The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Imhof, B. A.
Right arrow Articles by Vainio, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Imhof, B. A.
Right arrow Articles by Vainio, O.
The Journal of Immunology, 2000, 165: 6716-6722.
Copyright © 2000 by The American Association of Immunologists

Intestinal CD8{alpha}{alpha} and CD8{alpha}ß Intraepithelial Lymphocytes Are Thymus Derived and Exhibit Subtle Differences in TCRß Repertoires1

Beat A. Imhof2,*, Dominique Dunon2,{dagger}, David Courtois{dagger}, Marko Luhtala{ddagger} and Olli Vainio{ddagger}

* Department of Pathology, Geneva University, Geneva, Switzerland; {dagger} Unité Mixte de Recherche 7622, Centre National de la Recherche Scientifique, Université Pierre et Marie Curie, Paris, France; and {ddagger} Department of Medical Microbiology, Turku University, Turku, Finland


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intraepithelial lymphocytes (IEL) of the small intestine are anatomically positioned to be in the first line of cellular defense against enteric pathogens. Therefore, determining the origin of these cells has important implications for the mechanisms of T cell maturation and repertoire selection. Recent evidence suggests that murine CD8{alpha}{alpha} intestinal IELs (iIELs) can mature and undergo selection in the absence of a thymus. We analyzed IEL origin by cell transfer, using two congenic chicken strains. Embryonic day 14 and adult thymocytes did not contain any detectable CD8{alpha}{alpha} T cells. However, when TCR+ thymocytes were injected into congenic animals, they migrated to the gut and developed into CD8{alpha}{alpha} iIELs, while TCR- T cell progenitors did not. The TCR Vß1 repertoire of CD8{alpha}{alpha}+ TCR Vß1+ iIELs contained only part of the TCR Vß1 repertoire of total iIELs, and it exhibited no new members compared with CD8+ T cells in the thymus. This indicated that these T cells emigrated from the thymus at an early stage in their developmental process. In conclusion, we show that while CD8{alpha}{alpha} iIELs originate in the thymus, T cells acquire the expression of CD8{alpha}{alpha} homodimers in the gut microenvironment.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The intestinal epithelium harbors a large number of {alpha}ß and {gamma}{delta} TCR-positive lymphocytes functioning as the first line of defense against enteric pathogens. Although most peripheral T cells arise and expand in the thymus before they migrate to the periphery, it was proposed that the intestinal epithelium contains a thymus-independent T cell population that differentiates according to the epithelial microenvironment (1, 2, 3, 4). These cells express the coreceptor CD8{alpha} as a homodimer, whereas thymus-derived T cells bear CD8{alpha}ß heterodimers as well as CD8{alpha}{alpha} homodimers (5, 6, 7, 8, 9). This unusual CD8{alpha}{alpha} expression is also shared by an intestinal TCR+, NK-like cell population (10, 11, 12). The experiments suggesting an extrathymic origin for TCR+ cells were conducted in immunocompromised mice (1, 2). However, in sheep, thymectomy in utero results in severe persistent depletion of peripheral T cells and a dramatic drop in the number of intraepithelial lymphocytes (IELs)4 in the intestine of lambs during the first year of life (13). In athymic mice the IEL population is only 20% of normal numbers, and reconstitution can be obtained by thymus grafts (3). Current experiments in chickens show that TCR{gamma}{delta}+ thymocytes home to the intestine, whereas a TCR{gamma}{delta} - thymocyte population enriched for hemopoietic progenitors fails to give rise to {gamma}{delta} IELs (14, 15). Other chicken hemopoietic tissues, such as bone marrow and spleen, were also ineffective sources for {gamma}{delta} or {alpha}ß intestinal IELs (iIELs) (14, 16, 17). Therefore, these data showed that iIELs in the chicken are primarily derived from the thymus.

The chicken {alpha}ß and {gamma}{delta} TCR proteins closely resemble those of mammals (10, 16, 18, 19, 20, 21, 22). The variable TCR ß-chain comprises the two major gene families Vß1 and Vß2, and T cells expressing either of these genes differ in their ontogeny and function (19, 20). Vß2 T cells appear later in the thymus and periphery than Vß1 T cells and infrequently migrate to the intestine; the two subsets also differ in their graft-vs-host reaction capacity (18, 23). Furthermore, Vß1 T cells are mainly located within the lamina propria, although a CD8+ subpopulation of them subsequently enters the epithelial layer (18, 23, 24).

Mapping of the TCRß genomic region to date has identified six Vß1, four Vß2, one Dß, four Jß, and one Cß segments (16, 18, 19, 20). No Vß pseudogenes have been found, and the four Jß segments are very similar to each other (16). The TCRß rearrangement can start either by the Vß1Dß or the DßJß step and is restricted to the thymus at least during embryogenesis (25). Because of its relatively small heterogeneity among germline V, D, and Jß elements, TCRß diversity is largely maintained by the variable N nucleotide addition at the coding joints of VD and DJ recombinations (16, 19, 20).

T cell precursors enter the chick thymus in three waves during embryonic life, and these waves of precursors also generate waves of T cell progenies that emigrate sequentially to the periphery during development (14, 15, 16, 17, 22, 26, 27). Thymus-derived iIELs are not characterized by preselection of TCR Vß1 repertoires in the thymus (16). The low frequencies of nonproductive rearrangements in iIELs suggest that negative selection might occur in the intestine.

Here we studied whether {alpha}ß or {gamma}{delta} TCR+ CD8+{alpha}{alpha} iIELs are derived from the thymus or whether they have an extrathymic origin. These studies were performed by cell transfer experiments with novel chicken strains exhibiting polymorphic differences in the CD8 {alpha}-chain and Abs that recognized them. Furthermore, we determined differences in TCR Vß1 repertoire usage between thymus-derived CD8{alpha}{alpha} and CD8{alpha}ß iIELs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

MHC-homozygous embryos of White Leghorn chicken strains H.B15.H7 (H7) and H.B15.H12 (H12) were derived from animals kept at the Department of Medical Microbiology, Turku University (Turku, Finland).

The two strains are different with respect to their reactivity with the allotypic CD8-specific mouse mAb 11-13, which only recognizes H.B15.H12 cells (28, 29, 30). The H.B19 chickens were from colonies at the Basel Institute for Immunology (Gipf-Oberfrick, Switzerland). The H.B19 strain was subdivided into the congenic lines H.B19ov+ and H.B19ov-. These are distinguished by the ov Ag, which is present only on thymocytes and T cells of H.B19ov+ animals and is recognized by mAb 11A9 (31). These experimental animals were treated according to Swiss governmental veterinary guidelines. Fertilized eggs were incubated at 38°C and 80% humidity in a ventilated incubator.

Abs and FACS

For three-color analysis we used mouse-anti-TCR Vß1 mAb coupled to biotin (TCR2, Southern Biotechnology, Birmingham, AL), mouse anti-CD8ß mAb (Ep42, an IgG2a, gift from M. Ratcliffe, Montreal, Canada), and mouse anti-CD8{alpha} mAbs (11-39, an IgG1 recognizing all polymorhic forms; 11-7 and 11-13, both IgG1 recognizing only CD8 of the strain H.B15.H12; (32)). These Abs were detected by streptavidin-Tricolor (Caltag, South San Francisco, CA), polyclonal anti-mouse-IgG2a-FITC, or anti-mouse-IgG1-PE, respectively (Southern Biotechnology). Reanalysis of sorted CD8{alpha}{alpha} and CD8{alpha}ß cells showed no contamination (0%) by one or the other population.

COS cell labeling

COS-7 cell transfections and their staining with anti-CD8{alpha} mAb was performed as previously described (33). Transfections were performed with pCDM8 plasmids carrying CD8{alpha} from the inbred chicken lines H.B15.H12 and H.B15.H7, respectively. Transfected lines were grown for 2 days to express the protein. The cells were then fixed and stained with the CD8{alpha} allotypic mAbs 11-7 or 11-13, respectively. Staining of the cells with 11-39 served as a positive control. Abs were detected with HRP-conjugated rabbit anti mouse-Ig (Dako, Copenhagen, Denmark).

Injection of lymphoid cells into congenic chickens

Embryonic day 14 (E14) thymocytes of H12 animals were injected into a large vein at the end of the air sac of E16 H7 embryos (34). Alternatively, thymocytes of 2-day-old H12 chicks were injected into the jugular vein of 2-day-old H7 chicks. Before injection, thymocytes were suspended in PBS containing 10% chicken serum, filtered through a nylon sieve (mesh width, 25 µm; Nytal P-25 my, SST, Thal, Switzerland), and centrifuged at 255 x g for 7 min. The cells were then resuspended in PBS and adjusted to 2 x 108 cells/ml, and 100 µl was injected into E16 embryos or into chicks 2 days after hatching.

cDNA synthesis

Total cellular RNA from sorted CD8{alpha}{alpha} or CD8{alpha}ß IELs (3 x 104 cells for each population) of a 21-day-old chick was isolated by the guanidium isothiocyanate method and purified on a CsCl gradient (35). About 5 µg of RNA was used as a template for the synthesis of randomly primed single-stranded cDNA using murine Moloney leukemia virus reverse transcriptase (BRL, Gaithersburg, MD) in a reaction volume of 20 µl (according to the supplier’s instructions). This cDNA was subsequently diluted in 100 µl of water and heated to 94°C for 2 min to inactivate the reverse transcriptase enzyme.

PCR, semiquantitative PCR, and cloning of Vß transcripts

A PCR technique employing nucleotide primers was used to amplify the expressed TCR Vß regions. One nucleotide primer, 5872, was specific for the sequence contained in the chicken TCR Cß region located just upstream of the stop codon (16, 19). The expressed TCR Vß1 regions were specifically amplified using the second oligonucleotide primer, 5349, which starts at the position corresponding to amino acid residue 15 of the Vß1 segment. The procedure used for semiquantitative PCR was described previously (36). The amount of cDNA synthesized was calibrated using the relative expression level of ß-actin as a standard. The two actin oligonucleotide primers, 4611 and 4612, generated a band of 283 nucleotides (37).

The oligonucleotides used are as follows: 5872 (3' of Cß, antisense), ACAGGTCGACGTACCAAAGCATCATCCCCATCACAAAT; 5349 (5' of Vß1), ACAGGTCGACCTGGGAGACTCTCTGACTCTGAACTGT; 4611 (5' of actin), TACCACAATGTACCCTGGC; 4612 (3' of actin), CTCGTCTTGTTTTATGCGC; Vß18.b, 5'-ACACAAAGAGAGTGGAAA-3'; and Jß1280 (antisense), 5'-GCCATCACCGAAAATCATG-3'.

PCR were performed in 30 µl using 1 U of Taq polymerase (Perkin-Elmer/Cetus, Norwalk, CT). The PCR buffer was prepared (as suggested by Perkin-Elmer) with the addition of 10 mM 2-ME. Reaction mixtures were denatured at 96°C for 5 min and then subjected to 30 rounds of amplification using a Trio Thermoblock 48 thermocycler (Biometra, Tampa, FL). The following conditions were used: 96°C for 5 s, 50°C for 15 s, and 72°C for 1 min. For cloning of rearranged TCR V, final extension was at 72°C for 10 min. For cloning of rearranged TCR Vß1 cDNA, the PCR were performed with 5 times more cDNA template than that used for the semiquantitative analysis. Amplified DNA fragments were purified and cloned into the PCRII plasmid (Invitrogen, San Diego, CA).

Sequencing

Sequences were determined from denatured double-stranded recombinant plasmid DNA with Sequenase (Amersham, Arlington Heights, IL) using the chain termination reaction. Oligonucleotide 6106 starting 60 bp downstream of the 5' end of the Cß segment in the antisense orientation was used as a primer for the chain elongation reaction (6106 (5' of Cß, antisense), AATCTCTTGCTTTGATGGTGA). In cases where ambiguities remained, several additional nucleotide primers were used. Sequences were assembled and analyzed with the CITI2 software package (Université de Jussieu, Paris, France).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The thymus does not produce CD8{alpha}{alpha}+ T cells

IELs in the gut are formed by an unusual T cell population that expresses the CD8 {alpha}-chain as a homodimer instead of an {alpha}ß heterodimer as found on cells in most other organs (Fig. 1Go). To date, the expression of CD8{alpha}{alpha} has often been taken as a nonexclusive indicator of the extrathymic origin of these intestinal IELs. We found that neither E14 chicken embryonic nor adult thymus contained CD8{alpha}{alpha} T lymphocytes (Fig. 1Go; no CD8{alpha}{alpha} cells detected from 2 x 108 T cells analyzed). However, in the intestine, >50% of all TCR-positive IELs expressed CD8{alpha} as a homodimer (Fig. 1Go). Using two congenic chicken strains, H.B19ov+ and H.B19ov-, we recently demonstrated that embryonic TCR{gamma}{delta}+ thymocytes can colonize the gut where they are able to survive for months (14, 15). However, thymus-derived TCR-negative progenitors were not able to migrate into the intestinal epithelium and differentiate into T cells (14).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. CD8{alpha}{alpha} cells are absent from the thymus. Cytofluorometry of E14 and adult thymocytes and adult gut using anti-CD8{alpha} and CD8ß Abs 11-39 and EP-42, respectively, and anti-mouse IgG-specific Abs coupled to FITC or PE. Arrows point to the locations of CD8{alpha}{alpha} cells

 
Embryonic TCR{gamma}{delta}+ thymocytes differentiate into CD8{alpha}{alpha}+ T cells in the intestinal epithelium

To determine whether T cells emigrating from the thymus could differentiate into CD8{alpha}{alpha} cells after immigration into the gut epithelium, we developed a new cell transfer system with two congenic chicken strains expressing polymorphic CD8{alpha} molecules. To this end, we raised the mAb 11-13, which recognized CD8{alpha} of T cells from H.B15.H12 (H12) chickens, but not from congenic H.B15.H7 (H7) chickens (Fig. 2GoA). Immunoprecipitation using mAb 11-13 on H12 allotypic thymocytes showed CD8{alpha} bands on SDS-PAGE apparently identical with those found using mAb 11-39. The mAb 11-39 recognizes CD8{alpha} from all allotypic chicken strains (Fig. 2GoB). When COS cells were transfected with CD8{alpha} cDNA from either animal strain, the allotypic mAb 11-13 specifically recognized cells transfected with CD8{alpha} from H12 animals (Fig. 2GoC), whereas mAb 11-39 recognized both (not shown). These two mAbs were used to distinguish transferred donor H12 CD8{alpha} T cells in the intestine of H7 recipients from host H7 CD8{alpha} cells.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 2. Identification of two chicken strains congenic for the CD8 {alpha}-chain. H.B15.H7 and H.B15.H12 strains express different CD8{alpha} alleles. A, Cytofluorometry of adult H7 and H12 chicken thymocytes using anti-CD8{alpha} Abs 11-13 and 11-39. Note that Ab 11-13 does not recognize CD8{alpha} on thymocytes of H7 animals. B, mAbs 11-13 and 11-39 immunoprecipitate the CD8 {alpha}-chain. The thymocytes of a 3-wk-old H12 chicken were 125I labeled. The lysate was precipitated with mAbs 11-13 and 11-39. Immunoprecipitates were analyzed by SDS-PAGE on a 10% gel under reducing conditions. The molecular mass standards are indicated on the left. C, mAb 11-13 recognizes the allotypic CD8 {alpha}-chain. COS-7 cells were transfected with pCDM8 plasmids carrying CD8{alpha} from the inbred chicken lines H.B15.H7 (a) or H.B15.H12 (b), respectively. The cells were then stained with the CD8{alpha} allotypic mAb 11-13. Only H12 CD8 was recognized. Staining of the cells with mAb 11-39 served as a positive control. Abs were detected with HRP-conjugated rabbit anti-mouse-Ig.

 
Colonization of the chicken gut by T lymphocytes starts during embryogenesis at around E14–E17. On E14 about 25% of all thymocytes express TCR{gamma}{delta}, and <3% show TCR{alpha}ß. Injection of sorted TCR{gamma}{delta}+ E14 thymocytes into E16 recipients resulted in the colonization of the intestinal epithelium by these TCR{gamma}{delta} cells (14). In contrast, injected TCR{gamma}{delta}- thymocytes did not migrate to the gut epithelium (14). To follow the origin of CD8{alpha}{alpha} IELs, we then injected 2 x 107 E14 thymocytes of H12 embryos into E16 embryos of the H7 haplotype. After 18 days, iIELs were harvested from the H7 host animals and analyzed by cytofluorometry to test whether the injected thymocytes had seeded the gut epithelium. Double staining of these cells with the H12 donor-specific anti-CD8{alpha} mAb 11-13 and the anti-CD8ß mAb EP42 showed that 16.5% of all CD8+ cells were from the donor. Of these cells, 72% expressed CD8 as {alpha}{alpha} homodimers and 28% as {alpha}ß heterodimers (Fig. 3Go and Table IGo). Thus, E14 TCR{gamma}{delta}+ thymocytes are able to migrate to the intestine and differentiate into CD8+{alpha}{alpha} T cells.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. Embryonic TCR{gamma}{delta}+ CD8{alpha}{alpha}- thymocytes differentiate into TCR{gamma}{delta}+ CD8{alpha}{alpha}+ iIELs. E14 H12 thymocytes (2 x 107) were injected i.v. into E16 H7 recipient embryos. The iIELs were analyzed 18 days after injection by cytofluorometry. CD8{alpha}{alpha}+ donor cells were detected by Ab 11-13, which specifically recognizes the H12 CD8 {alpha}-chain (donor). Total CD8{alpha}+ iIELs, including both host and donor cells from the same animal, were detected with Ab 11-39 recognizing donor and host CD8{alpha}+ cells (Total). Quantification of CD8{alpha}{alpha} and CD8{alpha}ß cells was performed by double staining using anti-CD8ß-chain Ab EP42. The figure shows representative data from one animal of six. TCR{gamma}{delta}+ iIELs derive from TCR{gamma}{delta}+ thymocytes (14 ), and most donor CD8{alpha}{alpha}+ iIELs were TCR{gamma}{delta} positive (not shown). The numbers in the graph indicate percentages.

 

View this table:
[in this window]
[in a new window]
 
Table I. Chimerism of iIEL obtained 18 days after injection of E14 thymocytes into E16 congenic animals

 
Juvenile TCR{alpha}ß+ thymocytes differentiate into CD8+{alpha}{alpha} T cells in the intestinal epithelium

The thymus of a 2-day-old chick contains about 60% TCR{alpha}ß+ cells (38, 39). To test whether TCR{alpha}ß+ thymocytes from 2-day-old animals could migrate to the intestinal epithelium and differentiate into CD8{alpha}{alpha} T cells, we performed thymocyte transfer by injecting 2 x 107 cells from H12 chicks into age-matched H7 congenic animals. Injected TCR+ thymocytes differentiated into CD8{alpha}{alpha} T cells in the gut, while injected TCR- thymocytes did not (Fig. 4GoA).The analysis of intestinal TCR{alpha}ß+ IELs 18 days after transfer showed that 8.0% of all CD8{alpha}{alpha} cells and 6.2% of all CD8{alpha}ß+ were from the donor (average of two animals; Fig. 4GoB). This experiment demonstrated that in young chicks TCR{alpha}ß+ T cells can colonize the intestinal epithelium and are able to differentiate into CD8{alpha}{alpha} IELs. We then wondered whether CD8{alpha}{alpha} and CD8{alpha}ß T cells of these 20-day-old chicks presented different TCR{alpha}ß repertoires.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 4. Differentiation of thymocytes into CD8{alpha}{alpha} iIELs. Total or TCR-negative thymocytes of 2-day-old H12 chicks were injected into age-matched H7 recipients. TCR- thymocytes represented 24% of the total thymocytes. Consequently, to compare total and TCR- thymocyte progenies, 20 x 106 total thymocytes or 5 x 106 TCR- thymocytes were injected into each recipient. Donor CD8{alpha} iIELs were analyzed by flow cytometry using the 11-13 mAb specific for the H12 CD8 {alpha}-chain and the EP42 mAb specific for the CD8 ß-chain. A, TCR-negative thymocytes do not differentiate into CD8{alpha}{alpha} iIELs. Total, H7 recipients injected with total thymocytes; TCRneg, H7 recipients injected with TCR- thymocytes; Control, control recipients. The figure shows representative data from one animal of six for total thymocyte injections and one animal of three for TCR- thymocyte injections. The numbers in the graph indicate percentages. B, Donor thymocytes give rise to TCR{alpha}ß+, CD{alpha}{alpha}+ iIELs. H7 recipients injected with total thymocytes were analyzed 18 days later for TCR{alpha}ß+ IELs. Left, Donor CD8{alpha} vs CD8ß; right, total (donor plus host) CD8{alpha} vs CD8ß. This experiment was performed with two animals, and similar data were observed following transfer of E14 into E16 embryos.

 
Comparison of the TCRß repertoire of CD8{alpha}{alpha} and CD8{alpha}ß intestinal T cells

To examine the TCRß repertoire, we used semiquantitative PCR, employing a 3' primer specific for Cß and a 5' primer specific for Vß1, to amplify the Vß1 regions expressed in intestinal CD8{alpha}{alpha} and CD8{alpha}ß IELs from a 20-day-old chick. Vß2 regions were not analyzed, because Vß2-positive iIELs are rarely found (23), as confirmed at the RNA level (16). The number of TCR Vß1-positive cells is higher in the CD8{alpha}ß than in the CD8{alpha}{alpha} iIEL population (Fig. 5Go). This could reflect the fact that TCR{gamma}{delta} intestinal cells are better represented in the CD8{alpha}{alpha} than in the CD8{alpha}ß population. More than 30 Vß1 cDNA clones from CD8 {alpha}{alpha} and {alpha}ß intestinal intraembryonic T cells were sequenced (Fig. 6Go).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. Expression of TCR Vß1 transcripts. Identification of Vß1-Dß-Jß-Cß transcripts by PCR amplification. Actin expression was used as the parameter to standardize cDNA levels and for semiquantitative analysis. The templates were prepared from sorted CD8{alpha}{alpha} or CD8{alpha}ß iIELs of a single 20-day-old H.B19 chick. After 32 PCR cycles of cDNA amplification, the products were separated by electrophoresis, stained with ethidium bromide, and photographed. M, Mr marker; C, negative control PCR using water as template.

 


View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 6. Comparison of the TCR Vß1 repertoire between CD8{alpha}{alpha} and CD8{alpha}ß iIELs. The cDNA was prepared from iIELs of a single 20-day-old H.B19 chick and sorted for CD8{alpha}{alpha} or CD8{alpha}ß expression. Nucleotide sequences are shown for the Vß1-Dß-Jß junctions. The sequences of Vß1, Dß, and Jß segments are given for individual clones. The sequence of N and P nucleotides are indicated as N/P. All sequences that were found in-frame are indicated (+). The identification number for each Vß1 and Jß clone is indicated to the right of the figure (16 ). The clones that were encountered several times in the repertoire are also indicated in a column (NUMBER). A, TCRß1 repertoire of CD8{alpha}{alpha} iIELs. B, TCR Vß1 repertoire of CD8{alpha}ß iIELs

 
To compare the TCRß repertoire of CD8{alpha}{alpha} and CD8{alpha}ß cells with previous data, we performed a series of experiments with the chicken strain H.B19 (16, 22, 25). A single animal expressed eight members of the Vß1 family, confirming our former hypothesis that the H.B19 strain is not homogenous at the TCRß locus, as 17 Vß1 members were previously identified in 13 animals (16). The different Vß1 genes in the CD8{alpha}{alpha} or -{alpha}ß cell populations were expressed with comparable distribution (Table IIGo). However, in this animal we cannot ignore the apparent absence of Vß1.8b in the CD8{alpha}{alpha} population or the lower usage of Vß1.15a in the CD8{alpha}ß population. Similarly, the usage of the Jß segments showed subtle differences among the two IEL populations (Table IIIGo). The total CD8+, TCR Vß1 IELs preferentially rearranged Jß-1340 compared with CD4+, TCR Vß1 IELs. Furthermore, the CD8{alpha}ß IELs presented lower usage of Jß-1280 segments and more Jß-1336 than the CD8{alpha}{alpha} IELs. This was later confirmed by PCR using the Jß-1280-specific and Cß-specific primers (not shown).


View this table:
[in this window]
[in a new window]
 
Table II. Vß1 usage in rearranged Vß1 genesa

 

View this table:
[in this window]
[in a new window]
 
Table III. Jß usage in rearranged Vß1 genesa

 
Analysis of additional animals also revealed subtle TCRß1 repertoire differences. However, these differences varied from one animal to the other (data not shown). Notably, Jß-1280 was frequently used in the CD8{alpha}{alpha} population of animal 3, and Vb1.8b was used in CD8{alpha}{alpha} population of two animals. Analysis of junctional diversity did not reveal oligoclonality in either CD8 cell population. However, diversity appeared to be slightly larger in CD8{alpha}ß than in CD8{alpha}{alpha} cells, as suggested by the number of independent clones sequenced, 28 clones for CD8{alpha}ß cells and 22 clones for CD8{alpha}{alpha} cells of 31 clones each. Taken together, these results suggest that CD8{alpha}{alpha} and CD8{alpha}ß IELs express TCR Vß1 repertoires with subtle differences. More precisely they indicate that CD8{alpha}ß cells exhibit a slightly larger repertoire than CD8{alpha}{alpha} cells, in accordance with the total number of TCR Vß1 transcripts in both populations (Fig. 6Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study describes the thymic origin of the majority of CD8{alpha}{alpha} iIELs in birds. It is discordant with some of the results obtained with adult mice, in which CD8{alpha}{alpha} TCR{alpha}ß+ and TCR{gamma}{delta}+ lymphocytes are considered to be primarily of extrathymic origin (1, 2). However, several studies suggest that a subset of both TCR{alpha}ß and TCR{gamma}{delta} murine CD8{alpha}{alpha} iIELs is derived from the fetal/neonatal thymus (5, 6, 7, 8). In cell transfer experiments using congenic chickens, neither embryonic nor adult thymus contained CD8{alpha}{alpha} cells, while injection of TCR{alpha}ß+ or {gamma}{delta}+ thymocytes into congenic animals gave rise to CD8{alpha}{alpha} iIELs. The intestinal intraembryonic CD8{alpha}{alpha} TCR+ cells seem to emerge by a secondary T cell differentiation event and present a TCR repertoire different from that of CD8{alpha}ß T cells.

Do TCR+ cells from the thymus acquire CD8{alpha}{alpha} in the gut? We found that only thymocytes that expressed the TCR would migrate to the gut. Embryonic TCR-negative thymocytes, embryonic bone marrow and spleen cells do not migrate to the gut (14, 16). Most of our former experiments were performed with embryonic thymocytes injected into embryonic or juvenile recipients. Here we show that donor cells from juvenile thymus also need to express the TCR to home to the gut. An open question was whether these cells could acquire CD8 in the thymus or whether this would happen in the gut. Of 2 x 108 thymocytes analyzed, we did not detect a single CD8{alpha}{alpha}-positive cell, indicating that the expression of this molecule is dependent on the gut microenvironment. However, due to technical limits we cannot exclude that some CD8{alpha}{alpha} IELs derive from CD8{alpha}{alpha} thymocytes.

Do CD8{alpha}{alpha} thymus-derived T cells show normal characteristics? Most TCR{gamma}{delta} cells in the thymus and peripheral lymphoid organs are CD4- CD8- (40, 41). In gut epithelium the majority of the TCR{gamma}{delta} cells express CD8 as {alpha}{alpha} homodimeric chains. Our former and present experiments show that in young animals these cells derive from the thymus. Because most of them did not express CD8 before they left the thymus, they may have undergone a secondary differentiation and selection process in the gut. However, this gives rise to the problem of expansion of potential self-reacting CD8+ T cells. Does an MHC class I-restricted negative selection occur in the gut, or do MHC class I recognizing inhibitory receptors exist on iIELs, leading to inactivation of self-reacting CD8+ T cells? In fact, both these mechanisms seem to exist simultaneously in the gut as represented either by classical T cells (CD8{alpha}{alpha} or {alpha}ß) or by CD8{alpha}{alpha} cells bearing molecules that are characteristic of NK cells. Either cell type could receive inhibitory signals for proliferation upon interaction with MHC (11, 42). Therefore, while CD8{alpha}{alpha} T cells in the gut are thymus derived, those that have circumvented negative selection in the thymus have an alternative selection mechanism in the gut.

A previous report indicated that colonization of the intestine by thymocytes was not related to TCR Vß1 repertoire selection (16). Here we show that the CD8+ TCR Vß1+ iIELs do not represent the entire TCR Vß1 repertoire of iIELs as exhibited by the different usage of Jß-1340 and Vß1.8b in this subpopulation. Further analysis suggested that the repertoires expressed by the CD8{alpha}{alpha} and CD8{alpha}ß iIEL populations are different. Thus, each TCR{alpha}ß subpopulation exhibits a part of the TCR{alpha}ß repertoire of all iIELs. These results are somewhat in agreement with murine studies indicating that CD8{alpha}{alpha} and CD8{alpha}ß TCR{alpha}ß iIEL populations are oligoclonal with no overlap between the two subsets (16). The structure of the TCRß locus is different in birds and mice. Only two Vß families are found in the chicken (18), whereas 20 Vß families are described in the mouse (43, 44). At first sight, repertoire analysis would seem to be easier in mice, because Abs against the different families are readily available. However, the study of the diversity within each family would require a large number of clones. Due to the relative simplicity of the Vß repertoires in chicken, this endeavor can be performed with fewer clones. In addition, chicken Vß2 cells are extremely rare in the intestine, making analysis of this family unnecessary.

By sequencing the isolated Vß1 clones, we found all TCR Vß1 members in the two CD8+ iIEL subpopulations. This suggests that all resulting TCRs may recognize gut Ags. Although the CDR3 size is constant in each CD8 iIEL subpopulation in chicken and mouse, our data show that the diversity of the TCRß repertoire of CD8 iIELs is larger in chicken than in mouse. Our previous studies in chick embryos indicated that thymocytes migrating to the gut contained the entire TCR Vß1 repertoire (16). Here, we also show that no Vß1 member, Jß segment, or Vß1-Dß-Jß rearrangement is expressed solely in CD8{alpha}{alpha} iIELs. The presence of a low frequency of nonproductive TCR Vß1 rearrangements in CD8 iIEL subpopulations indicates an active negative or positive TCR selection process in the gut, similar to the establishment of locally restricted repertoires in the mouse (45).


    Acknowledgments
 
We thank Mark Dessing, Viktor Hasler, Barbara Ecabert, Mika Korkeamäki, and Pascale Vigneron for excellent technical assistance, and Dr. Dheepika Weerasinghe for critical reading and improvement of the manuscript.


    Footnotes
 
1 This work was supported by the Association pour la Recherche contre le Cancer, the Human Frontier Science Program Organization (HFSP-RG 366/96), the Fondation pour la Recherche Scientifique, the Ministère de l’Éducation Nationale de la Recherche et de la Technologie (ACC-SV4), the Centre National de la Recherche Scientifique, the Swiss National Science Foundation (Grant 3100-059173), the Turku University Foundation, and the Academy of Finland. Back

2 B.A.I. and D.D. contributed equally to this study. Back

3 Address correspondence and reprint requests to Dr. Beat A. Imhof, Department of Pathology, Geneva University, Centre Médical Universitaire, rue Michel Servet 1, CH-1211 Geneva, Switzerland. Back

4 Abbreviations used in this paper: IEL, intraepithelial lymphocyte; iIEL, intestinal IEL; E14, embryonic day 14. Back

Received for publication June 5, 2000. Accepted for publication September 11, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Poussier, P., M. Julius. 1994. Intestinal intraepithelial lymphocytes: the plot thickens. J. Exp. Med. 180:1185.[Free Full Text]
  2. Rocha, B., D. Guy-Grand, P. Vassali. 1995. Extrathymic T cell differentiation. Curr. Opin. Immunol. 7:235.[Medline]
  3. Lefrançois, L., L. Puddington. 1995. Extrathymic intestinal T-cell development: virtual reality?. Immunol. Today 16:16.[Medline]
  4. Lefrançois, L., S. Olson. 1997. Reconstitution of the extrathymical T cell compartment in the absence of irradiation. J. Immunol. 159:538.[Abstract]
  5. Lefrancois, L., S. Olson. 1994. A novel pathway of thymus-directed T lymphocyte maturation. J. Immunol. 153:987.[Abstract]
  6. Lin, T., G. Matsuzaki, H. Kenai, K. Nomoto. 1994. Progenies of fetal thymocytes are the major source of CD4-CD8+ {alpha}{alpha} intestinal intraepithelial lymphocytes early in ontogeny. Eur. J. Immunol. 24:1785.[Medline]
  7. Lin, T., G. Matsuzaki, H. Kenai, K. Kishihara, S. Nabeshima, W. P. Fung-Leung, T. W. Mak, K. Nomoto. 1994. Characteristics of fetal thymus-derived T cell receptor {gamma}{delta} intestinal intraepithelial lymphocytes. Eur. J. Immunol. 24:1792.[Medline]
  8. Lin, T., G. Matsuzaki, H. Yoshida, H. Kenai, K. Omoto, M. Umesue, C. Singaram, K. Nomoto. 1996. Thymus ontogeny and the development of TCR {alpha}ß intestinal intraepithelial lymphocytes. Cell Immunol. 171:132.[Medline]
  9. Arstila, T., T. P. Arstila, S. Calbo, F. Selz, M. Malassis-Seris, P. Vassalli, P. Kourilsky, D. Guy-Grand. 2000. Identical T cell clones are located within the mouse gut epithelium and lamina propia and circulate in the thoracic duct lymph. J. Exp. Med. 191:823.[Abstract/Free Full Text]
  10. Göbel, T., C. Chen, M. Cooper. 1996. Avian natural killer cells. Curr. Top. Microbiol. Immunol. 212:107.[Medline]
  11. Guy-Grand, D., B. Cuenod-Jabri, M. Malassis-Seri, P. Vassalli. 1996. Complexity of the mouse gut T cell immune system: identification of two distinct natural killer T cell intraepithelial lineages. J. Immunol. 26:2248.
  12. Guy-Grand, D., J. DiSanto, P. Henchoz, M. Malassis-Seris, P. Vassali. 1998. Small bowel enteropathy: role of intraepithelial lymphocytes and of cytokines (IL-12, IFN-{gamma}, TNF) in the induction of epithelial cell death and renewal. Eur. J. Immunol. 28:730.[Medline]
  13. Hein, W. R., L. Dudler, B. Morris. 1990. Differential peripheral expansion and in vivo antigen reactivity of {alpha}ß and {gamma}{delta} T cells emigrating from the early lamb thymus. Eur. J. Immunol. 20:1805.[Medline]
  14. Dunon, D., M. D. Cooper, B. A. Imhof. 1993. Thymic origin of embryonic intestinal {gamma}/{delta} T cells. J. Exp. Med. 177:257.[Abstract/Free Full Text]
  15. Dunon, D., M. D. Cooper, B. A. Imhof. 1993. Migration patterns of thymus-derived {gamma}{delta} T cells during chicken development. Eur. J. Immunol. 23:2545.[Medline]
  16. Dunon, D., J. Schwager, J. Dangy, M. Cooper, B. Imhof. 1994. T cell migration during development: homing is not related to TCR Vß1 repertoire selection. EMBO J. 13:808.[Medline]
  17. Dunon, D., B. Imhof. 1996. T cell migration during ontogeny and T cell repertoire generation. Curr. Top. Microbiol. Immunol. 212:79.[Medline]
  18. Chen, C., A. Six, T. Kubota, S. Tsuji, F. Kong, T. Göbel, M. Cooper. 1996. T cell receptors and T cell development. Curr. Top. Microbiol. Immunol. 212:37.[Medline]
  19. Tjoelker, L., L. Carlson, K. Lee, J. Lahti, W. McCormack, J. Leiden, C. Chen, M. Cooper, C. Thompson. 1990. Evolutionary conservation of antigen recognition: the chicken T-cell receptor ß chain. Proc. Natl. Acad. Sci. USA 87:7856.[Abstract/Free Full Text]
  20. McCormack, W., L. Tjoelker, G. Stella, C. Postema, C. Thompson. 1991. Chicken T-cell receptor ß-chain diversity: an evolutionarily conserved Db-encoded glycine turn within the hypervariable CDR3 domain. Proc. Natl. Acad. Sci. USA 88:7699.[Abstract/Free Full Text]
  21. Six, A., J. Rast, W. McCormack, D. Dunon, Y. Courtois, C. Li, C. Chen, M. Cooper. 1996. Characterization of avian T cell receptor {gamma} genes. Proc. Natl. Acad. Sci. USA 93:15329.[Abstract/Free Full Text]
  22. Dunon, D., D. Courtois, O. Vainio, A. Six, C. Chen, M. Cooper, J. Dangy, B. Imhof. 1997. Ontogeny of the immune system: {gamma}{delta} and {alpha}ß T cells migrate alternatively to the periphery in alternating waves. J. Exp. Med. 186:977.[Abstract/Free Full Text]
  23. Char, D., P. Sanchez, C. L. Chen, R. P. Bucy, M. D. Cooper. 1990. A third sublineage of avian T cells can be identified with a T cell receptor-3-specific antibody. J. Immunol. 145:3547.[Abstract]
  24. Bucy, R. P., C. H. Chen, J. Cihak, U. Lösch, M. D. Cooper. 1988. Avian T cells expressing {gamma}{delta} receptors localize in the splenic sinusoids and the intestinal epithelium. J. Immunol. 141:2200.[Abstract]
  25. Dunon, D., J. Schwager, J. Dangy, B. Imhof. 1995. Ontogeny of TCR Vß1 expression revealed novel invariant alternative transcripts. J. Immunol. 154:1256.[Abstract]
  26. Coltey, M., F. V. Jotereau, N. M. Le Douarin. 1987. Evidence for a cyclic renewal of lymphocyte precursor cells in the embryonic chick thymus. Cell Differ. 22:71.[Medline]
  27. Coltey, M., R. P. Bucy, C. H. Chen, J. Cihak, U. Lösch, D. Char, N. M. Le Douarin, M. D. Cooper. 1989. Analysis of the first two waves of thymus homing stem cells and their T cell progeny in chick-quail chimeras. J. Exp. Med. 170:543.[Abstract/Free Full Text]
  28. Luhtala, M., J. Salomonsen, Y. Hirota, T. Onodera, P. Toivanen, O. Vainio. 1993. Analysis of chicken CD4 by monoclonal antibodies indicates evolutionary conservation between avian and mammalian species. Hybridoma 12:633.[Medline]
  29. Luhtala, M., R. Koskinen, P. Toivanen, O. Vainio. 1995. Characterization of chicken CD8-specific monoclonal antibodies recognizing novel epitopes. Scand. J. Immunol. 42:171.[Medline]
  30. Luthala, M., C. Tregaskes, J. Young, O. Vainio. 1997. Polymorphism of chicken CD8-{alpha} but not CD8-ß. Immunogenetics 46:396.[Medline]
  31. Vainio, O., T. V. Veromaa, E. Eerola, P. Toivanen. 1987. Characterization of two monoclonal antibodies against chicken T lymphocytes surface antigen. W. T. Weber, and D. L. Ewert, eds. Avian Immunology 99. Alan R. Liss, New York.
  32. Luhtala, M., R. Koskinen, P. Toivanen, O. Vainio. 1995. Characterization of chicken CD8-specific monoclonal antibodies recognizing novel epitopes. Scand. J. Immunol. 42:171.
  33. Young, J. R., T. F. Davison, C. A. Tregaskes, M. C. Rennie, O. Vainio. 1994. Monomeric homologue of mammalian CD28 is expressed on chicken T cells. J. Immunol. 152:3848.[Abstract]
  34. Dunon, D., O. Vainio, B. Imhof. 1997. Lymphocyte migration in vivo: the chicken embryo model. I. Lefkovits, ed. Immunology Methods Manual 1345.-1352. Academic Press, London.
  35. Sambrook, J., E. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  36. Keller, G., M. Kennedy, T. Papayannopoulo, M. Wiles. 1993. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol. Cell. Biol. 13:473.[Abstract/Free Full Text]
  37. Kost, T., N. Theodorakis, S. Hughes. 1983. The nucleotide sequence of the chick cytoplasmic beta-actin gene. Nucleic Acids Res. 11:8287.[Abstract/Free Full Text]
  38. Cihak, J., H. W. S. Ziegler-Heitbrock, H. Trainer, I. Schranner, M. Merkenschlager, U. Lösch. 1988. Characterization and functional properties of a novel monoclonal antibody which identifies a T cell receptor in chickens. Eur. J. Immunol. 18:533.[Medline]
  39. Bucy, R. P., C. L. Chen, M. D. Cooper. 1990. Ontogeny of T cell receptors in the chicken thymus. J. Immunol. 144:1161.[Abstract]
  40. Cooper, M., C. Chen, R. Bucy, C. Thompson. 1991. Avian T cell ontogeny. Adv. Immunol. 50:87.[Medline]
  41. Haas, W., P. Pereira, S. Tonegawa. 1993. {gamma}/{delta} cells. Annu. Rev. Immunol. 11:637.[Medline]
  42. Dohring, C., M. Colonna. 1997. Major histocompatibility complex (MHC) class I recognition by natural killer cells. Crit. Rev. Immunol. 17:285.[Medline]
  43. Schiffer, M., T. Wu, E. Kabat. 1986. Subgroups of variable region genes of ß chains of T cell receptors for antigen. Proc. Natl. Acad. Sci. USA 83:4461.[Abstract/Free Full Text]
  44. Bougueleret, L., J.-M. Claverie. 1987. Variability analysis of the human and mouse T cell receptor ß chains. Immunogenetics 26:304.[Medline]
  45. Badiner, G., T. Goodman, L. Lefrançois. 1993. Selection of intraepithelial lymphocyte T cell receptors: evidence for a dynamic tissue-specific process. Int. Immunol. 5:223.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
X. Tang, I. Maricic, and V. Kumar
Anti-TCR Antibody Treatment Activates a Novel Population of Nonintestinal CD8{alpha}{alpha}+TCR{alpha}beta+ Regulatory T Cells and Prevents Experimental Autoimmune Encephalomyelitis
J. Immunol., May 15, 2007; 178(10): 6043 - 6050.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Konno, K. Okada, K. Mizuno, M. Nishida, S. Nagaoki, T. Toma, T. Uehara, K. Ohta, Y. Kasahara, H. Seki, et al.
CD8alpha alpha memory effector T cells descend directly from clonally expanded CD8alpha +beta high TCRalpha beta T cells in vivo
Blood, December 1, 2002; 100(12): 4090 - 4097.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Imhof, B. A.
Right arrow Articles by Vainio, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Imhof, B. A.
Right arrow Articles by Vainio, O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS