The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Airoldi, I.
Right arrow Articles by Pistoia, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Airoldi, I.
Right arrow Articles by Pistoia, V.
The Journal of Immunology, 2000, 165: 6880-6888.
Copyright © 2000 by The American Association of Immunologists

Expression and Function of IL-12 and IL-18 Receptors on Human Tonsillar B Cells1

Irma Airoldi2,*,{dagger}, Giorgia Gri{dagger},{ddagger}, Jason D. Marshall{dagger}, Anna Corcione*, Paola Facchetti*, Roberta Guglielmino*, Giorgio Trinchieri{dagger} and Vito Pistoia*

* Laboratory of Oncology, G. Gaslini Institute, Genoa, Italy; {dagger} Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104; {ddagger} Division of Experimental Oncology, Istituto per lo Studio e la Cura dei tumori, Milan, Italy; and § Dynavax Technologies, Berkeley, CA 94705


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-12 activates murine and human B cells, but little information is available as to the expression and function of IL-12R on human B lymphocytes. Here we show that the latter cells, freshly isolated from human tonsils, expressed the transcripts of both ß1 and ß2 chains of IL-12R and that ß2 chain mRNA was selectively increased (4- to 5-fold) by incubation with Staphylococcus aureus Cowan I bacteria or IL-12. B cell stimulation with IL-12 induced de novo expression of the transcripts of the two chains of IL-18R, i.e., IL-1 receptor-related protein and accessory protein-like. Functional studies showed that both IL-12 and IL-18 signaled to B cells through the NF-{kappa}B pathway. In the case of IL-12, no involvement of STAT transcription factors, and in particular of STAT-4, was detected. c-rel and p50 were identified as the members of NF-{kappa}B family involved in IL-12-mediated signal transduction to B cells. IL-12 and IL-18 synergized in the induction of IFN-{gamma} production by tonsillar B cells, but not in the stimulation of B cell differentiation, although either cytokine promoted IgM secretion in culture supernatants. Finally, naive but not germinal center or memory, tonsillar B cells were identified as the exclusive IL-12 targets in terms of induction of NF-{kappa}B activation and of IFN-{gamma} production.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-12 is an immunomodulatory cytokine that represents a functional bridge between innate resistance and Ag-specific adaptive immunity (1). IL-12 is produced by various cell types, such as phagocytic cells, dendritic cells, and B lymphocytes, and induces production of cytokines, especially IFN-{gamma}, from T and NK cells after binding to its own receptor (2, 3, 4, 5, 6, 7, 8, 9).

The IL-12R is composed of two subunits designated ß1 and ß2 (10, 11). The tissue distribution of the ß2 subunit is more restricted than that of the ß1, and regulation of ß2 expression is likely to represent a central mechanism whereby IL-12 responsiveness is controlled (12, 13, 14, 15, 16, 17). In T and NK cells, IL-12 induces activation of STAT family members, i.e., STAT3 and STAT4, which bind to the promoter regions of different genes, including the IFN-{gamma} gene promoter (18, 19, 20, 21, 22, 23). However, STAT-4 activation is restricted to IL-12 and IFN-{alpha}, whereas STAT-3 is activated by different cytokines (18, 19, 20, 21, 22, 23).

Recently, murine dendritic cells have been found to transduce IL-12 signaling through NF-{kappa}B activation, leading to functional responses (24). IL-12 mediates activation of human and murine B cells (25, 26, 27, 28, 29, 30). It is well known that human B lymphocytes express constitutively the IL-12Rß1 chain, but no information is available as to the expression of the ß2 chain in these cells (31, 32). Furthermore, the signal transduction pathways initiated in B lymphocytes by IL-12 triggering are unknown.

Another IFN-{gamma}-inducing factor sharing functional similarities with IL-12, i.e., IL-18, has been recently cloned (33). IL-18 is synthesized by various cell types (34, 35, 36) as an inactive precursor molecule that becomes functional following cleavage by caspase-1 (37, 38). IL-18 synergizes with IL-12 in the enhancement of NK cell cytotoxicity and of T cell proliferation, as well as in the induction of IFN-{gamma} production by T cells (39, 40). The IL-18R is composed of two chains, named IL-1 receptor-related protein (IL-1Rrp)3 and accessory protein-like (AcPL), respectively, both of which are required for IL-18-driven induction of NF-{kappa}B activation (41, 42, 43, 44). IL-12 induces the expression of both IL-1Rrp and AcPL in different cell types (39, 45).

Here we have investigated IL-12R expression and function in freshly isolated or cultured human tonsillar B lymphocytes and in their subsets. Because IL-12 was found to induce de novo expression of IL-18R chains, the interactions of IL-12 and IL-18 with respect to different B cell functions were also investigated.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell separation and culture

Mononuclear cells (MNC) were isolated from surgically removed tonsils on Ficoll-Hypaque density gradients and depleted of T cells by rosetting with neuraminidase-treated sheep erythrocytes. Non-T cells were subsequently deprived of macrophages and NK cells by incubation with CD68 and CD56 mAbs, respectively, followed by immune rosetting (46). The resulting cell preparations contained on average 99% B cells, as assessed by staining with CD19 or CD20 mAbs (Becton Dickinson, San Jose, CA). CD3+ T cells, CD56+ NK cells, and CD68+ macrophages were virtually absent (<1%) from these cell suspensions, as assessed by flow cytometry. CD3, CD56, and CD68 mAbs were all obtained from Becton Dickinson. Controls were cells stained with isotype-matched mAbs of unrelated specificities; at least 10,000 events were acquired for each staining.

The purity of B cell fractions was further checked by extracting RNA and searching for the expression of the CD3{gamma} (T cell-specific), CD56 (NK cell-specific), and CD19 (B cell-specific) genes by RT-PCR (see below for the sequences of the primers and the details of these procedures).

As shown in Fig. 1GoA, the CD3{gamma} and CD56 transcripts were not detected in B cell-enriched suspensions, whereas they were consistently found in neuraminidase-treated sheep erythrocytes-rosette forming tonsillar cell fractions. The opposite pattern of expression was observed for the B cell-specific CD19 gene. These experiments demonstrate that there were no T or NK cell contaminants in the tonsillar B suspensions used throughout this study.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. A, Expression of the CD3{gamma}, CD56, CD19, IL-12Rß1, and ß2 genes in freshly purified tonsillar B lymphocytes as assessed by RT-PCR. Primers specific for IL-12Rß1, IL-12Rß2, and CD56 genes were designed on mRNA sequences. Primers for CD3{gamma} gene were designed upon the exon 3 sequence. The CD19 sense primer was designed on exon 1 sequence, the CD19 antisense primer on exon 9. CD19-specific primers amplify CD19 cDNA giving rise to the 1103-bp band shown in the figure. Amplification of genomic DNA using the same primers generates a 5286-bp band that can be easily distinguished from the CD19 cDNA band (data not shown). Left to right, MW, m.w. markers; NC, negative control, represented by a Th2 cell clone for CD56, CD19, and IL-12Rß2 primers, purified tonsillar B cells for CD3{gamma} primers, and water in the place of cDNA for IL12Rß1 and GAPDH primers; PC, positive control, represented by: 1) an Ag-specific Th1 cell clone for CD3{gamma}, IL12Rß1, and IL-12Rß2 primers; 2) tonsillar non-T cells for CD56 primers; and 3) the RPMI 8866 lymphoblastoid B cell line for CD19 primers. The residual lanes represent four experiments conducted with B cell suspensions from different tonsils. GAPDH is a housekeeping gene tested as control. Right, The expected m.w. of the amplified bands are shown. B, Expression of IL-12Rß1 and ß2 transcripts in freshly isolated and cultured tonsillar B lymphocytes as assessed by RPA. Cells (5 x 106/ml) were cultured for 4, 24, or 48 h in the presence of SAC (1:10,000) or IL-12 (20 ng/ml). One representative experiment of the five conducted with superimposable results is shown. Top right, The free probe and the negative control, i.e., t-RNA yeast. Arrows, top to bottom, indicate the position of the bands corresponding to IL-12Rß1 and ß2 mRNA and to the L32 and GAPDH housekeeping gene transcripts, respectively. Bottom (histogram), Fold induction of IL-12Rß1 and ß2 chain mRNA expression obtained by normalization.

 
Fractionation of tonsillar B lymphocytes into germinal center (GC), naive, and memory cell subsets was performed as follows. Naive B lymphocytes were isolated as IgD+ cells from total B lymphocyte suspensions by immune rosetting (46). The IgD- B cell fractions were further separated into CD38+ (GC) cells and CD38- (memory) cells by the same technique (46).

All of the separation procedures were performed at 4°C to prevent spontaneous apoptosis of GC B cells. Purified B cells were used immediately after isolation or were cultured for the indicated times at the concentration of 1 x 106/ml in RPMI 1640 medium (Seromed-Biochrom KG, Berlin, Germany) supplemented with 10% FCS (Seromed) in the presence of different stimuli (see below).

RNA preparation, PCR, and RNase protection assay (RPA)

RNA was extracted from cultured cells using Ultraspec (Biotecx Laboratories, Houston, TX). The stimuli tested were: Staphylococcus aureus Cowan I bacteria (SAC; 1:10,000) (Calbiochem, La Jolla, CA); rIL-12 (20 ng/ml) (Genetics Institute, Cambridge, MA); and anti-{kappa} (1 µg/106 cells) (Southern Biotechnology Associates, Birmingham, AL) in combination with anti-{lambda} (1 µg/106 cells) Ig light chain mAbs (Southern Biotechnology Associates); CD40 mAb (1 µg/ml) (Immunotech, Marseille, France), alone or in combination with rIL-4 (10 ng/ml) (Genzyme, Cambridge, MA); rIL-4 alone (10 ng/ml); and IFN-{gamma} (1000 U/ml) (Boehringer Mannheim, Mannheim, Germany). Primer sequences and profiles of amplification were as follows: hypoxanthine-guanine phosphoribosyltransferase (HPRT) sense CCTGCTGGATTACATCAAAGCACTG, antisense TCCAACACTTCGTGGGGTCCT, 94°C for 1 min, 61°C for 1 min, 72°C for 1 min, 30 cycles; IL-12Rß1 sense TCTTCCTCTTCCTGCTGTCC, antisense CAGCCGCCTCCTCCCATCC, 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, 30 cycles; IL-12Rß2 sense ACCGGAAATTGGGCTGTGGCTG, antisense AATGCTTGGTGCCACAAACGCC 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, 30 cycles; IL-1Rrp sense ATTACCCTTGACCCTTTGGG, antisense TCAAACTCGGCGTTCTTCTT, 94°C for 1 min, 55°C for 1 min, 58°C for 1 min, 27 cycles; AcPL sense CCTGCCCTTCATGGGTAGTA, antisense ATCCACTACGATTCGGTTGC, 94°C for 1 min, 55°C for 1 min, 60°C for 1 min, 26 cycles; GAPDH sense ACATCGCTCAGAACACCTATGG, antisense GGGTCTACATGGCAACTGTGAG, 94°C for 1 min, 60°C for 1 min, 72°C for 2 min, 30 cycles; CD3{gamma} sense GGTTCGGTACTTCTGACT, antisense TGGTTTTGACTTGTTCTG, 94°C for 1 min, 48°C for 1 min, 72°C for 1 min, 32 cycles; CD19 sense ACCTCCTCGCCTCCTCTTC, antisense TCCCCTTCCTCTTCTTCTG, 94°C for 1 min, 57°C for 1 min, 72°C for 1 min, 32 cycles. Ten microliters of each sample were electrophoresed through a 1.5% agarose gel with ethidium bromide and scanned via FluorImager (Molecular Dynamics, Sunnyvale, CA). The specificity of the PCR products was checked both by confirming the known base pair sequence length and by Southern blot of the amplified bands using internal probes specific for each gene investigated. Bands were assigned densitometric values by ImageQuaNT program (Molecular Dynamics), and these values were normalized to HPRT values.

RPA was performed using the PharMingen probe kit hCR-3 (San Diego, CA) with 5 µg/lane total RNA, according to the manufacturer’s protocol. Products were resolved on 6% denaturing polyacrylamide gels, and the protected fragments were visualized and quantitated using a PhosphorImager 445SI (Molecular Dynamics). Relative radioactivity values for IL-12Rß1 and IL-12Rß2 transcripts were determined by normalizing to the values obtained for the L32 housekeeping gene, which was used as internal control for equal RNA loading.

Assay for Ig secretion

B cells were cultured in the presence of IL-12 (20 ng/ml) or SAC (1:10,000) for 48 h, washed, and incubated with IL-12 (20 ng/ml) or IL-18 (50 ng/ml) (Harlan Breeders, Indianapolis, IN) alone or in combination, for 7 days. Culture supernatants and human Ig standards (Behring, Marburg, Germany) were diluted in PBS containing 2% BSA (Sigma, St. Louis, MO). IgG, IgA, and IgM concentration was measured by ELISA. Samples (100 µl) were added to 96-well polystyrene ELISA/RIA plates (Dynatech Laboratories, Chantilly, VA) previously coated for 16 h at 4°C with rabbit anti-human IgG, IgA, or IgM antisera (Dako, Glostrup, Denmark). Following a 2-h incubation at 37°C and three washings with PBS containing 0.001% Tween 20, HRP-conjugated goat anti-human IgG, IgA, or IgM (Dako) antiserum was added. After addition of O-phenylenediamine (Sigma), substrate color development was stopped by 5 M sulfuric acid, and absorbance was measured at 492 nm using a Gralis Ad Reader (Bouty, Milan, Italy). The concentration of Ig in the culture supernatants was calculated from the standard curve.

Detection of IFN-{gamma} in B cell culture supernatants

Purified tonsillar B cells pretreated for 48 h with IL-12 (20 ng/ml) or SAC (1:10,000) were washed and subsequently cultured for 24 or 48 h with IL-12 (20 ng/ml) and/or IL-18 (50 ng/ml). IgD+ (naive) and IgD- (GC and memory) B cell fractions were cultured for 24 h in the presence of IL-12 (20 ng/ml). Supernatants were then collected and tested in triplicate for IFN-{gamma} by ELISA (BioSource International, Camarillo, CA).

IFN-{gamma} intracellular staining

Purified tonsillar B cells or MNC were cultured for 48 h with IL-12 and IL-18, washed, and incubated for an additional 5 h with 20 ng/ml PMA, 250 ng/ml calcium ionophore, and 5 µg/ml brefeldin A (all reagents purchased from Sigma). After washing, cells were single- or double-stained for a pan-B surface marker (CD20) and/or intracytoplasmic IFN-{gamma}. For double staining, B cells were first incubated with PE-conjugated CD20 mAb (Becton Dickinson) or with the appropriate control (see below) for 30 min at 4°C, then fixed with 4% paraformaldehyde (Sigma) for 20 min at 4°C and permeabilized with 0.1% saponin (Sigma) in PBS. In some experiments, a PE-conjugated CD3 mAb (Becton Dickinson) was used in the place of CD20 mAb following the same protocol. Cells were subsequently incubated with an FITC-conjugated anti-IFN-{gamma} mAb (PharMingen) or with the appropriate controls (see below) for 30 min at 4°C, washed, and enumerated by flow cytometry. Control for CD20 surface staining were cells incubated with a PE-conjugated, isotype-matched mAb of irrelevant specificity. Controls for intracytoplasmic IFN-{gamma} staining were cells incubated with an FITC-conjugated, isotype-matched mAb of irrelevant specificity or with the anti-IFN-{gamma} mAb preincubated with rIFN-{gamma} before staining. Single staining of B cells by CD20 or anti-IFN-{gamma} mAbs was conducted using the above procedures separately.

Nuclear extracts and EMSA

Purified B lymphocytes were used directly or following stimulation with SAC (1:10,000) or IL-12 (20 ng/ml) for 48 h, washed with serum-free RPMI 1640, and starved for 3 h at 37°C in RPMI 1640 supplemented with 1% albumin. Cells were then resuspended at a concentration of 2 x 107/ml in medium with or without IL-12 (20 ng/ml) or IL-18 (50 ng/ml), either alone or in combination, and incubated at 37°C for 30 min. Nuclear extracts were subsequently prepared as previously described (47). Freshly isolated IgD+ and IgD- B cells starved as described above were incubated for 30 min with IL-12 before preparing nuclear extract.

End-labeled DNA probes (50,000 cpm/sample) were mixed with 4 µg of crude nuclear extract and incubated at room temperature for 25 min in the presence of 1 µg of poly (dI-dC) (Boehringer Mannheim) in a volume of 10 µl of buffer C (20 mM HEPES, pH 7.9; 0.4 M NaCl; 0.1 mM EGTA; 1 mM DTT; 1 mM PMSF; 10 µg/ml aprotinin; 10 µg/ml leupeptin; 1 µg/ml pepstatin A; and 1 mM sodium orthovanadate). The mix was then fractionated through a 6% polyacrylamide gel in 0.5x Tris borate EDTA for 1.5 h at 150 V. The gel was dried, exposed in a PhosphorImager storage screen, and scanned. Supershift experiments were conducted by preincubating the nuclear extract with 1–2 µg polyclonal anti-p50, anti-p65, anti-c-Rel, anti-Rel-B, or anti-ets2 rabbit antisera (all purchased from Santa Cruz Biotechnology, Santa Cruz, CA) or normal rabbit serum for 30 min at room temperature after the addition of radiolabeled probe. The following double-strand oligonucleotides were used in EMSA as labeled or competitor probes: IFN-{gamma} activation site (GAS), 5'-GTATTTCCCAGAAAAGGAAC 3', NF-{kappa}B 5'-ATGTGAGGGGACTTTCCCAGG-3'.

Total extracts and Western blot analysis

Purified tonsillar B cells were stimulated with SAC (1:10,000) or medium for 48 h, washed with serum-free RPMI 1640, and incubated for an additional 30 min with IL-12 (20 ng/ml) or medium alone. Cells were subsequently incubated for 30 min on ice with lysis buffer containing 20 mM HEPES, 150 mM NaCl, 10% glycerol, 0.5% Nonidet P-40, 1 mM EDTA, 2.5 mM DTT, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 µg/ml pepstatin A, 1 mM PMSF, and 1 mM Na3VO4. During this time interval, cells were subjected to vortex mixing every 5 min. Thereafter, lysates were centrifuged at 12,000 rpm for 5 min at 4°C, and supernatants were quantitated by the BCA kit assay (Pierce, Rockford, IL). Equal amounts of protein (10 µg) were loaded on 8% SDS-polyacrylamide gel and boiled 3 min before application. Gel was blotted onto Protean nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany) for 1 h at 100 V. Blots were incubated in a blocking buffer containing BSA and 0.5% Tween 20 in TBS for 1 h, followed by incubation with rabbit anti-human STAT4 antiserum (Santa Cruz Biotechnology). After three washings in TBS-Tween 20, blots were incubated for 1 h with goat anti-rabbit Ig conjugated with HRP (Santa Cruz Biotechnology) at the final concentration of 50 ng/ml in TBS-Tween 20 containing 1% BSA. Detection was performed by enhanced chemiluminescence (ECL, Pierce).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-12R and IL-18R expression in human tonsillar B cells

IL-12Rß1 and ß2 gene expression in freshly isolated tonsillar B lymphocytes was investigated by RT-PCR. As shown in Fig. 1AGo, the two IL-12R chain transcripts were detected in B cells obtained from four different tonsils and in T cells from a Th1 clone tested as positive control (12, 14, 15, 17). The specificity of the amplified bands was confirmed by Southern blot analysis with internal probes (data not shown).

Next, regulation of ß1 and ß2 gene expression in B lymphocytes cultured with different stimuli for 4, 24, or 48 h was studied by RPA (Fig. 1GoB). Consistent with the results of the RT-PCR experiments shown in Fig. 1GoA, freshly purified B cells expressed IL-12Rß1 and ß2 chain mRNA. Upon normalization, the intensity of the ß2 band displayed a 4- to 5-fold increase following a 48-h incubation with SAC (1:10,000) or IL-12 (20 ng/ml) (Fig. 1GoB). In contrast, the ß1 chain transcript showed little variation over the whole culture period (Fig. 1GoB). Other stimuli tested, such as anti-Ig light chain mAbs, CD40 mAb (alone or in combination with IL-4), IL-4, or IFN-{gamma} were found to be ineffective at modulating the expression of both IL-12R chain genes (data not shown). Based on these results, all of the subsequent experiments making use of SAC or IL-12 were conducted at the concentrations indicated above.

The effects of IL-12 on IL-18R mRNA expression in tonsillar B cells were next investigated. As shown in Fig. 2Go, transcripts of the two IL-18R chains were not detected in freshly isolated B cells but became apparent after 12–48 h culture with IL-12. In contrast, other stimuli, such as anti-Ig light chain mAbs, CD40 mAb (alone or in combination with IL-4), IL-4, or IFN-{gamma} did not induce expression of the transcripts of either IL-18R chain at any time tested (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of IL1-Rrp and AcPL chain mRNA of the IL-18R in freshly isolated or cultured tonsillar B lymphocytes as assessed by RT-PCR. Cells (5 x 106/ml) were cultured for 4–48 h in the presence of IL-12 (20 ng/ml). HPRT is a housekeeping gene.

 
IL-12 does not activate STAT-4 in tonsillar B cells

Next, tonsillar B cells, either freshly purified or pretreated with SAC for 48 h, were shortly exposed to IL-12 and tested for STAT activation by EMSA. The rationale of these experiments was that the transcripts of both IL-12R chains were already expressed in freshly isolated tonsillar B cells and that SAC stimulation up-regulated the expression of IL-12Rß2 mRNA (see Fig, 1B).

EMSA were first performed using a probe with the sequence of the STAT-binding region of the Fc{gamma} receptor promoter (IFN-{gamma} activation site (GAS) probe). Incubation of B lymphocytes with IL-12 did not induce STAT binding. The representative experiment shown in Fig. 3GoA refers to B cells pretreated with SAC or medium alone (control) for 48 h, but identical results were obtained when freshly isolated B lymphocytes were tested (data not shown). As expected, specific binding of the probe to nuclear extracts was detected in PHA-stimulated control PBL incubated with IL-12 (Fig. 3GoA).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3. A, EMSA conducted with nuclear extracts from tonsillar B lymphocytes incubated 48 h with medium or SAC and subsequently exposed either to IL-12 or medium alone for 30 min. The oligonucleotide used has the sequence of the IFN-{gamma} activation site element of the Fc{gamma} receptor 1 promoter. Left to right, 48-h PHA-stimulated PBL exposed to IL-12 (positive control); B cells preincubated with medium (MED) and then cultured with medium alone (none) or with IL-12; SAC-preactivated B cells (SAC) cultured with medium alone (none) or with IL-12. Arrow indicates the specific band. One representative experiment of the 10 performed with different tonsillar B cell suspensions is shown. B, Western blot analysis of total extracts from tonsillar B lymphocytes cultured for 48 h with medium or SAC and then exposed to IL-12 or medium alone for 30 min. The experiments were conducted with an anti-STAT4 polyclonal Ab. Left to right, PBL cultured with medium alone; PBL stimulated with PHA and exposed to IL-12 (positive control); B cells cultured in medium (MED) and then incubated with IL-12; SAC-preactivated B cells (SAC) exposed to medium alone (none) or with IL-12. Left, Arrows (top to bottom) indicate the position of the bands corresponding to phosphorylated and unphosphorylated STAT4, respectively. One representative experiment of the three performed with different B cell fractions is shown.

 
Next, total extracts from B cells pretreated with SAC or medium alone (control) for 48 h and subsequently exposed to IL-12 were challenged with anti-STAT4 polyclonal Abs and analyzed by Western blot (Fig. 3GoB). PHA-stimulated control PBL incubated with IL-12 contained both the phosphorylated and the unphosphorylated bands of STAT4, whereas only the latter band was detected in B cells incubated with IL-12, as well as in unstimulated PBL (Fig. 3GoB). Taken together, the EMSA and Western blot experiments rule out STAT transcription factor involvement in IL-12-mediated human B cell signaling.

Both IL-12 and IL-18 activate NF-{kappa}B in human tonsillar B cells

Previously it was shown that IL-12 activates the NF-{kappa}B complex in murine dendritic cells (24). Therefore, the possible involvement of NF-{kappa}B in IL-12 signaling to B cells was investigated and the effects of IL-12 were compared with those of IL-18 (41, 42).

For the IL-12 experiments, tonsillar B lymphocytes, either freshly purified or pretreated with SAC for 48 h, were shortly exposed (30 min) to IL-12 and tested for NF-{kappa}B activation. The IL-18 experiments were conducted by preincubating B cells with IL-12 for 48 h before exposing them to IL-18 for 30 min. The latter protocol was used due to the observation shown in Fig. 2Go that tonsillar B lymphocytes expressed IL-18R mRNAs only upon prolonged incubation with IL-12.

Binding of nuclear extracts to the NF-{kappa}B probe was detected both in freshly isolated B cells incubated with IL-12 for 30 min (data not shown and Fig. 4GoB, lanes 3–4 from the left) and in 48-h cultured B cells (Fig. 4GoA, lanes 3–6 from the left), irrespective of whether they had been pretreated with SAC or medium before being pulsed with IL-12 for 30 min. The intensity of the bands was higher in the cultures exposed to IL-12 as compared with the ones conducted in the absence of the cytokine (~4- and 2.5-fold induction, respectively; see Fig. 4GoA, lanes 3–6 from the left).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. A, EMSA conducted with nuclear extracts from tonsillar B lymphocytes incubated 48 h with medium, SAC, or IL-12 and subsequently exposed to IL-12, medium alone, or IL-18 for 30 min. The oligonucleotide has the sequence of the NF-{kappa}B binding site of the Ig {lambda} light chain enhancer. Left to right, Negative control (no extract), RPMI 8866 lymphoblastoid B cell line (positive control); B cells cultured with medium (MED) and then exposed to medium (none) or IL-12; B cells cultured with SAC and then incubated with medium (none) or IL-12; B cells cultured with IL-12 and then incubated with medium (none) or IL-18. One representative experiment of the 12 performed with different B cell fractions is shown. B, EMSA conducted with nuclear extracts from freshly isolated tonsillar B lymphocytes exposed to IL-12 or medium alone for 30 min. The oligonucleotide used has the sequence of the NF-{kappa}B binding site of the Ig {lambda} light chain enhancer. Left to right, Negative control (no extract), positive control (RPMI 8866); B cells cultured with medium alone (medium). Lanes 4–9, Nuclear extracts from IL-12-stimulated B cells were admixed with both the radioactive oligonucleotide and with a molar excess, ranging from 10x to 160x, of the same unlabeled oligonucleotide. In the last lane, an oligonucleotide of irrelevant sequence was admixed with nuclear extracts at a molar excess of 40x. The arrows point to specific bands generated during the assay. One representative experiment of the two conducted with different B cell fractions is shown.

 
Similar results were obtained in the IL-18 experiments. Again, binding of the NF-{kappa}B probe to nuclear extracts was detected in IL-12-pretreated B cells pulsed with either IL-18 or medium, and the intensity of the band was higher in the presence than in the absence of IL-18 (~2- to 3-fold induction, see Fig. 4GoA, lanes 7 and 8 from the left).

To demonstrate the binding specificity of the NF-{kappa}B probe to B cell nuclear extracts, freshly purified tonsillar B lymphocytes were exposed to IL-12 for 30 min and subjected to gel shift experiments in the presence or absence of increasing molar concentrations of the unlabeled NF-{kappa}B oligonucleotide (Fig. 4GoB). Addition of such competitor caused the complete disappearance of the specific bands starting from the concentration of 40x (Fig. 4GoB).

The above findings indicate that IL-12 and IL-18 independently activate NF-{kappa}B in human tonsillar B lymphocytes. A final series of experiments was addressed to the identification of NF-{kappa}B family members involved in IL-12-driven activation of tonsillar B lymphocytes (48). To this end, nuclear extracts were prepared from freshly purified tonsillar B cells incubated with IL-12 for 30 min and run in a gel supershift assay in the presence or absence of different Abs to the main components of the NF-{kappa}B complex.

As shown in Fig. 5Go, the anti-p50 antiserum caused a supershift of the lower band, whereas the c-Rel-specific antiserum induced a supershift of the upper band, as compared with the pattern detected in the absence of any Ab added. Accordingly, binding of anti-p50 Abs to nuclear extracts caused the disappearance of the p50/p50 homodimer (lower band) and a reduction of the intensity of the p50/c-Rel heterodimer (upper band) (Fig. 5Go). Binding of anti-c-Rel antiserum resulted in a decreased intensity of the latter band only (Fig. 5Go).



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 5. Gel supershift conducted with nuclear extracts from freshly isolated tonsillar B lymphocytes. The oligonucleotide used has the sequence of the NF-{kappa}B binding site of the Ig {lambda} light chain enhancer. The Abs used were directed to NF-{kappa}B family members (p50, p65, c-Rel, and Rel-B) or to the unrelated ets-2 transcription factor. Left to right, Negative control (no extract), positive control (RPMI 8866); B cells cultured with IL-12 for 30 min in the absence of any Ab added. Lanes 4–8, Supershift assay with anti-p50, p-65, c-Rel, Rel-B, or ets-2 Abs conducted with nuclear extracts from IL-12-stimulated B cells. Arrows indicate the specific bands corresponding to the p50/c-Rel and p50/p50 NF-{kappa}B complexes. One representative experiment of the four performed with different B cell fractions is shown.

 
In contrast, no supershift was observed using antisera to Rel-B or p65 (two additional components of the NF-{kappa}B family), to ets-2 (a transcription factor unrelated to NF-{kappa}B) (Fig. 5Go), or normal rabbit serum (data not shown). It is concluded that IL-12-induced NF-{kappa}B activation in tonsillar B lymphocytes involves the p50 and c-Rel NF-{kappa}B family members.

Functional activation of tonsillar B cells by IL-12 and/or IL-18

In a first series of experiments, tonsillar B lymphocytes were pretreated with SAC or IL-12 for 48 h and then cultured in the presence or absence of IL-12 and/or IL-18 for 7 days. As shown in Fig. 6Go, A and B, the only Ig isotype detected in culture supernatants over background values (medium) was IgM. Both IL-12 and IL-18 induced the production of higher amounts of IgM in SAC- than in IL-12-pretreated B cell cultures (Fig. 6Go, A and B). No additive or synergistic effects of IL-12 and IL-18 were observed (Fig. 6Go, A and B).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. In vitro Ig production by tonsillar B lymphocytes preactivated with SAC (Fig. 7GoA) or IL-12 (Fig. 7GoB) for 48 h and subsequently incubated with IL-12, IL-18, or the combination of the two cytokines for additional 7 days. Culture supernatants were harvested, and IgM, IgG, and IgA concentrations were determined by ELISA. Results (expressed in ng/ml) are means from nine experiments performed with different B cell fractions.

 
Next, the ability of tonsillar B cells to synthesize IFN-{gamma} in response to IL-12 and/or IL-18 was investigated by ELISA (Fig. 7Go). IL-12 alone induced IFN-{gamma} secretion in SAC- (Fig. 7GoA) or IL-12- (Fig. 7GoB) pretreated B lymphocytes, and such induction was enhanced by IL-18 in a synergistic manner at all the times tested. In contrast, IL-18 alone was poorly effective at stimulating IFN-{gamma} production (Fig. 7Go, A and B).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 7. IFN-{gamma} secretion by tonsillar B lymphocytes preactivated with SAC (Fig. 8GoA) or IL-12 (Fig. 8GoB) for 48 h and subsequently incubated with IL-12, IL-18, or the combination of the two cytokines for 24 or 48 h. Culture supernatants were harvested and tested for IFN-{gamma} secretion by ELISA. Results (expressed as pg/ml) represent the means from 12 experiments performed with different B cell fractions.

 
The B cell suspensions used throughout this study were virtually devoid of contaminant cell types, as assessed by both flow cytometry and RT-PCR (see above). Nonetheless, to demonstrate unequivocally that B cells were indeed the source of IFN-{gamma}, IL-12 plus IL-18-stimulated B lymphocytes were double-stained for intracellular IFN-{gamma} and surface CD20, a B cell-specific marker. B cells staining for intracellular IFN-{gamma} were detected in the representative experiment shown in Fig. 8Go, as well as in two additional experiments conducted with similar results (mean positive cells 20%). Double-staining of tonsillar MNC for CD3 and intracellular IFN-{gamma} following incubation with IL-12 as above showed that ~40% T cells (mean from three different experiments) contained the intracellular cytokine (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. IFN-{gamma} synthesis by tonsillar B lymphocytes preincubated with IL-12 and IL-18 for 48 h. A, Cells were single stained by a PE-conjugated CD20 mAb (surface staining) or a FITC-conjugated anti-IFN-{gamma} mAb (intracytoplasmic staining) and analyzed by flow cytometry. Approximately 99% CD20+ and 20% intracytoplasmic IFN-{gamma}+ cells, respectively, were detected in this experiment. Control for CD20 surface staining were cells incubated with a PE-conjugated, isotype-matched mAb of irrelevant specificity (left, dashed line). Controls for intracytoplasmic IFN-{gamma} staining were cells incubated with an FITC-conjugated, isotype-matched mAb of irrelevant specificity (right, dashed line) or with the anti-IFN-{gamma} mAb preincubated with rIFN-{gamma} before staining (right, continuous line). B, Double staining of tonsillar B lymphocytes for CD20 and intracytoplasmic IFN-{gamma}. Left, No staining (<1% positive cells) was detected when the two fluorochrome-conjugated control mAbs of irrelevant specificity were tested together. Middle, B cells were stained with the PE-conjugated CD20 mAb and with the FITC-conjugated, isotype-matched irrelevant mAb used as control for anti-IFN-{gamma} staining. Only CD20 single positive cells (99%) are detected. In experiments not shown, B cells were stained with the FITC-conjugated anti-IFN-{gamma} mAb and with the PE-conjugated isotype-matched irrelevant mAb used as control for CD20 staining. Only 20% intracytoplasmic IFN-{gamma} single positive cells were detected. Right, B cells were double stained with CD20 and anti-IFN-{gamma} mAbs. The shift of the FACS profile to the right, as compared with the staining shown in the middle panel of this figure, clearly denotes the presence of a fraction (20%) of B cells positive for intracytoplasmic IFN-{gamma}. Such findings demonstrate that, under these experimental conditions, the only cells that displayed a positive staining for intracytoplasmic IFN-{gamma} were B lymphocytes. Results refer to a representative experiment of the three performed.

 
IL-12Rß1 and ß2 chain gene expression, IL-12-induced NF{kappa}B activation, and IFN-{gamma} production in tonsillar B cell subsets

Tonsillar B lymphocytes are comprised of three major cell populations, i.e., GC, naive, and memory cells (36, 49, 50, 51, 52, 53). These cell fractions differ as for immunophenotype, anatomical location, and functional features (49, 50, 51, 52, 53, 54). To investigate what B cell subset(s) were targets of IL-12, purified tonsillar B lymphocytes were separated into naive (IgD+, CD38-), GC (IgD-, CD38+), and memory (IgD-, CD38-) cells (36, 49, 50, 51, 52, 53, 54). Consistent with previous reports (36, 54, 55) most IgD+ naive B cells were CD39+, IgM+, IgG-, CD38-, CD10-, whereas approximately one-half of them expressed the CD23 marker (data not shown). CD38+, IgD- GC B cells were CD10+, CD39-, CD23-. IgD-, CD38- memory B lymphocytes were predominantly CD39+, IgG+, CD23-, CD10- (data not shown) (36, 54, 55). All separation procedures were conducted at 4°C to prevent spontaneous apoptosis, and freshly isolated GC B cells contained consistently >90% viable lymphocytes, as assessed by trypan blue staining.

IL-12Rß1 and ß2 gene expression in freshly isolated naive, GC, and memory B lymphocytes was first investigated by RT-PCR. As shown in Fig. 9GoA, the two IL-12R chain gene transcripts were detected in all B cell subsets, as well as in T cells from a Th1 clone tested as positive control (12, 14, 15, 17).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 9. Expression of IL-12R ß1 and ß2 chain mRNA, IL-12-induced NF-{kappa}B activation, and IFN-{gamma} production in human tonsillar B cell subsets. A, Expression of IL-12Rß1 and ß2 transcripts in freshly isolated B cell subsets as assessed by RT-PCR. Left to right, MW, m.w. markers; negative control NC, represented by water in the place of cRNA; an Ag-specific Th1 cell clone; total tonsillar B cells; GC (IgD-, CD38+), naive (IgD+), and memory (IgD-, CD38-) B cells. B, EMSA conducted with nuclear extracts from freshly isolated tonsillar B cell subsets exposed to IL-12 for 30 min. The oligonucleotide has the sequence of the NF-{kappa}B binding site of the Ig {lambda} light chain enhancer. Left to right, RPMI 8866 lymphoblastoid B cell line (positive control); IgD- (GC and memory) B cells incubated with medium (none) or IL-12; IgD+ (naive) B cells incubated with medium (none) or IL-12. One representative experiment of the four performed with different B cell fractions is shown. C, IFN-{gamma} secretion by tonsillar B cell subsets incubated with IL-12 for 24 h. The IgD- B cell fraction contains GC and memory B lymphocytes, whereas the IgD+ B cell fraction contains naive B cells. Culture supernatants were harvested and tested for IFN-{gamma} secretion by ELISA. Results (expressed as pg/ml) represent the means from four experiments performed with different B cell suspensions.

 
Previously it was shown that naive tonsillar B lymphocytes were induced to differentiate to IgM-secreting cells following incubation with follicular dendritic cell-derived IL-12 in the absence of any preactivation (30). Therefore, tonsillar B lymphocytes were separated into IgD+ (naive) and IgD- (GC and memory) cells, nuclear extracts were prepared from freshly isolated cells incubated for 30 min with IL-12, and EMSA was conducted using the NF-{kappa}B probe. Fig. 9GoB shows that the probe bound to extracts from naive, but not GC and memory, B cells, indicating that IL-12 activated the NF-{kappa}B system in naive B lymphocytes only.

Finally, IgD+ and IgD- tonsillar B cells were tested by ELISA for their ability to produce IFN-{gamma}. Cells were first incubated with SAC for 48 h and then exposed to IL-12 for 24 h before harvesting culture supernatants. Fig. 9GoC shows that IgD+ naive B cells but not IgD- GC and memory B cells produced IFN-{gamma} under the above conditions. Additional experiments (data not shown) in which tonsillar B cells were separated into naive (IgD+, CD38-), GC (IgD-, CD38+), and memory (IgD-, CD38-) subsets and cultured as above confirmed that IFN-{gamma} production was restricted to naive B lymphocytes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human T and NK cells are activated by IL-12 via a heterodimeric receptor composed of the ß1 and ß2 chains. In the case of T cells, clonal studies have shown that Th1 cells, whose differentiation is induced by IL-12, express both chains of the IL-12R, whereas Th2 cells do not express the ß2 chain and, consequently, are refractory to IL-12 stimulation (11, 12, 14, 17).

Numerous effects of IL-12 on human peripheral blood or tonsillar B cells have been reported, namely 1) induction of proliferation of preactivated B lymphocytes (28, 29); 2) induction of differentiation to Ig-secreting cells, especially in association with IL-2 (28, 30); 3) enhancement of CD25 expression (25); 4) induction of IFN-{gamma} mRNA and protein (29, 40); and 5) inhibition of IgE synthesis induced by IL-4 (56). With the exception of the latter effect, which is probably indirect and mediated by T or NK cells, all of the other data were obtained using purified human B lymphocytes. In addition, murine studies have demonstrated that IL-12 mediates biological effects on B cells, such as changes in the IgG subclass distribution during ongoing Ag-specific immune responses or in vivo depletion of CD5+ peritoneal B1 cells (26, 56, 57).

The reported effects of IL-12 on human B lymphocytes raise questions about the nature of IL-12R and the signal transduction pathways triggered by the cytokine in these cells. As for the first issue, binding of IL-12 to B cells has been demonstrated in one study using SAC-preactivated peripheral blood B lymphocytes, but conflicting results have been obtained in other reports (12, 31, 32). Furthermore, it has been clearly established that human B lymphocytes express constitutively the IL-12Rß1 chain (31, 32), whereas no information is so far available on ß2 chain expression.

Here we show that freshly isolated tonsillar B cells, which were devoid of contaminant T cells and NK cells, expressed mRNA of both IL-12R chains as assessed by RT-PCR and RPA, and that culture with SAC or IL-12 caused a 4- to 5-fold increase in IL-12Rß2, but not ß1, chain transcript. In contrast, no increase of IL-12Rß2 gene expression was observed when B cells were incubated with anti-{kappa} plus anti-{lambda} Ig light chain Abs. Because SAC binds to the third variable heavy (VH3) chain region of IgM, IgG, and IgA, the different results obtained by stimulating B cells with SAC or anti-Ig Abs may appear surprising. Notably, in this connection, it was previously shown that malignant B cells from B chronic lymphocytic leukemia patients produced granulocyte-CSF in vitro following stimulation with SAC but not with anti-Ig Abs (58). Because of its binding capacity to the third variable heavy (VH3) chain region of most Ig isotypes, SAC has been designated as a B cell superantigen, and it has been proposed that it may activate B lymphocytes also through mechanisms unrelated to Ig binding that are so far poorly understood (59).

In view of the heterogeneity of tonsillar B cells, the expression of IL-12Rß1 and ß2 genes was investigated in freshly isolated naive, GC, and memory B lymphocytes. These experiments showed that the mRNA of both chains was constitutively expressed in all subsets.

The transcripts for both IL-1Rrp and AcPL, i.e., the two chains of the IL-18R, were induced de novo in tonsillar B cells by IL-12 stimulation. Similar results have been reported in the mouse, whereas immunophenotypic studies of human peripheral blood B cells have indicated that the latter cells express constitutively IL-1Rrp surface protein (46). The apparent discrepancy between these data and our results may be related to the different sources of B lymphocytes used in the two studies and/or to the different states of activation of peripheral blood vs tonsillar B cells.

Because IL-12 induced IL-18R expression in B cells, we next investigated the effects of IL-12 and IL-18 on Ig production and IFN-{gamma} synthesis. These experiments showed that IgM was the major isotype produced by preactivated B cells in the presence of IL-12 or IL-18. Synergistic or additive effects between the two cytokines were not observed.

IL-12 stimulation induced IFN-{gamma} synthesis and release by SAC- or IL-12-preactivated B cells in accordance with the results of previous studies (25, 26). IL-18 alone was poorly effective at stimulating IFN-{gamma} production, whereas IL-12 and IL-18 synergized in these experimental conditions (40).

IL-12-induced IFN-{gamma} production was also investigated in separated naive, GC, and memory tonsillar B lymphocytes. These experiments demonstrated that naive B cells only released IFN-{gamma} in culture supernatants following IL-12 stimulation.

Such observations may lead to speculation that, in the secondary lymphoid organs where the bulk of Ag-specific immune responses take place, the availability of IL-12 and IL-18 can switch on B cell IFN-{gamma} production and perhaps induce Th1 differentiation. However, current models of B cell activation indicate that the latter cells are committed to maintain the Th1 or Th2 phenotype of already differentiated CD4+ cells rather than to promote such differentiation (8, 60).

STAT3 and STAT4 are the major transcription factors involved in IL-12-mediated signaling to T and NK cells (18, 19, 20, 21, 22). An alternative pathway of IL-12-driven signal transduction has been reported for murine dendritic cells, in which NF-{kappa}B is activated by IL-12 in the absence of STAT3 or STAT4 involvement (24).

In this study, EMSA and Western blot experiments excluded the activation of any STAT family member in tonsillar B cells exposed to IL-12. However, in experiments not shown here, specific binding of nuclear extracts from IFN-{alpha}-treated B cells to the IFN-{gamma} activation site probe was observed, indicating that tonsillar B lymphocytes activated STAT 4 under these conditions.

We speculated that NF-{kappa}B could be a candidate family of transcription factors involved in IL-12-mediated signaling to B cells. NF-{kappa}B was found to be constitutively activated in freshly separated or cultured B cells, but IL-12 or IL-18 stimulation caused a clear-cut increase of NF-{kappa}B binding to DNA, thus lending support to our hypothesis.

Cell fractionation experiments showed that IL-12-induced NF-{kappa}B activation occurred in naive, but not in GC or memory B cells. The reason why signal transduction in response to IL-12 was detected only in naive B cells, whereas expression of IL-12R chains was demonstrated also in GC and memory B cells, is presently unknown. One possibility is that posttranscriptional modifications of the ß1 and/or ß2 IL12R chain mRNA lead to the production of the functional protein(s) in naive, but not in GC or memory B cells. Further studies are needed to clarify this issue.

IL-12 and IL-18 share the ability to activate NF-{kappa}B (24, 41, 42) and to induce IFN-{gamma} production by T and NK cells (2). The possibility that, in our experimental conditions, part of the biological activities attributed to IL-12 were mediated by endogenous IL-18 possibly produced by the B cells themselves is made highly unlikely because: 1) IL-12-induced B cell signaling via NF-{kappa}B was clearly demonstrated using freshly isolated tonsillar B lymphocytes that did not express IL-18R; and 2) IL-18 was a poor stimulator of IFN-{gamma} production by B cells pretreated with either SAC or IL-12.

The human NF-{kappa}B family is comprised of five members, i.e., p50, p65, c-Rel, Rel-B, and p52 (48). To investigate what NF-{kappa}B components were involved in IL-12-mediated B cell signaling, gel supershift experiments were conducted with specific Abs. It was found that p50 and c-Rel were the members of the NF-{kappa}B family responsible for IL-12-delivered signals. Interestingly, p50 and Rel-B were previously identified as the proteins involved in IL-12 signaling to murine dendritic cells (24).

In conclusion, this study shows that IL-12 signals to human tonsillar B cells through the NF-{kappa}B pathway by interacting with the classic heterodimeric IL-12R composed of the ß1 and ß2 chains. IL-12R is constitutively expressed by freshly isolated tonsillar B cells and, in particular, by the naive, GC, and memory cell subsets, but exposure to IL-12 activates signal transduction and IFN-{gamma} production in naive B cells only.


    Footnotes
 
1 This work was supported by grants from the Associazione Italiana per la Ricerca sul Cancro, Italy and Ministero della Sanità, Progetti Finalizzati, Italy (to V.P.). I.A. was supported by an Italian Foundation for Cancer Research (FIRC) fellowship. Back

2 Address correspondence and reprint requests to Dr. Irma Airoldi, Laboratory of Oncology, G. Gaslini Institute, Largo G. Gaslini, 5 16148 Genova, Italy. Back

3 Abbreviations used in this paper: IL-1Rrp, IL-1 receptor-related protein; SAC, Staphylococcus aureus Cowan I bacteria; AcPL, accessory protein-like; MNC, mononuclear cells; GC, germinal center; HPRT, hypoxanthine-guanine phosphoribosyltransferase; RPA, RNase protection assay. Back

Received for publication February 1, 2000. Accepted for publication September 26, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridges innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
  2. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, G. Trinchieri. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170:827.[Abstract/Free Full Text]
  3. Stern, A. S., F. J. Podlaski, J. D. Hulmes, Y. C. Pan, P. M. Quinn, A. G. Wolitzky, P. C. Familletti, D. L. Stremlo, T. Truitt, R. Chizzonite, M. K. Gately. 1990. Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells. Proc. Natl. Acad. Sci. USA 87:6808.[Abstract/Free Full Text]
  4. Wolf, S. F., P. A. Temple, M. Kobayashi, D. Young, M. Dicig, L. Lowe, R. Dzialo, L. Fitz, C. Ferenz, R. M. Hewick, et al 1991. Cloning of cDNA for natural killer stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J. Immunol. 146:3074.[Abstract]
  5. Manetti, R., F. Gerosa, M. G. Giudizi, R. Biagiotti, P. Parronchi, M. P. Piccinni, S. Sampognaro, E. Maggi, S. Romagnani, G. Trinchieri. 1994. Interleukin 12 induces stable priming for interferon gamma (IFN-{gamma}) production during differentiation of human T helper (Th) cells and transient IFN-{gamma} production in established Th2 clones. J. Exp. Med. 179:1273.[Abstract/Free Full Text]
  6. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Carvajal, C.-Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, M. K. Gately. 1996. IL-12-deficient mice are defective in IFN-{gamma} production and type 1 cytokine responses. Immunity 4:471.[Medline]
  7. Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C. Hsieh, J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy, A. O’Garra. 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol. 154:5071.[Abstract]
  8. Shultze, J. L., S. Michalak, J. Lowne, A. Wong, M. H. Gilleece, J. G. Gribben, L. M. Nadler. 1999. Human non-germinal center B cell interleukin (IL)-12 production is primarily regulated by T cell signal CD40 ligand, interferon {gamma}, and IL-10: role of B cells in the maintenance of T cell responses. J. Exp. Med. 189:1.[Abstract/Free Full Text]
  9. Peritt, D., S. Robertson, G. Gri, M. Aste-Amezaga, G. Trinchieri. 1998. Differentiation of human NK cells into NK1 and NK2 subsets. J. Immunol. 161:5821.[Abstract/Free Full Text]
  10. Chua, A. O., R. Chizzonite, B. B. Desai, T. P. Truitt, P. Nunes, L. J. Minetti, R. R. Warrier, D. H. Presky, J. F. Levine, M. K. Gately, U. Gubler. 1994. Expression cloning of a human IL-12 receptor component. J. Immunol. 153:128.[Abstract]
  11. Presky, D. H., Y. Hong, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  12. Desai, B. B., P. M. Quinn, A. G. Wolitzky, P. K. A. Mongini, R. Chizzonite, M. K. Gately. 1992. IL-12 receptor. II. Distribution and regulation of receptor expression. J. Immunol. 148:3125.[Abstract]
  13. Wu, C., R. R. Warrier, X. Wang, D. H. Presky, M. K. Gately. 1997. Regulation of IL-12 receptor ß1 chain expression and IL-12 binding by human peripheral blood mononuclear cells. Eur. J. Immunol. 27:147.[Medline]
  14. Szabo, S., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12Rß2 subunit expression. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  15. Gollob, J. A., H. Kawasaki, J. Ritz. 1997. Interferon-{gamma} and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of high-affinity interleukin-12 receptor expression. Eur. J. Immunol. 3:647.
  16. Igarashi, O., H. Yamane, S. Imajoh-Ohmi, H. Nariuchi. 1998. IL-12 receptor (IL-12R) expression and accumulation of IL-12Rß1 and IL-12Rß2 mRNAs in CD4+ T cells by costimulation with B7-2 molecules. J. Immunol. 160:1638.[Abstract/Free Full Text]
  17. Rogge, L., A. Papi, D. H. Presky, M. Biffi, L. J. Minetti, D. Miotto, C. Agostini, G. Semenzato, L. M. Fabbri, F. Sinigaglia. 1999. Antibodies to the IL-12 receptor ß2 chain mark human Th1 but not Th2 cells in vitro and in vivo. J. Immunol. 162:3926.[Abstract/Free Full Text]
  18. Bacon, C. M., E. F. Petricoin, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. IL-12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  19. Cho, S. S., C. M. Bacon, C. Sudarshan, R. C. Rees, D. Flimbloom, R. Pine, J. J. O’Shea. 1996. Activation of STAT4 by IL-12 and IFN-{alpha}: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
  20. Murphy, K. M., T. L. Murphy, S. J. Szabo, N. J. Jacobson, M. L. Guler, J. D. Gorham, U. Gubler. 1997. Regulation of IL-12 receptor in early T-helper responses implies two phases of Th1 differentiation: capacitance and development. Chem. Immunol. 68:54.[Medline]
  21. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sasawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for STAT-4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  22. Kaplan, M. H., Y. L. Sun, T. Heey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in STAT4 deficient mice. Nature 382:174.[Medline]
  23. Leonard, W. J., J. J. O’Shea. 1998. JAKs and STATs: biological implications. Annu. Rev. Immunol. 16:293.[Medline]
  24. Grohmann, U., M. L. Belladonna, R. Bianchi, C. Orabona, E. Ayroldi, M. C. Fioretti, P. Puccetti. 1998. IL-12 acts directly on DC to promote nuclear localization of NF-{kappa}B and primes DC for IL-12 production. Immunity. 9:315.[Medline]
  25. Metzger, D. W., L. A. Vogel, V. H. Van Cleave, T. L. Lester, J. M. Buchanan. 1995. The effects of IL12 on B cell subset function. Res. Immunol. 147:499.
  26. Vogel, L. A., T. L. Lester, V. H. Van Cleave, D. W. Metzger. 1996. Inhibition of murine B1 lymphocytes by interleukin-12. Eur. J. Immunol. 26:219.[Medline]
  27. Jones, B. M.. 1996. Effect of IL-12 neutralizing anti-cytokine antibodies on in vitro activation of B-cells: interleukin-12 is required by B1a but not B2 cells. Scand. J. Immunol. 43:64.[Medline]
  28. Jelinek, D. F., J. K. Braaten. 1995. Role of IL-12 in human B lymphocyte proliferation and differentiation. J. Immunol. 154:1606.[Abstract]
  29. Li, L., D. Young, S. F. Wolf, Y. S. Choi. 1996. Interleukin-12 stimulates B cell growth by inducing IFN-{gamma}. Cell. Immunol. 168:133.[Medline]
  30. Dubois, B., C. Massacrier, B. Vanbervliet, J. Faiette, F. Brière, J. Banchereau, C. Caux. 1998. Critical role of IL-12 in dendritic cell-induced differentiation of naive B lymphocytes. J. Immunol. 161:2223.[Abstract/Free Full Text]
  31. Vogel, L. A., L. C. Showe, T. L. Lester, R. M. McNutt, V. H. Van Cleave, D. W. Metzger. 1996. Direct binding of IL-12 to human and murine B lymphocytes. Int. Immunol. 8:1955.[Abstract/Free Full Text]
  32. Benjamin, B., V. Sharma, M. Kubin, J. L. Klein, A. Sartori, J. Holliday, G. Trinchieri. 1996. IL-12 expression in AIDS-related lymphoma B cell lines. J. Immunol. 156:1626.[Abstract]
  33. Okamura, H., T. Tsutsui, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Harttori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  34. Stoll, S., G. Muller, M. Kurimoto, J. Saloga, T. Tanimoto, H. Yamauchi, H. Okamura, J. Knop, A. H. Enk. 1997. Production of IL-18 (IFN-{gamma} inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159:198.
  35. Conti, B., J. Jahng, C. Tinti, J. Son, T. Joh. 1997. Induction of IFN-{gamma} inducing factor in the adrenal cortex. J. Biol. Chem. 264:2025.
  36. Tsutsui, H., K. Matsui, N. Kawada, Y. Hyodo, N. Hayashi, H. Okamura, K. Higashino, K. Nakanishi. 1997. IL-18 accounts for both TNF-{alpha} and FasL-mediated hepatotoxic pathways in endotoxin-induced liver injury. J. Immunol. 159:3961.[Abstract]
  37. Ghayur, T., S. Banerjee, M. Hugunin, D. Butler, L. Herzog, A. Carter, L. Quinta, L. Sekut, R. Talanian, M. Paskind, et al 1997. Caspase-1 processes IFN-{gamma} inducing factor and regulates LPS-induced IFN-{gamma} production. Nature 386:619.[Medline]
  38. Gu, Y., K. Kuida, H. Tsutsui, G. Ku, K. Hsiao, M. Fleming, H. Hayashi, K. Higashino, H. Okamura, K. Nakanishi, et al 1997. Activation of IFN-{gamma} inducing factor mediated by interleukin-1 ß converting enzyme. Science 275:206.[Abstract/Free Full Text]
  39. Yoshimoto, T., K. Takeda, T. Tanaka, K. Ohkusu, S. Kashiwamura, H. Okamura, S. Akira, K. Nakanishi. 1998. IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-{gamma} production. J. Immunol. 161:3400.[Abstract/Free Full Text]
  40. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K.-H. Meyer zum Buschenfelde, M. F. Neurath. 1998. Cutting edge: IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-{gamma} promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text]
  41. Robinson, D., K. Shibuia, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kalstelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7:571.[Medline]
  42. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 373:30412.
  43. Torigoe, K., S. Ushio, T. Okura, S. Kobayashi, M. Taniai, T. Kunikata, T. Murakami, O. Sanou, H. Kojima, M. Fujii, et al 1997. Purification and characterization of the human interleukin-18 receptor. J. Biol. Chem. 272:25737.[Abstract/Free Full Text]
  44. Born, T. L., E. Thomassen, T. A. Bird, J. E. Sims. 1998. Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J. Biol. Chem. 272:29445.
  45. Kunikata, T., K. Torigoe, S. Ushio, T. Okura, C. Ushio, H. Yamauchi, M. Ikeda, H. Ikegami, M. Kurimoto. 1998. Constitutive and induced IL-18 receptor expression by various peripheral blood cell subsets as determined by anti-hIL-18R monoclonal antibody. Cell. Immunol. 189:135.[Medline]
  46. Lagresle, C., C. Bella, T. Defrance. 1993. Phenotypic and functional heterogeneity of the IgD- B cell compartment: identification of two major tonsillar B cell subsets. Int. Immunol. 5:1259.[Abstract/Free Full Text]
  47. Schreiber, E., P. Matthias, M. M. Muller, W. Schaffner. 1989. Rapid detection of octamer binding proteins with "mini-extracts", prepared from a small number of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  48. Ghosh, S., M. J. May, E. B. Kopp. 1998. NF{kappa}B and Rel proteins: evolutionary conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
  49. Liu, Y. J., D. E. Joshua, G. T. Williams, C. A. Smith, J. Gordon, I. C. M. MacLennan. 1989. Mechanism of antigen-driven selection in germinal centers. Nature 342:929.[Medline]
  50. Berek, C., A. Berger, M. Apel. 1991. Maturation of immune responses in germinal centers. Cell 67:1121.[Medline]
  51. Leanderson, T., E. Kàllberg, D. Gray. 1992. Expansion, selection and mutation of antigen-specific B cells in germinal centers. Immunol. Rev. 126:47.[Medline]
  52. MacLennan, I. C. M.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  53. Pascual, V., Y. J. Liu, A. Magalski, O. de Bouteiller, J. Banchereau, J. D. Capra. 1994. Analysis of somatic mutation in five B cell subsets of human tonsil. J. Exp. Med. 180:329.[Abstract/Free Full Text]
  54. Szakal, A. K. H., M. Kosko, J. G. Tew. 1989. Microanatomy of lymphoid tissues during humoral immune responses: structure function relationships. Annu. Rev. Immunol. 7:91.[Medline]
  55. Liu, Y. D., C. Barthelemy, O. de Bouteiller, C. Arpin, I. Durand, J. Banchereau. 1995. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cell by rapid up-regulation of B7-1 and B7-2. Immunity 2:239.[Medline]
  56. Kiniwa, M., M. Gately, U. Gubler, R. Chizzonite, C. Fargeas, G. Delespesse. 1992. Recombinant interleukin-12 suppresses the synthesis of immunoglobulin E by interleukin-4 stimulated human lymphocytes. J. Clin. Invest. 90:262.
  57. Morris, S. C., K. B. Madden, J. J. Adamovicz, W. C. Gause, B. R. Hubbard, M. K. Gately, F. D. Finkelman. 1994. Effects of IL-12 on in vivo cytokine gene expression and Ig isotype selection. J. Immunol. 152:1047.[Abstract]
  58. Corcione, A., M. V. Corrias, S. Daniele, S. Zupo, M. Spriano, V. Pistoia. 1996. Expression of granulocyte colony-stimulating factor and granulocyte colony-stimulating factor receptor genes in partially overlapping monoclonal B-cell populations from chronic lymphocytic leukemia patients. Blood 87:2861.[Abstract/Free Full Text]
  59. Silverman, G. J.. 1997. B-cell superantigens. Immunol. Today 18:379.[Medline]
  60. Skok, J., J. Poudrier, D. Gray. 1999. Dendritic cell-derived IL-12 promotes B cell induction of Th2 differentiation: a feedback regulation of Th1 development. J. Immunol. 163:4284.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Virol.Home page
T. Demberg, J. D. Boyer, N. Malkevich, L. J. Patterson, D. Venzon, E. L. Summers, I. Kalisz, V. S. Kalyanaraman, E. M. Lee, D. B. Weiner, et al.
Sequential Priming with Simian Immunodeficiency Virus (SIV) DNA Vaccines, with or without Encoded Cytokines, and a Replicating Adenovirus-SIV Recombinant Followed by Protein Boosting Does Not Control a Pathogenic SIVmac251 Mucosal Challenge
J. Virol., November 1, 2008; 82(21): 10911 - 10921.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Airoldi, C. Cocco, N. Giuliani, M. Ferrarini, S. Colla, E. Ognio, G. Taverniti, E. Di Carlo, G. Cutrona, V. Perfetti, et al.
Constitutive expression of IL-12R{beta}2 on human multiple myeloma cells delineates a novel therapeutic target
Blood, August 1, 2008; 112(3): 750 - 759.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
M. Suzuki, T. Iizasa, T. Nakajima, R. Kubo, A. Iyoda, K. Hiroshima, Y. Nakatani, and T. Fujisawa
Aberrant Methylation of IL-12R{beta}2 Gene in Lung Adenocarcinoma Cells Is Associated with Unfavorable Prognosis
Ann. Surg. Oncol., September 1, 2007; 14(9): 2636 - 2642.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Airoldi, E. Di Carlo, C. Cocco, G. Taverniti, T. D'Antuono, E. Ognio, M. Watanabe, D. Ribatti, and V. Pistoia
From the Cover: Endogenous IL-12 triggers an antiangiogenic program in melanoma cells
PNAS, March 6, 2007; 104(10): 3996 - 4001.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Bekeredjian-Ding, S. I. Roth, S. Gilles, T. Giese, A. Ablasser, V. Hornung, S. Endres, and G. Hartmann
T Cell-Independent, TLR-Induced IL-12p70 Production in Primary Human Monocytes.
J. Immunol., June 15, 2006; 176(12): 7438 - 7446.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Larousserie, P. Charlot, E. Bardel, J. Froger, R. A. Kastelein, and O. Devergne
Differential Effects of IL-27 on Human B Cell Subsets
J. Immunol., May 15, 2006; 176(10): 5890 - 5897.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Airoldi, C. Cocco, E. Di Carlo, S. Disaro, E. Ognio, G. Basso, and V. Pistoia
Methylation of the IL-12R{beta}2 Gene as Novel Tumor Escape Mechanism for Pediatric B-Acute Lymphoblastic Leukemia Cells.
Cancer Res., April 15, 2006; 66(8): 3978 - 3980.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Matsushita, M. Fujimoto, M. Hasegawa, K. Komura, K. Takehara, T. F. Tedder, and S. Sato
Inhibitory Role of CD19 in the Progression of Experimental Autoimmune Encephalomyelitis by Regulating Cytokine Response
Am. J. Pathol., March 1, 2006; 168(3): 812 - 821.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Airoldi, L. Raffaghello, E. Piovan, C. Cocco, B. Carlini, A. Amadori, M. V. Corrias, and V. Pistoia
CXCL12 Does Not Attract CXCR4+ Human Metastatic Neuroblastoma Cells: Clinical Implications
Clin. Cancer Res., January 1, 2006; 12(1): 77 - 82.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
Z. Zhou, E. A. Lafleur, N. V. Koshkina, L. L. Worth, M. S. Lester, and E. S. Kleinerman
Interleukin-12 Up-Regulates Fas Expression in Human Osteosarcoma and Ewing's Sarcoma Cells by Enhancing Its Promoter Activity
Mol. Cancer Res., December 1, 2005; 3(12): 685 - 692.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Trinchieri
Cytokine receptor gene plays antioncogene
Blood, December 1, 2005; 106(12): 3684 - 3685.
[Full Text] [PDF]


Home page
BloodHome page
I. Airoldi, E. Di Carlo, C. Cocco, C. Sorrentino, F. Fais, M. Cilli, T. D'Antuono, M. P. Colombo, and V. Pistoia
Lack of Il12rb2 signaling predisposes to spontaneous autoimmunity and malignancy
Blood, December 1, 2005; 106(12): 3846 - 3853.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Harris, S. Goodrich, A. J. Gerth, S. L. Peng, and F. E. Lund
Regulation of IFN-{gamma} Production by B Effector 1 Cells: Essential Roles for T-bet and the IFN-{gamma} Receptor
J. Immunol., June 1, 2005; 174(11): 6781 - 6790.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Pages, J. Galon, G. Karaschuk, D. Dudziak, M. Camus, V. Lazar, S. Camilleri-Broet, C. Lagorce-Pages, S. Lebel-Binay, G. Laux, et al.
Epstein-Barr virus nuclear antigen 2 induces interleukin-18 receptor expression in B cells
Blood, February 15, 2005; 105(4): 1632 - 1639.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. R. Winders, R. H. Schwartz, and D. Bruniquel
A Distinct Region of the Murine IFN-{gamma} Promoter Is Hypomethylated from Early T Cell Development through Mature Naive and Th1 Cell Differentiation, but Is Hypermethylated in Th2 Cells
J. Immunol., December 15, 2004; 173(12): 7377 - 7384.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Dakic, Q.-x. Shao, A. D'Amico, M. O'Keeffe, W.-f. Chen, K. Shortman, and L. Wu
Development of the Dendritic Cell System during Mouse Ontogeny
J. Immunol., January 15, 2004; 172(2): 1018 - 1027.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Airoldi, L. Raffaghello, C. Cocco, R. Guglielmino, S. Roncella, F. Fedeli, C. Gambini, and V. Pistoia
Heterogeneous Expression of Interleukin-18 and Its Receptor in B-Cell Lymphoproliferative Disorders Deriving from Naive, Germinal Center, and Memory B Lymphocytes
Clin. Cancer Res., January 1, 2004; 10(1): 144 - 154.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. M. Raza, G. N. Fuller, C. H. Rhee, S. Huang, K. Hess, W. Zhang, and R. Sawaya
Identification of Necrosis-Associated Genes in Glioblastoma by cDNA Microarray Analysis
Clin. Cancer Res., January 1, 2004; 10(1): 212 - 221.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Gutzmer, K. Langer, S. Mommert, M. Wittmann, A. Kapp, and T. Werfel
Human Dendritic Cells Express the IL-18R and Are Chemoattracted to IL-18
J. Immunol., December 15, 2003; 171(12): 6363 - 6371.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. J. Segel, G. Izbicki, P. Y. Cohen, R. Or, T. G. Christensen, S. B. Wallach-Dayan, and R. Breuer
Role of interferon-{gamma} in the evolution of murine bleomycin lung fibrosis
Am J Physiol Lung Cell Mol Physiol, December 1, 2003; 285(6): L1255 - L1262.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Durali, M.-G. de Goer de Herve, J. Giron-Michel, B. Azzarone, J.-F. Delfraissy, and Y. Taoufik
In human B cells, IL-12 triggers a cascade of molecular events similar to Th1 commitment
Blood, December 1, 2003; 102(12): 4084 - 4089.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kitaura, N. Nagata, Y. Fujimura, H. Hotokezaka, N. Yoshida, and K. Nakayama
Effect of IL-12 on TNF-{alpha}-Mediated Osteoclast Formation in Bone Marrow Cells: Apoptosis Mediated by Fas/Fas Ligand Interaction
J. Immunol., November 1, 2002; 169(9): 4732 - 4738.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Ek, C.-M. Hogerkorp, M. Dictor, M. Ehinger, and C. A. K. Borrebaeck
Mantle Cell Lymphomas Express a Distinct Genetic Signature Affecting Lymphocyte Trafficking and Growth Regulation as Compared with Subpopulations of Normal Human B Cells
Cancer Res., August 1, 2002; 62(15): 4398 - 4405.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Ottonello, G. Frumento, N. Arduino, M. Bertolotto, P. Dapino, M. Mancini, and F. Dallegri
Differential regulation of spontaneous and immune complex-induced neutrophil apoptosis by proinflammatory cytokines. Role of oxidants, Bax and caspase-3
J. Leukoc. Biol., July 1, 2002; 72(1): 125 - 132.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. P. Arulanandam, J. M. Lynch, D. E. Briles, S. Hollingshead, and D. W. Metzger
Intranasal Vaccination with Pneumococcal Surface Protein A and Interleukin-12 Augments Antibody-Mediated Opsonization and Protective Immunity against Streptococcus pneumoniae Infection
Infect. Immun., November 1, 2001; 69(11): 6718 - 6724.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Airoldi, I.
Right arrow Articles by Pistoia, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Airoldi, I.
Right arrow Articles by Pistoia, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS