|
|
||||||||

*
Department of Pathology, Case Western Reserve University, Cleveland, OH 44106; and
Department of Internal Medicine, University of Iowa, and Veterans Affairs Medical Center, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Bacterial DNA has immunostimulatory properties due to the presence of
CpG motifs, which consist of a central unmethylated CG dimer in
particular base contexts (in the mouse, often with two upstream purines
and two downstream pyrimidines) (19, 20, 21). Such
unmethylated CpG motifs are suppressed in mammalian DNA. Synthetic
oligodeoxynucleotides (ODN) that contain CpG motifs (CpG ODN) mimic
bacterial DNA and have a similar ability to activate immune responses.
CpG ODN activate splenocytes and induce production of multiple
cytokines, including IL-6, IL-12, and IFN-
. Administration of CpG
ODN or related DNA preparations with protein Ag in vivo enhances Th1
responses, characterized by increased production of IFN-
, decreased
production of IL-5, and production of Ag-specific IgG2a, a
Th1-associated isotype (22, 23). These DNA preparations
have potent adjuvant activities in a number of vaccine applications
(22, 23, 24, 25, 26, 27, 28).
One mechanism for the adjuvant activity of CpG ODN may be modulation of Ag processing by macrophages, DCs, or B cells. We define Ag processing broadly as the set of mechanisms that convert protein Ags to peptide-MHC-II complexes and regulate the half-life of these complexes (because their half-life may be controlled by endocytosis and intracellular events). Ag presentation is defined to be the interactions that occur at the cell surface between peptideMHC complexes and TCRs, plus interactions between other accessory molecules on the surfaces of APCs and T cells that promote T cell responses. Overnight treatment of macrophages with CpG ODN was recently shown to inhibit macrophage Ag processing, due in part to a decrease in synthesis of MHC-II molecules, and CpG ODN were not found to enhance Ag processing by macrophages at any time point (29). In contrast, other recent studies have shown that treatment of DCs with CpG ODN increases cell surface expression of MHC-II, CD40, CD80, and CD86 (14, 15), but these studies did not examine other protein Ag-processing functions in detail.
The studies presented here address the effects of CpG ODN on protein Ag processing for the production of two different peptide-MHC-II complexes, bovine RNase A (RNase)4256:I-Ak, and hen egg lysozyme (HEL)4861:I-Ak, which are produced by different processing mechanisms. HEL4861:I-Ak complexes are produced in late endocytic compartments using nascent I-Ak molecules, whereas RNase4256:I-Ak complexes are produced in early endosomes using (at least in part) recycling I-Ak molecules (30). Treatment of DCs with CpG ODN caused a transient enhancement in processing of both HEL and RNase to produce HEL4861:I-Ak and RNase4256:I-Ak complexes. However, after 2 days of exposure to CpG ODN, DCs were unable to process HEL to produce HEL4861:I-Ak complexes, yet were still able to process RNase to produce RNase4256:I-Ak complexes, although with somewhat reduced efficiency. Thus, fully mature DCs did not express Ag-processing mechanisms that use nascent MHC-II, but maintained processing mechanisms that use recycling MHC-II.
| Materials and Methods |
|---|
|
|
|---|
Bone marrow cells were isolated from CBA/J mice (The Jackson Laboratory, Bar Harbor, ME) and cultured to produce DCs (31). Femurs were flushed with DMEM (Life Technologies, Rockville, MD), and cells were passed through a 70-µm cell strainer, pelleted, and resuspended for 10 min in 0.83% NH4Cl to lyse erythrocytes. The remaining cells were incubated for 1 h at 4°C with a combination of mAbs purified from supernatants of B hybridomas GK1.5 (anti-CD4), 53-6.72 (anti-CD8), RA3-3A1/61 (anti-B220), H116-32 (anti-I-Ak), and 10-3.6.2 (anti-I-Ak) (American Type Culture Collection (ATCC), Manassas, VA); each Ab was present at 20 µg/108 bone marrow cells. The cells were pelleted and resuspended for 1 h at 37°C in complement (Accurate, Westbury, NY) diluted 1:10 in RPMI 1640 (Life Technologies). Cells were cultured in 24-well plates (106 cells/well) in RPMI 1640 supplemented with 5% FCS, 50 mM 2-ME, 25 mM HEPES, L-glutamine, 20 µg/ml gentamicin, and 500 U/ml GM-CSF (PharMingen, San Diego, CA). Nonadherent cells were removed every 2 days by gently swirling the plates, removing 70% of the medium, and replacing it with fresh medium containing GM-CSF. DCs were harvested by pipetting on day 6, depleted of granulocytes using magnetic beads (Dynal, Lake Success, NY), coated with anti-GR-1 (PharMingen), incubated for 2 h in 100-mm Petri dishes to remove adherent macrophages, and harvested by vigorous pipetting. DCs were distinguished from macrophages by dendritic morphology, pattern of intracellular acid phosphatase staining (focal perinuclear distribution for DCs vs diffuse cytoplasmic distribution for macrophages) (32), expression of higher levels of CD11c, and lower expression of macrophage markers (F4/80 and CD11b).
Oligodeoxynucleotides
ODN were provided by Coley Pharmaceutical Group (Wellesley, MA). ODN were phosphorothioate-modified to increase their resistance to nuclease degradation. Most studies were performed with the following ODN (CpG motifs or the corresponding non-CpG sequence are underlined): CpG ODN 1826, TCCATGACGTTCCTGACGTT; and non-CpG ODN 1982, TCCAGGACTTCTCTCAGGTT. Some studies also used CpG ODN 1758, TCTAGCGTGCGCCAT; CpG ODN 1760, ATAATCGACGTTCAAGCAAG; CpG ODN 1840, TCCATGTCGTTCCTGTCGTT; non-CpG ODN 1911, TCCAGGACTTTCCTCAGGTT; and an ODN with a methylated (therefore inactive) CpG sequence, ODN 1979, TCCAT GTZGTTCCTGTZGTT.
ODN were dissolved in TE (10 mM Tris, 1 mM EDTA). LPS content of ODN was <1 ng LPS/mg DNA as measured by Limulus amebocyte assay (QCL-1000; BioWhittaker, Walkersville, MD). The maximum concentration of ODN in cell cultures was 1 µg/ml, resulting in a maximum potential LPS concentration of <1 pg/ml.
Flow cytometry
DCs were incubated in 96-well V-bottom plates
(105/well) for 30 min at 4°C with PBS, 1% FCS,
and 10% normal mouse serum and stained with PE-conjugated mAbs (from
PharMingen), i.e., rat anti-murine CD40 (clone 3/23), hamster
anti-murine CD80 (clone 16-10A1), rat anti-murine CD86 (clone
GL1), or an isotype control (rat IgG2a or hamster
IgG). MHC-II was labeled with a combination of biotinylated Abs to the
I-Ak
-chain (H116-32) and
I-Ak ß-chain (10-3.6.2; ATCC). Biotinylated
AF6-88.5.3 (anti-H-2Kb) provided an
IgG2a isotype control Ab. Binding of biotinylated
primary Abs was detected with FITC-streptavidin (PharMingen).
Incubations with Abs were done in the presence of 10% normal mouse
serum. After immunolabeling, cells were washed in PBS, fixed in 2%
paraformaldehyde in PBS, examined in a FACScan flow cytometer (Becton
Dickinson Immunocytometry Systems, San Jose, CA) and analyzed using
CellQuest software (Becton Dickinson Immunocytometry Systems).
Endocytosis was examined by culturing DCs for 3 or 24 h with 1
mg/ml FITC-dextran (20 kDa; Sigma, St. Louis, MO) at 4°C (control for
surface binding of FITC-dextran) or 37°C (to assess endocytosis).
Cells were washed three times with ice-cold PBS, fixed with 2%
paraformaldehyde, and analyzed by flow cytometry.
Ag-processing assays
DCs (106/well) were incubated for 24 h in 24-well plates with HEL or RNase with or without CpG ODN or non-CpG ODN at 1 µg/ml, washed, and incubated without Ag for 0, 24, or 48 h in the continued presence or absence of CpG ODN or non-CpG ODN. DCs were transferred to 96-well plates (2 x 104 cells/well), fixed with 0.5% paraformaldehyde, incubated with 0.2 M lysine, and washed extensively. Peptide:MHC-II complexes were detected with T hybridomas obtained from Paul Allen and Emil Unanue (Washington University, St. Louis. MO): TS12, specific for RNase4256:I-Ak, and 3A9, specific for HEL4861:I-Ak. T hybridoma cells (105/well) were incubated with fixed DCs for 2024 h. Supernatants were assessed for IL-2 using a CTLL-2 bioassay (described below). Ag-processing reactions were performed in triplicate, and data points are presented as mean ± SD. Statistical significance was evaluated using Students t test. For exposure of DCs to ODN before Ag, DCs were incubated with or without ODN at 1 µg/ml in 24-well plates (106 cells/well) for 24 or 48 h, transferred to 96-well plates (2 x 104 DCs/well), incubated with or without brefeldin A (BFA, 1 µg/ml; Sigma) for 3 h, incubated with Ag for 3 h in the continued presence or absence of BFA, and fixed and processed for T hybridoma assay.
CTLL-2 bioassay for IL-2 with spectrophotometric readout
A CTLL-2 bioassay for IL-2 (33) was modified for spectrophotometric readout (34, 35). CTLL-2 cells were cultured in 96-well plates for 24 h with supernatants from T hybridoma assays, and 15 µl Alamar Blue (Alamar Biosciences, Sacramento, CA) was added for 1824 h. Alamar Blue is an oxidation-reduction indicator that is reduced by metabolically active cells, producing a shift in relative absorbance at wavelengths near 570 and 600 nm. Both reduced and oxidized forms have high absorbance near 570 nm, but only the oxidized form has high absorbance near 600 nm. CTLL-2 growth was assessed by subtracting OD595 from OD550 using a plate spectrophotometer (Bio-Rad Laboratories, Hercules, CA). The Alamar Blue assay gave results similar to CTLL-2 proliferation assays using [3H]methylthymidine incorporation (similar threshold sensitivity, plateau, and IL-2 dose-response curves). The Alamar Blue assay showed a minimum response of CTLL-2 cells to culture with 0.0040.04 U/ml recombinant murine IL-2 (2 U/ng; Roche, Indianapolis, IN), a half-maximal response to 0.04 U/ml IL-2, and a plateau response to 0.44 U/ml IL-2.
RNA isolation and analysis by real-time quantitative PCR
Total RNA was isolated from 5 x 106 DCs using RNeasy (Qiagen, Valencia, CA), resuspended in diethylpyrocarbonate-treated water, and stored at -80°C. RNA (1 µg) was converted to cDNA using a SuperScript preamplification system (Life Technologies) for first-strand cDNA synthesis. Ten percent of the cDNA product was used for real-time quantitative PCR using a high-speed thermal cycler (LightCycler; Roche Diagnostics, Indianapolis, IN) and detection of product by SYBR Green I (36, 37, 38). The amplification cycle was 90°C for 0 s, 50°C for 5 s, and 72°C for 20 s. Melting curves confirmed that only one product was amplified. PCR primers for detection of I-Aßk were determined using OLIGO 6.4 (Molecular Biology Insights, Cascade, CO) and consisted of a 5'-3' sense primer, GCGACGTGGGCGAGTACC, and a 5'-3' antisense primer, CATTCCGGAACCAGCGCA. Specific cDNA was quantified with a standard curve based on known amounts of XhoI-derived fragment from a 1-kb Aßk insert of plasmid pcExv-3 (39). Mouse ß-actin primers (Stratagene, La Jolla, CA) used as an internal control consisted of a 5'-3' sense primer, TGTGATGGTGGGAATGGGTCAG, and a 5'-3' antisense primer, TTTGATGTCACGCACGATTTCC. To generate a standard curve for ß-actin, amplified cDNA product was purified from an agarose gel using a QiaQuick gel extraction kit (Qiagen).
| Results |
|---|
|
|
|---|
DCs were analyzed by flow cytometry either immediately after
isolation or after isolation and culture for 48 h with or without
CpG ODN (1 µg/ml), non-CpG ODN (1 µg/ml), or LPS (10 µg/ml). DCs
isolated from day 6 bone marrow cultures expressed moderate levels of
MHC-II, low levels of CD80 and CD86, and almost no CD40 (Fig. 1
). DCs that were cultured for an
additional 2 days in media alone had a slight decrease in MHC-II
expression and slight increases in expression of CD80, CD86, and CD40.
Culture with CpG ODN 1826 increased the expression of MHC-II and
greatly enhanced expression of CD80, CD86, and CD40. These effects were
specific for CpG-ODN and were not seen with non-CpG ODN 1982 (Fig. 2
, and data not shown). Other CpG ODN
(1758, 1760, and 1840) similarly enhanced expression of MHC-II, but
addition of inactive control ODN (non-CpG ODN 1911 or ODN 1979 with a
methylated CpG sequence) did not affect MHC-II expression. The effects
observed with CpG ODN were not due to LPS contamination, because both
CpG and non-CpG ODN had undetectable levels of LPS (<1 ng LPS/mg DNA
and <1 pg LPS/ml in culture), and the effects were only observed with
ODN containing the CpG motif. Incubation of DCs with LPS (10 µg/ml)
for 2 days also increased expression of MHC-II, CD80, CD86, and CD40.
In summary, exposure of DCs to CpG ODN increased expression of MHC-II
and greatly enhanced expression of CD80, CD86, and CD40.
|
|
Ag processing was examined using two different Ags, RNase and HEL, which contain epitopes that are processed via different mechanisms (30). HEL4861:I-Ak complexes are generated in late endocytic compartments via a processing mechanism that requires nascent (newly synthesized) I-Ak molecules, whereas RNase4256:I-Ak complexes are generated in early endosomes via a processing mechanism that can use recycling I-Ak molecules (30). The two processing mechanisms also exhibit different kinetics and dependence on Ag-processing components such as HLA-DM/H2-DM and invariant chain (30).
DCs from day 6 cultures were incubated with soluble Ag with or without
CpG ODN for 2448 h, washed, and fixed either immediately or after
incubation for an additional 24 h in the continuing presence or
absence of CpG ODN. T hybridoma assays assessed expression of
HEL4861:I-Ak or
RNase4256:I-Ak complexes.
CpG ODN enhanced generation of both
RNase4256:I-Ak and
HEL4861:I-Ak complexes by
DCs (Fig. 3
), although optimum
enhancement was achieved at different time points with the two Ags.
Expression of
RNase4256:I-Ak was
enhanced by CpG ODN after 24 h, whereas optimal enhancement of
expression of
HEL4861:I-Ak occurred
after an additional 24-h chase incubation. Ag processing was enhanced
by CpG ODN at 0.1, 0.3, 1, and 3 µg/ml, whereas non-CpG ODN at 1 or 3
µg/ml had no significant effect on Ag processing (data not shown).
Thus, enhancement of Ag processing was specific for CpG ODN. Addition
of LPS with Ag also enhanced processing of both epitopes (data not
shown). Thus, CpG ODN enhanced DC Ag processing, and additional
experiments were performed to determine specific mechanisms that
contributed to this enhancement.
|
|
Although CpG ODN initially enhance Ag processing, these agents
promote DC maturation, which has been associated with an ultimate
decrease in Ag-processing functions. However, prior studies have not
examined Ag-processing functions in detail or distinguished the effects
of DC maturation on different Ag-processing mechanisms. Treatment of DC
with CpG ODN for 48 h profoundly blocked subsequent processing of
HEL to produce
HEL4861:I-Ak complexes
(Fig. 5
), a process that requires nascent
MHC-II (see below). This effect was specific for CpG ODN; non-CpG ODN
had no effect on Ag processing (Fig. 5
). Exposure of DCs to CpG ODN for
only 24 h before the addition of Ag produced a lesser inhibition
of HEL4861:I-Ak
processing (data not shown). To confirm the requirement for nascent
MHC-II in this process, DCs were incubated for 3 h with or without
BFA, incubated for 3 h with Ag in the continued presence or
absence of BFA, and fixed and assessed for expression of
HEL4861:I-Ak complexes.
Consistent with our prior studies with macrophages (30),
processing of HEL by DCs to produce
HEL4861:I-Ak complexes
was inhibited by BFA (Fig. 5
), consistent with the hypothesis that this
process requires nascent MHC-II. Thus, CpG ODN caused long-term
inhibition of DC Ag-processing mechanisms that rely on nascent
MHC-II.
|
Because exposure to CpG ODN inhibited processing mechanisms that
depend on nascent MHC-II, we examined the effect of CpG ODN on the
expression of MHC-II mRNA. DCs were incubated for 24 h with or
without CpG ODN, total RNA was isolated, 1 µg of total RNA was
converted to cDNA, and 10% of the product was included in each
real-time quantitative PCR. As indicated in Table I
, treatment with CpG ODN reduced the
relative expression of
I-Aßk cDNA to 36% of
control (normalized to ß-actin expression). Thus, treatment of DCs
with CpG ODN resulted in a substantial reduction in MHC-II mRNA
levels.
|
To determine whether Ag-processing mechanisms that use recycling
MHC-II persist after CpG DNA-enhanced maturation of DCs, we examined DC
processing of RNase to produce
RNase4256:I-Ak complexes
(30). DCs were cultured with or without CpG ODN or
non-CpG ODN for 2 days, with or without BFA for 3 h, and with
RNase in the continuing presence or absence of BFA for 3 h. DCs
were then fixed and assessed for expression of
RNase4256:I-Ak complexes
(Fig. 6
). BFA produced a partial
inhibition of
RNase4256:I-Ak
processing, but a substantial proportion of this processing was BFA
resistant, confirming the use of recycling MHC-II by this processing
mechanism in DCs. Treatment with CpG ODN inhibited processing of
RNase4256:I-Ak, but a
significant proportion of this activity was also CpG resistant (in
contrast, the processing of
HEL4861:I-Ak was
completely blocked by CpG ODN, Fig. 5
).
RNase4256:I-Ak processing
that persisted after treatment with CpG ODN was completely resistant to
BFA, indicating that Ag-processing functions maintained in fully mature
DCs (after exposure to CpG ODN) exclusively use recycling MHC-II, not
nascent MHC-II. CpG ODN mediated inhibition of
RNase4256:I-Ak processing
via mechanisms besides inhibition of nascent MHC-II, because processing
of RNase4256:I-Ak was
significantly lower in CpG ODN-treated DCs than in BFA-treated DCs
(decreased Ag endocytosis is a likely explanation; see below).
|
In addition to regulating Ag processing by modulation of MHC-II
synthesis, another mechanism whereby CpG ODN could modulate Ag
processing is by alteration of Ag uptake. Endocytosis by DCs was
measured by uptake of FITC-dextran (changes in the endocytosis of
FITC-dextran accurately reflect changes in the endocytosis of
radiolabeled HEL and RNase, data not shown). DCs were cultured for
24 h with FITC-dextran in the presence or absence of CpG ODN or
non-CpG ODN (a parallel of conditions that enhance Ag processing, Fig. 3
). The cells were washed, fixed, and examined by flow cytometry. The
mean fluorescence value (MFV) of DCs cultured with FITC-dextran at
4°C was subtracted from the MFV of DCs cultured with FITC-dextran at
37°C to calculate
MFV, a measure of endocytosis. This analysis
showed that endocytosis of FITC-dextran was enhanced in the first
24 h of exposure to CpG ODN (Table II
). To assess later effects on
endocytosis, DCs were cultured for 2 days with or without CpG ODN or
non-CpG ODN and then incubated with FITC-dextran for 3 h at 4°C
or 37°C (a parallel to conditions that inhibit Ag processing, Figs. 5
and 6
). Exposure to CpG ODN for 2 days decreased subsequent endocytosis
by DCs to 53% of the control level (Table II
). Overall, CpG ODN caused
short-term enhancement of endocytosis followed by a long-term decrease
in endocytosis (associated with DC maturation). Thus, the ability of
CpG ODN to modulate Ag processing by DCs involves modulation of both
MHC-II synthesis and Ag endocytosis.
|
| Discussion |
|---|
|
|
|---|
, TNF-
, or IL-12 by macrophages, DCs, and
NK cells (reviewed in Ref. 20). CpG ODN influence Ag
processing, but the effects observed depend on cell type and length of
exposure to CpG ODN. CpG ODN cause biphasic changes in Ag processing by
DCs, with initial enhancement followed by a long-term decrease (Table III
|
The long-term effects of CpG ODN included decreased DC Ag processing
(Figs. 5
and 6
) and sustained expression of previously generated
peptide-MHC-II complexes (Fig. 4
). Inhibition of Ag processing was
correlated with decreased expression of MHC-II mRNA (Table I
) and
decreased endocytosis (Table II
). In addition to decreasing Ag uptake,
inhibition of endocytosis may decrease internalization of MHC-II
molecules, potentially decreasing the supply of recycling MHC-II
molecules involved in the production of
RNase4256:I-Ak complexes.
Despite the long-term decrease in Ag processing, CpG ODN prolonged
expression of peptide-MHC-II complexes that were formed before (or
during) the induction of DC maturation. The mechanism for enhancing the
half-life of peptide-MHC-II complexes is not known, but may relate to
decreased endocytosis of MHC-II molecules, because turnover, removal,
or degradation of peptide-MHC-II complexes may be dependent on their
endocytosis. Long-term enhancement of Ag presentation is supported by
the ability of CpG ODN to increase expression of accessory molecules,
e.g., CD80, CD86, and CD40, as well as MHC-II (Fig. 1
, and Refs.
14, 15 , and 17). In summary, the presence of
CpG ODN during initial exposure to exogenous Ag increases the half-life
of peptide-MHC-II complexes generated during the processing of that Ag,
prolonging presentation of the Ag even after loss of Ag-processing
functions by mature DCs.
The changes in DC function induced by CpG ODN are similar to those induced by other substances that promote DC maturation. Phagocytosis and endocytosis are generally decreased upon maturation of DCs or Langerhans cells (2, 8, 11, 13, 40, 41). Certain other microbial products (e.g., LPS and double-stranded RNA) also decrease DC Ag-processing function and promote sustained presentation of previously processed Ags (1, 2, 3, 4, 5, 6, 7, 9, 10, 13, 42, 43, 44, 45, 46). Thus, CpG ODN and certain other microbial products similarly induce DC maturation, a transient increase in Ag processing, a subsequent decline in Ag-processing function, and sustained presentation of peptide-MHC-II complexes. The consequence may be to focus presentation on Ags processed soon after exposure to CpG DNA or other microbial products, resulting in enhanced presentation of a cohort of microbial Ags that were present in this frame in the sequence of events. To summarize this "freeze-frame" hypothesis, DCs are exposed to a continuous stream of self or nonself Ags, but exposure to CpG DNA causes the processing treadmill to freeze and Ag presentation to maintain focus on one frame of this sequence, correlating with the point of microbial Ag exposure. The induction of DC maturation is also associated with migration of DCs to lymph nodes, enabling presentation to naive T cells and the priming of T cell responses.
Our data reveal a novel exception to the cessation of Ag processing that accompanies DC maturation. Although fully mature DCs cannot process Ag via mechanisms that use nascent MHC-II to produce peptide-MHC-II complexes in late endocytic compartments, even these cells can still process Ag via a distinct mechanism that uses recycling MHC-II and produces peptide:MHC-II complexes in early endosomes. Thus, processing of RNase to RNase4256:I-Ak complexes was maintained even after DC maturation, although at reduced levels (perhaps due to decreased endocytosis associated with DC maturation).
DC Ag-presenting function may be altered in vivo by CpG DNA and other microbial products in the context of infection or vaccination with CpG DNA adjuvants. DCs at a site of infection or immunization will simultaneously encounter Ag and CpG DNA, resulting in a transient increase in Ag processing and in the half-life of peptide:MHC-II complexes (as well as increased expression of accessory molecules, e.g., CD80, CD86, and CD40). After maturation, these DCs will not produce new peptide:MHC-II complexes, but their expression of previously formed complexes will be prolonged, resulting in Ag presentation that is focused on microbial or vaccine Ags.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Clifford V. Harding, Department of Pathology, Case Western Reserve University BRB925, 10900 Euclid Avenue, Cleveland, OH 44106. ![]()
3 Abbreviations used in this paper: DC, dendritic cells; MHC-II, MHC class II; MIIC, MHC class II compartment; HEL, hen egg lysosome; RNase, bovine RNase A; ODN, oligodeoxynucleotide; BFA, brefeldin A; MFV, mean fluorescence value. ![]()
Received for publication April 7, 2000. Accepted for publication September 26, 2000.
| References |
|---|
|
|
|---|
A 20210 and methylenetetrahydrofolate reductase C
T 677 mutation detection using real-time fluorescence PCR and melting curves. Biotechniques 27:234.[Medline]
differentially regulates antigen processing functions in distinct endocytic compartments of macrophages with constitutive expression of class II MHC molecules. Immunology 87:68.
This article has been cited by other articles:
![]() |
M. S. Czuczman, S. Olejniczak, A. Gowda, A. Kotowski, A. Binder, H. Kaur, J. Knight, P. Starostik, J. Deans, and F. J. Hernandez-Ilizaliturri Acquirement of Rituximab Resistance in Lymphoma Cell Lines Is Associated with Both Global CD20 Gene and Protein Down-Regulation Regulated at the Pretranscriptional and Posttranscriptional Levels Clin. Cancer Res., March 1, 2008; 14(5): 1561 - 1570. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Young, N. S. Wilson, P. Schnorrer, A. Mount, R. J. Lundie, N. L. La Gruta, B. S. Crabb, G. T. Belz, W. R. Heath, and J. A. Villadangos Dendritic cell preactivation impairs MHC class II presentation of vaccines and endogenous viral antigens PNAS, November 6, 2007; 104(45): 17753 - 17758. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. A. Ivory and K. Chadee Intranasal Immunization with Gal-Inhibitable Lectin plus an Adjuvant of CpG Oligodeoxynucleotides Protects against Entamoeba histolytica Challenge Infect. Immun., October 1, 2007; 75(10): 4917 - 4922. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Casals, M. Barrachina, M. Serra, J. Lloberas, and A. Celada Lipopolysaccharide Up-Regulates MHC Class II Expression on Dendritic Cells through an AP-1 Enhancer without Affecting the Levels of CIITA J. Immunol., May 15, 2007; 178(10): 6307 - 6315. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Gray, J. Kuchtey, and C. V. Harding CpG-B ODNs potently induce low levels of IFN-{alpha}{beta} and induce IFN-{alpha}{beta}-dependent MHC-I cross-presentation in DCs as effectively as CpG-A and CpG-C ODNs J. Leukoc. Biol., April 1, 2007; 81(4): 1075 - 1085. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. van Meerten, R. S. van Rijn, S. Hol, A. Hagenbeek, and S. B. Ebeling Complement-Induced Cell Death by Rituximab Depends on CD20 Expression Level and Acts Complementary to Antibody-Dependent Cellular Cytotoxicity. Clin. Cancer Res., July 1, 2006; 12(13): 4027 - 4035. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sen, Q. Chen, and C. M. Snapper Immunization of Aged Mice with a Pneumococcal Conjugate Vaccine Combined with an Unmethylated CpG-Containing Oligodeoxynucleotide Restores Defective Immunoglobulin G Antipolysaccharide Responses and Specific CD4+-T-Cell Priming to Young Adult Levels Infect. Immun., April 1, 2006; 74(4): 2177 - 2186. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. A. Ivory, K. Keller, and K. Chadee CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils Infect. Immun., January 1, 2006; 74(1): 528 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tada, S. Aiba, K.-I. Shibata, T. Ohteki, and H. Takada Synergistic Effect of Nod1 and Nod2 Agonists with Toll-Like Receptor Agonists on Human Dendritic Cells To Generate Interleukin-12 and T Helper Type 1 Cells Infect. Immun., December 1, 2005; 73(12): 7967 - 7976. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kuchtey, P. J. Chefalo, R. C. Gray, L. Ramachandra, and C. V. Harding Enhancement of Dendritic Cell Antigen Cross-Presentation by CpG DNA Involves Type I IFN and Stabilization of Class I MHC mRNA J. Immunol., August 15, 2005; 175(4): 2244 - 2251. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Friedberg, H. Kim, M. McCauley, E. M. Hessel, P. Sims, D. C. Fisher, L. M. Nadler, R. L. Coffman, and A. S. Freedman Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-{alpha}/{beta}-inducible gene expression, without significant toxicity Blood, January 15, 2005; 105(2): 489 - 495. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Friedberg Unique Toxicities and Resistance Mechanisms Associated with Monoclonal Antibody Therapy Hematology, January 1, 2005; 2005(1): 329 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wysocka, B. M. Benoit, S. Newton, L. Azzoni, L. J. Montaner, and A. H. Rook Enhancement of the host immune responses in cutaneous T-cell lymphoma by CpG oligodeoxynucleotides and IL-15 Blood, December 15, 2004; 104(13): 4142 - 4149. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. R. Tobian, D. H. Canaday, and C. V. Harding Bacterial Heat Shock Proteins Enhance Class II MHC Antigen Processing and Presentation of Chaperoned Peptides to CD4+ T Cells J. Immunol., October 15, 2004; 173(8): 5130 - 5137. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bevaart, H. H. Van Ojik, A. W. Sun, T. H. Sulahian, J. H. W. Leusen, G. J. Weiner, J. G. J. van de Winkel, and M. J. Van Vugt CpG oligodeoxynucleotides enhance Fc{gamma}RI-mediated cross presentation by dendritic cells Int. Immunol., August 1, 2004; 16(8): 1091 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. R. Tobian, D. H. Canaday, W. H. Boom, and C. V. Harding Bacterial Heat Shock Proteins Promote CD91-Dependent Class I MHC Cross-Presentation of Chaperoned Peptide to CD8+ T Cells by Cytosolic Mechanisms in Dendritic Cells versus Vacuolar Mechanisms in Macrophages J. Immunol., May 1, 2004; 172(9): 5277 - 5286. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Johnson, G. J. Brunn, and J. L. Platt Cutting Edge: An Endogenous Pathway to Systemic Inflammatory Response Syndrome (SIRS)-Like Reactions through Toll-Like Receptor 4 J. Immunol., January 1, 2004; 172(1): 20 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Beloeil, M. Tomkowiak, G. Angelov, T. Walzer, P. Dubois, and J. Marvel In Vivo Impact of CpG1826 Oligodeoxynucleotide on CD8 T Cell Primary Responses and Survival J. Immunol., September 15, 2003; 171(6): 2995 - 3002. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kuchtey, M. Pennini, R. K. Pai, and C. V. Harding CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes J. Immunol., September 1, 2003; 171(5): 2320 - 2325. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. R. Tobian, N. S. Potter, L. Ramachandra, R. K. Pai, M. Convery, W. H. Boom, and C. V. Harding Alternate Class I MHC Antigen Processing Is Inhibited by Toll-Like Receptor Signaling Pathogen-Associated Molecular Patterns: Mycobacterium tuberculosis 19-kDa Lipoprotein, CpG DNA, and Lipopolysaccharide J. Immunol., August 1, 2003; 171(3): 1413 - 1422. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lu, M. Zhang, R. L. Kitchens, S. Fosmire, A. Takashima, and R. S. Munford Stimulus-dependent Deacylation of Bacterial Lipopolysaccharide by Dendritic Cells J. Exp. Med., June 16, 2003; 197(12): 1745 - 1754. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Weber, C. Lange, W. Gunther, M. Franz, E. Kremmer, and H.-J. Kolb Minor Histocompatibility Antigens on Canine Hemopoietic Progenitor Cells J. Immunol., June 15, 2003; 170(12): 5861 - 5868. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Kumaraguru, C. D. Pack, and B. T. Rouse Toll-like receptor ligand links innate and adaptive immune responses by the production of heat-shock proteins J. Leukoc. Biol., May 1, 2003; 73(5): 574 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Stober, I. Jomantaite, R. Schirmbeck, and J. Reimann NKT Cells Provide Help for Dendritic Cell-Dependent Priming of MHC Class I-Restricted CD8+ T Cells In Vivo J. Immunol., March 1, 2003; 170(5): 2540 - 2548. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kitagaki, V. V. Jain, T. R. Businga, I. Hussain, and J. N. Kline Immunomodulatory Effects of CpG Oligodeoxynucleotides on Established Th2 Responses Clin. Vaccine Immunol., November 1, 2002; 9(6): 1260 - 1269. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O. Gor, X. Ding, Q. Li, J. R. Schreiber, M. Dubinsky, and N. S. Greenspan Enhanced Immunogenicity of Pneumococcal Surface Adhesin A by Genetic Fusion to Cytokines and Evaluation of Protective Immunity in Mice Infect. Immun., October 1, 2002; 70(10): 5589 - 5595. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator J. Immunol., August 1, 2002; 169(3): 1326 - 1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain J. Immunol., May 15, 2002; 168(10): 4951 - 4959. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Johnson, G. J. Brunn, Y. Kodaira, and J. L. Platt Receptor-Mediated Monitoring of Tissue Well-Being Via Detection of Soluble Heparan Sulfate by Toll-Like Receptor 4 J. Immunol., May 15, 2002; 168(10): 5233 - 5239. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Boldrick, A. A. Alizadeh, M. Diehn, S. Dudoit, C. L. Liu, C. E. Belcher, D. Botstein, L. M. Staudt, P. O. Brown, and D. A. Relman Stereotyped and specific gene expression programs in human innate immune responses to bacteria PNAS, January 22, 2002; 99(2): 972 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Juffermans, J. C. Leemans, S. Florquin, A. Verbon, A. H. Kolk, P. Speelman, S. J. H. van Deventer, and T. van der Poll CpG Oligodeoxynucleotides Enhance Host Defense during Murine Tuberculosis Infect. Immun., January 1, 2002; 70(1): 147 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Lipscomb and B. J. Masten Dendritic Cells: Immune Regulators in Health and Disease Physiol Rev, January 1, 2002; 82(1): 97 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Okada, T. Saito, Y. Masunaga, Y. Tsukada, S. Nakagawa, H. Mizuguchi, K. Mori, Y. Okada, T. Fujita, T. Hayakawa, et al. Efficient Antigen Gene Transduction Using Arg-Gly-Asp Fiber-Mutant Adenovirus Vectors Can Potentiate Antitumor Vaccine Efficacy and Maturation of Murine Dendritic Cells Cancer Res., November 1, 2001; 61(21): 7913 - 7919. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Potter and C. V. Harding Neutrophils Process Exogenous Bacteria Via an Alternate Class I MHC Processing Pathway for Presentation of Peptides to T Lymphocytes J. Immunol., September 1, 2001; 167(5): 2538 - 2546. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Noss, R. K. Pai, T. J. Sellati, J. D. Radolf, J. Belisle, D. T. Golenbock, W. H. Boom, and C. V. Harding Toll-Like Receptor 2-Dependent Inhibition of Macrophage Class II MHC Expression and Antigen Processing by 19-kDa Lipoprotein of Mycobacterium tuberculosis J. Immunol., July 15, 2001; 167(2): 910 - 918. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |