|
|
||||||||

and CD8
ß Intraepithelial Lymphocytes Are Thymus Derived and Exhibit Subtle Differences in TCRß Repertoires1




*
Department of Pathology, Geneva University, Geneva, Switzerland;
Unité Mixte de Recherche 7622, Centre National de la Recherche Scientifique, Université Pierre et Marie Curie, Paris, France; and
Department of Medical Microbiology, Turku University, Turku, Finland
| Abstract |
|---|
|
|
|---|

intestinal IELs (iIELs) can mature and undergo
selection in the absence of a thymus. We analyzed IEL origin by cell
transfer, using two congenic chicken strains. Embryonic day 14 and
adult thymocytes did not contain any detectable CD8
T cells.
However, when TCR+ thymocytes were injected into congenic
animals, they migrated to the gut and developed into CD8
iIELs,
while TCR- T cell progenitors did not. The TCR Vß1
repertoire of CD8
+ TCR Vß1+ iIELs
contained only part of the TCR Vß1 repertoire of total iIELs, and it
exhibited no new members compared with CD8+ T cells in the
thymus. This indicated that these T cells emigrated from the thymus at
an early stage in their developmental process. In conclusion, we show
that while CD8
iIELs originate in the thymus, T cells acquire the
expression of CD8
homodimers in the gut
microenvironment. | Introduction |
|---|
|
|
|---|
ß and 
TCR-positive lymphocytes functioning as the first line of defense
against enteric pathogens. Although most peripheral T cells arise and
expand in the thymus before they migrate to the periphery, it was
proposed that the intestinal epithelium contains a thymus-independent T
cell population that differentiates according to the epithelial
microenvironment (1, 2, 3, 4). These cells express the
coreceptor CD8
as a homodimer, whereas thymus-derived T cells bear
CD8
ß heterodimers as well as CD8
homodimers
(5, 6, 7, 8, 9). This unusual CD8
expression is also shared
by an intestinal TCR+, NK-like cell population
(10, 11, 12). The experiments suggesting an extrathymic origin
for TCR+ cells were conducted in
immunocompromised mice (1, 2). However, in sheep,
thymectomy in utero results in severe persistent depletion of
peripheral T cells and a dramatic drop in the number of intraepithelial
lymphocytes (IELs)4 in
the intestine of lambs during the first year of life (13).
In athymic mice the IEL population is only 20% of normal numbers, and
reconstitution can be obtained by thymus grafts (3).
Current experiments in chickens show that
TCR
+ thymocytes home to the intestine,
whereas a TCR
- thymocyte population
enriched for hemopoietic progenitors fails to give rise to 
IELs
(14, 15). Other chicken hemopoietic tissues, such as bone
marrow and spleen, were also ineffective sources for 
or
ß
intestinal IELs (iIELs) (14, 16, 17). Therefore, these
data showed that iIELs in the chicken are primarily derived from the
thymus.
The chicken
ß and 
TCR proteins closely resemble those of
mammals (10, 16, 18, 19, 20, 21, 22). The variable TCR ß-chain
comprises the two major gene families Vß1 and Vß2, and T cells
expressing either of these genes differ in their ontogeny and function
(19, 20). Vß2 T cells appear later in the thymus and
periphery than Vß1 T cells and infrequently migrate to the intestine;
the two subsets also differ in their graft-vs-host reaction capacity
(18, 23). Furthermore, Vß1 T cells are mainly located
within the lamina propria, although a CD8+
subpopulation of them subsequently enters the epithelial layer
(18, 23, 24).
Mapping of the TCRß genomic region to date has identified six Vß1, four Vß2, one Dß, four Jß, and one Cß segments (16, 18, 19, 20). No Vß pseudogenes have been found, and the four Jß segments are very similar to each other (16). The TCRß rearrangement can start either by the Vß1Dß or the DßJß step and is restricted to the thymus at least during embryogenesis (25). Because of its relatively small heterogeneity among germline V, D, and Jß elements, TCRß diversity is largely maintained by the variable N nucleotide addition at the coding joints of VD and DJ recombinations (16, 19, 20).
T cell precursors enter the chick thymus in three waves during embryonic life, and these waves of precursors also generate waves of T cell progenies that emigrate sequentially to the periphery during development (14, 15, 16, 17, 22, 26, 27). Thymus-derived iIELs are not characterized by preselection of TCR Vß1 repertoires in the thymus (16). The low frequencies of nonproductive rearrangements in iIELs suggest that negative selection might occur in the intestine.
Here we studied whether
ß or 
TCR+
CD8+
iIELs are derived from the thymus or
whether they have an extrathymic origin. These studies were performed
by cell transfer experiments with novel chicken strains exhibiting
polymorphic differences in the CD8
-chain and Abs that recognized
them. Furthermore, we determined differences in TCR Vß1 repertoire
usage between thymus-derived CD8
and CD8
ß iIELs.
| Materials and Methods |
|---|
|
|
|---|
MHC-homozygous embryos of White Leghorn chicken strains H.B15.H7 (H7) and H.B15.H12 (H12) were derived from animals kept at the Department of Medical Microbiology, Turku University (Turku, Finland).
The two strains are different with respect to their reactivity with the allotypic CD8-specific mouse mAb 11-13, which only recognizes H.B15.H12 cells (28, 29, 30). The H.B19 chickens were from colonies at the Basel Institute for Immunology (Gipf-Oberfrick, Switzerland). The H.B19 strain was subdivided into the congenic lines H.B19ov+ and H.B19ov-. These are distinguished by the ov Ag, which is present only on thymocytes and T cells of H.B19ov+ animals and is recognized by mAb 11A9 (31). These experimental animals were treated according to Swiss governmental veterinary guidelines. Fertilized eggs were incubated at 38°C and 80% humidity in a ventilated incubator.
Abs and FACS
For three-color analysis we used mouse-anti-TCR Vß1 mAb
coupled to biotin (TCR2, Southern Biotechnology, Birmingham, AL), mouse
anti-CD8ß mAb (Ep42, an IgG2a, gift from M. Ratcliffe, Montreal,
Canada), and mouse anti-CD8
mAbs (11-39, an IgG1 recognizing all
polymorhic forms; 11-7 and 11-13, both IgG1 recognizing only CD8 of the
strain H.B15.H12; (32)). These Abs were detected by
streptavidin-Tricolor (Caltag, South San Francisco, CA), polyclonal
anti-mouse-IgG2a-FITC, or anti-mouse-IgG1-PE, respectively
(Southern Biotechnology). Reanalysis of sorted CD8
and CD8
ß
cells showed no contamination (0%) by one or the other population.
COS cell labeling
COS-7 cell transfections and their staining with anti-CD8
mAb was performed as previously described (33).
Transfections were performed with pCDM8 plasmids carrying CD8
from
the inbred chicken lines H.B15.H12 and H.B15.H7, respectively.
Transfected lines were grown for 2 days to express the protein. The
cells were then fixed and stained with the CD8
allotypic mAbs 11-7
or 11-13, respectively. Staining of the cells with 11-39 served as a
positive control. Abs were detected with HRP-conjugated rabbit anti
mouse-Ig (Dako, Copenhagen, Denmark).
Injection of lymphoid cells into congenic chickens
Embryonic day 14 (E14) thymocytes of H12 animals were injected into a large vein at the end of the air sac of E16 H7 embryos (34). Alternatively, thymocytes of 2-day-old H12 chicks were injected into the jugular vein of 2-day-old H7 chicks. Before injection, thymocytes were suspended in PBS containing 10% chicken serum, filtered through a nylon sieve (mesh width, 25 µm; Nytal P-25 my, SST, Thal, Switzerland), and centrifuged at 255 x g for 7 min. The cells were then resuspended in PBS and adjusted to 2 x 108 cells/ml, and 100 µl was injected into E16 embryos or into chicks 2 days after hatching.
cDNA synthesis
Total cellular RNA from sorted CD8
or CD8
ß IELs
(3 x 104 cells for each population) of a
21-day-old chick was isolated by the guanidium isothiocyanate method
and purified on a CsCl gradient (35). About 5 µg of RNA
was used as a template for the synthesis of randomly primed
single-stranded cDNA using murine Moloney leukemia virus reverse
transcriptase (BRL, Gaithersburg, MD) in a reaction volume of 20 µl
(according to the suppliers instructions). This cDNA was subsequently
diluted in 100 µl of water and heated to 94°C for 2 min to
inactivate the reverse transcriptase enzyme.
PCR, semiquantitative PCR, and cloning of Vß transcripts
A PCR technique employing nucleotide primers was used to amplify the expressed TCR Vß regions. One nucleotide primer, 5872, was specific for the sequence contained in the chicken TCR Cß region located just upstream of the stop codon (16, 19). The expressed TCR Vß1 regions were specifically amplified using the second oligonucleotide primer, 5349, which starts at the position corresponding to amino acid residue 15 of the Vß1 segment. The procedure used for semiquantitative PCR was described previously (36). The amount of cDNA synthesized was calibrated using the relative expression level of ß-actin as a standard. The two actin oligonucleotide primers, 4611 and 4612, generated a band of 283 nucleotides (37).
The oligonucleotides used are as follows: 5872 (3' of Cß, antisense), ACAGGTCGACGTACCAAAGCATCATCCCCATCACAAAT; 5349 (5' of Vß1), ACAGGTCGACCTGGGAGACTCTCTGACTCTGAACTGT; 4611 (5' of actin), TACCACAATGTACCCTGGC; 4612 (3' of actin), CTCGTCTTGTTTTATGCGC; Vß18.b, 5'-ACACAAAGAGAGTGGAAA-3'; and Jß1280 (antisense), 5'-GCCATCACCGAAAATCATG-3'.
PCR were performed in 30 µl using 1 U of Taq polymerase (Perkin-Elmer/Cetus, Norwalk, CT). The PCR buffer was prepared (as suggested by Perkin-Elmer) with the addition of 10 mM 2-ME. Reaction mixtures were denatured at 96°C for 5 min and then subjected to 30 rounds of amplification using a Trio Thermoblock 48 thermocycler (Biometra, Tampa, FL). The following conditions were used: 96°C for 5 s, 50°C for 15 s, and 72°C for 1 min. For cloning of rearranged TCR V, final extension was at 72°C for 10 min. For cloning of rearranged TCR Vß1 cDNA, the PCR were performed with 5 times more cDNA template than that used for the semiquantitative analysis. Amplified DNA fragments were purified and cloned into the PCRII plasmid (Invitrogen, San Diego, CA).
Sequencing
Sequences were determined from denatured double-stranded recombinant plasmid DNA with Sequenase (Amersham, Arlington Heights, IL) using the chain termination reaction. Oligonucleotide 6106 starting 60 bp downstream of the 5' end of the Cß segment in the antisense orientation was used as a primer for the chain elongation reaction (6106 (5' of Cß, antisense), AATCTCTTGCTTTGATGGTGA). In cases where ambiguities remained, several additional nucleotide primers were used. Sequences were assembled and analyzed with the CITI2 software package (Université de Jussieu, Paris, France).
| Results |
|---|
|
|
|---|

+ T cells
IELs in the gut are formed by an unusual T cell population that
expresses the CD8
-chain as a homodimer instead of an
ß
heterodimer as found on cells in most other organs (Fig. 1
). To date, the expression of CD8
has often been taken as a nonexclusive indicator of the extrathymic
origin of these intestinal IELs. We found that neither E14 chicken
embryonic nor adult thymus contained CD8
T lymphocytes (Fig. 1
;
no CD8
cells detected from 2 x 108 T
cells analyzed). However, in the intestine, >50% of all TCR-positive
IELs expressed CD8
as a homodimer (Fig. 1
). Using two congenic
chicken strains, H.B19ov+ and
H.B19ov-, we recently demonstrated that
embryonic TCR
+ thymocytes can colonize the
gut where they are able to survive for months (14, 15).
However, thymus-derived TCR-negative progenitors were not able to
migrate into the intestinal epithelium and differentiate into T cells
(14).
|

+ thymocytes differentiate
into CD8
+ T cells in the intestinal epithelium
To determine whether T cells emigrating from the thymus could
differentiate into CD8
cells after immigration into the gut
epithelium, we developed a new cell transfer system with two congenic
chicken strains expressing polymorphic CD8
molecules. To this end,
we raised the mAb 11-13, which recognized CD8
of T cells from
H.B15.H12 (H12) chickens, but not from congenic H.B15.H7 (H7) chickens
(Fig. 2
A). Immunoprecipitation
using mAb 11-13 on H12 allotypic thymocytes showed CD8
bands on
SDS-PAGE apparently identical with those found using mAb 11-39. The mAb
11-39 recognizes CD8
from all allotypic chicken strains (Fig. 2
B). When COS cells were transfected with CD8
cDNA from
either animal strain, the allotypic mAb 11-13 specifically recognized
cells transfected with CD8
from H12 animals (Fig. 2
C),
whereas mAb 11-39 recognized both (not shown). These two mAbs were used
to distinguish transferred donor H12 CD8
T cells in the intestine of
H7 recipients from host H7 CD8
cells.
|

, and <3% show TCR
ß. Injection of sorted
TCR
+ E14 thymocytes into E16 recipients
resulted in the colonization of the intestinal epithelium by these
TCR
cells (14). In contrast, injected
TCR
- thymocytes did not migrate to the gut
epithelium (14). To follow the origin of CD8
IELs,
we then injected 2 x 107 E14 thymocytes of
H12 embryos into E16 embryos of the H7 haplotype. After 18 days, iIELs
were harvested from the H7 host animals and analyzed by cytofluorometry
to test whether the injected thymocytes had seeded the gut epithelium.
Double staining of these cells with the H12 donor-specific
anti-CD8
mAb 11-13 and the anti-CD8ß mAb EP42 showed that
16.5% of all CD8+ cells were from the donor. Of
these cells, 72% expressed CD8 as 
homodimers and 28% as
ß
heterodimers (Fig. 3
+ thymocytes are able to migrate to the
intestine and differentiate into CD8+
T
cells.
|
|
ß+ thymocytes differentiate
into CD8+
T cells in the intestinal epithelium
The thymus of a 2-day-old chick contains about 60%
TCR
ß+ cells (38, 39). To test
whether TCR
ß+ thymocytes from 2-day-old
animals could migrate to the intestinal epithelium and differentiate
into CD8
T cells, we performed thymocyte transfer by injecting
2 x 107 cells from H12 chicks into
age-matched H7 congenic animals. Injected TCR+
thymocytes differentiated into CD8
T cells in the gut, while
injected TCR- thymocytes did not (Fig. 4
A).The analysis of intestinal
TCR
ß+ IELs 18 days after transfer showed
that 8.0% of all CD8
cells and 6.2% of all
CD8
ß+ were from the donor (average of two
animals; Fig. 4
B). This experiment demonstrated that in
young chicks TCR
ß+ T cells can colonize the
intestinal epithelium and are able to differentiate into CD8
IELs. We then wondered whether CD8
and CD8
ß T cells of these
20-day-old chicks presented different TCR
ß repertoires.
|

and CD8
ß
intestinal T cells
To examine the TCRß repertoire, we used semiquantitative PCR,
employing a 3' primer specific for Cß and a 5' primer specific for
Vß1, to amplify the Vß1 regions expressed in intestinal CD8
and CD8
ß IELs from a 20-day-old chick. Vß2 regions were not
analyzed, because Vß2-positive iIELs are rarely found
(23), as confirmed at the RNA level (16). The
number of TCR Vß1-positive cells is higher in the CD8
ß than in
the CD8
iIEL population (Fig. 5
).
This could reflect the fact that TCR
intestinal cells are better
represented in the CD8
than in the CD8
ß population. More
than 30 Vß1 cDNA clones from CD8 
and
ß intestinal
intraembryonic T cells were sequenced (Fig. 6
).
|
|

and CD8
ß cells with
previous data, we performed a series of experiments with the chicken
strain H.B19 (16, 22, 25). A single animal expressed eight
members of the Vß1 family, confirming our former hypothesis that the
H.B19 strain is not homogenous at the TCRß locus, as 17 Vß1 members
were previously identified in 13 animals (16). The
different Vß1 genes in the CD8
or -
ß cell populations were
expressed with comparable distribution (Table II
population or
the lower usage of Vß1.15a in the CD8
ß population. Similarly,
the usage of the Jß segments showed subtle differences among the two
IEL populations (Table III
ß IELs presented lower usage of Jß-1280
segments and more Jß-1336 than the CD8
IELs. This was later
confirmed by PCR using the Jß-1280-specific and Cß-specific primers
(not shown).
|
|

population of animal 3, and Vb1.8b was used in CD8
population of two animals. Analysis of junctional diversity did not
reveal oligoclonality in either CD8 cell population. However, diversity
appeared to be slightly larger in CD8
ß than in CD8
cells, as
suggested by the number of independent clones sequenced, 28 clones for
CD8
ß cells and 22 clones for CD8
cells of 31 clones each.
Taken together, these results suggest that CD8
and CD8
ß
IELs express TCR Vß1 repertoires with subtle differences. More
precisely they indicate that CD8
ß cells exhibit a slightly larger
repertoire than CD8
cells, in accordance with the total number of
TCR Vß1 transcripts in both populations (Fig. 6| Discussion |
|---|
|
|
|---|

iIELs in birds. It is discordant with some of the results
obtained with adult mice, in which CD8
TCR
ß+ and TCR
+
lymphocytes are considered to be primarily of extrathymic origin
(1, 2). However, several studies suggest that a subset of
both TCR
ß and TCR
murine CD8
iIELs is derived from the
fetal/neonatal thymus (5, 6, 7, 8). In cell transfer experiments
using congenic chickens, neither embryonic nor adult thymus contained
CD8
cells, while injection of TCR
ß+ or

+ thymocytes into congenic animals gave
rise to CD8
iIELs. The intestinal intraembryonic CD8
TCR+ cells seem to emerge by a secondary T cell
differentiation event and present a TCR repertoire different from that
of CD8
ß T cells.
Do TCR+ cells from the thymus acquire CD8
in the gut? We found that only thymocytes that expressed the TCR would
migrate to the gut. Embryonic TCR-negative thymocytes, embryonic bone
marrow and spleen cells do not migrate to the gut (14, 16). Most of our former experiments were performed with
embryonic thymocytes injected into embryonic or juvenile recipients.
Here we show that donor cells from juvenile thymus also need to express
the TCR to home to the gut. An open question was whether these cells
could acquire CD8 in the thymus or whether this would happen in the
gut. Of 2 x 108 thymocytes analyzed, we did
not detect a single CD8
-positive cell, indicating that the
expression of this molecule is dependent on the gut microenvironment.
However, due to technical limits we cannot exclude that some CD8
IELs derive from CD8
thymocytes.
Do CD8
thymus-derived T cells show normal characteristics? Most
TCR
cells in the thymus and peripheral lymphoid organs are
CD4- CD8- (40, 41). In gut epithelium the majority of the TCR
cells
express CD8 as 
homodimeric chains. Our former and present
experiments show that in young animals these cells derive from the
thymus. Because most of them did not express CD8 before they left the
thymus, they may have undergone a secondary differentiation and
selection process in the gut. However, this gives rise to the problem
of expansion of potential self-reacting CD8+ T
cells. Does an MHC class I-restricted negative selection occur in the
gut, or do MHC class I recognizing inhibitory receptors exist on iIELs,
leading to inactivation of self-reacting CD8+ T
cells? In fact, both these mechanisms seem to exist simultaneously in
the gut as represented either by classical T cells (CD8
or
ß) or by CD8
cells bearing molecules that are characteristic
of NK cells. Either cell type could receive inhibitory signals for
proliferation upon interaction with MHC (11, 42).
Therefore, while CD8
T cells in the gut are thymus derived, those
that have circumvented negative selection in the thymus have an
alternative selection mechanism in the gut.
A previous report indicated that colonization of the intestine by
thymocytes was not related to TCR Vß1 repertoire selection
(16). Here we show that the CD8+ TCR
Vß1+ iIELs do not represent the entire TCR
Vß1 repertoire of iIELs as exhibited by the different usage of
Jß-1340 and Vß1.8b in this subpopulation. Further analysis
suggested that the repertoires expressed by the CD8
and CD8
ß
iIEL populations are different. Thus, each TCR
ß subpopulation
exhibits a part of the TCR
ß repertoire of all iIELs. These results
are somewhat in agreement with murine studies indicating that CD8
and CD8
ß TCR
ß iIEL populations are oligoclonal with no
overlap between the two subsets (16). The structure of the
TCRß locus is different in birds and mice. Only two Vß families are
found in the chicken (18), whereas 20 Vß families are
described in the mouse (43, 44). At first sight,
repertoire analysis would seem to be easier in mice, because Abs
against the different families are readily available. However, the
study of the diversity within each family would require a large number
of clones. Due to the relative simplicity of the Vß repertoires in
chicken, this endeavor can be performed with fewer clones. In addition,
chicken Vß2 cells are extremely rare in the intestine, making
analysis of this family unnecessary.
By sequencing the isolated Vß1 clones, we found all TCR Vß1 members
in the two CD8+ iIEL subpopulations. This
suggests that all resulting TCRs may recognize gut Ags. Although the
CDR3 size is constant in each CD8 iIEL subpopulation in chicken and
mouse, our data show that the diversity of the TCRß repertoire of CD8
iIELs is larger in chicken than in mouse. Our previous studies in chick
embryos indicated that thymocytes migrating to the gut contained the
entire TCR Vß1 repertoire (16). Here, we also show that
no Vß1 member, Jß segment, or Vß1-Dß-Jß rearrangement is
expressed solely in CD8
iIELs. The presence of a low frequency of
nonproductive TCR Vß1 rearrangements in CD8 iIEL subpopulations
indicates an active negative or positive TCR selection process in the
gut, similar to the establishment of locally restricted repertoires in
the mouse (45).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 B.A.I. and D.D. contributed equally to this study. ![]()
3 Address correspondence and reprint requests to Dr. Beat A. Imhof, Department of Pathology, Geneva University, Centre Médical Universitaire, rue Michel Servet 1, CH-1211 Geneva, Switzerland. ![]()
4 Abbreviations used in this paper: IEL, intraepithelial lymphocyte; iIEL, intestinal IEL; E14, embryonic day 14. ![]()
Received for publication June 5, 2000. Accepted for publication September 11, 2000.
| References |
|---|
|
|
|---|

intestinal intraepithelial lymphocytes early in ontogeny. Eur. J. Immunol. 24:1785.[Medline]

intestinal intraepithelial lymphocytes. Eur. J. Immunol. 24:1792.[Medline]
ß intestinal intraepithelial lymphocytes. Cell Immunol. 171:132.[Medline]
, TNF) in the induction of epithelial cell death and renewal. Eur. J. Immunol. 28:730.[Medline]
ß and 
T cells emigrating from the early lamb thymus. Eur. J. Immunol. 20:1805.[Medline]
/
T cells. J. Exp. Med. 177:257.
T cells during chicken development. Eur. J. Immunol. 23:2545.[Medline]
genes. Proc. Natl. Acad. Sci. USA 93:15329.
and
ß T cells migrate alternatively to the periphery in alternating waves. J. Exp. Med. 186:977.
receptors localize in the splenic sinusoids and the intestinal epithelium. J. Immunol. 141:2200.[Abstract]
but not CD8-ß. Immunogenetics 46:396.[Medline]
/
cells. Annu. Rev. Immunol. 11:637.[Medline]
This article has been cited by other articles:
![]() |
X. Tang, I. Maricic, and V. Kumar Anti-TCR Antibody Treatment Activates a Novel Population of Nonintestinal CD8{alpha}{alpha}+TCR{alpha}beta+ Regulatory T Cells and Prevents Experimental Autoimmune Encephalomyelitis J. Immunol., May 15, 2007; 178(10): 6043 - 6050. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Konno, K. Okada, K. Mizuno, M. Nishida, S. Nagaoki, T. Toma, T. Uehara, K. Ohta, Y. Kasahara, H. Seki, et al. CD8alpha alpha memory effector T cells descend directly from clonally expanded CD8alpha +beta high TCRalpha beta T cells in vivo Blood, December 1, 2002; 100(12): 4090 - 4097. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |