The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Askew, D.
Right arrow Articles by Harding, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Askew, D.
Right arrow Articles by Harding, C. V.
The Journal of Immunology, 2000, 165: 6889-6895.
Copyright © 2000 by The American Association of Immunologists

CpG DNA Induces Maturation of Dendritic Cells with Distinct Effects on Nascent and Recycling MHC-II Antigen-Processing Mechanisms

David Askew*, Rose S. Chu*, Arthur M. Krieg{dagger} and Clifford V. Harding2,*

* Department of Pathology, Case Western Reserve University, Cleveland, OH 44106; and {dagger} Department of Internal Medicine, University of Iowa, and Veterans Affairs Medical Center, Iowa City, IA 52242


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Murine bone marrow cultured with GM-CSF produced dendritic cells (DCs) expressing MHC class II (MHC-II) but little CD40, CD80, or CD86. Oligodeoxynucleotides (ODN) containing CpG motifs enhanced DC maturation, increased MHC-II expression, and induced high levels of CD40, CD80, and CD86. When added with Ag to DCs for 24 h, CpG ODN enhanced Ag processing, and the half-life of peptide:MHC-II complexes was increased. However, Ag processing was only transiently enhanced, and exposure of DCs to CpG ODN for 48 h blocked processing of hen egg lysozyme (HEL) to HEL48–61:I-Ak complexes. Processing of this epitope required newly synthesized MHC-II and was blocked by brefeldin A (BFA), suggesting that reduced MHC-II synthesis could explain decreased processing. Real-time quantitative PCR confirmed that CpG ODN decreased I-Aßk mRNA in DCs. In contrast, RNase42–56:I-Ak complexes were generated via a different processing mechanism that involved recycling MHC-II and was partially resistant to BFA. Processing of RNase42–56:I-Ak persisted, although at reduced levels, after CpG-induced maturation of DCs, and this residual processing by mature DCs was completely resistant to BFA. Changes in endocytosis, which was transiently enhanced and subsequently suppressed by CpG ODN, may affect Ag processing by both nascent and recycling MHC-II mechanisms. In summary, CpG ODN induce DC maturation, transiently increase Ag processing, and increase the half-life of peptide-MHC-II complexes to sustain subsequent presentation. Processing mechanisms that require nascent MHC-II are subsequently lost, but those that use recycling MHC-II persist even in fully mature DCs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DCs)3 are professional APCs that induce T cell responses, but their ability to process and present Ag varies with maturation (1, 2). Immature DCs exhibit active endocytosis but lack sufficient cell surface MHC class II (MHC-II) and costimulatory molecules for efficient Ag presentation. Mature DCs have increased levels of cell surface MHC-II, CD40, and costimulatory molecules (CD80 and CD86) promoting Ag presentation, but have decreased synthesis of MHC-II and invariant chain, endocytosis, phagocytosis, and ability to process Ags encountered after maturation (3, 4, 5, 6, 7, 8, 9, 10, 11). DCs derived from GM-CSF-stimulated bone marrow cultures at early time points have an immature phenotype, but maturation occurs with further culture and is enhanced by bacteria or bacterial products (e.g., LPS or bacterial DNA) (9, 12, 13, 14, 15, 16, 17, 18).

Bacterial DNA has immunostimulatory properties due to the presence of CpG motifs, which consist of a central unmethylated CG dimer in particular base contexts (in the mouse, often with two upstream purines and two downstream pyrimidines) (19, 20, 21). Such unmethylated CpG motifs are suppressed in mammalian DNA. Synthetic oligodeoxynucleotides (ODN) that contain CpG motifs (CpG ODN) mimic bacterial DNA and have a similar ability to activate immune responses. CpG ODN activate splenocytes and induce production of multiple cytokines, including IL-6, IL-12, and IFN-{gamma}. Administration of CpG ODN or related DNA preparations with protein Ag in vivo enhances Th1 responses, characterized by increased production of IFN-{gamma}, decreased production of IL-5, and production of Ag-specific IgG2a, a Th1-associated isotype (22, 23). These DNA preparations have potent adjuvant activities in a number of vaccine applications (22, 23, 24, 25, 26, 27, 28).

One mechanism for the adjuvant activity of CpG ODN may be modulation of Ag processing by macrophages, DCs, or B cells. We define Ag processing broadly as the set of mechanisms that convert protein Ags to peptide-MHC-II complexes and regulate the half-life of these complexes (because their half-life may be controlled by endocytosis and intracellular events). Ag presentation is defined to be the interactions that occur at the cell surface between peptideMHC complexes and TCRs, plus interactions between other accessory molecules on the surfaces of APCs and T cells that promote T cell responses. Overnight treatment of macrophages with CpG ODN was recently shown to inhibit macrophage Ag processing, due in part to a decrease in synthesis of MHC-II molecules, and CpG ODN were not found to enhance Ag processing by macrophages at any time point (29). In contrast, other recent studies have shown that treatment of DCs with CpG ODN increases cell surface expression of MHC-II, CD40, CD80, and CD86 (14, 15), but these studies did not examine other protein Ag-processing functions in detail.

The studies presented here address the effects of CpG ODN on protein Ag processing for the production of two different peptide-MHC-II complexes, bovine RNase A (RNase)42–56:I-Ak, and hen egg lysozyme (HEL)48–61:I-Ak, which are produced by different processing mechanisms. HEL48–61:I-Ak complexes are produced in late endocytic compartments using nascent I-Ak molecules, whereas RNase42–56:I-Ak complexes are produced in early endosomes using (at least in part) recycling I-Ak molecules (30). Treatment of DCs with CpG ODN caused a transient enhancement in processing of both HEL and RNase to produce HEL48–61:I-Ak and RNase42–56:I-Ak complexes. However, after 2 days of exposure to CpG ODN, DCs were unable to process HEL to produce HEL48–61:I-Ak complexes, yet were still able to process RNase to produce RNase42–56:I-Ak complexes, although with somewhat reduced efficiency. Thus, fully mature DCs did not express Ag-processing mechanisms that use nascent MHC-II, but maintained processing mechanisms that use recycling MHC-II.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of DCs from bone marrow cultures

Bone marrow cells were isolated from CBA/J mice (The Jackson Laboratory, Bar Harbor, ME) and cultured to produce DCs (31). Femurs were flushed with DMEM (Life Technologies, Rockville, MD), and cells were passed through a 70-µm cell strainer, pelleted, and resuspended for 10 min in 0.83% NH4Cl to lyse erythrocytes. The remaining cells were incubated for 1 h at 4°C with a combination of mAbs purified from supernatants of B hybridomas GK1.5 (anti-CD4), 53-6.72 (anti-CD8), RA3-3A1/61 (anti-B220), H116-32 (anti-I-Ak), and 10-3.6.2 (anti-I-Ak) (American Type Culture Collection (ATCC), Manassas, VA); each Ab was present at 20 µg/108 bone marrow cells. The cells were pelleted and resuspended for 1 h at 37°C in complement (Accurate, Westbury, NY) diluted 1:10 in RPMI 1640 (Life Technologies). Cells were cultured in 24-well plates (106 cells/well) in RPMI 1640 supplemented with 5% FCS, 50 mM 2-ME, 25 mM HEPES, L-glutamine, 20 µg/ml gentamicin, and 500 U/ml GM-CSF (PharMingen, San Diego, CA). Nonadherent cells were removed every 2 days by gently swirling the plates, removing 70% of the medium, and replacing it with fresh medium containing GM-CSF. DCs were harvested by pipetting on day 6, depleted of granulocytes using magnetic beads (Dynal, Lake Success, NY), coated with anti-GR-1 (PharMingen), incubated for 2 h in 100-mm Petri dishes to remove adherent macrophages, and harvested by vigorous pipetting. DCs were distinguished from macrophages by dendritic morphology, pattern of intracellular acid phosphatase staining (focal perinuclear distribution for DCs vs diffuse cytoplasmic distribution for macrophages) (32), expression of higher levels of CD11c, and lower expression of macrophage markers (F4/80 and CD11b).

Oligodeoxynucleotides

ODN were provided by Coley Pharmaceutical Group (Wellesley, MA). ODN were phosphorothioate-modified to increase their resistance to nuclease degradation. Most studies were performed with the following ODN (CpG motifs or the corresponding non-CpG sequence are underlined): CpG ODN 1826, TCCATGACGTTCCTGACGTT; and non-CpG ODN 1982, TCCAGGACTTCTCTCAGGTT. Some studies also used CpG ODN 1758, TCTAGCGTGCGCCAT; CpG ODN 1760, ATAATCGACGTTCAAGCAAG; CpG ODN 1840, TCCATGTCGTTCCTGTCGTT; non-CpG ODN 1911, TCCAGGACTTTCCTCAGGTT; and an ODN with a methylated (therefore inactive) CpG sequence, ODN 1979, TCCAT GTZGTTCCTGTZGTT.

ODN were dissolved in TE (10 mM Tris, 1 mM EDTA). LPS content of ODN was <1 ng LPS/mg DNA as measured by Limulus amebocyte assay (QCL-1000; BioWhittaker, Walkersville, MD). The maximum concentration of ODN in cell cultures was 1 µg/ml, resulting in a maximum potential LPS concentration of <1 pg/ml.

Flow cytometry

DCs were incubated in 96-well V-bottom plates (105/well) for 30 min at 4°C with PBS, 1% FCS, and 10% normal mouse serum and stained with PE-conjugated mAbs (from PharMingen), i.e., rat anti-murine CD40 (clone 3/23), hamster anti-murine CD80 (clone 16-10A1), rat anti-murine CD86 (clone GL1), or an isotype control (rat IgG2a or hamster IgG). MHC-II was labeled with a combination of biotinylated Abs to the I-Ak {alpha}-chain (H116-32) and I-Ak ß-chain (10-3.6.2; ATCC). Biotinylated AF6-88.5.3 (anti-H-2Kb) provided an IgG2a isotype control Ab. Binding of biotinylated primary Abs was detected with FITC-streptavidin (PharMingen). Incubations with Abs were done in the presence of 10% normal mouse serum. After immunolabeling, cells were washed in PBS, fixed in 2% paraformaldehyde in PBS, examined in a FACScan flow cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA) and analyzed using CellQuest software (Becton Dickinson Immunocytometry Systems). Endocytosis was examined by culturing DCs for 3 or 24 h with 1 mg/ml FITC-dextran (20 kDa; Sigma, St. Louis, MO) at 4°C (control for surface binding of FITC-dextran) or 37°C (to assess endocytosis). Cells were washed three times with ice-cold PBS, fixed with 2% paraformaldehyde, and analyzed by flow cytometry.

Ag-processing assays

DCs (106/well) were incubated for 24 h in 24-well plates with HEL or RNase with or without CpG ODN or non-CpG ODN at 1 µg/ml, washed, and incubated without Ag for 0, 24, or 48 h in the continued presence or absence of CpG ODN or non-CpG ODN. DCs were transferred to 96-well plates (2 x 104 cells/well), fixed with 0.5% paraformaldehyde, incubated with 0.2 M lysine, and washed extensively. Peptide:MHC-II complexes were detected with T hybridomas obtained from Paul Allen and Emil Unanue (Washington University, St. Louis. MO): TS12, specific for RNase42–56:I-Ak, and 3A9, specific for HEL48–61:I-Ak. T hybridoma cells (105/well) were incubated with fixed DCs for 20–24 h. Supernatants were assessed for IL-2 using a CTLL-2 bioassay (described below). Ag-processing reactions were performed in triplicate, and data points are presented as mean ± SD. Statistical significance was evaluated using Student’s t test. For exposure of DCs to ODN before Ag, DCs were incubated with or without ODN at 1 µg/ml in 24-well plates (106 cells/well) for 24 or 48 h, transferred to 96-well plates (2 x 104 DCs/well), incubated with or without brefeldin A (BFA, 1 µg/ml; Sigma) for 3 h, incubated with Ag for 3 h in the continued presence or absence of BFA, and fixed and processed for T hybridoma assay.

CTLL-2 bioassay for IL-2 with spectrophotometric readout

A CTLL-2 bioassay for IL-2 (33) was modified for spectrophotometric readout (34, 35). CTLL-2 cells were cultured in 96-well plates for 24 h with supernatants from T hybridoma assays, and 15 µl Alamar Blue (Alamar Biosciences, Sacramento, CA) was added for 18–24 h. Alamar Blue is an oxidation-reduction indicator that is reduced by metabolically active cells, producing a shift in relative absorbance at wavelengths near 570 and 600 nm. Both reduced and oxidized forms have high absorbance near 570 nm, but only the oxidized form has high absorbance near 600 nm. CTLL-2 growth was assessed by subtracting OD595 from OD550 using a plate spectrophotometer (Bio-Rad Laboratories, Hercules, CA). The Alamar Blue assay gave results similar to CTLL-2 proliferation assays using [3H]methylthymidine incorporation (similar threshold sensitivity, plateau, and IL-2 dose-response curves). The Alamar Blue assay showed a minimum response of CTLL-2 cells to culture with 0.004–0.04 U/ml recombinant murine IL-2 (2 U/ng; Roche, Indianapolis, IN), a half-maximal response to 0.04 U/ml IL-2, and a plateau response to 0.4–4 U/ml IL-2.

RNA isolation and analysis by real-time quantitative PCR

Total RNA was isolated from 5 x 106 DCs using RNeasy (Qiagen, Valencia, CA), resuspended in diethylpyrocarbonate-treated water, and stored at -80°C. RNA (1 µg) was converted to cDNA using a SuperScript preamplification system (Life Technologies) for first-strand cDNA synthesis. Ten percent of the cDNA product was used for real-time quantitative PCR using a high-speed thermal cycler (LightCycler; Roche Diagnostics, Indianapolis, IN) and detection of product by SYBR Green I (36, 37, 38). The amplification cycle was 90°C for 0 s, 50°C for 5 s, and 72°C for 20 s. Melting curves confirmed that only one product was amplified. PCR primers for detection of I-Aßk were determined using OLIGO 6.4 (Molecular Biology Insights, Cascade, CO) and consisted of a 5'-3' sense primer, GCGACGTGGGCGAGTACC, and a 5'-3' antisense primer, CATTCCGGAACCAGCGCA. Specific cDNA was quantified with a standard curve based on known amounts of XhoI-derived fragment from a 1-kb Aßk insert of plasmid pcExv-3 (39). Mouse ß-actin primers (Stratagene, La Jolla, CA) used as an internal control consisted of a 5'-3' sense primer, TGTGATGGTGGGAATGGGTCAG, and a 5'-3' antisense primer, TTTGATGTCACGCACGATTTCC. To generate a standard curve for ß-actin, amplified cDNA product was purified from an agarose gel using a QiaQuick gel extraction kit (Qiagen).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG ODN and LPS enhance cell surface expression of MHC-II, CD40, CD80, and CD86

DCs were analyzed by flow cytometry either immediately after isolation or after isolation and culture for 48 h with or without CpG ODN (1 µg/ml), non-CpG ODN (1 µg/ml), or LPS (10 µg/ml). DCs isolated from day 6 bone marrow cultures expressed moderate levels of MHC-II, low levels of CD80 and CD86, and almost no CD40 (Fig. 1Go). DCs that were cultured for an additional 2 days in media alone had a slight decrease in MHC-II expression and slight increases in expression of CD80, CD86, and CD40. Culture with CpG ODN 1826 increased the expression of MHC-II and greatly enhanced expression of CD80, CD86, and CD40. These effects were specific for CpG-ODN and were not seen with non-CpG ODN 1982 (Fig. 2Go, and data not shown). Other CpG ODN (1758, 1760, and 1840) similarly enhanced expression of MHC-II, but addition of inactive control ODN (non-CpG ODN 1911 or ODN 1979 with a methylated CpG sequence) did not affect MHC-II expression. The effects observed with CpG ODN were not due to LPS contamination, because both CpG and non-CpG ODN had undetectable levels of LPS (<1 ng LPS/mg DNA and <1 pg LPS/ml in culture), and the effects were only observed with ODN containing the CpG motif. Incubation of DCs with LPS (10 µg/ml) for 2 days also increased expression of MHC-II, CD80, CD86, and CD40. In summary, exposure of DCs to CpG ODN increased expression of MHC-II and greatly enhanced expression of CD80, CD86, and CD40.



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 1. CpG ODN and LPS increase DC expression of MHC-II, CD40, CD80, and CD86. DCs were isolated from day 6 bone marrow cultures and analyzed immediately (6d) or after 2 days’ additional culture in medium alone (6d + 2d medium), medium with 1 µg/ml CpG ODN 1826 (6d + 2d CpG), or medium with 10 µg/ml LPS (6d + 2d LPS). For flow cytometry, immunolabeling was performed with biotinylated anti-I-Ak followed by streptavidin-FITC, or with PE-conjugated Ab against CD40, CD80, or CD86 (see Materials and Methods). Shaded histogram profiles represent binding of isotype-matched control Ab. Each histogram shows labeling detected in ungated populations and is labeled with the MFV and the percentage of positive events (events with immunolabeling above isotype-matched control).

 


View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 2. CD40 expression is enhanced by CpG ODN but not by non-CpG ODN. DCs were cultured as described for Fig. 1Go. During the last 2 days of culture they were exposed to control medium (thin line), non-CpG ODN (dotted line, overlapping the thin line), or CpG ODN (thick line).

 
CpG ODN enhance Ag processing and increase the half-life of peptide-MHC-II complexes on the cell surface

Ag processing was examined using two different Ags, RNase and HEL, which contain epitopes that are processed via different mechanisms (30). HEL48–61:I-Ak complexes are generated in late endocytic compartments via a processing mechanism that requires nascent (newly synthesized) I-Ak molecules, whereas RNase42–56:I-Ak complexes are generated in early endosomes via a processing mechanism that can use recycling I-Ak molecules (30). The two processing mechanisms also exhibit different kinetics and dependence on Ag-processing components such as HLA-DM/H2-DM and invariant chain (30).

DCs from day 6 cultures were incubated with soluble Ag with or without CpG ODN for 24–48 h, washed, and fixed either immediately or after incubation for an additional 24 h in the continuing presence or absence of CpG ODN. T hybridoma assays assessed expression of HEL48–61:I-Ak or RNase42–56:I-Ak complexes. CpG ODN enhanced generation of both RNase42–56:I-Ak and HEL48–61:I-Ak complexes by DCs (Fig. 3Go), although optimum enhancement was achieved at different time points with the two Ags. Expression of RNase42–56:I-Ak was enhanced by CpG ODN after 24 h, whereas optimal enhancement of expression of HEL48–61:I-Ak occurred after an additional 24-h chase incubation. Ag processing was enhanced by CpG ODN at 0.1, 0.3, 1, and 3 µg/ml, whereas non-CpG ODN at 1 or 3 µg/ml had no significant effect on Ag processing (data not shown). Thus, enhancement of Ag processing was specific for CpG ODN. Addition of LPS with Ag also enhanced processing of both epitopes (data not shown). Thus, CpG ODN enhanced DC Ag processing, and additional experiments were performed to determine specific mechanisms that contributed to this enhancement.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 3. CpG ODN initially enhance Ag processing. DCs were cultured with Ag in the presence or absence of CpG ODN for 24 h, washed, and fixed immediately (A and C) or incubated for an additional 24 h before fixation (B and D). Expression of RNase42–56:I-Ak (A and B) and HEL48–61:I-Ak (C and D) was detected with the TS12 and 3A9 T cell hybridomas, respectively. T cell response was assessed by IL-2 secretion, which was measured using a colorimetric bioassay with CTLL-2 cells. Each data point represents the mean of triplicate wells ± SD. If error bars are not visible, they are smaller than the symbols used for data points. CpG ODN produced a statistically significant (p < 0.01) enhancement of response at Ag concentrations with data points marked by an asterisk.

 
Changes in Ag processing occurred with a delayed time course, particularly for HEL48–61:I-Ak. This suggested the possibility of a mechanism involving an increased half-life of complexes and a resulting increase in their steady state expression, rather than (or in addition to) an enhancement of the initial rate of formation of complexes. To address this hypothesis, we assessed the effect of CpG ODN on the stability of peptide-MHC-II complexes. DCs were pulsed with Ag with or without CpG ODN for 24 h, washed, cultured without Ag in the continuing presence or absence of CpG ODN for 0, 24, or 48 h, and then fixed. At the end of a 24-h pulse with HEL and no chase, HEL48–61:I-Ak complexes were expressed at similar levels on control and CpG ODN-treated DCs (consistent with Fig. 3Go). However, after a 24-h chase, DCs treated with CpG ODN had a higher expression of HEL48–61:I-Ak complexes than control DCs. Expression of HEL48–61:I-Ak complexes increased slightly on CpG-treated DCs during the first 24 h of chase (Fig. 4Go), presumably due to continued processing of Ag that was internalized during the Ag pulse incubation. In contrast, expression of HEL48–61:I-Ak complexes declined slightly on control cells, indicating that the loss of complexes exceeded any production of additional complexes during the chase period (some loss of complexes may have been masked by the continued production of complexes from HEL that was internalized during the Ag pulse). The most significant results were observed after 48 h of chase, when CpG-treated DCs were found to maintain strong expression of HEL48–61:I-Ak complexes, whereas control DCs had greatly reduced expression of these complexes (Fig. 4Go). Thus, expression of HEL48–61:I-Ak complexes declined more rapidly on control DCs than on DCs that were treated with CpG ODN, consistent with an increase in the half-life of these complexes after treatment with CpG ODN. CpG ODN also caused an increase in the half-life of RNase42–56:I-Ak complexes (data not shown). In summary, exposure of DCs to CpG ODN increased the half-life of peptide-MHC-II complexes expressed by these cells, and enhanced stability of peptide-MHC-II complexes may contribute substantially to enhancement of Ag processing by CpG ODN.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. CpG ODN enhance the stability of peptide-MHC-II complexes. DCs were incubated for 24 h with 10 µg/ml HEL in the presence or absence of CpG ODN, washed, and either fixed immediately (0 h Ag chase) or resuspended in fresh media and incubated for an additional 24 or 48 h before fixation. Expression of HEL48–61-I-Ak complexes was determined using 3A9 cells. Each data point represents the mean of triplicate wells ± SD. CpG ODN produced a statistically significant (p < 0.004) enhancement of response after a 48-h chase.

 
Transient enhancement of DC Ag processing by CpG ODN is followed by a decrease in Ag-processing mechanisms that use nascent MHC-II

Although CpG ODN initially enhance Ag processing, these agents promote DC maturation, which has been associated with an ultimate decrease in Ag-processing functions. However, prior studies have not examined Ag-processing functions in detail or distinguished the effects of DC maturation on different Ag-processing mechanisms. Treatment of DC with CpG ODN for 48 h profoundly blocked subsequent processing of HEL to produce HEL48–61:I-Ak complexes (Fig. 5Go), a process that requires nascent MHC-II (see below). This effect was specific for CpG ODN; non-CpG ODN had no effect on Ag processing (Fig. 5Go). Exposure of DCs to CpG ODN for only 24 h before the addition of Ag produced a lesser inhibition of HEL48–61:I-Ak processing (data not shown). To confirm the requirement for nascent MHC-II in this process, DCs were incubated for 3 h with or without BFA, incubated for 3 h with Ag in the continued presence or absence of BFA, and fixed and assessed for expression of HEL48–61:I-Ak complexes. Consistent with our prior studies with macrophages (30), processing of HEL by DCs to produce HEL48–61:I-Ak complexes was inhibited by BFA (Fig. 5Go), consistent with the hypothesis that this process requires nascent MHC-II. Thus, CpG ODN caused long-term inhibition of DC Ag-processing mechanisms that rely on nascent MHC-II.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 5. Long-term effects of CpG ODN include down-regulation of Ag processing by DCs. DCs were cultured for 2 days with or without CpG ODN 1826 or non-CpG ODN 1982, added to 96-well plates (2 x 104 cells/well), incubated for 3 h with or without BFA, incubated for 3 h with Ag in the continued presence or absence of BFA, and then fixed. 3A9 cells were used to detect HEL48–61:I-Ak complexes. Each data point represents the mean of triplicate wells ± SD. Statistically significant (p < 0.01) decreases in response (relative to medium control) were produced by CpG ODN and BFA at Ag concentrations with data points marked by an asterisk.

 
CpG ODN decrease MHC-II mRNA levels in mature DCs

Because exposure to CpG ODN inhibited processing mechanisms that depend on nascent MHC-II, we examined the effect of CpG ODN on the expression of MHC-II mRNA. DCs were incubated for 24 h with or without CpG ODN, total RNA was isolated, 1 µg of total RNA was converted to cDNA, and 10% of the product was included in each real-time quantitative PCR. As indicated in Table IGo, treatment with CpG ODN reduced the relative expression of I-Aßk cDNA to 36% of control (normalized to ß-actin expression). Thus, treatment of DCs with CpG ODN resulted in a substantial reduction in MHC-II mRNA levels.


View this table:
[in this window]
[in a new window]
 
Table I. CpG ODN inhibit expression of I-Aßk cDNA mRNA by DCs

 
Ag processing involving recycling MHC-II persists after CpG-enhanced maturation of DCs

To determine whether Ag-processing mechanisms that use recycling MHC-II persist after CpG DNA-enhanced maturation of DCs, we examined DC processing of RNase to produce RNase42–56:I-Ak complexes (30). DCs were cultured with or without CpG ODN or non-CpG ODN for 2 days, with or without BFA for 3 h, and with RNase in the continuing presence or absence of BFA for 3 h. DCs were then fixed and assessed for expression of RNase42–56:I-Ak complexes (Fig. 6Go). BFA produced a partial inhibition of RNase42–56:I-Ak processing, but a substantial proportion of this processing was BFA resistant, confirming the use of recycling MHC-II by this processing mechanism in DCs. Treatment with CpG ODN inhibited processing of RNase42–56:I-Ak, but a significant proportion of this activity was also CpG resistant (in contrast, the processing of HEL48–61:I-Ak was completely blocked by CpG ODN, Fig. 5Go). RNase42–56:I-Ak processing that persisted after treatment with CpG ODN was completely resistant to BFA, indicating that Ag-processing functions maintained in fully mature DCs (after exposure to CpG ODN) exclusively use recycling MHC-II, not nascent MHC-II. CpG ODN mediated inhibition of RNase42–56:I-Ak processing via mechanisms besides inhibition of nascent MHC-II, because processing of RNase42–56:I-Ak was significantly lower in CpG ODN-treated DCs than in BFA-treated DCs (decreased Ag endocytosis is a likely explanation; see below).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 6. Ag processing that uses recycling MHC-II persists after CpG-enhanced maturation of DCs. DCs were cultured for 2 days with or without CpG ODN 1826 or non-CpG ODN 1982. DCs were added to 96-well plates (2 x 104 cells/well), incubated for 3 h with or without BFA, incubated for an additional 3 h with RNase in the continued presence or absence of BFA, and then fixed. TS12 cells were used to assess expression of RNase42–56:I-Ak complexes. Each data point represents the mean of triplicate wells ± SD. Statistically significant (p < 0.01) decreases in response (relative to medium control) were produced by CpG ODN and BFA at Ag concentrations with data points marked by an asterisk.

 
CpG ODN alter endocytosis by DCs

In addition to regulating Ag processing by modulation of MHC-II synthesis, another mechanism whereby CpG ODN could modulate Ag processing is by alteration of Ag uptake. Endocytosis by DCs was measured by uptake of FITC-dextran (changes in the endocytosis of FITC-dextran accurately reflect changes in the endocytosis of radiolabeled HEL and RNase, data not shown). DCs were cultured for 24 h with FITC-dextran in the presence or absence of CpG ODN or non-CpG ODN (a parallel of conditions that enhance Ag processing, Fig. 3Go). The cells were washed, fixed, and examined by flow cytometry. The mean fluorescence value (MFV) of DCs cultured with FITC-dextran at 4°C was subtracted from the MFV of DCs cultured with FITC-dextran at 37°C to calculate {Delta}MFV, a measure of endocytosis. This analysis showed that endocytosis of FITC-dextran was enhanced in the first 24 h of exposure to CpG ODN (Table IIGo). To assess later effects on endocytosis, DCs were cultured for 2 days with or without CpG ODN or non-CpG ODN and then incubated with FITC-dextran for 3 h at 4°C or 37°C (a parallel to conditions that inhibit Ag processing, Figs. 5Go and 6Go). Exposure to CpG ODN for 2 days decreased subsequent endocytosis by DCs to 53% of the control level (Table IIGo). Overall, CpG ODN caused short-term enhancement of endocytosis followed by a long-term decrease in endocytosis (associated with DC maturation). Thus, the ability of CpG ODN to modulate Ag processing by DCs involves modulation of both MHC-II synthesis and Ag endocytosis.


View this table:
[in this window]
[in a new window]
 
Table II. Effect of CpG ODN on endocytosis by DCs

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG DNA influences the immune system at multiple levels. CpG DNA enhances in vivo immune responses to protein or glycoprotein vaccine Ags (20, 21, 22, 23, 24, 25, 28). CpG DNA increases in vitro proliferation and activation of B lymphocytes (19) and production of cytokines such as IFN-{gamma}, TNF-{alpha}, or IL-12 by macrophages, DCs, and NK cells (reviewed in Ref. 20). CpG ODN influence Ag processing, but the effects observed depend on cell type and length of exposure to CpG ODN. CpG ODN cause biphasic changes in Ag processing by DCs, with initial enhancement followed by a long-term decrease (Table IIIGo), whereas macrophages exhibit only a long-term decrease in Ag processing (29).


View this table:
[in this window]
[in a new window]
 
Table III. Functional aspects of CpG-enhanced DC maturation

 
Ag processing was enhanced during the first 24 h of exposure to CpG ODN (Fig. 3Go), although this was followed by a subsequent inhibitory phase. In the course of natural infection, CpG sequences in bacterial DNA may similarly enhance Ag processing by DCs. Additional experiments showed that Escherichia coli DNA produced similar enhancement of early-phase RNase processing, whereas calf thymus DNA produced only a lesser enhancement of uncertain significance (data not shown). Several mechanisms may contribute to transient enhancement of Ag processing upon induction of DC maturation, including enhanced use of intracellular MHC-II molecules (10), increased synthesis of MHC-II (12), and increased endocytosis (Table IIGo), facilitating Ag uptake. In addition, treatment with CpG ODN enhanced the stability of peptide-MHC-II complexes on DCs (Fig. 4Go), which would increase expression of these complexes (see below). In summary, DCs respond to DNA that contains CpG motifs, with a transient enhancement of Ag processing.

The long-term effects of CpG ODN included decreased DC Ag processing (Figs. 5Go and 6Go) and sustained expression of previously generated peptide-MHC-II complexes (Fig. 4Go). Inhibition of Ag processing was correlated with decreased expression of MHC-II mRNA (Table IGo) and decreased endocytosis (Table IIGo). In addition to decreasing Ag uptake, inhibition of endocytosis may decrease internalization of MHC-II molecules, potentially decreasing the supply of recycling MHC-II molecules involved in the production of RNase42–56:I-Ak complexes. Despite the long-term decrease in Ag processing, CpG ODN prolonged expression of peptide-MHC-II complexes that were formed before (or during) the induction of DC maturation. The mechanism for enhancing the half-life of peptide-MHC-II complexes is not known, but may relate to decreased endocytosis of MHC-II molecules, because turnover, removal, or degradation of peptide-MHC-II complexes may be dependent on their endocytosis. Long-term enhancement of Ag presentation is supported by the ability of CpG ODN to increase expression of accessory molecules, e.g., CD80, CD86, and CD40, as well as MHC-II (Fig. 1Go, and Refs. 14, 15 , and 17). In summary, the presence of CpG ODN during initial exposure to exogenous Ag increases the half-life of peptide-MHC-II complexes generated during the processing of that Ag, prolonging presentation of the Ag even after loss of Ag-processing functions by mature DCs.

The changes in DC function induced by CpG ODN are similar to those induced by other substances that promote DC maturation. Phagocytosis and endocytosis are generally decreased upon maturation of DCs or Langerhans cells (2, 8, 11, 13, 40, 41). Certain other microbial products (e.g., LPS and double-stranded RNA) also decrease DC Ag-processing function and promote sustained presentation of previously processed Ags (1, 2, 3, 4, 5, 6, 7, 9, 10, 13, 42, 43, 44, 45, 46). Thus, CpG ODN and certain other microbial products similarly induce DC maturation, a transient increase in Ag processing, a subsequent decline in Ag-processing function, and sustained presentation of peptide-MHC-II complexes. The consequence may be to focus presentation on Ags processed soon after exposure to CpG DNA or other microbial products, resulting in enhanced presentation of a cohort of microbial Ags that were present in this frame in the sequence of events. To summarize this "freeze-frame" hypothesis, DCs are exposed to a continuous stream of self or nonself Ags, but exposure to CpG DNA causes the processing treadmill to freeze and Ag presentation to maintain focus on one frame of this sequence, correlating with the point of microbial Ag exposure. The induction of DC maturation is also associated with migration of DCs to lymph nodes, enabling presentation to naive T cells and the priming of T cell responses.

Our data reveal a novel exception to the cessation of Ag processing that accompanies DC maturation. Although fully mature DCs cannot process Ag via mechanisms that use nascent MHC-II to produce peptide-MHC-II complexes in late endocytic compartments, even these cells can still process Ag via a distinct mechanism that uses recycling MHC-II and produces peptide:MHC-II complexes in early endosomes. Thus, processing of RNase to RNase42–56:I-Ak complexes was maintained even after DC maturation, although at reduced levels (perhaps due to decreased endocytosis associated with DC maturation).

DC Ag-presenting function may be altered in vivo by CpG DNA and other microbial products in the context of infection or vaccination with CpG DNA adjuvants. DCs at a site of infection or immunization will simultaneously encounter Ag and CpG DNA, resulting in a transient increase in Ag processing and in the half-life of peptide:MHC-II complexes (as well as increased expression of accessory molecules, e.g., CD80, CD86, and CD40). After maturation, these DCs will not produce new peptide:MHC-II complexes, but their expression of previously formed complexes will be prolonged, resulting in Ag presentation that is focused on microbial or vaccine Ags.


    Acknowledgments
 
We thank Karin Havenith and Erika Noss for valuable advice and assistance.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants R03 AI44794, R01 AI35726, and R01 AI47255. Back

2 Address correspondence and reprint requests to Dr. Clifford V. Harding, Department of Pathology, Case Western Reserve University BRB925, 10900 Euclid Avenue, Cleveland, OH 44106. Back

3 Abbreviations used in this paper: DC, dendritic cells; MHC-II, MHC class II; MIIC, MHC class II compartment; HEL, hen egg lysosome; RNase, bovine RNase A; ODN, oligodeoxynucleotide; BFA, brefeldin A; MFV, mean fluorescence value. Back

Received for publication April 7, 2000. Accepted for publication September 26, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  2. Cella, M., F. Sallusto, A. Lanzavecchia. 1997. Origin, maturation and antigen presenting function of dendritic cells. Curr. Opin. Immunol. 9:10.[Medline]
  3. Cella, M., A. Engering, V. Pinet, J. Pieters, A. Lanzavecchia. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[Medline]
  4. Pure, E., K. Inaba, M. T. Crowley, L. Tardelli, M. D. Witmer-Pack, G. Ruberti, G. Fathman, R. M. Steinman. 1990. Antigen processing by epidermal Langerhans cells correlates with the level of biosynthesis of major histocompatibility complex class II molecules and expression of invariant chain. J. Exp. Med. 172:1459.[Abstract/Free Full Text]
  5. Kampgen, E., N. Koch, F. Koch, P. Stoger, C. Heufler, G. Schuler, N. Romani. 1991. Class II major histocompatibility complex molecules of murine dendritic cells: synthesis, sialylation of invariant chain, and antigen processing capacity are down-regulated upon culture. Proc. Natl. Acad. Sci. USA 88:3014.[Abstract/Free Full Text]
  6. Romani, N., S. Koide, M. Crowley, M. Witmerpack, A. M. Livingstone, C. V. Fathman, K. Inaba, R. M. Steinman. 1989. Presentation of exogenous protein antigens by dendritic cells to T cell clones: intact protein is best presented by immature, epidermal Langerhans cells. J. Exp. Med. 169:1169.[Abstract/Free Full Text]
  7. Stossel, H., F. Koch, E. Kampgen, P. Stoger, A. Lenz, C. Heufler, N. Romani, G. Schuler. 1990. Disappearance of certain acidic organelles (endosomes and Langerhans cell granules) accompanies loss of antigen processing capacity upon culture of epidermal Langerhans cells. J. Exp. Med. 172:1471.[Abstract/Free Full Text]
  8. Inaba, K., M. Inaba, M. Naito, R. M. Steinman. 1993. Dendritic cell progenitors phagocytose particulates, including Bacillus Calmette-Guerin organisms, and sensitize mice to mycobacterial antigens in vivo. J. Exp. Med. 178:479.[Abstract/Free Full Text]
  9. Winzler, C., P. Rovere, M. Rescigno, F. Granucci, G. Penna, L. Adorini, V. S. Zimmermann, J. Davoust, Ricciardi-Castagnoli. 1997. Maturation stages of mouse dendritic cells in growth factor-dependent long-term cultures. J. Exp. Med. 185:317.[Abstract/Free Full Text]
  10. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, R. M. Steinman, I. Mellman. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388:787.[Medline]
  11. Reis e Sousa, C., P. D. Stahl, J. M. Austyn. 1993. Phagocytosis of antigens by Langerhans cells in vitro. J. Exp. Med. 178:509.[Abstract/Free Full Text]
  12. Rescigno, M., S. Citterio, C. Thery, M. Rittig, D. Medaglini, G. Pozzi, S. Amigorena, P. Ricciardi-Castagnoli. 1998. Bacteria-induced neo-biosynthesis, stabilization, and surface expression of functional class I molecules in mouse dendritic cells. Proc. Natl. Acad. Sci. USA 95:5229.[Abstract/Free Full Text]
  13. Sallusto, F., M. Cella, C. Danieli, A. Lanzavecchia. 1995. Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. J. Exp. Med. 182:389.[Abstract/Free Full Text]
  14. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, J. C. Vogel. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042.[Abstract/Free Full Text]
  15. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
  16. Henderson, R. A., S. C. Watkins, J. L. Flynn. 1997. Activation of human dendritic cells following infection with Mycobacterium tuberculosis. J. Immunol. 159:635.[Abstract]
  17. Hartmann, G., G. J. Weiner, A. M. Krieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96:9305.[Abstract/Free Full Text]
  18. Ojcius, D. M., Y. Bravo de Alba, J. M. Kanellopoulos, R. A. Hawkins, K. A. Kelly, R. G. Rank, A. Dautry-Varsat. 1998. Internalization of Chlamydia by dendritic cells and stimulation of Chlamydia-specific T cells. J. Immunol. 160:1297.[Abstract/Free Full Text]
  19. Krieg, A. M., A.-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 374:546.[Medline]
  20. Wagner, H.. 1999. Bacterial CpG DNA activates immune cells to signal infectious danger. Adv. Immunol. 73:329.[Medline]
  21. Klinman, D. M., K. M. Barnhart, J. Conover. 1999. CpG motifs as immune adjuvants. Vaccine 17:19.[Medline]
  22. Chu, R., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  23. Roman, M., E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nature Medicine 3:849.[Medline]
  24. Chu, R. S., T. McCool, N. S. Greenspan, J. R. Schreiber, C. V. Harding. 2000. CpG oligodeoxynucleotides act as adjuvants for pneumococcal polysaccharide-protein conjugate vaccines and enhance anti-polysaccharide immunoglobulin G2a (IgG2a) and IgG3 antibodies. Infect. Immun. 68:1450.[Abstract/Free Full Text]
  25. Davis, H. L., R. Weeranta, T. J. Waldschmidt, L. Tygrett, J. Schorr, A. M. Krieg. 1998. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160:870.[Abstract/Free Full Text]
  26. Lipford, G. B., M. Bauer, C. Blank, R. Reiter, H. Wagner, K. Heeg. 1997. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur. J. Immunol. 27:2340.[Medline]
  27. Moldoveanu, Z., L. Love-Homan, W. Q. Huang, A. M. Krieg. 1998. CpG DNA, a novel immune enhancer for systemic and mucosal immunization with influenza virus. Vaccine 16:1216.[Medline]
  28. Brazolot Millan, C. L., R. Weeratna, A. M. Krieg, C. A. Siegrist, H. L. Davis. 1998. CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice. Proc. Natl. Acad. Sci. USA 95:15553.[Abstract/Free Full Text]
  29. Chu, R. S., D. Askew, E. H. Noss, A. Tobian, A. M. Krieg, C. V. Harding. 1999. CpG oligodeoxynucleotides down-regulate macrophage class II MHC antigen processing. J. Immunol. 163:1188.[Abstract/Free Full Text]
  30. Griffin, J. P., R. Chu, C. V. Harding. 1997. Early endosomes and a late endocytic compartment generate different peptide-class II MHC complexes via distinct processing mechanisms. J. Immunol. 158:1523.[Abstract]
  31. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, R. M. Steinman. 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693.[Abstract/Free Full Text]
  32. Havenith, C. E., J. M. van Haarst, A. J. Breedijk, M. G. Betjes, H. C. Hoogsteden, R. H. Beelen, E. C. Hoefsmit. 1994. Enrichment and characterization of dendritic cells from human bronchoalveolar lavages. Clin. Exp. Immunol. 96:339.[Medline]
  33. Harding, C. V.. 1994. Techniques for studying phagocytic processing of bacteria for class I or II MHC-restricted antigen recognition by T lymphocytes. Methods Cell Biol. 45:307.
  34. Matousek, M. P., J. N. Nedrud, W. Cieplak, C. V. Harding. 1998. Inhibition of class II MHC antigen processing and presentation by Escherichia coli heat-labile enterotoxin requires an enzymatically active A subunit. Infect. Immun. 66:3480.[Abstract/Free Full Text]
  35. Ahmed, S. A., Jr R. M. Gogal, J. E. Walsh. 1994. A new rapid and simple nonradioactive assay to monitor and determine the proliferation of lymphocytes: an alternative to [3H]thymidine incorporation assay. J. Immunol. Methods 170:211.[Medline]
  36. Aslanidis, C., M. Nauck, G. Schmitz. 1999. High-speed prothrombin G->A 20210 and methylenetetrahydrofolate reductase C->T 677 mutation detection using real-time fluorescence PCR and melting curves. Biotechniques 27:234.[Medline]
  37. Overbergh, L., D. Valckx, M. Waer, C. Mathieu. 1999. Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11:305.[Medline]
  38. Hiratsuka, M., Y. Agatsuma, M. Mizugaki. 1999. Rapid detection of CYP2C9*3 alleles by real-time fluorescence PCR based on SYBR Green. Mol. Genet. Metab. 68:357.[Medline]
  39. Hockett, R. D., J. R. Cook, K. Findlay, C. V. Harding. 1996. Interferon-{gamma} differentially regulates antigen processing functions in distinct endocytic compartments of macrophages with constitutive expression of class II MHC molecules. Immunology 87:68.
  40. Nijman, H. W., M. J. Kleijmeer, M. A. Ossevoort, V. M. J. Oorschot, M. P. M. Vierboom, M. Van de Keur, P. Kenemans, W. M. Kast, H. J. Geuze, C. J. M. Melief. 1995. Antigen capture and major histocompatibility class II compartments of freshly isolated and cultured human blood dendritic cells. J. Exp. Med. 182:163.[Abstract/Free Full Text]
  41. Stumbles, P. A., J. A. Thomas, C. L. Pimm, P. T. Lee, T. J. Venaille, S. Proksch, P. G. Holt. 1998. Resting respiratory tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require obligatory cytokine signals for induction of Th1 immunity. J. Exp. Med. 188:2019.[Abstract/Free Full Text]
  42. De Smedt, T., B. Pajak, E. Muraille, L. Lespagnard, E. Heinen, P. De Baetselier, J. Urbain, O. Leo, M. Moser. 1996. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo. J. Exp. Med. 184:1413.[Abstract/Free Full Text]
  43. Steinman, R. M., J. Swanson. 1995. The endocytic activity of dendritic cells. J. Exp. Med. 182:283.[Free Full Text]
  44. Cella, M., M. Salio, Y. Sakakibara, H. Langen, I. Julkunen, A. Lanzavecchia. 1999. Maturation, activation, and protection of dendritic cells induced by double-stranded RNA. J. Exp. Med. 189:821.[Abstract/Free Full Text]
  45. Sallusto, F., A. Lanzavecchia. 1999. Mobilizing dendritic cells for tolerance, priming, and chronic inflammation. J. Exp. Med. 189:611.[Free Full Text]
  46. Rescigno, M., F. Granucci, S. Citterio, M. Foti, P. Ricciardi-Castagnoli. 1999. Coordinated events during bacteria-induced DC maturation. Immunol. Today 20:200.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
M. S. Czuczman, S. Olejniczak, A. Gowda, A. Kotowski, A. Binder, H. Kaur, J. Knight, P. Starostik, J. Deans, and F. J. Hernandez-Ilizaliturri
Acquirement of Rituximab Resistance in Lymphoma Cell Lines Is Associated with Both Global CD20 Gene and Protein Down-Regulation Regulated at the Pretranscriptional and Posttranscriptional Levels
Clin. Cancer Res., March 1, 2008; 14(5): 1561 - 1570.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. J. Young, N. S. Wilson, P. Schnorrer, A. Mount, R. J. Lundie, N. L. La Gruta, B. S. Crabb, G. T. Belz, W. R. Heath, and J. A. Villadangos
Dendritic cell preactivation impairs MHC class II presentation of vaccines and endogenous viral antigens
PNAS, November 6, 2007; 104(45): 17753 - 17758.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. P. A. Ivory and K. Chadee
Intranasal Immunization with Gal-Inhibitable Lectin plus an Adjuvant of CpG Oligodeoxynucleotides Protects against Entamoeba histolytica Challenge
Infect. Immun., October 1, 2007; 75(10): 4917 - 4922.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Casals, M. Barrachina, M. Serra, J. Lloberas, and A. Celada
Lipopolysaccharide Up-Regulates MHC Class II Expression on Dendritic Cells through an AP-1 Enhancer without Affecting the Levels of CIITA
J. Immunol., May 15, 2007; 178(10): 6307 - 6315.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. C. Gray, J. Kuchtey, and C. V. Harding
CpG-B ODNs potently induce low levels of IFN-{alpha}{beta} and induce IFN-{alpha}{beta}-dependent MHC-I cross-presentation in DCs as effectively as CpG-A and CpG-C ODNs
J. Leukoc. Biol., April 1, 2007; 81(4): 1075 - 1085.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. van Meerten, R. S. van Rijn, S. Hol, A. Hagenbeek, and S. B. Ebeling
Complement-Induced Cell Death by Rituximab Depends on CD20 Expression Level and Acts Complementary to Antibody-Dependent Cellular Cytotoxicity.
Clin. Cancer Res., July 1, 2006; 12(13): 4027 - 4035.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
G. Sen, Q. Chen, and C. M. Snapper
Immunization of Aged Mice with a Pneumococcal Conjugate Vaccine Combined with an Unmethylated CpG-Containing Oligodeoxynucleotide Restores Defective Immunoglobulin G Antipolysaccharide Responses and Specific CD4+-T-Cell Priming to Young Adult Levels
Infect. Immun., April 1, 2006; 74(4): 2177 - 2186.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. P. A. Ivory, K. Keller, and K. Chadee
CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils
Infect. Immun., January 1, 2006; 74(1): 528 - 536.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Tada, S. Aiba, K.-I. Shibata, T. Ohteki, and H. Takada
Synergistic Effect of Nod1 and Nod2 Agonists with Toll-Like Receptor Agonists on Human Dendritic Cells To Generate Interleukin-12 and T Helper Type 1 Cells
Infect. Immun., December 1, 2005; 73(12): 7967 - 7976.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kuchtey, P. J. Chefalo, R. C. Gray, L. Ramachandra, and C. V. Harding
Enhancement of Dendritic Cell Antigen Cross-Presentation by CpG DNA Involves Type I IFN and Stabilization of Class I MHC mRNA
J. Immunol., August 15, 2005; 175(4): 2244 - 2251.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. W. Friedberg, H. Kim, M. McCauley, E. M. Hessel, P. Sims, D. C. Fisher, L. M. Nadler, R. L. Coffman, and A. S. Freedman
Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-{alpha}/{beta}-inducible gene expression, without significant toxicity
Blood, January 15, 2005; 105(2): 489 - 495.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
J. W. Friedberg
Unique Toxicities and Resistance Mechanisms Associated with Monoclonal Antibody Therapy
Hematology, January 1, 2005; 2005(1): 329 - 334.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Wysocka, B. M. Benoit, S. Newton, L. Azzoni, L. J. Montaner, and A. H. Rook
Enhancement of the host immune responses in cutaneous T-cell lymphoma by CpG oligodeoxynucleotides and IL-15
Blood, December 15, 2004; 104(13): 4142 - 4149.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. R. Tobian, D. H. Canaday, and C. V. Harding
Bacterial Heat Shock Proteins Enhance Class II MHC Antigen Processing and Presentation of Chaperoned Peptides to CD4+ T Cells
J. Immunol., October 15, 2004; 173(8): 5130 - 5137.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
L. Bevaart, H. H. Van Ojik, A. W. Sun, T. H. Sulahian, J. H. W. Leusen, G. J. Weiner, J. G. J. van de Winkel, and M. J. Van Vugt
CpG oligodeoxynucleotides enhance Fc{gamma}RI-mediated cross presentation by dendritic cells
Int. Immunol., August 1, 2004; 16(8): 1091 - 1098.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. R. Tobian, D. H. Canaday, W. H. Boom, and C. V. Harding
Bacterial Heat Shock Proteins Promote CD91-Dependent Class I MHC Cross-Presentation of Chaperoned Peptide to CD8+ T Cells by Cytosolic Mechanisms in Dendritic Cells versus Vacuolar Mechanisms in Macrophages
J. Immunol., May 1, 2004; 172(9): 5277 - 5286.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. B. Johnson, G. J. Brunn, and J. L. Platt
Cutting Edge: An Endogenous Pathway to Systemic Inflammatory Response Syndrome (SIRS)-Like Reactions through Toll-Like Receptor 4
J. Immunol., January 1, 2004; 172(1): 20 - 24.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Beloeil, M. Tomkowiak, G. Angelov, T. Walzer, P. Dubois, and J. Marvel
In Vivo Impact of CpG1826 Oligodeoxynucleotide on CD8 T Cell Primary Responses and Survival
J. Immunol., September 15, 2003; 171(6): 2995 - 3002.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kuchtey, M. Pennini, R. K. Pai, and C. V. Harding
CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes
J. Immunol., September 1, 2003; 171(5): 2320 - 2325.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. R. Tobian, N. S. Potter, L. Ramachandra, R. K. Pai, M. Convery, W. H. Boom, and C. V. Harding
Alternate Class I MHC Antigen Processing Is Inhibited by Toll-Like Receptor Signaling Pathogen-Associated Molecular Patterns: Mycobacterium tuberculosis 19-kDa Lipoprotein, CpG DNA, and Lipopolysaccharide
J. Immunol., August 1, 2003; 171(3): 1413 - 1422.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Lu, M. Zhang, R. L. Kitchens, S. Fosmire, A. Takashima, and R. S. Munford
Stimulus-dependent Deacylation of Bacterial Lipopolysaccharide by Dendritic Cells
J. Exp. Med., June 16, 2003; 197(12): 1745 - 1754.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Weber, C. Lange, W. Gunther, M. Franz, E. Kremmer, and H.-J. Kolb
Minor Histocompatibility Antigens on Canine Hemopoietic Progenitor Cells
J. Immunol., June 15, 2003; 170(12): 5861 - 5868.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
U. Kumaraguru, C. D. Pack, and B. T. Rouse
Toll-like receptor ligand links innate and adaptive immune responses by the production of heat-shock proteins
J. Leukoc. Biol., May 1, 2003; 73(5): 574 - 583.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Stober, I. Jomantaite, R. Schirmbeck, and J. Reimann
NKT Cells Provide Help for Dendritic Cell-Dependent Priming of MHC Class I-Restricted CD8+ T Cells In Vivo
J. Immunol., March 1, 2003; 170(5): 2540 - 2548.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
K. Kitagaki, V. V. Jain, T. R. Businga, I. Hussain, and J. N. Kline
Immunomodulatory Effects of CpG Oligodeoxynucleotides on Established Th2 Responses
Clin. Vaccine Immunol., November 1, 2002; 9(6): 1260 - 1269.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. O. Gor, X. Ding, Q. Li, J. R. Schreiber, M. Dubinsky, and N. S. Greenspan
Enhanced Immunogenicity of Pneumococcal Surface Adhesin A by Genetic Fusion to Cytokines and Evaluation of Protective Immunity in Mice
Infect. Immun., October 1, 2002; 70(10): 5589 - 5595.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding
Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator
J. Immunol., August 1, 2002; 169(3): 1326 - 1333.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck
Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain
J. Immunol., May 15, 2002; 168(10): 4951 - 4959.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. B. Johnson, G. J. Brunn, Y. Kodaira, and J. L. Platt
Receptor-Mediated Monitoring of Tissue Well-Being Via Detection of Soluble Heparan Sulfate by Toll-Like Receptor 4
J. Immunol., May 15, 2002; 168(10): 5233 - 5239.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Boldrick, A. A. Alizadeh, M. Diehn, S. Dudoit, C. L. Liu, C. E. Belcher, D. Botstein, L. M. Staudt, P. O. Brown, and D. A. Relman
Stereotyped and specific gene expression programs in human innate immune responses to bacteria
PNAS, January 22, 2002; 99(2): 972 - 977.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. P. Juffermans, J. C. Leemans, S. Florquin, A. Verbon, A. H. Kolk, P. Speelman, S. J. H. van Deventer, and T. van der Poll
CpG Oligodeoxynucleotides Enhance Host Defense during Murine Tuberculosis
Infect. Immun., January 1, 2002; 70(1): 147 - 152.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. F. Lipscomb and B. J. Masten
Dendritic Cells: Immune Regulators in Health and Disease
Physiol Rev, January 1, 2002; 82(1): 97 - 130.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Okada, T. Saito, Y. Masunaga, Y. Tsukada, S. Nakagawa, H. Mizuguchi, K. Mori, Y. Okada, T. Fujita, T. Hayakawa, et al.
Efficient Antigen Gene Transduction Using Arg-Gly-Asp Fiber-Mutant Adenovirus Vectors Can Potentiate Antitumor Vaccine Efficacy and Maturation of Murine Dendritic Cells
Cancer Res., November 1, 2001; 61(21): 7913 - 7919.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. S. Potter and C. V. Harding
Neutrophils Process Exogenous Bacteria Via an Alternate Class I MHC Processing Pathway for Presentation of Peptides to T Lymphocytes
J. Immunol., September 1, 2001; 167(5): 2538 - 2546.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. H. Noss, R. K. Pai, T. J. Sellati, J. D. Radolf, J. Belisle, D. T. Golenbock, W. H. Boom, and C. V. Harding
Toll-Like Receptor 2-Dependent Inhibition of Macrophage Class II MHC Expression and Antigen Processing by 19-kDa Lipoprotein of Mycobacterium tuberculosis
J. Immunol., July 15, 2001; 167(2): 910 - 918.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Askew, D.
Right arrow Articles by Harding, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Askew, D.
Right arrow Articles by Harding, C. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS