|
|
||||||||
Laboratory of Biochemistry and Molecular Biology, Rockefeller University, 1230 York Avenue, New York, NY 10021
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
B, Pip-1, and OCA-B are required for Ag-dependent B
cell differentiation in the periphery. OCA-B (also called Bob1 and OBF-1) is a transcription coactivator that functions in conjunction with Oct family transcription factors Oct-1 and Oct-2 to generate full activation of Ig promoters in vitro and in transient transfection assays (2, 3, 4, 5, 6). Surprisingly, mice lacking OCA-B can undergo normal Ag-independent B cell differentiation and produce normal levels of serum IgM, indicating that OCA-B function is not required for early B cell development and serum IgM production (7, 8, 9). However, OCA-B is essential for the Ag-dependent phase of B cell differentiation, as Oca-b-/- mice show severe deficiencies in serum IgG, IgA, and IgE levels, reduced Ab responses to T-independent (TI) and T-dependent (TD) Ags, and an inability to form germinal centers (7, 8, 9). Because Oca-b-/- B cells can undergo normal isotype switching when cultured in the presence of LPS and IL-4, but show reduced levels of transcripts from corresponding loci (7), the reduced levels of secondary isotypes appear to result from defects in transcription from switched loci.
Consistent with indications that transcription of heavy chain genes is driven by an intronic enhancer in early B cell differentiation and by the 3' enhancer in late B cell differentiation, it was recently shown that the IgH 3' enhancers are less active in Oca-b-/- B cells than in normal cells under certain conditions (10). This may reflect direct function of OCA-B through octamer sequence elements present in the 3' IgH enhancer (11) or an enhancer-specific synergy with OCA-B-activated promoters. Because B cell activation by CD40 and IL-4 induces OCA-B expression (12, 13), OCA-B also may regulate factors required for B cell activation that in turn induce 3' IgH enhancer function. Oca-b-/- splenic B cells are deficient in B cell receptor (BCR) signaling, because mutant B cells show decreased proliferation following surface IgM cross-linking (7). Furthermore, Oca-b-/- B cells, unlike normal B cells, do not exhibit repression of the 3' IgH enhancer following surface Ig cross-linking (10). Because a number of studies suggest that BCR signaling is required for normal differentiation and maintenance of B cells in the bone marrow and periphery (14, 15), inefficient BCR signaling by Oca-b-/- B cells is likely to affect the differentiation and survival capabilities of these cells.
Studies of mice lacking members of the NF-
B/Rel transcription factor
family have shown that, like OCA-B, these proteins function in late B
cell differentiation (16, 17). Thus, B cells in
Nfkb1 (p50/p105) null mutant mice undergo normal
Ag-independent differentiation, but show a severely reduced ability to
proliferate in response to LPS stimulation and a moderately reduced
ability to proliferate upon surface IgM cross-linking
(18). Like OCA-B-deficient mice, mice lacking NFKB1 have
reduced levels of serum IgG, IgA, and IgE but normal levels of IgM.
These mutant mice do not respond well to TD Ags and are more
susceptible to certain bacterial infections. However, in contrast to
Oca-b-/- B cells,
Nfkb1-/- B cells are defective in both
transcription at IgG3 and IgE germline loci and isotype switching to
IgG3, IgE, and IgA (19), but not in germinal center
formation. Double-null mutations in Nfkb1 (p50/p105) and
Nfkb2 (p52/p100) result in a B cell differentiation block
earlier than that seen with single-null mutations, as the double-mutant
mice contain severely reduced levels of B cells in the spleen
(20). Adoptive transfer studies showed that this defect is
B cell autonomous and that double-null B cells are functionally
deficient and, like Oca-b-/- B cells,
unable to form germinal centers. Therefore, NFKB1 and NFKB2 play
compensatory roles in generating normal numbers of splenic B cells and
in germinal center formation.
It has been proposed that cell lineage originates from stochastic low-level expression of lineage-affiliated genes in the progenitor cells (21, 22, 23). Defined patterns of gene expression within a lineage may be ensured by redundancy and feedback mechanisms involving multiple proteins. The criteria for functional redundancy are that mutations in single genes individually produce no phenotype, whereas mutation of all paralogs produces a strong phenotype (21). Therefore, a protein may be involved in pathways that are not disrupted by a mutation in that protein if its normal function is fully compensated by other factors playing redundant roles. Consequently, analyses of single mutations produce only a partial list of protein functions, and more extensive insight into a protein function can be gained by creating multiple mutations in genes that are suspected of playing redundant roles. Such functional redundancy has been observed not only among proteins within the same family (i.e., NFKB1 and NFKB2) but also between the two unrelated transcription factors early B cell factor and E2A (24). Considering the fact that both NFKB1 and OCA-B are required for late B cell differentiation, we wished to determine whether these two transcription factors participate in redundant pathways during late B cell differentiation. To this end, we generated mice lacking both NFKB1 and OCA-B by crossing the Nfkb1-/- mice with Oca-b-/- mice. Interestingly, the double-mutant mice showed severe deficiencies in B-1 cell development and serum IgM. Moreover, conventional B (B-2) cell frequencies in the spleen also were reduced in Nfkb1-/-Oca-b-/- mice. These results suggest that NFKB1 and OCA-B are involved in functionally redundant pathways that ensure proper B cell differentiation.
| Materials and Methods |
|---|
|
|
|---|
Oca-b-/- mice (7) were mated with the Nfkb1-/- mice (18) mice (stock number 002849; B6, 129-Nfkb1tm1Bal; The Jackson Laboratory, Bar Harbor, ME) to generate mice heterozygous for Oca-b and Nfkb1 mutations. Interbreeding the heterozygotes generated homozygous double-knockout mice. All mice including the wild type were maintained in a C57BL and 129SV hybrid background in specific pathogen-free conditions. The following primers were used to identify the genotypes by PCR: primer set A, sense, TTGCAAACCTGGGAATACTTCATGT, antisense, GTGAGTTGCCGGTCTCCTCCGCCTT; set B, sense, CGTGACATTAGTGATGAGTGGTGGA, antisense, CCATACCAGGGCGTTCGAGTCA; set C, sense, CTCCCCTACCCGGTAGAATTGACC, antisense, CTGCTGGAATGCTATAGAGTGGTTC. Typically, 1 µg of tail DNA was amplified by 30 cycles of 45 s at 94°C, 45 s at 55°C, and 2045 s at 72°C. For phenotype analyses, either littermates or age- and gender-matched 5- to 9-wk-old mice were used.
B cell purification and RT-PCR
B cells were purified from spleen by immunomagnetic cell sorting as follows. A single-cell suspension from spleen was washed with PBS/0.3% BSA and incubated with biotinylated anti-B220 Ab (PharMingen, San Diego, CA; 0.1 µg per 106 cells) at 4°C for 45 min. Cells were washed twice with PBS/2 mM EDTA to remove excess Ab. Cells were then incubated with streptavidin-conjugated M280 Dynabeads (Dynal, Great Neck, NY) at 4°C for 45 min. Labeled cells were collected on a magnet and washed twice with PBS/2 mM EDTA/0.5% BSA. Trizol (Life Technologies, Rockville, MD) was added to purified splenocytes. Total RNA was prepared following the manufacturers protocol. Total RNA was treated with DNase I to remove any contaminating DNA. Complementary DNA was prepared from 2 µg total RNA using random hexamer and avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI). The cDNA amount was normalized by amplifying the ubiquitous GAPDH mRNA. Two 3-fold serial dilutions of cDNA per genotype were used to ensure that amplification was in a linear range. A typical PCR involved 28 cycles of 45 s at 94°C, 45 s at 55°C, and 3060 s at 72°C. The following gene-specific primers were used: BLR-1 sense, ATGAACTACCCACTAACCCTGGAC; BLR-1 antisense, CTAGAAGGTGGTGAGGGAAGTAGC; Oct-2 sense, ACCTCCAGCCACCTGCTCAGTTC; Oct-2 antisense, TTGTGCTCAGACTGCTAGAAGCT; CD36 sense, GTGCTGATCCTTTCAGAGTCTC; CD36 antisense, CTGAGGAATGGATCTTTGTAAC; BSAP sense, CTACAGGCTCCGTGACGCAG; BSAP antisense, GTCTCGGCCTGTGAAATAGG; GAPDH sense, AAGCTTGTCATCAACGGGAAGCCCATC; GAPDH antisense, GATGTTCTGGGCAGCCCCACGGCCATC.
Flow cytometry
For bone marrow analyses, marrow cells were flushed out from the thighbone using PBS. Splenocytes were prepared by squashing the spleen using the top of a plunger from a 1-ml syringe. Peritoneal lavage was obtained by flooding the peritoneal cavity with 5 ml PBS. RBC were lysed using 160 mM NH4Cl/10 mM KHCO3/0.1 mM EDTA, and debris was filtered out with a 40-µm nylon membrane. After blocking the Fc receptors with FcBlock (PharMingen), cells were incubated with fluorescently labeled antisera on ice. Cells were washed with PBS/0.3% BSA, fixed with 1% formaldehyde (methanol-free EM grade; Polysciences, Warrington, PA), and analyzed on a FACScan using CellQuest software (Becton Dickinson, Mountain View, CA). Lymphocytes were gated according to the forward- and side-scatter patterns to exclude large granular cells and debris. For each experiment, isotype controls were used as the negative staining controls. Quadrants were drawn according to the negative controls and confirmed by single-stain controls. Numbers represent the percentage of gated cells in the region or quadrant. Data are illustrated as dot plots or 20% probability contour plots. In each case, a representative data set out of five separate experiments is shown. The following antisera recognizing mouse cell surface markers were used: from PharMingen, anti-B220, clone RA3-6b2; anti-IgM, clone II/41; anti-CD4, clone H129.19; anti-CD8, clone 53-6.7; anti-CD11b, clone M1/70; anti-IgD, clone 11-26c.2a; anti-CD5, clone 53-7.3; anti-CD43, clone S7; anti-CD23, clone B3B4; from Southern Biotechnology Associates (Birmingham, AL), goat anti-IgM R-PE conjugate; and from Caltag (South San Francisco, CA), anti-CD11b Tricolor conjugate, clone M1/70.15.
Immunization and determination of serum Ig levels
Total Ig levels (IgM and IgG) were determined by sandwich ELISA using a mouse isotyping kit (Southern Biotechnology Associates). For IgA measurements, anti-mouse IgA (Southern Biotechnology Associates) was used as a capture Ab, and biotinylated anti-mouse IgA (Sigma) followed by avidin-HRP conjugate was used as detecting Ab. For all experiments, eight 1:5 serially diluted sera and standard Igs were added to the plate. Ig concentrations were determined using a standard curve generated from standard Igs. For TI Ab responses, mice were i.p. injected with 50 µg DNP-conjugated Ficoll (Biosearch Technologies, Novato, CA). Blood was collected before and 10 days after the immunization. TD responses were analyzed by injecting mice with 100 µg DNP-keyhole limpet hemocyanin (KLH; Calbiochem, La Jolla, CA) with CFA. After 3 wk, mice were injected again with 10 µg DNP-KLH with IFA. Blood was collected before and 10 days after the first and second injections. Ab to DNP was measured by ELISA using plates coated with either DNP-OVA (OVA; Biosearch Technologies) or DNP-gammaglobulin (Calbiochem). Eight 1:5 serially diluted sera were used to determine the titer. The DNP-specific titer was defined as fold serum dilution that resulted in background absorbance.
| Results |
|---|
|
|
|---|
Mice lacking both NFKB1 (p50/p105) and OCA-B were made by crossing
Oca-b-/- mice with
Nfkb1-/- mice (Fig. 1
). As expected, the
Nfkb1-/-Oca-b-/-
mice expressed neither NFKB1 nor OCA-B mRNA, as determined by RT-PCR
assays (Fig. 1
B). Recently, it was reported that the
promoter of the B cell-specific chemokine receptor gene
Blr-1 (Cxcr-5) contains NF-
B and octamer sites
and that this promoter is synergistically activated by the NFKB1/RelA
heterodimer and the Oct/OCA-B complex (25). The BLR-1 mRNA
level was decreased 2- to 3-fold in the
Oca-b-/- splenic B cells, indicating that
OCA-B is indeed necessary for full activation of this promoter (Fig. 1
B, data not shown). In contrast, the
Nfkb1-/- splenic B cells expressed normal
levels of BLR-1 mRNA, suggesting that NFKB1 is not required for
activation of the Blr-1 promoter. In the
Nfkb1-/-Oca-b-/-
splenic B cells, the level of BLR-1 mRNA was decreased to a level
comparable to that in Oca-b-/- B cells.
This suggests that OCA-B is necessary for BLR-1 expression whereas
NFKB1 is not. In contrast, mRNAs for OCT-2 and its presumptive target
CD36 (26) were present at normal levels in both the
single- and double-mutant mice.
|
To study B cell development in the absence of OCA-B and NFKB1, we
analyzed cell surface marker expression in lymphoid organs by flow
cytometry. Similar numbers of nucleated bone marrow cells were obtained
from wild-type and mutant mice (24 ± 9 x
106 for wild type, 19 ± 8 x
106 for Nfkb1-/-,
25 ± 18 x 106 for
Oca-b-/-, and 26 ± 8 x
106 for
Nfkb1-/-Oca-b-/-).
Previous studies indicated that B cell differentiation in the bone
marrow proceeds normally in the absence of either NFKB1 or OCA-B
(7, 8, 9, 18). To find out whether NFKB1 and OCA-B play
redundant roles in early B cell differentiation, we analyzed B cell
differentiation in the bone marrow of
Nfkb1-/-Oca-b-/-
mice. The double-mutant mice contained slightly reduced
proportions of B220+IgM+
immature B cells (Fig. 2
A).
However, analyses of B220 and CD43 expression did not show any obvious
differences (data not shown), indicating that early B cell
differentiation is largely normal in the absence of both NFKB1 and
OCA-B. Previous studies of Oca-b-/- mice
indicated that there is a reduction of the recirculating B cell
population in bone marrow (8, 9, 27). This deficiency in
recirculating B cells was most pronounced in young (3- to 4-wk-old)
mice, while in older (20-wk) mice the recirculating B cell population
was largely restored. In the present study, when mice were analyzed
between 5 and 9 wk of age, the recirculating B cell population (defined
as B220highIgDhigh cells)
was significantly reduced in both
Nfkb1-/- and
Oca-b-/- mice, as well as in
Nfkb1-/-Oca-b-/-
mice (Fig. 2
A).
|
B splenocytes can be further subdivided according to IgM and IgD
expression patterns (28). Transitional B cells recently
arrived from the bone marrow are
IgMhighIgDlow (T1) and
subsequently IgMhighIgDhigh
(T2), whereas mature recirculating B cells are
IgMlowIgDhigh. An increase
in the transitional B cell population with a concomitant decrease in
the mature B cell population would indicate that there is a
developmental block preventing B cell progression from the transitional
to the mature B cell stage. For example, B cell differentiation is
blocked at the T2 to mature B cell transition in B220 null
and X-linked immunodeficiency (XID) mice (28).
However, in the present case the
Nfkb1-/-Oca-b-/-
mice exhibited defects in both transitional and mature B cell
populations (Fig. 2
B). This suggests that the developmental
block is at or before the arrival of the transitional B cells in the
spleen of
Nfkb1-/-Oca-b-/-
mice. Alternatively, there might be a defect in survival rate of the
mutant B cells. T cell differentiation to CD4 or CD8 single-positive
stages occurs normally in the double-knockout thymus (data not shown).
However, there is up to a 2-fold increase in the frequency of
CD8+ cells in the
Nfkb1-/-Oca-b-/-
spleen (Fig. 2
B). This altered
CD4+/CD8+ frequency in the
Nfkb1-/-Oca-b-/-
spleen might indicate a dependency of CD4+ T cell
maintenance on B cell function. However, we cannot exclude the
possibility that NFKB1 and OCA-B might directly function in redundant T
cell pathways that maintain normal
CD4+/CD8+ frequencies.
B-1 cell development is defective in the absence of NFKB1 and OCA-B
In addition to the well-studied conventional B cells (B-2 cells), there is a separate population of B cells (B-1 cells) that is found mainly in the adult peritoneal and pleural cavities (29, 30, 31, 32). B-1 cells make a major contribution to serum IgM, IgG3, and IgA levels and respond well to TI Ags such as bacterial coat Ags and autoantigens. Recent studies showed that natural IgM produced by B-1 cells is crucial for complement-mediated inflammatory diseases (33). B-1 cells are subdivided into B-1a and B-1b populations on the basis of cell surface markers and progenitor sources (34). All B-1 cells in the peritoneum are CD11b (MAC1)+, IgM+, and CD23-. B-1a cells express CD5 on the cell surface, whereas B-1b cells do not. Adoptive transfer studies show that the precursors for B-1a cells are restricted to fetal liver and omentum, while progenitors for B-1b cells are found in adult bone marrow as well as in fetal liver and omentum (34). An alternative view proposes that B-1 cells are generated from activated B-2 cells rather than from a separate lineage (35, 36). In addition, recent studies using the hen egg lysozyme transgenic mouse model system have shown that anergic B cells can assume a B-1a cell phenotype by up-regulating the expression of CD5, which inhibits the BCR signal induced by the autoantigen (37). Regardless of the origin of the B-1 cells, several recent studies showed that B-1 cell differentiation and survival are critically dependent on positive selection through BCR signaling (38, 39, 40).
We studied B-1 cell development in the various mutant mice by analyzing
cell surface expression of CD5 and CD11b in the peritoneum (Fig. 3
). Staining for the total B-1 cells
(CD11b+IgM+) indicated that
Oca-b-/- mice contained an increased
frequency of B-1 cells in the peritoneum (Fig. 3
A). In
contrast, there was a 2- to 3-fold reduction in the frequency of
CD11b+IgM+ B-1 cells in
mice lacking NFKB1 (Fig. 3
A). In fact, the absolute numbers
of CD11b+IgM+ cells were 2-
to 3-fold elevated in the Oca-b-/- mice
and 2- to 3-fold reduced in the Nfkb1-/-
mice (1.2 ± 0.6 x 106 for wild-type,
0.5 ± 0.3 x 106 for
Nfkb1-/-, 3 ± 2 x
106 for Oca-b-/-,
and 0.05 ± 0.04 x 106 for
Nfkb1-/-Oca-b-/-).
Three-color flow cytometry showed that this reduction in the total B-1
cell population in Nfkb1-/- mice is
specifically due to a severe reduction in the
CD5+IgM+ B-1a cell
population, whereas the
CD5-IgM+ cell population
appears to be unaffected by the Nfkb1 mutation (Fig. 3
B, upper panel). The CD11b expression patterns
of the IgM+CD5- gated
fraction showed that Nfkb1-/- mice
contained a normal proportion of B-1b
(CD11b+CD5-IgM+)
cells (Fig. 3
B, lower panel). Thus, our analyses
indicate that NFKB1 is selectively required for B-1a cell
differentiation. In Oca-b-/- mice, there
was an increase in the B-1a
(CD5+IgM+) population (Fig. 3
B, upper panel) and a slight decrease in the
CD11b+CD5-IgM+
population (Fig. 3
B, lower panel). Interestingly,
there was a drastic loss of the
IgMhighCD11b+CD5-
population in the Oca-b-/- mice (boxed,
Fig. 3
B, lower panel), indicating that a subset
of B-1b cells are reduced in the absence of OCA-B. Importantly,
Nfkb1-/-Oca-b-/-
mice had severe deficiencies in both the B-1a and the B-1b cell
populations in the peritoneum (Fig. 3
, A and B).
In fact, the reduction in B-1 cells in
Nfkb1-/-Oca-b-/-
mice was comparable to that seen in the XID mice (Fig. 3
, A and B). Taken together, these results suggest
that NFKB1 and OCA-B are required for B-1 cell differentiation and that
each factor selectively affects either B-1a (NFKB1) or B-1b (OCA-B)
cell differentiation.
|
We measured the total serum Ig levels to see whether the reduced
number of
Nfkb1-/-Oca-b-/-
B cells in the periphery function normally (Fig. 4
). As expected from the single-knockout
phenotypes, the secondary heavy chain isotypes were all reduced, albeit
to variable degrees, in the
Nfkb1-/-Oca-b-/-
mice. Thus, whereas IgG1 and IgG2b levels were slightly increased
in
Nfkb1-/-Oca-b-/-
mice compared with Oca-b-/- mice,
IgG2b, IgG3, and IgA levels were decreased even further. It is
unclear whether these slight differences are functionally significant.
Surprisingly, however, the IgM levels in the
Nfkb1-/-Oca-b-/-
mice were greatly reduced, to <10% of the wild-type level. Because
single-knockout mice produce normal levels of IgM, this is another
phenotype that reflects redundant functions of OCA-B and NFKB1.
Considering that B-1 cells produce a major portion of serum IgM, the
reductions in IgM levels might be due to the virtual absence of B-1
cells in the
Nfkb1-/-Oca-b-/-
mice.
|
|
| Discussion |
|---|
|
|
|---|
|
Our present study shows that
Nfkb1-/- mice have a severely reduced
B-1a subpopulation
(CD5+CD11b+IgM+)
but normal levels of B-1b cells
(CD5-CD11b+IgM+)
(Fig. 3
, A and B). In contrast,
Oca-b-/- mice contain elevated numbers of
B-1a cells and reduced numbers of IgMhigh B-1b
cells (Fig. 3
, A and B). Interestingly, the
double-knockout mice contain drastically reduced levels of both B-1a
and B-1b cells (Fig. 3
). This suggests that NFKB1 and OCA-B are
required for B-1 cell differentiation. This also suggests that although
B-1a and B-1b cells are considered to be closely related, each are
under a distinct transcriptional control. Currently, only limited
information is available on the transcriptional regulation of B-1 cell
differentiation. Analyses of mice lacking either Oct-2 or Pax-5 (BSAP)
have shown that these transcription factors are required for B-1 cell
differentiation (41, 42). However, in these studies on
Oct-2-/- and
Pax-5-/- mice, only
CD5+ B-1a cells were analyzed, and no information
is available on the requirement of these factors in B-1b cell
differentiation. Therefore, ours is the first report to show that two
distinct transcription factors regulate B-1a or B-1b cell
differentiation. There is growing evidence that positive selection
through the BCR plays a crucial role in B-1 cell differentiation
(38, 39, 40). Therefore, the B-1 cell deficiencies observed in
the mutant mice might be due in part to defective BCR signaling in the
mutant B cells (7, 10, 18).
It has been proposed that B-1 cells make a major contribution to serum
IgM levels. For example, depletion of B-1 cells by anti-IL-10
treatment results in a 90% reduction in serum IgM levels, whereas IgM
responses to TD Ag by conventional B cells are normal
(43). Therefore, it is likely that reductions in serum IgM
levels in the
Nfkb1-/-Oca-b-/-
mice (Fig. 4
) are, in large part, a consequence of the severe reduction
in the B-1 populations. The inability of conventional
Nfkb1-/-Oca-b-/-
B cells to generate specific IgM Abs against TI and TD Ags (Fig. 5
) may
contribute further to the deficiencies in the total serum IgM
levels.
Conventional (B-2) B cell differentiation
In the spleen,
B220+IgM+ B cell
frequencies are relatively normal in the single-knockout mice (Fig. 2
B). In contrast, the double mutation causes a 2- to 3-fold
reduction in the B220+IgM+
B cell frequency. These results suggest that OCA-B and NFKB1 play
redundant roles in the generation and/or maintenance of normal
frequency of conventional B cells in the periphery. While analyzing the
cell surface expression of IgM and IgD in the spleen, we noticed that
the mean intensity of both IgM and IgD was consistently reduced in
Oca-b-/- and
Nfkb1-/-Oca-b-/-
mice. In fact, this reduction is quite obvious in the contour plot of
the double staining (Fig. 2
B). We do not know the precise
reason for this reduction, but it is possible that the peripheral B
cells in the Oca-b-/- and the
Nfkb1-/-Oca-b-/-
mice are abnormal. Thus, in addition to being reduced in number, the
peripheral B cells in
Nfkb1-/-Oca-b-/-
mice may be functionally distinct from the B cells in wild-type mice.
Detailed cellular analyses are under way to study the activation
processes in mutant B cells.
Defects in switched isotype levels, Ab responses, and germinal center formation
Single-null mutations in either Nfkb1 or
Oca-b lead to decreased serum IgG and IgA levels. In the
Oca-b-/- mice these defects may reflect
essential OCA-B function both in germinal center formation
(7, 8, 9) and in optimal 3' enhancer-dependent expression of
switched heavy chain loci (10). In contrast, the decreased
serum isotype levels in Nfkb1-/- mice may
reflect the fact that unlike OCA-B, NFKB1 is required for germline
immunoglobulin transcription and isotype switching, but not for
germinal center formation (18, 19). It is currently
unknown whether NFKB1 plays a role in transcription of the switched
isotype loci through the 3' IgH enhancer. However, the presence of
functional NF-
B sites along with octamer sites in the 3' IgH
enhancer (11) suggests that transcription of switched
isotype loci might be coordinately regulated by NFKB1 and OCA-B.
Ab responses to either TI (DNP-Ficoll) or TD (DNP-KLH) Ags are
significantly reduced in the single-knockout mice. In the
Nfkb1-/-Oca-b-/-
mice, the responses are further reduced, with very little anti-DNP
antisera detectable (Fig. 5
). Functional redundancy between NFKB1 and
OCA-B is obvious in both TI and TD responses, as the single-knockout
mice produce significantly reduced (4- to 600-fold) yet measurable
amounts of DNP-specific antisera, whereas the
Nfkb1-/-Oca-b-/-
mice produce very little anti-DNP antisera above the preimmune
level. These results suggest that OCA-B and NFKB1 play functionally
redundant roles in the production of TI and TD Ab responses. The roles
played by these factors in isotype switching, germinal center
formation, and 3' IgH enhancer-dependent transcription may be part of
this process. However, the degree of the defect produced by the
double-null mutation is more than the simple sum of defects caused by
the single mutations. Therefore, it is likely that NFKB1 and OCA-B play
additional roles in generating specific Ab responses.
Collaboration between NFKB1 and OCA-B
Currently, the only known target gene that is coordinately
regulated by NFKB1 and OCA-B is the B cell chemokine receptor
Blr-1 (25). Our analyses of BLR-1 mRNA levels
in the single- and double-mutant B cells suggest that NFKB1 function on
this promoter is compensated by other NF-
B family proteins (Fig. 1
B). Considering the defects in the
Nfkb1-/-Oca-b-/-
mice, it is possible that there are other target promoters/enhancers
that are directly and synergistically regulated by NFKB1 and OCA-B. It
is also possible that NFKB1 and OCA-B activate separate target genes
that regulate the same downstream genes within a B cell differentiation
pathway. A large-scale gene expression profiling of the mutant mice
should yield interesting information on potential target genes and
pathways coordinately regulated by NFKB1 and OCA-B.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Robert G. Roeder, Laboratory of Biochemistry and Molecular Biology, Rockefeller University, 1230 York Avenue, New York, NY 10021. ![]()
3 Abbreviations used in this paper: BSAP, B cell lineage-specific activator protein; TI, T independent; TD, T dependent; BCR, B cell receptor; KLH, keyhole limpet hemocyanin; XID, X-linked immunodeficiency; RT, reverse transcription. ![]()
Received for publication June 12, 2000. Accepted for publication September 21, 2000.
| References |
|---|
|
|
|---|
B-binding proteins. J. Immunol. 156:2828.[Abstract]
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
B transcription factors during lymphocyte activation. Curr. Opin. Immunol. 10:353.[Medline]
B leads to multifocal defects in immune response. Cell 80:321.[Medline]
B knockout mice have selective defects in proliferation, differentiation, germline CH transcription, and Ig class switching. J. Immunol. 156:183.[Abstract]
B in osteoclast and B cell development. Genes Dev. 11:3482.
B directs expression of the homing receptor BLR1 to mature B cells. J. Biol. Chem. 273:28831.
9 B cell antigen receptor drives generation of CD5+ B cells both in vivo and in vitro. J. Immunol. 164:4586.This article has been cited by other articles:
![]() |
X. Yu, R. Siegel, and R. G. Roeder Interaction of the B Cell-specific Transcriptional Coactivator OCA-B and Galectin-1 and a Possible Role in Regulating BCR-mediated B Cell Proliferation J. Biol. Chem., June 2, 2006; 281(22): 15505 - 15516. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Podojil, N. W. Kin, and V. M. Sanders CD86 and {beta}2-Adrenergic Receptor Signaling Pathways, Respectively, Increase Oct-2 and OCA-B Expression and Binding to the 3'-IgH Enhancer in B Cells J. Biol. Chem., May 28, 2004; 279(22): 23394 - 23404. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Kim, R. Siegel, X. Ren, C. S. Gunther, T. Gaasterland, and R. G. Roeder Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B cell differentiation by cDNA array analyses PNAS, July 22, 2003; 100(15): 8868 - 8873. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Elphick, J. Wieseler-Frank, B. N. Greenwood, J. Campisi, and M. Fleshner B-1 cell (CD5+/CD11b+) numbers and nIgM levels are elevated in physically active vs. sedentary rats J Appl Physiol, July 1, 2003; 95(1): 199 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Rothstein Two B-1 or Not To Be One J. Immunol., May 1, 2002; 168(9): 4257 - 4261. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |