| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
CUTTING EDGE |
*
Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine; and
Department of Periodontology, School of Dentistry, Aichi-Gakuin University, Nagoya, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production and NF-
B activation. Additionally, in mouse
macrophages, LPS increased the mRNA for smTLR4. Taken together, our
results indicate that smTLR4 may function as a feedback mechanism to
inhibit the excessive LPS responses in mouse
macrophages. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B
(1, 2). Also, recent reports including ours have indicated
that a fraction of T cells respond to LPS by acquiring Th1-like
phenotypes (3, 4, 5). Toll, first identified in Drosophila (6), participates in antimicrobial immune responses (7). Several mammalian Toll homologs have recently been identified (8). In addition to their cytoplasmic domains homologous to IL-1 receptor family proteins (6), they also share leucine-rich repeats (LRRs)3 in the extracellular region. One of the mammalian Toll homologs, Toll-like receptor (TLR)2, was shown to function as an LPS signaling receptor (5, 9, 10). However, more recent studies found TLR4 gene in the chromosomal region responsible for the defective LPS responses in some mouse strains (lps) (11, 12). These studies also found independent mutations in the TLR4 genes of two LPS-hyporesponsive mouse strains (C3H/HeJ and C57BL10/ScCr), strongly suggesting that TLR4 is the dominant receptor for LPS in vivo.
In our current study, we report the molecular cloning of an
alternatively spliced mouse TLR4 (mTLR4) mRNA form, encoding 122 aa.
When expressed in Chinese hamster ovary (CHO)-K1 cells, this protein
was partly secreted into the culture medium, thus named soluble mTLR4
(smTLR4). Exogenous expression of smTLR4 in a mouse macrophage cell
line inhibited LPS-mediated TNF- production and NF-B activation.
Additionally, LPS stimulation increased the smTLR4 mRNA level,
suggesting that smTLR4 might be induced as a feedback mechanism to
inhibit the excessive LPS responses in mouse macrophages.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
LPS from Escherichia coli serotype B6:026, FCS, and the anti-Flag M2 mAb were obtained from Sigma (St. Louis, MO). A mouse T cell line, EL-4, and CHO-K1 were obtained from the American Type Culture Collection (ATCC, Manassas, VA). A mouse macrophage cell line, RAW264.7, was obtained from RIKEN cell bank (Tsukuba, Japan).
Isolation of the full-length cDNA clone encoding smTLR4
In an effort to clone the mTLR4 cDNA, a 500-bp DNA probe was generated by RT-PCR corresponding to the 5' region of published TLR4 DNA starting from the translational initiation site using the total RNA from a mouse macrophage cell line, J774.1, as a template. The synthesized cDNA fragment was 32P-labeled by random priming and used for screening a J774.1 cDNA library constructed in the Uni-Zap cloning vector (Stratagene, La Jolla, CA), provided by Dr. H. Yagita (Juntendo University, Tokyo, Japan). Plaque hybridization was conducted as previously described (5). The inserts of the positive phage clones were excised using the Rapid Excision Kit (Stratagene) and recloned in the pBlueScript vector (Stratagene). DNA sequence analysis was performed on these plasmids using a DNA sequencer (model 373A; Perkin-Elmer Biosystems, Foster City, CA) and a Thermo Sequence cycle sequencing kit (Perkin-Elmer Biosystems).
Expression plasmids
For the Flag-tagged smTLR4 expression plasmid, the coding region of smTLR4 was amplified by PCR from the isolated alternatively spliced mTLR4 cDNA and cloned into the AscI site of the expression plasmid, pEFBOS-Flag, which encodes a C-terminal Flag epitope (5).
Transient transfection
CHO-K1 or RAW cells were plated onto 35-mm plates at 1 x 106 cells/plate on the day before transfection. Combinations of expression plasmid DNAs (2 µg total/plate) were transfected using Lipofectamine (Life Technologies, Grand Island, NY). Cells were used for further analysis at 48 h after transfection.
RT-PCR and Northern blot analysis
Total cellular RNA was prepared using TRIZOL reagent (Life Technologies). cDNA was synthesized from 2 µg of total RNA by extension of random primers with 200 U of Superscript II (Life Technologies). PCR of the synthesized cDNA was performed as previously described (5). The synthesized PCR products were separated by electrophoresis on a 2% agarose gel and visualized by ethidium bromide staining. The primers were: mouse ß-actin sense, TGGAATCCTGTGGCATCCATGAAAC; ß-actin anti-sense, TAAAACGCAGCTCAGTAACAGTCCG; mTLR4 sense, AGTGGGTCAAGGAACAGAAGCA; mTLR4 anti-sense, CTTTACCAGCTCATTTCTCACC; alternatively spliced mTLR4 sense, TTATCCAGGAGCATGATA; anti-sense, TCACACCATTTTCCTTTA. The primers for the alternatively spliced mTLR4 are directed to the junction of the reported second exon/the alternative exon and the alternative exon/the reported third exon, respectively, and were confirmed not to synthesize PCR products from the mouse genomic DNA.
For Northern blot analysis, messenger RNA was isolated from total RNA using the mRNA Isolation Kit (Roche Molecular Biochemicals). RNA blotting was conducted as previously described (5).
Cell extract preparation and immunoblotting
Cells were lysed in RIPA lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1.0% Nonidet P-40, 0.5% deoxycholic acid, 0.1% SDS, 1 mM Na3VO4, 1 mM PMSF, 10 mg/ml aprotinin, 10 mg/ml leupeptin) at 108 cells/ml. The lysates were analyzed by immunoblotting as previously described (5).
Immunoprecipitation
Supernatants were collected from CHO-K1 cells transiently transfected with pEFBOS-Flag or pEFBOS-smTLR4/Flag. smTLR4/Flag was immunoprecipitated with the anti-Flag M2 mAb and protein G-Sepharose beads (Amersham Pharmacia Biotech, Piscataway, NJ) before analysis by immunoblotting.
Subcellular localization of smTLR4
CHO-K1 cells were transiently transfected with pEFBOS-smTLR4/Flag as described above. At 48 h posttransfection, the cytosolic and membrane fractions were isolated as previously described (13).
Cytokine ELISA
RAW264.7 cells transiently transfected with pEFBOS-Flag or
pEFBOS-smTLR4/Flag were cultured with LPS for 24 h. Production of
TNF- in the supernatant was measured by a TNF- ELISA system
(Genzyme, Boston, MA), and the data were presented as the mean ±
SD of triplicate samples.
Luciferase assays
Raw264.7 cells were transiently transfected with 0.8 µg of
pGL3-NF-B/Luc (a luciferase reporter construct containing the
consensus NF-B binding sequence), 0.2 µg of pRL/SV40 as an
internal control (Promega, Madison, WI), and either 1.0 µg
pEFBOS-Flag or pEFBOS-smTLR4/Flag. At 48 h after the transfection,
cells were stimulated with LPS for 8 h, lysed, and the luciferase
activity was measured by the Dual-Luciferase Reporter Assay System
(Toyo Ink, Tokyo, Japan) according to the manufacturer’s instructions.
Background luciferase activity was subtracted, and the data were
presented as the means ± SD of triplicate samples.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As several laboratories have reported (28) multiple
mRNA isoforms were detected for mTLR4 in the Northern blot analysis
(Fig. 1
A). For the purpose of
identifying mTLR4 mRNA isoforms, a mouse macrophage cDNA library was
screened with a 0.5-kb probe directed to the 5' region of the published
mTLR4 cDNA. Three independent clones were isolated from 8 x
105 plaques and analyzed by DNA sequencing. Two
of the clones exactly matched the published mTLR4 cDNA sequence,
whereas the other had a 144-bp insertion between the reported second
and third exon sequences (Fig. 1B). This 144-bp sequence was
found in the reported mTLR4 genomic DNA (accession number AF177767) and
matched the AG/GT rule suggesting that it was produced by the
alternative splicing. This novel exon contains an in-frame stop codon
at 110 bp (Fig. 1C).
|
Regulation of the alternatively spliced TLR4 mRNA expression in mouse macrophages and T cells
To analyze the effects of LPS on the TLR4 alternatively spliced
mRNA expression, RAW264.7, a well-established mouse macrophage cell
line, was treated for 1, 2, 4, or 24 h with LPS, and total RNAs
were isolated. The expression of the alternatively spliced mRNA was
visualized by a pair of primers that both span the junctions of the
alternatively spliced exon and the published exon sequences. The total
TLR4 mRNA level was measured by a pair of primers directed to the 3'
region of the TLR4 cDNA common to the published TLR4 cDNA and the
alternatively spliced form. In the semiquantitative RT-PCR using these
two pairs of primers, LPS increased the alternatively spliced TLR4 mRNA
level within 4 h (Fig. 2A). The mRNA level remained
elevated at least until 24 h after the LPS treatment. In contrast,
no significant increase was observed in the total TLR4 mRNA level after
LPS treatment (Fig. 2A). The similar results were also
obtained with freshly isolated mouse splenic macrophages (Fig. 2A).
|
Ab, and total RNAs
were isolated. The anti-CD3 Ab treatment failed to increase the
total TLR4 mRNA level but increased the alternatively spliced mTLR4
mRNA level in both T cell lines (Fig. 2
B). Additionally,
this mRNA isoform was detected in various mouse tissues including
brain, heart, lung, kidney, liver, thymus, spleen, small intestine, and
testis (data not shown). The alternatively spliced TLR4 mRNA encodes a soluble 20-kDa protein
As the extra exon has a stop codon in frame, two open reading
frames (ORFs) were possible in the alternatively spliced TLR4 mRNA.
Thus the two putative ORFs were prepared by RT-PCR using the total RNA
prepared from a mouse macrophage cell line, J774.1, as a template, and
cloned in frame with the 3' Flag tag in the expression vector, pEFBOS
(15). These two expression plasmids were transiently
transfected into CHO-K1 cells, and protein expression was analyzed by
anti-Flag Ab. ORF (3') did not express a detectable amount of
protein, probably suggesting that the produced protein was unstable
(data not shown). In contrast, in the cells transfected with 5' ORF
expression plasmids, a 20-kDa protein was detected (Fig. 3A). This 20-kDa protein was
easily detected in the culture supernatant, suggesting that it is a
soluble protein and thus called smTLR4. Additionally, in the
subcellular localization experiment, most of this protein was detected
in the membranous compartment (Fig. 3B).
|
B activation and TNF-
production in RAW264.7 cells
To determine whether smTLR4 had any physiological functions, we
transfected RAW264.7 cells with the expression plasmid encoding smTLR4,
pEFBOS-smTLR4/Flag. Forty-eight hours after the transfection, cells
were stimulated with various concentrations of LPS for 24 h, and
the culture supernatants were collected for the measurement of TNF-.
As shown in Fig. 4A, the
expression of smTLR4 inhibited LPS-mediated TNF- production from
RAW264.7. We also analyzed LPS-mediated NF-B activation in RAW264.7
cells expressing smTLR4. An NF-B/Luc reporter plasmid was
cotransfected with the smTLR4 expression plasmid into RAW264.7 cells.
Forty-eight hours after the transfection, cells were stimulated with
LPS for 8 h and NF-B activation was measured by the luciferase
assay. As shown in Fig. 4B, the expression of smTLR4
inhibited LPS-mediated NF-B activation in RAW264.7 cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activation and TNF- secretion) in a mouse macrophage
cell line.
This alternatively spliced mTLR4 mRNA contains an in-frame stop codon
in its additional exon. In the originally reported mTLR4 mRNA, the
first, second, and most of the third exon encodes the extracellular
domain (Genebank accession number AF177767). As the additional exon is
located between the second and third exon, it results in the expression
of a protein consisting of 86 aa of the extracellular domain of the
reported mTLR4 protein and an additional 36 aa. The encoded protein has
a signal peptide but lacks the obvious transmembrane and intracellular
domains. Thus, it is assumed that it can be secreted. In fact, we could
easily detect the protein in the culture supernatant in a transient
transfection assay. However, it is of note that a significant
proportion of the protein remained in the cell lysate (Fig. 3A). The size of this protein in the cells is also 
20
kDa, suggesting it is posttranslationally modified (probably
glycosylated), and it was most localized in the membrane (Fig. 3B). Consistent with this, there is a stretch of hydrophobic
amino acids in the C-terminal region of the protein (Fig. 1C).
The extracellular segments of TLR proteins are distinctively composed
of 24–28 aa-long LRRs (8). LRRs are also found in
Drosophila homologs, Toll, and 18 wheeler (16, 17), suggesting that LRRs are functionally essential for the
Toll family proteins. Although amino acid sequence homology between
human and mouse TLR4 is higher in the cytoplasmic domains, the LRR
structure is also conserved well, suggesting that it plays a critical
role in their biological functions. We searched for conserved
alignments about smTLR4 with Block Searcher
(http://blocks.fhcrc.org/blocks/blocks search.html). Interestingly, in
addition to the LRRs common to the originally reported mTLR4, the
C-terminal amino acids that are not found in the originally reported
sequence contribute to an additional LRR signature (Fig. 1C). Thus, it is possible that smTLR4 has functions
divergent from the N-terminal region of the originally reported TLR4,
such as qualitatively or quantitatively different binding affinities.
Interestingly, in an amino acid sequence homology search, the
additional 36 aa sequence showed homology (73% positives) with the
N-terminal region of mouse PI3-kinase (14). The function
of this N-terminal region of PI3-kinase is unknown, thus the
significance of this homology remains obscure.
It was noteworthy that the overexpression of smTLR4 inhibited
LPS-mediated TNF- production and NF-B activation in a mouse
macrophage cell line, RAW264.7 (Fig. 4). Several explanations are
conceivable for this inhibitory effect. The extracellular domain of
TLR4 has been thought to interact with LPS and smTLR4 contains a part
of it, raising a possibility that it may compete for LPS binding.
However, at present, there is no strong evidence for high-affinity
interaction of LPS with any members of the Toll family. CD14 is
involved in mediating LPS responses by binding LPS with high affinity
(18). This binding seems to require a serum factor, LPS
binding protein, which is a plasma lipid transfer protein that
transfers LPS from the bacterial membrane to the LPS-binding site of
CD14. Thus, smTLR4 may interact with CD14 and/or LPS binding protein
and inhibit LPS signaling via TLR4. In the preliminary experiments, we
could not inhibit the LPS-mediated NF-B activation by the
supernatant transfer of the smTLR4-transfected cells (data not shown).
However, this does not rule out the possibility that smTLR4 exerts its
inhibitory effect after secretion, because smTLR4 may be locally highly
concentrated in the vicinity of the transfected cells.
It has also been reported that TLR4 alone is not capable of sensing the presence of LPS and works with a secretory molecule, MD-2, which can be coprecipitated with TLR4 (19). Treatment of cells with an Ab that recognizes TLR4-MD2 complex inhibited LPS signals, suggesting that MD2 is essential in mediating LPS responses (20). Thus, it is also possible that smTLR4 may inhibit TLR4-MD2 interaction that is necessary for the proper receptor complex.
Another possibility is that the inhibitory effect of smTLR4 occurs in
the membrane. Although smTLR4 can be secreted into the culture
supernatant, a significant amount of the protein was also found in the
membrane compartment (Fig. 3). smTLR4 may interact with the newly
synthesized TLR4 or CD14 in the membrane and block its signal
transduction.
As smTLR4 inhibits LPS-mediated signals and smTLR4 mRNA is induced by
LPS, it is reasonable to presume that smTLR4 works as a feedback
mechanism to inhibit the excessive LPS responses of macrophages.
Additionally, our results have demonstrated that smTLR4 mRNA level is
also increased in T cells by TCR engagement (Fig. 2B). We
have recently reported that TLR4 is expressed in T cells and may
participate to promote Th1-type differentiation in response to LPS
(5, 21). Our current data suggest that smTLR4 may also
inhibit the excessive LPS responses in T cells.
We are not presently certain how LPS regulates this alternative
splicing. Several regulatory mechanisms have been reported for the
alternative splicing that include both positive regulation by specific
factors such as TRA/TRA2 and negative regulation (exon skipping) in
which splice sites are blocked by either protein factors or secondary
RNA structure (reviewed by A. J. Lopez in Ref. 22).
Alternative splicing is a powerful and versatile regulatory mechanism
that can affect quantitative control gene expression and functional
diversification of proteins. It is reported in virtually every type of
protein including cell surface receptors (e.g., fibroblast growth
factor receptor, Ref. 23 ; and and ß subunits of
integrins, Ref. 24). The alternative splicing of mTLR4
resembles that of Sxl in Drosophila in that both of them
regulate the expression of proteins by including or excluding stop
codons (25). It also resembles that of IL-1 receptor
accessory protein (IL-1R AcP) in that both are regulated in response to
physiological cues and lead to the expression of soluble forms, which
inhibit excessive cellular responses (26, 27).
We compared mouse and human TLR4 genomic DNA (accession number
AF177765) (Fig. 5). Mouse exons 1, 2, and
3 resemble human exons 1, 2, and 4, respectively. Thus, the location of
the additional mouse exon studied here resembles that of the human
third exon, although they do not show any obvious sequence homologies.
Interestingly, the second or the third exon of the human
TLR4 gene is occasionally skipped like the additional mouse
exon. In this alternative splicing, the second exon has an in-frame
stop codon. Thus, various ORFs are possible according to the
alternatively spliced mRNA isoforms (Fig. 5). Multiple mRNA isoforms
are observed in the Northern blot analyses for both human and mouse
TLR4, indicating that TLR4 may be functionally regulated by alternative
splicing in various species.
|
secretion, a major cause of endotoxin shock, may provide an
insight into a new therapeutic approach controlling endotoxin
shock.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tetsuya Matsuguchi, Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan.
3 Abbreviations used in this paper: LRR, leucine-rich repeat; TLR, Toll-like receptor; mTLR4, mouse TLR4; smTLR4, soluble mTLR4; PI3-kinase, phosphatidylinositol 3-kinase; ORF, open reading frame; CHO, Chinese hamster ovary.
Received for publication July 21, 2000. Accepted for publication October 16, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activity in murine macrophages: effect of bacterial lipopolysaccharide and phorbol ester. J. Cell. Physiol. 150:204.[Medline]
B binding sites. J. Exp. Med. 174:1517.
production by Th1 cells. Eur. J. Immunol. 29:413.[Medline]
This article has been cited by other articles:
|
|
 |
|
  J. R. Conner, I. I. Smirnova, and A. Poltorak A mutation in Irak2c identifies IRAK-2 as a central component of the TLR regulatory network of wild-derived mice J. Exp. Med., July 6, 2009; 206(7): 1615 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.-C. Raby, E. Le Bouder, C. Colmont, J. Davies, P. Richards, B. Coles, C. H. George, S. A. Jones, P. Brennan, N. Topley, et al. Soluble TLR2 Reduces Inflammation without Compromising Bacterial Clearance by Disrupting TLR2 Triggering J. Immunol., July 1, 2009; 183(1): 506 - 517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Cerovic, C. D. Jenkins, A. G. C. Barnes, S. W. F. Milling, G. G. MacPherson, and L. S. Klavinskis Hyporesponsiveness of Intestinal Dendritic Cells to TLR Stimulation Is Limited to TLR4 J. Immunol., February 15, 2009; 182(4): 2405 - 2415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Frost and C. H. Lang Regulation of muscle growth by pathogen-associated molecules J Anim Sci, April 1, 2008; 86(14_suppl): E84 - E93. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Torgler, S. E. Bongfen, J. C. Romero, A. Tardivel, M. Thome, and G. Corradin Sporozoite-Mediated Hepatocyte Wounding Limits Plasmodium Parasite Development via MyD88-Mediated NF-{kappa}B Activation and Inducible NO Synthase Expression J. Immunol., March 15, 2008; 180(6): 3990 - 3999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Conner, I. I. Smirnova, and A. Poltorak Forward genetic analysis of Toll-like receptor responses in wild-derived mice reveals a novel antiinflammatory role for IRAK1BP1 J. Exp. Med., February 18, 2008; 205(2): 305 - 314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Whitmore, A. Iparraguirre, L. Kubelka, W. Weninger, T. Hai, and B. R. G. Williams Negative Regulation of TLR-Signaling Pathways by Activating Transcription Factor-3 J. Immunol., September 15, 2007; 179(6): 3622 - 3630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Divanovic, A. Trompette, L. K. Petiniot, J. L. Allen, L. M. Flick, Y. Belkaid, R. Madan, J. J. Haky, and C. L. Karp Regulation of TLR4 signaling and the host interface with pathogens and danger: the role of RP105 J. Leukoc. Biol., August 1, 2007; 82(2): 265 - 271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Foster, S. R. Lea, P. M. Preshaw, and J. J. Taylor Pivotal Advance: Vasoactive intestinal peptide inhibits up-regulation of human monocyte TLR2 and TLR4 by LPS and differentiation of monocytes to macrophages J. Leukoc. Biol., April 1, 2007; 81(4): 893 - 903. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Sun, P. E. Fegan, A. S. Desai, J. L. Madara, and M. E. Hobert Flagellin-induced tolerance of the Toll-like receptor 5 signaling pathway in polarized intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G767 - G778. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Masuda, K. Hashimoto, T. Yokoi, T. Doi, T. Kodama, H. Kume, K. Ohno, and T. Matsuguchi Essential Role of GATA Transcriptional Factors in the Activation of Mast Cells J. Immunol., January 1, 2007; 178(1): 360 - 368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Romics Jr, G. Szabo, J. C. Coffey, J. H. Wang, and H. P. Redmond The Emerging Role of Toll-Like Receptor Pathways in Surgical Diseases Arch Surg, June 1, 2006; 141(6): 595 - 601. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Seya, T. Akazawa, T. Tsujita, and M. Matsumoto Role of Toll-like Receptors in Adjuvant-Augmented Immune Therapies. Evid. Based Complement. Altern. Med., March 1, 2006; 3(1): 31 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Brandl, T. Gluck, P. Hartmann, B. Salzberger, and W. Falk A designed TLR4/MD-2 complex to capture LPS Innate Immunity, August 1, 2005; 11(4): 197 - 206. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Fazeli, C. Bruce, and D.O. Anumba Characterization of Toll-like receptors in the female reproductive tract in humans Hum. Reprod., May 1, 2005; 20(5): 1372 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Zijlstra, J. E. Tulleken, J. J.M. Ligtenberg, P. de Boer, and T. S. van der Werf p38-MAPK inhibition and endotoxin induced tubular dysfunction in men Innate Immunity, December 1, 2004; 10(6): 402 - 405. [Abstract] [PDF]
|
|
|
|
 |
|
 D. de Kleijn and G. Pasterkamp Toll-like receptors in cardiovascular diseases Cardiovasc Res, October 15, 2003; 60(1): 58 - 67. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. S. Van Amersfoort, T. J. C. Van Berkel, and J. Kuiper Receptors, Mediators, and Mechanisms Involved in Bacterial Sepsis and Septic Shock Clin. Microbiol. Rev., July 1, 2003; 16(3): 379 - 414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Iwaki, H. Mitsuzawa, S. Murakami, H. Sano, M. Konishi, T. Akino, and Y. Kuroki The Extracellular Toll-like Receptor 2 Domain Directly Binds Peptidoglycan Derived from Staphylococcus aureus J. Biol. Chem., June 28, 2002; 277(27): 24315 - 24320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Murakami, D. Iwaki, H. Mitsuzawa, H. Sano, H. Takahashi, D. R. Voelker, T. Akino, and Y. Kuroki Surfactant Protein A Inhibits Peptidoglycan-induced Tumor Necrosis Factor-alpha Secretion in U937 Cells and Alveolar Macrophages by Direct Interaction with Toll-like Receptor 2 J. Biol. Chem., February 22, 2002; 277(9): 6830 - 6837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Zarember and P. J. Godowski Tissue Expression of Human Toll-Like Receptors and Differential Regulation of Toll-Like Receptor mRNAs in Leukocytes in Response to Microbes, Their Products, and Cytokines J. Immunol., January 15, 2002; 168(2): 554 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Alexander and E. Th. Rietschel Invited review: Bacterial lipopolysaccharides and innate immunity Innate Immunity, June 1, 2001; 7(3): 167 - 202. [Abstract] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
