the Diverse Ligand Recognition by NKG2D
J. Immunol., December 1, 2002; 169(11): 6279 - 6285.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Y. L. Yu, N. Netuschil, L. Lybarger, J. M. Connolly, and T. H. Hansen
Cutting Edge: Single-Chain Trimers of MHC Class I Molecules Form Stable Structures That Potently Stimulate Antigen-Specific T Cells and B Cells
J. Immunol., April 1, 2002; 168(7): 3145 - 3149.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Sundback, A. Achour, J. Michaelsson, H. Lindstrom, and K. Karre
NK Cell Inhibitory Receptor Ly-49C Residues Involved in MHC Class I Binding
J. Immunol., January 15, 2002; 168(2): 793 - 800.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. Zimmer, V. Ioannidis, and W. Held
H-2D Ligand Expression by Ly49A+ Natural Killer (NK) Cells Precludes Ligand Uptake from Environmental Cells: Implications for NK Cell Function
J. Exp. Med., November 19, 2001; 194(10): 1531 - 1539.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Wang, M. C. Whitman, K. Natarajan, J. Tormo, R. A. Mariuzza, and D. H. Margulies
Binding of the Natural Killer Cell Inhibitory Receptor Ly49A to Its Major Histocompatibility Complex Class I Ligand. CRUCIAL CONTACTS INCLUDE BOTH H-2Dd AND beta 2-MICROGLOBULIN
J. Biol. Chem., January 4, 2002; 277(2): 1433 - 1442.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chung, D. H.
Right arrow Articles by Margulies, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, D. H.
Right arrow Articles by Margulies, D. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS