|
|
||||||||

,
,§
*
Laboratory of Oncology, G. Gaslini Institute, Genoa, Italy;
Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104;
Division of Experimental Oncology, Istituto per lo Studio e la Cura dei tumori, Milan, Italy; and
§
Dynavax Technologies, Berkeley, CA 94705
| Abstract |
|---|
|
|
|---|
B pathway. In the case of IL-12, no involvement of STAT
transcription factors, and in particular of STAT-4, was detected.
c-rel and p50 were identified as the members of NF-
B
family involved in IL-12-mediated signal transduction to B cells. IL-12
and IL-18 synergized in the induction of IFN-
production by
tonsillar B cells, but not in the stimulation of B cell
differentiation, although either cytokine promoted IgM secretion in
culture supernatants. Finally, naive but not germinal center or memory,
tonsillar B cells were identified as the exclusive IL-12 targets in
terms of induction of NF-
B activation and of IFN-
production. | Introduction |
|---|
|
|
|---|
, from T and NK cells after
binding to its own receptor (2, 3, 4, 5, 6, 7, 8, 9).
The IL-12R is composed of two subunits designated ß1 and ß2
(10, 11). The tissue distribution of the ß2 subunit is
more restricted than that of the ß1, and regulation of ß2
expression is likely to represent a central mechanism whereby IL-12
responsiveness is controlled (12, 13, 14, 15, 16, 17). In T and NK cells,
IL-12 induces activation of STAT family members, i.e., STAT3 and STAT4,
which bind to the promoter regions of different genes, including the
IFN-
gene promoter (18, 19, 20, 21, 22, 23). However, STAT-4 activation
is restricted to IL-12 and IFN-
, whereas STAT-3 is activated by
different cytokines (18, 19, 20, 21, 22, 23).
Recently, murine dendritic cells have been found to transduce IL-12
signaling through NF-
B activation, leading to functional responses
(24). IL-12 mediates activation of human and murine B
cells (25, 26, 27, 28, 29, 30). It is well known that human B lymphocytes
express constitutively the IL-12Rß1 chain, but no information is
available as to the expression of the ß2 chain in these cells
(31, 32). Furthermore, the signal transduction pathways
initiated in B lymphocytes by IL-12 triggering are unknown.
Another IFN-
-inducing factor sharing functional similarities with
IL-12, i.e., IL-18, has been recently cloned (33). IL-18
is synthesized by various cell types (34, 35, 36) as an
inactive precursor molecule that becomes functional following cleavage
by caspase-1 (37, 38). IL-18 synergizes with IL-12 in the
enhancement of NK cell cytotoxicity and of T cell proliferation, as
well as in the induction of IFN-
production by T cells (39, 40). The IL-18R is composed of two chains, named IL-1
receptor-related protein
(IL-1Rrp)3 and
accessory protein-like (AcPL), respectively, both of which are required
for IL-18-driven induction of NF-
B activation (41, 42, 43, 44).
IL-12 induces the expression of both IL-1Rrp and AcPL in different cell
types (39, 45).
Here we have investigated IL-12R expression and function in freshly isolated or cultured human tonsillar B lymphocytes and in their subsets. Because IL-12 was found to induce de novo expression of IL-18R chains, the interactions of IL-12 and IL-18 with respect to different B cell functions were also investigated.
| Materials and Methods |
|---|
|
|
|---|
Mononuclear cells (MNC) were isolated from surgically removed tonsils on Ficoll-Hypaque density gradients and depleted of T cells by rosetting with neuraminidase-treated sheep erythrocytes. Non-T cells were subsequently deprived of macrophages and NK cells by incubation with CD68 and CD56 mAbs, respectively, followed by immune rosetting (46). The resulting cell preparations contained on average 99% B cells, as assessed by staining with CD19 or CD20 mAbs (Becton Dickinson, San Jose, CA). CD3+ T cells, CD56+ NK cells, and CD68+ macrophages were virtually absent (<1%) from these cell suspensions, as assessed by flow cytometry. CD3, CD56, and CD68 mAbs were all obtained from Becton Dickinson. Controls were cells stained with isotype-matched mAbs of unrelated specificities; at least 10,000 events were acquired for each staining.
The purity of B cell fractions was further checked by extracting RNA
and searching for the expression of the CD3
(T cell-specific), CD56
(NK cell-specific), and CD19 (B cell-specific) genes by RT-PCR (see
below for the sequences of the primers and the details of these
procedures).
As shown in Fig. 1
A, the CD3
and CD56 transcripts were
not detected in B cell-enriched suspensions, whereas they were
consistently found in neuraminidase-treated sheep erythrocytes-rosette
forming tonsillar cell fractions. The opposite pattern of expression
was observed for the B cell-specific CD19 gene. These experiments
demonstrate that there were no T or NK cell contaminants in the
tonsillar B suspensions used throughout this study.
|
All of the separation procedures were performed at 4°C to prevent spontaneous apoptosis of GC B cells. Purified B cells were used immediately after isolation or were cultured for the indicated times at the concentration of 1 x 106/ml in RPMI 1640 medium (Seromed-Biochrom KG, Berlin, Germany) supplemented with 10% FCS (Seromed) in the presence of different stimuli (see below).
RNA preparation, PCR, and RNase protection assay (RPA)
RNA was extracted from cultured cells using Ultraspec (Biotecx
Laboratories, Houston, TX). The stimuli tested were:
Staphylococcus aureus Cowan I bacteria (SAC; 1:10,000)
(Calbiochem, La Jolla, CA); rIL-12 (20 ng/ml) (Genetics Institute,
Cambridge, MA); and anti-
(1 µg/106
cells) (Southern Biotechnology Associates, Birmingham, AL) in
combination with anti-
(1 µg/106 cells)
Ig light chain mAbs (Southern Biotechnology Associates); CD40 mAb (1
µg/ml) (Immunotech, Marseille, France), alone or in combination with
rIL-4 (10 ng/ml) (Genzyme, Cambridge, MA); rIL-4 alone (10 ng/ml); and
IFN-
(1000 U/ml) (Boehringer Mannheim, Mannheim, Germany). Primer
sequences and profiles of amplification were as follows:
hypoxanthine-guanine phosphoribosyltransferase (HPRT) sense
CCTGCTGGATTACATCAAAGCACTG, antisense TCCAACACTTCGTGGGGTCCT, 94°C
for 1 min, 61°C for 1 min, 72°C for 1 min, 30 cycles;
IL-12Rß1 sense TCTTCCTCTTCCTGCTGTCC, antisense CAGCCGCCTCCTCCCATCC,
94°C for 1 min, 55°C for 1 min, 72°C for 1 min, 30 cycles;
IL-12Rß2 sense ACCGGAAATTGGGCTGTGGCTG, antisense
AATGCTTGGTGCCACAAACGCC 94°C for 1 min, 55°C for 1 min, 72°C for 1
min, 30 cycles; IL-1Rrp sense ATTACCCTTGACCCTTTGGG, antisense
TCAAACTCGGCGTTCTTCTT, 94°C for 1 min, 55°C for 1 min, 58°C for 1
min, 27 cycles; AcPL sense CCTGCCCTTCATGGGTAGTA, antisense
ATCCACTACGATTCGGTTGC, 94°C for 1 min, 55°C for 1 min, 60°C for 1
min, 26 cycles; GAPDH sense ACATCGCTCAGAACACCTATGG, antisense
GGGTCTACATGGCAACTGTGAG, 94°C for 1 min, 60°C for 1 min, 72°C for
2 min, 30 cycles; CD3
sense GGTTCGGTACTTCTGACT, antisense
TGGTTTTGACTTGTTCTG, 94°C for 1 min, 48°C for 1 min, 72°C for 1
min, 32 cycles; CD19 sense ACCTCCTCGCCTCCTCTTC, antisense
TCCCCTTCCTCTTCTTCTG, 94°C for 1 min, 57°C for 1 min, 72°C for 1
min, 32 cycles. Ten microliters of each sample were electrophoresed
through a 1.5% agarose gel with ethidium bromide and scanned via
FluorImager (Molecular Dynamics, Sunnyvale, CA). The specificity of the
PCR products was checked both by confirming the known base pair
sequence length and by Southern blot of the amplified bands using
internal probes specific for each gene investigated. Bands were
assigned densitometric values by ImageQuaNT program (Molecular
Dynamics), and these values were normalized to HPRT values.
RPA was performed using the PharMingen probe kit hCR-3 (San Diego, CA) with 5 µg/lane total RNA, according to the manufacturers protocol. Products were resolved on 6% denaturing polyacrylamide gels, and the protected fragments were visualized and quantitated using a PhosphorImager 445SI (Molecular Dynamics). Relative radioactivity values for IL-12Rß1 and IL-12Rß2 transcripts were determined by normalizing to the values obtained for the L32 housekeeping gene, which was used as internal control for equal RNA loading.
Assay for Ig secretion
B cells were cultured in the presence of IL-12 (20 ng/ml) or SAC (1:10,000) for 48 h, washed, and incubated with IL-12 (20 ng/ml) or IL-18 (50 ng/ml) (Harlan Breeders, Indianapolis, IN) alone or in combination, for 7 days. Culture supernatants and human Ig standards (Behring, Marburg, Germany) were diluted in PBS containing 2% BSA (Sigma, St. Louis, MO). IgG, IgA, and IgM concentration was measured by ELISA. Samples (100 µl) were added to 96-well polystyrene ELISA/RIA plates (Dynatech Laboratories, Chantilly, VA) previously coated for 16 h at 4°C with rabbit anti-human IgG, IgA, or IgM antisera (Dako, Glostrup, Denmark). Following a 2-h incubation at 37°C and three washings with PBS containing 0.001% Tween 20, HRP-conjugated goat anti-human IgG, IgA, or IgM (Dako) antiserum was added. After addition of O-phenylenediamine (Sigma), substrate color development was stopped by 5 M sulfuric acid, and absorbance was measured at 492 nm using a Gralis Ad Reader (Bouty, Milan, Italy). The concentration of Ig in the culture supernatants was calculated from the standard curve.
Detection of IFN-
in B cell culture supernatants
Purified tonsillar B cells pretreated for 48 h with IL-12
(20 ng/ml) or SAC (1:10,000) were washed and subsequently cultured for
24 or 48 h with IL-12 (20 ng/ml) and/or IL-18 (50 ng/ml).
IgD+ (naive) and IgD- (GC
and memory) B cell fractions were cultured for 24 h in the
presence of IL-12 (20 ng/ml). Supernatants were then collected and
tested in triplicate for IFN-
by ELISA (BioSource International,
Camarillo, CA).
IFN-
intracellular staining
Purified tonsillar B cells or MNC were cultured for 48 h
with IL-12 and IL-18, washed, and incubated for an additional 5 h
with 20 ng/ml PMA, 250 ng/ml calcium ionophore, and 5 µg/ml brefeldin
A (all reagents purchased from Sigma). After washing, cells were
single- or double-stained for a pan-B surface marker (CD20) and/or
intracytoplasmic IFN-
. For double staining, B cells were first
incubated with PE-conjugated CD20 mAb (Becton Dickinson) or with the
appropriate control (see below) for 30 min at 4°C, then fixed with
4% paraformaldehyde (Sigma) for 20 min at 4°C and permeabilized with
0.1% saponin (Sigma) in PBS. In some experiments, a PE-conjugated CD3
mAb (Becton Dickinson) was used in the place of CD20 mAb following the
same protocol. Cells were subsequently incubated with an
FITC-conjugated anti-IFN-
mAb (PharMingen) or with the
appropriate controls (see below) for 30 min at 4°C, washed, and
enumerated by flow cytometry. Control for CD20 surface staining were
cells incubated with a PE-conjugated, isotype-matched mAb of irrelevant
specificity. Controls for intracytoplasmic IFN-
staining were cells
incubated with an FITC-conjugated, isotype-matched mAb of irrelevant
specificity or with the anti-IFN-
mAb preincubated with rIFN-
before staining. Single staining of B cells by CD20 or anti-IFN-
mAbs was conducted using the above procedures separately.
Nuclear extracts and EMSA
Purified B lymphocytes were used directly or following stimulation with SAC (1:10,000) or IL-12 (20 ng/ml) for 48 h, washed with serum-free RPMI 1640, and starved for 3 h at 37°C in RPMI 1640 supplemented with 1% albumin. Cells were then resuspended at a concentration of 2 x 107/ml in medium with or without IL-12 (20 ng/ml) or IL-18 (50 ng/ml), either alone or in combination, and incubated at 37°C for 30 min. Nuclear extracts were subsequently prepared as previously described (47). Freshly isolated IgD+ and IgD- B cells starved as described above were incubated for 30 min with IL-12 before preparing nuclear extract.
End-labeled DNA probes (50,000 cpm/sample) were mixed with 4 µg of
crude nuclear extract and incubated at room temperature for 25 min in
the presence of 1 µg of poly (dI-dC) (Boehringer Mannheim) in a
volume of 10 µl of buffer C (20 mM HEPES, pH 7.9; 0.4 M NaCl; 0.1 mM
EGTA; 1 mM DTT; 1 mM PMSF; 10 µg/ml aprotinin; 10 µg/ml leupeptin;
1 µg/ml pepstatin A; and 1 mM sodium orthovanadate). The mix was then
fractionated through a 6% polyacrylamide gel in 0.5x Tris borate EDTA
for 1.5 h at 150 V. The gel was dried, exposed in a PhosphorImager
storage screen, and scanned. Supershift experiments were conducted by
preincubating the nuclear extract with 12 µg polyclonal
anti-p50, anti-p65, anti-c-Rel, anti-Rel-B,
or anti-ets2 rabbit antisera (all purchased from Santa Cruz
Biotechnology, Santa Cruz, CA) or normal rabbit serum for 30 min at
room temperature after the addition of radiolabeled probe. The
following double-strand oligonucleotides were used in EMSA as labeled
or competitor probes: IFN-
activation site (GAS),
5'-GTATTTCCCAGAAAAGGAAC 3', NF-
B 5'-ATGTGAGGGGACTTTCCCAGG-3'.
Total extracts and Western blot analysis
Purified tonsillar B cells were stimulated with SAC (1:10,000) or medium for 48 h, washed with serum-free RPMI 1640, and incubated for an additional 30 min with IL-12 (20 ng/ml) or medium alone. Cells were subsequently incubated for 30 min on ice with lysis buffer containing 20 mM HEPES, 150 mM NaCl, 10% glycerol, 0.5% Nonidet P-40, 1 mM EDTA, 2.5 mM DTT, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 µg/ml pepstatin A, 1 mM PMSF, and 1 mM Na3VO4. During this time interval, cells were subjected to vortex mixing every 5 min. Thereafter, lysates were centrifuged at 12,000 rpm for 5 min at 4°C, and supernatants were quantitated by the BCA kit assay (Pierce, Rockford, IL). Equal amounts of protein (10 µg) were loaded on 8% SDS-polyacrylamide gel and boiled 3 min before application. Gel was blotted onto Protean nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany) for 1 h at 100 V. Blots were incubated in a blocking buffer containing BSA and 0.5% Tween 20 in TBS for 1 h, followed by incubation with rabbit anti-human STAT4 antiserum (Santa Cruz Biotechnology). After three washings in TBS-Tween 20, blots were incubated for 1 h with goat anti-rabbit Ig conjugated with HRP (Santa Cruz Biotechnology) at the final concentration of 50 ng/ml in TBS-Tween 20 containing 1% BSA. Detection was performed by enhanced chemiluminescence (ECL, Pierce).
| Results |
|---|
|
|
|---|
IL-12Rß1 and ß2 gene expression in freshly isolated tonsillar
B lymphocytes was investigated by RT-PCR. As shown in Fig. 1A
, the two IL-12R chain transcripts
were detected in B cells obtained from four different tonsils and in T
cells from a Th1 clone tested as positive control (12, 14, 15, 17). The specificity of the amplified bands was confirmed by
Southern blot analysis with internal probes (data not shown).
Next, regulation of ß1 and ß2 gene expression in B lymphocytes
cultured with different stimuli for 4, 24, or 48 h was studied by
RPA (Fig. 1
B). Consistent with the results of the RT-PCR
experiments shown in Fig. 1
A, freshly purified B cells
expressed IL-12Rß1 and ß2 chain mRNA. Upon normalization, the
intensity of the ß2 band displayed a 4- to 5-fold increase following
a 48-h incubation with SAC (1:10,000) or IL-12 (20 ng/ml) (Fig. 1
B). In contrast, the ß1 chain transcript showed little
variation over the whole culture period (Fig. 1
B). Other
stimuli tested, such as anti-Ig light chain mAbs, CD40 mAb (alone
or in combination with IL-4), IL-4, or IFN-
were found to be
ineffective at modulating the expression of both IL-12R chain genes
(data not shown). Based on these results, all of the subsequent
experiments making use of SAC or IL-12 were conducted at the
concentrations indicated above.
The effects of IL-12 on IL-18R mRNA expression in tonsillar B cells
were next investigated. As shown in Fig. 2
, transcripts of the two IL-18R chains
were not detected in freshly isolated B cells but became apparent after
1248 h culture with IL-12. In contrast, other stimuli, such as
anti-Ig light chain mAbs, CD40 mAb (alone or in combination with
IL-4), IL-4, or IFN-
did not induce expression of the transcripts of
either IL-18R chain at any time tested (data not shown).
|
Next, tonsillar B cells, either freshly purified or pretreated with SAC for 48 h, were shortly exposed to IL-12 and tested for STAT activation by EMSA. The rationale of these experiments was that the transcripts of both IL-12R chains were already expressed in freshly isolated tonsillar B cells and that SAC stimulation up-regulated the expression of IL-12Rß2 mRNA (see Fig, 1B).
EMSA were first performed using a probe with the sequence of the
STAT-binding region of the Fc
receptor promoter (IFN-
activation
site (GAS) probe). Incubation of B lymphocytes with IL-12 did not
induce STAT binding. The representative experiment shown in Fig. 3
A refers to B cells
pretreated with SAC or medium alone (control) for 48 h, but
identical results were obtained when freshly isolated B lymphocytes
were tested (data not shown). As expected, specific binding of the
probe to nuclear extracts was detected in PHA-stimulated control PBL
incubated with IL-12 (Fig. 3
A).
|
Both IL-12 and IL-18 activate NF-
B in human tonsillar B cells
Previously it was shown that IL-12 activates the NF-
B complex
in murine dendritic cells (24). Therefore, the possible
involvement of NF-
B in IL-12 signaling to B cells was investigated
and the effects of IL-12 were compared with those of IL-18 (41, 42).
For the IL-12 experiments, tonsillar B lymphocytes, either freshly
purified or pretreated with SAC for 48 h, were shortly exposed (30
min) to IL-12 and tested for NF-
B activation. The IL-18 experiments
were conducted by preincubating B cells with IL-12 for 48 h before
exposing them to IL-18 for 30 min. The latter protocol was used due to
the observation shown in Fig. 2
that tonsillar B lymphocytes expressed
IL-18R mRNAs only upon prolonged incubation with IL-12.
Binding of nuclear extracts to the NF-
B probe was detected both in
freshly isolated B cells incubated with IL-12 for 30 min (data not
shown and Fig. 4
B, lanes
34 from the left) and in 48-h cultured B cells (Fig. 4
A, lanes 36 from the left), irrespective of
whether they had been pretreated with SAC or medium before being pulsed
with IL-12 for 30 min. The intensity of the bands was higher in the
cultures exposed to IL-12 as compared with the ones conducted in the
absence of the cytokine (
4- and 2.5-fold induction, respectively;
see Fig. 4
A, lanes 36 from the left).
|
B probe to nuclear extracts was detected in
IL-12-pretreated B cells pulsed with either IL-18 or medium, and
the intensity of the band was higher in the presence than in the
absence of IL-18 (
2- to 3-fold induction, see Fig. 4
To demonstrate the binding specificity of the NF-
B probe to B cell
nuclear extracts, freshly purified tonsillar B lymphocytes were exposed
to IL-12 for 30 min and subjected to gel shift experiments in the
presence or absence of increasing molar concentrations of the unlabeled
NF-
B oligonucleotide (Fig. 4
B). Addition of such
competitor caused the complete disappearance of the specific bands
starting from the concentration of 40x (Fig. 4
B).
The above findings indicate that IL-12 and IL-18 independently activate
NF-
B in human tonsillar B lymphocytes. A final series of experiments
was addressed to the identification of NF-
B family members involved
in IL-12-driven activation of tonsillar B lymphocytes
(48). To this end, nuclear extracts were prepared from
freshly purified tonsillar B cells incubated with IL-12 for 30 min and
run in a gel supershift assay in the presence or absence of different
Abs to the main components of the NF-
B complex.
As shown in Fig. 5
, the anti-p50
antiserum caused a supershift of the lower band, whereas the
c-Rel-specific antiserum induced a supershift of the upper
band, as compared with the pattern detected in the absence of any Ab
added. Accordingly, binding of anti-p50 Abs to nuclear
extracts caused the disappearance of the p50/p50 homodimer (lower band)
and a reduction of the intensity of the p50/c-Rel
heterodimer (upper band) (Fig. 5
). Binding of anti-c-Rel
antiserum resulted in a decreased intensity of the latter band only
(Fig. 5
).
|
B family), to ets-2 (a
transcription factor unrelated to NF-
B) (Fig. 5
B
activation in tonsillar B lymphocytes involves the p50 and
c-Rel NF-
B family members. Functional activation of tonsillar B cells by IL-12 and/or IL-18
In a first series of experiments, tonsillar B lymphocytes were
pretreated with SAC or IL-12 for 48 h and then cultured in the
presence or absence of IL-12 and/or IL-18 for 7 days. As shown in Fig. 6
, A and B, the
only Ig isotype detected in culture supernatants over background values
(medium) was IgM. Both IL-12 and IL-18 induced the production of higher
amounts of IgM in SAC- than in IL-12-pretreated B cell cultures
(Fig. 6
, A and B). No additive or synergistic
effects of IL-12 and IL-18 were observed (Fig. 6
, A and
B).
|
in
response to IL-12 and/or IL-18 was investigated by ELISA (Fig. 7
secretion
in SAC- (Fig. 7
production (Fig. 7
|
, IL-12 plus IL-18-stimulated B
lymphocytes were double-stained for intracellular IFN-
and surface
CD20, a B cell-specific marker. B cells staining for intracellular
IFN-
were detected in the representative experiment shown in Fig. 8
following incubation with IL-12 as above showed that
40% T cells
(mean from three different experiments) contained the intracellular
cytokine (data not shown).
|
B
activation, and IFN-
production in tonsillar B cell subsetsTonsillar B lymphocytes are comprised of three major cell populations, i.e., GC, naive, and memory cells (36, 49, 50, 51, 52, 53). These cell fractions differ as for immunophenotype, anatomical location, and functional features (49, 50, 51, 52, 53, 54). To investigate what B cell subset(s) were targets of IL-12, purified tonsillar B lymphocytes were separated into naive (IgD+, CD38-), GC (IgD-, CD38+), and memory (IgD-, CD38-) cells (36, 49, 50, 51, 52, 53, 54). Consistent with previous reports (36, 54, 55) most IgD+ naive B cells were CD39+, IgM+, IgG-, CD38-, CD10-, whereas approximately one-half of them expressed the CD23 marker (data not shown). CD38+, IgD- GC B cells were CD10+, CD39-, CD23-. IgD-, CD38- memory B lymphocytes were predominantly CD39+, IgG+, CD23-, CD10- (data not shown) (36, 54, 55). All separation procedures were conducted at 4°C to prevent spontaneous apoptosis, and freshly isolated GC B cells contained consistently >90% viable lymphocytes, as assessed by trypan blue staining.
IL-12Rß1 and ß2 gene expression in freshly isolated naive, GC, and
memory B lymphocytes was first investigated by RT-PCR. As shown in Fig. 9
A, the two IL-12R chain gene
transcripts were detected in all B cell subsets, as well as in T cells
from a Th1 clone tested as positive control (12, 14, 15, 17).
|
B probe. Fig. 9
B
system in naive B lymphocytes only.
Finally, IgD+ and
IgD- tonsillar B cells were tested by ELISA for
their ability to produce IFN-
. Cells were first incubated with SAC
for 48 h and then exposed to IL-12 for 24 h before harvesting
culture supernatants. Fig. 9
C shows that
IgD+ naive B cells but not
IgD- GC and memory B cells produced IFN-
under the above conditions. Additional experiments (data not shown) in
which tonsillar B cells were separated into naive
(IgD+,
CD38-), GC
(IgD-, CD38+), and memory
(IgD-, CD38-) subsets and
cultured as above confirmed that IFN-
production was restricted to
naive B lymphocytes.
| Discussion |
|---|
|
|
|---|
Numerous effects of IL-12 on human peripheral blood or tonsillar B
cells have been reported, namely 1) induction of proliferation of
preactivated B lymphocytes (28, 29); 2) induction of
differentiation to Ig-secreting cells, especially in association with
IL-2 (28, 30); 3) enhancement of CD25 expression
(25); 4) induction of IFN-
mRNA and protein (29, 40); and 5) inhibition of IgE synthesis induced by IL-4
(56). With the exception of the latter effect, which is
probably indirect and mediated by T or NK cells, all of the other data
were obtained using purified human B lymphocytes. In addition,
murine studies have demonstrated that IL-12 mediates biological effects
on B cells, such as changes in the IgG subclass distribution during
ongoing Ag-specific immune responses or in vivo depletion of
CD5+ peritoneal B1 cells (26, 56, 57).
The reported effects of IL-12 on human B lymphocytes raise questions about the nature of IL-12R and the signal transduction pathways triggered by the cytokine in these cells. As for the first issue, binding of IL-12 to B cells has been demonstrated in one study using SAC-preactivated peripheral blood B lymphocytes, but conflicting results have been obtained in other reports (12, 31, 32). Furthermore, it has been clearly established that human B lymphocytes express constitutively the IL-12Rß1 chain (31, 32), whereas no information is so far available on ß2 chain expression.
Here we show that freshly isolated tonsillar B cells, which were devoid
of contaminant T cells and NK cells, expressed mRNA of both IL-12R
chains as assessed by RT-PCR and RPA, and that culture with SAC or
IL-12 caused a 4- to 5-fold increase in IL-12Rß2, but not ß1, chain
transcript. In contrast, no increase of IL-12Rß2 gene expression was
observed when B cells were incubated with anti-
plus
anti-
Ig light chain Abs. Because SAC binds to the third
variable heavy (VH3) chain region of IgM, IgG,
and IgA, the different results obtained by stimulating B cells with SAC
or anti-Ig Abs may appear surprising. Notably, in this connection,
it was previously shown that malignant B cells from B chronic
lymphocytic leukemia patients produced granulocyte-CSF in vitro
following stimulation with SAC but not with anti-Ig Abs
(58). Because of its binding capacity to the third
variable heavy (VH3) chain region of most Ig
isotypes, SAC has been designated as a B cell superantigen, and it has
been proposed that it may activate B lymphocytes also through
mechanisms unrelated to Ig binding that are so far poorly understood
(59).
In view of the heterogeneity of tonsillar B cells, the expression of IL-12Rß1 and ß2 genes was investigated in freshly isolated naive, GC, and memory B lymphocytes. These experiments showed that the mRNA of both chains was constitutively expressed in all subsets.
The transcripts for both IL-1Rrp and AcPL, i.e., the two chains of the IL-18R, were induced de novo in tonsillar B cells by IL-12 stimulation. Similar results have been reported in the mouse, whereas immunophenotypic studies of human peripheral blood B cells have indicated that the latter cells express constitutively IL-1Rrp surface protein (46). The apparent discrepancy between these data and our results may be related to the different sources of B lymphocytes used in the two studies and/or to the different states of activation of peripheral blood vs tonsillar B cells.
Because IL-12 induced IL-18R expression in B cells, we next
investigated the effects of IL-12 and IL-18 on Ig production and
IFN-
synthesis. These experiments showed that IgM was the major
isotype produced by preactivated B cells in the presence of IL-12 or
IL-18. Synergistic or additive effects between the two cytokines were
not observed.
IL-12 stimulation induced IFN-
synthesis and release by SAC- or
IL-12-preactivated B cells in accordance with the results of previous
studies (25, 26). IL-18 alone was poorly effective at
stimulating IFN-
production, whereas IL-12 and IL-18 synergized in
these experimental conditions (40).
IL-12-induced IFN-
production was also investigated in separated
naive, GC, and memory tonsillar B lymphocytes. These experiments
demonstrated that naive B cells only released IFN-
in culture
supernatants following IL-12 stimulation.
Such observations may lead to speculation that, in the secondary
lymphoid organs where the bulk of Ag-specific immune responses take
place, the availability of IL-12 and IL-18 can switch on B cell IFN-
production and perhaps induce Th1 differentiation. However,
current models of B cell activation indicate that the latter
cells are committed to maintain the Th1 or Th2 phenotype of already
differentiated CD4+ cells rather than to promote
such differentiation (8, 60).
STAT3 and STAT4 are the major transcription factors involved in
IL-12-mediated signaling to T and NK cells (18, 19, 20, 21, 22). An
alternative pathway of IL-12-driven signal transduction has been
reported for murine dendritic cells, in which NF-
B is activated by
IL-12 in the absence of STAT3 or STAT4 involvement
(24).
In this study, EMSA and Western blot experiments excluded the
activation of any STAT family member in tonsillar B cells exposed to
IL-12. However, in experiments not shown here, specific binding of
nuclear extracts from IFN-
-treated B cells to the IFN-
activation
site probe was observed, indicating that tonsillar B lymphocytes
activated STAT 4 under these conditions.
We speculated that NF-
B could be a candidate family of transcription
factors involved in IL-12-mediated signaling to B cells. NF-
B was
found to be constitutively activated in freshly separated or cultured B
cells, but IL-12 or IL-18 stimulation caused a clear-cut increase of
NF-
B binding to DNA, thus lending support to our hypothesis.
Cell fractionation experiments showed that IL-12-induced NF-
B
activation occurred in naive, but not in GC or memory B cells. The
reason why signal transduction in response to IL-12 was detected only
in naive B cells, whereas expression of IL-12R chains was demonstrated
also in GC and memory B cells, is presently unknown. One possibility is
that posttranscriptional modifications of the ß1 and/or ß2 IL12R
chain mRNA lead to the production of the functional protein(s) in
naive, but not in GC or memory B cells. Further studies are needed to
clarify this issue.
IL-12 and IL-18 share the ability to activate NF-
B (24, 41, 42) and to induce IFN-
production by T and NK cells
(2). The possibility that, in our experimental conditions,
part of the biological activities attributed to IL-12 were mediated by
endogenous IL-18 possibly produced by the B cells themselves is made
highly unlikely because: 1) IL-12-induced B cell signaling via NF-
B
was clearly demonstrated using freshly isolated tonsillar B lymphocytes
that did not express IL-18R; and 2) IL-18 was a poor stimulator of
IFN-
production by B cells pretreated with either SAC or IL-12.
The human NF-
B family is comprised of five members, i.e., p50, p65,
c-Rel, Rel-B, and p52 (48). To investigate what
NF-
B components were involved in IL-12-mediated B cell signaling,
gel supershift experiments were conducted with specific Abs. It was
found that p50 and c-Rel were the members of the NF-
B
family responsible for IL-12-delivered signals. Interestingly, p50 and
Rel-B were previously identified as the proteins involved in IL-12
signaling to murine dendritic cells (24).
In conclusion, this study shows that IL-12 signals to human tonsillar B
cells through the NF-
B pathway by interacting with the classic
heterodimeric IL-12R composed of the ß1 and ß2 chains. IL-12R is
constitutively expressed by freshly isolated tonsillar B cells and, in
particular, by the naive, GC, and memory cell subsets, but exposure to
IL-12 activates signal transduction and IFN-
production in naive B
cells only.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Irma Airoldi, Laboratory of Oncology, G. Gaslini Institute, Largo G. Gaslini, 5 16148 Genova, Italy. ![]()
3 Abbreviations used in this paper: IL-1Rrp, IL-1 receptor-related protein; SAC, Staphylococcus aureus Cowan I bacteria; AcPL, accessory protein-like; MNC, mononuclear cells; GC, germinal center; HPRT, hypoxanthine-guanine phosphoribosyltransferase; RPA, RNase protection assay. ![]()
Received for publication February 1, 2000. Accepted for publication September 26, 2000.
| References |
|---|
|
|
|---|
) production during differentiation of human T helper (Th) cells and transient IFN-
production in established Th2 clones. J. Exp. Med. 179:1273.
production and type 1 cytokine responses. Immunity 4:471.[Medline]
, and IL-10: role of B cells in the maintenance of T cell responses. J. Exp. Med. 189:1.
and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of high-affinity interleukin-12 receptor expression. Eur. J. Immunol. 3:647.
: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
B and primes DC for IL-12 production. Immunity. 9:315.[Medline]
. Cell. Immunol. 168:133.[Medline]
production by T cells. Nature 378:88.[Medline]
inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159:198.
inducing factor in the adrenal cortex. J. Biol. Chem. 264:2025.
and FasL-mediated hepatotoxic pathways in endotoxin-induced liver injury. J. Immunol. 159:3961.[Abstract]
inducing factor and regulates LPS-induced IFN-
production. Nature 386:619.[Medline]
inducing factor mediated by interleukin-1 ß converting enzyme. Science 275:206.
production. J. Immunol. 161:3400.
promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.
production and activates IRAK and NF
B. Immunity 7:571.[Medline]
B and NFAT with the interferon-
promoter. J. Biol. Chem. 373:30412.
B and Rel proteins: evolutionary conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]