|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Adult Oncology, Dana-Farber Cancer Institute, and Department of Medicine, Harvard Medical School, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Double-stranded DNA breaks (DSBs) are generated during initiation of meiotic recombination or V(D)J recombination of Ig and TCR genes. Ionizing radiation (IR) and certain chemotherapeutic drugs also induce DSBs. Due to the instability of DSBs and disruption of the genome, highly efficient mechanisms have evolved for both recognition and repair of DSBs. Specifically, DSBs are repaired in mammalian cells primarily via nonhomologous or illegitimate recombination (3, 4), which is dependent upon Ku/DNA-dependent protein kinase (DNA-PK) (5, 6). Ku, originally identified as a target Ag in a patient with autoimmune disease (7), is an abundant nuclear protein that binds selectively to free double-stranded DNA (8). It consists of Ku70 and Ku86 subunits that bind with high affinity to altered DNA, including DSBs (9, 10). Ku is the regulatory subunit of DNA-PK and is required for DNA-PK activity (11): Ku binds to DSBs, recruits the catalytic subunit of the 460-kDa protein DNA-PKcs, and activates its kinase function (12) to phosphorylate DNA-bound proteins (13). Cells deficient in Ku86 are hypersensitive to IR in vitro, due to defects in DSB rejoining (14); conversely, transfection of human or hamster Ku86 gene into Ku86 mutant cells can restore DSB repair (15, 16, 17). Ku-deficient cells are also deficient in DNA-PK activity, further suggesting that Ku DNA-binding is required for DNA-PK activation in vivo (18). The observation that Ku86 (19, 20) or Ku70 (21) knockout mice demonstrate hypersensitivity to IR further confirms the role of Ku in DSB repair in vivo. Ku86 has also been shown to be required for normal Ig rearrangement and IgH class switch recombination (22, 23). This may be relevant in MM because chromosome translocations involving the IgH switch regions are common. In addition, Ku80 has been implicated in maintaining the integrity of the genome via suppression of chromosomal rearrangements (24).
Despite many studies with established cell lines, little is known about Ku activity and its regulation in fresh human cells and tissues. Studies in resting murine B cells showed low levels of Ku, and that Ku expression could be up-regulated by culturing the cells with CD40L and IL-4 (25). In addition, Ku was found in the cytoplasm without any identified biological function (25, 26). Altered forms of Ku86 with lesser m.w. have also been described (27, 28, 29). We have previously demonstrated ectopic localization of Ku86 in the cell membrane of human MM cells after CD40L activation (30). The Ku86 on the membrane of activated MM cells mediates both homotypic tumor cell adhesion and heterotypic adhesion of tumor cells to fibronectin and BM stromal cells. These results, coupled with the abnormalities in DNA repair and Ig gene rearrangement characteristic of human MMs, suggest that abnormalities in the Ku86 may play a role in the biology of MM.
In this study, we characterized the expression and function of Ku86 in
human MM. We demonstrate that a variant of Ku86 (Ku86v) is expressed in
freshly prepared tumor cell lysates from a majority of MM patient BM
aspirates. Immunoblotting studies show reactivity with Abs for Ku86 N
terminus, but not with Abs directed against Ku86 C terminus, suggesting
C terminus truncation. EMSA with these Abs confirmed truncation of C
terminus in Ku86v and further demonstrated decreased DNA end binding
(DEB) activity and DNA-PKcs binding, resulting in a lack of detectable
DNA-PKcs complexes and kinase activity. 5' end Ku86 transcripts are
detectable in all samples, whereas 3' end Ku86 transcripts are somehow
altered or reduced in patients expressing only Ku86v protein,
suggesting posttranscriptional modification. Finally, patient MM cells
expressing Ku86v exhibit hypersensitivity to DNA-damaging agents,
including mitomycin C, bleomycin, and
irradiation compared with
patient MM cells or normal BM (NBM) donors with normal Ku86. Therefore,
these studies provide mechanisms for both decreased DSB repair and
sensitivity to DNA damaging agents in those MM cells expressing Ku86v,
and further suggest that Ku86 in MM cells may confer relative
resistance to treatment and, therefore, represent a novel therapeutic
target.
| Materials and Methods |
|---|
|
|
|---|
BM aspirates from patients with MM (>70%
CD38+CD45RA- cells) were
collected in heparinized tubes following Institutional guidelines with
informed consent. Suspensions enriched for tumor cells were prepared by
density gradient centrifugation (Ficoll-Hypaque; Pharmacia, Uppsala,
Sweden) followed by depletion of erythrocytes and non-MM cells using
immunomagnetic bead separation (31). Briefly, cell
suspensions were incubated with a cocktail of mouse mAbs directed
against CD3 (T cells); CD11b and CD14 (monocytes); CD33 (myeloid
cells); CD45 and CD45RA (leukocyte common Ag); CD32 (Fc
RIIA); as
well as glycophorin A (erythrocytes) for 30 min in the cold room,
with constantly gentle agitation. Then, non-MM cells were removed by
incubation with goat anti-mouse IgG (Fc) Ab coupled to
immunomagnetic beads (Dynabeads M450; Dynal, Oslo, Norway). Resultant
populations were >95% MM cells
(CD38+CD45RA-) and
98%
viable, assessed by trypan blue exclusion. MM cells were also >95%
positive for CD138 or syndecan-1 (32, 33). Cells were
resuspended in complete medium (CM: RPMI 1640 media containing 10%
heat-inactivated FBS, 25 IU/ml penicillin, 25 µg/ml streptomycin, and
2 mM L-glutamine) for further analysis.
After informed consent, NBM was obtained from healthy donors at the
time of allogeneic BM harvest. Mononuclear cell suspensions separated
by Ficoll-Hypaque gradient centrifugation were resuspended in CM
(1 x 106 cells/ml) and incubated in tissue
culture flasks for 1 h at 37°C. Monocytes were removed by
adherence, and the resultant lymphocyte cell suspensions contained
0.5% CD14+ cells with >95% viability. They
were immediately used as controls for further analysis, as described
below.
Cell culture
Cell lines (CESS, Jurkat, 293) (American Type Culture Collection, Manassas, VA) were grown at 37°C in CM. IR was performed at room temperature using a Gammacell-1000 (Atomic Energy of Canada, Ottawa, ON, Canada) under aerobic conditions with 137Cs source emitting at a fixed dose rate of 300 rad/min.
Cell extract preparation
To prepare whole cell extracts (WCE), cells were washed in PBS, pelleted, and resuspended in extraction buffer: 0.5% Nonidet P-40; 20 mM HEPES pH 8.0; 20% glycerol (v/v); 400 mM NaCl containing 0.5 mM DTT; 0.2 mM EDTA; 1 µg/ml aprotinin; 10 µg/ml leupeptin; 0.5 mM PMSF; 1.5 µg/ml pepstatin with 0.5 µg/ml proteinase inhibitors (proteinase inhibitor cocktail tablets; Boehringer Mannheim, Indianapolis, IN, and Calbiochem, La Jolla, CA); as well as phosphatase inhibitors, 50 mM NaF and 1 mM Na3VO4. pH was carefully maintained to assure inhibitor activity. We also performed experiments to lyse MM cells directly in SDS lysing buffer (62.5 mM Tris-Cl, pH 7.0, 2% SDS, 720 mM 2-ME, 5 mg bromophenol blue) and boiled samples for 5 min, a process that inactivates proteases. After incubation on ice for 30 min and microcentrifugation at 4°C, supernatants were transferred to new microfuge tubes. Protein concentrations were determined using Bradford assay (Bio-Rad, Hercules, CA) and samples aliquoted and stored at -80°C.
Western blot analysis
Protein lysates were subjected to electrophoresis on a 6 or 8%
SDS-PAGE. Routinely, 15 µg of WCE from each sample was then
transferred into polyvinylidene difluoride membrane (Millipore,
Freehold, NJ) and the membrane blocked with TBST/5% milk. The membrane
was next hybridized with Ab overnight in the cold room, washed, and
then incubated with anti-mouse IgG-HRP Ab (1:2000; Santa Cruz
Biotechnology, Santa Cruz, CA) for 1 h. The reaction was
visualized using the ECL system (DuPont-NEN, Boston, MA). Abs used in
Western blotting experiments were as follows: murine anti-Ku mAbs
111 (antiKu86 aa 610705), S10B1 (antiKu86 aa 8221), NC91 (antiKu86
aa 1374), N3H10 (antiKu70 aa 506541), anti-DNA-PKcs mAb 182
(aa 12713), anti-DNA-PKcs (aa 4227) (Labvision, Fremont, CA),
5E2 (antiKu86 aa 535543) (30), anti-
-tubulin DM1A
mAb (Sigma, St. Louis. MO), and B-B4 mAb (syndecan-1; Serotec, Raleigh,
NC).
DEB assay
EMSA was performed as described previously (27, 34)
to determine Ku-DEB activity and complex formation, specifically to
define whether the Ku86v-DNA protein complexes demonstrate distinct
electrophoretic mobility. To obtain the radiolabeled DNA probe, two 25
mer-oligonucleotides (5'-ACTTGATTAGTTACGTAACGTTATG-3' and
5'-CATAACGTTACGTAACTAATCAAGT-3') were annealed and end-labeled
with T4 polynucleotide kinase in the presence of
[
-32P]ATP (6000 Ci/mmol; 1 Ci = 37 GBq;
NEN, Cambridge, MA). The probes were purified by chromatography through
Sephadex G-50 (Amersham Pharmacia Biotech, Piscataway, NJ).
The radiolabeled 25-mer DNA probe (4 ng; 100,000 cpm) was incubated with WCE (1 µg) in 15 µl of binding buffer (10 mM Tris/pH 8.0, 1 mM EDTA, 10% glycerol, 50 mM KCl, 0.5 mM PMSF) for 20 min on ice, in the presence of 1 µg of unlabeled supercoiled plasmid DNA to compete for nonspecific DNA-binding proteins. The protein-bound and free oligonucleotides were electrophoretically separated on 5% native polyacrylamide gels at room temperature for 3 h at 130 V in 0.5x TBE (90 mM Tris-borate, 2 mM EDTA) running buffer. Gels were dried and exposed to X-OMAT films (Eastman Kodak, Rochester, NY) at -80°C. For gel mobility supershift experiments, mAbs against Ku70/Ku86 heterodimer (162), Ku86 (111, S10B1), or BAX (rabbit polyclonal Ab as a control Ab unreactive with Ku86; PharMingen, San Diego, CA) were preincubated with WCE and added to binding mixtures. To control for DNA binding activities in the same cell extracts, EMSA was also conducted in the absence of nonspecific competitor DNA (either plasmids or poly(dI:dC)).
DNA-PK activity assay
The DNA-PK "pull down" kinase assay was performed as
previously described (18). WCE prepared as described above
were tested for DNA-PK activity by first absorbing protein onto
double-stranded DNA cellulose beads, which was then assayed for ability
to phosphorylate a p53 peptide substrate. Each sample was assayed in
the presence of either wild-type peptide or mutated peptide, as well as
in the absence of peptide as negative controls. In brief, 150 µg of
WCE was incubated with 50 µl of dsDNA cellulose (30 mg/ml) in 1 ml K
buffer (25 mM Tris-HCl, pH 7.9, 10 mM KCl, 5 mM
MgCl2, 1 mM DTT, 2.5% glycerol) containing 60 mM
NaCl for 30 min at 4°C. The DNA cellulose was then washed by
centrifugation three times in 1 ml of Z'0.05 buffer (25 mM HEPES pH
7.9, 50 mM KCl, 10 mM MgCl2, 20% glycerol, 0.1%
Nonidet P-40, 1 mM DTT) and resuspended in 50 µl of Z'0.05 buffer. An
aliquot (15 µl) of the DNA cellulose was assayed for DNA-PK activity
by adding 0.5 µl of [
-32P]ATP (300
µCi/mmol; 1 Ci = 37 GBq) in the presence of 4 nmol (0.2 mM) of
synthetic DNA-PK peptide substrates derived from the N-terminal
transcriptional activation domain of murine p53 (wild-type peptide,
EPPLSQEAFADLLKK; mutated peptide,
EPPLSEQAFADLLKK). Reactions were stopped and analyzed by
spotting onto phosphocellulose paper, washing, and liquid scintillation
counting. DNA-PK activity for a given WCE was expressed in cpm
incorporated in the wild-type or mutated peptide minus the background
signal in the absence of peptides. To determine the status of Ku86,
Ku70, and DNA-PKcs in the kinase reaction, an aliquot of beads was
washed with Z'0.05 buffer and incubated for 1 h in 50 mM Tris-HCl
(pH 9.0)/Triton 1%, with constant agitation to elute proteins bound to
the beads. The eluted proteins were electrophoresed in 7% SDS-PAGE and
transferred onto a polyvinylidene difluoride membrane, which was
subjected to Western blot analysis for the presence of DNA-PKcs, Ku86,
and Ku70 proteins.
Radiation/drug sensitivity assay
Highly viable (98%, assessed by trypan blue exclusion) MM
(CD38+CD45RA-) cells that
either express both wild-type Ku86 and Ku86v or Ku86v alone were
isolated and suspended in CM. Cells with only full-length
Ku86 (as NBM) were used as positive control. Cells were treated with
irradiation (010 Gy), mitomycin C (05 µg/ml) (Ben Venue
Laboratories, Bedford, OH), or bleomycin (05 µg/ml) (Blenoxane;
Bristol-Myers Squibb, Princeton, NJ) on day 0. Both control
(untreated) and treated MM cells (12 x
106 cells/ml) were seeded into 96-well
microculture plates (200 µl/well) and incubated at 37°C in a 5%
CO2 incubator. Quadruplicate experiments were
performed at each treatment dose. The sensitivity/cytotoxicity assays
were used to define viable tumor cells remaining after treatment.
Specifically, viable cells were enumerated in control vs treated
cultures using trypan blue exclusion 2 days after treatment. In
contrast, apoptosis in MM cells was assessed using annexin V-FITC
(PharMingen, San Diego, CA) staining, and FACS analysis. When it is
possible, MM cells were cultured for 24 h after treatment,
incubated with 1 µCi of tritiated thymidine
([3H]TdR; DuPont-NEN) for 18 h, harvested
onto glass filters using the Harvestar 96 MACH II harvester (Tomtec,
Orange, CT), and analyzed on the 1205 Betaplate
-counter (Wallac,
Gaithersburg, MD).
Northern blot analysis
Total cellular RNA from patient MM cells
(CD38+CD45RA-) was
extracted by RNeasy kit (Qiagen, Valencia, CA). Five micrograms of
total cellular RNA from each sample were separated on a 1.2%
agarose-formaldehyde gel, transferred to Nitropure membrane (Micron
Separation, Westboro, MA) in 10x SSC, and hybridized with
32P-labeled probes. Two cDNA probes were used
that were specific for 5' and 3' Ku86 RNA, respectively. They were
obtained through RT-PCR using primer pairs (5'-1/5'-2; 3'-1/3'-2) as
described below. The resultant 5' probe (1097 bp) and 3' probe (1082
bp) were purified and labeled with
[
-32P]dCTP to
109
cpm/µg of specific activity using the random primer method. An 18S
rRNA oligonucleotide, 5' ACGGTATCTGATCGTCTTCGAACC 3' with
32P end labeling was used as the loading control.
Hybridization was conducted at 68°C in QuickHyb (Stratagene, La
Jolla, CA) in the presence of 100 µg/ml of salmon sperm DNA. After
washing, the blots were dried and analyzed by autoradiography.
Sequencing for Ku86 cDNA
Total cellular RNA (2.5 µg) was used for 20-µl reverse
transcription reaction with Random Primer and Superscript II
RNaseH- reverse transcriptase (Life
Technologies, Gaithersburg, MD). RT (2 µl) was used for RT-PCR on the
TC-480 thermocycler (Perkin-Elmer, Norwalk, CT) using this program:
94°C for 3 min followed by 30 cycles of 94°C for 1 min, 56°C for
1 min, and 72°C for 2 min and an extension at 72°C for 7 min. Each
RT-PCR product was directly sequenced using Dye Terminator Cycle
Sequencing Kits and an ABI Prism 377 DNA Sequencer (Perkin-Elmer). Both
sense and antisense primers were used to confirm the
fidelity of the sequence. Primers used in this study were
as follows (schematic diagram shown in Fig. 8
A):
5'-1: 5'-TTGTACAGCGACAGGTGT-3'/5'-2:
5'-GCCGACTTGAGGATTAGC-3'; 3'-1:
5'-CTCCCTGATTCATGCTTT-3'/3'-2: 5'-CCCATACATCCACGACCT
3'; F2: 5'-ATGTGCAGCTGCCTTTCATGGAAG-3'/B2:
5'-TTTGTCTTTGGGGGCCAGAAACTT-3'; F3:
5'-GCTGTTGATGCTTTGATTGACTCC-3'/B3:
5'-TGCTGTGTCTCCACTTGGTTTG-3'. As a control
for RT-PCR, a primer pair to amplify a 630-bp fragment of
-actin was
used: upper primer: 5'-TCACCCACACTGTGCCCAT-3' and lower primer:
5'-GCATTTGCGGTGGACGATG-3'.
|
Protein microsequencing and mass spectrometry
Protein microsequencing and mass spectrometry were performed by Harvard Microchemistry Facility at Harvard University (Cambridge, MA). In brief, WCE from MM with only Ku86v expression were prepared as described before, incubated with N terminus Ku86 Ab (S10B1 mAb or 5E2 mAb), and then overnight with protein A-Sepharose (Sepharose CL-4B; Amersham Pharmacia Biotech, Piscataway, NJ). The immunopurified protein was washed and then resolved on 8% SDS-PAGE, followed by staining with Coomassie Brilliant Blue R-250 (CBB) (Bio-Rad). Protein species at the expected m.w. were dissected out from the gel for further proteolytic digestion. Peptide sequence analysis was then performed by microcapillary reverse-phase HPLC nano-electrospray tandem mass spectrometry (µlC/MS/MS) on a Finnigan LCQ quadrupole ion trap mass spectrometer.
| Results |
|---|
|
|
|---|
To characterize Ku86 expression in MM patients, WCE from patient
MM (>97%
CD38+CD45RA-CD138+)
cells were immunoblotted with Ku86-specific Abs. NBM served as a
control for the expression of Ku86. As shown in Fig. 1
A, immunoblotting of MM
patient lysates with Ab directed at Ku86 N terminus (S10B1: aa 8221)
demonstrated a 69-kDa protein that was not detected in NBM. Twelve of
fourteen (86%) MM patient samples expressed only this 69-kDa protein
and lacked Ku86 (Fig. 1
A, MM 314), whereas two patients
expressed both the 69-kDa protein and Ku86 (MM 12). Immunoblotting of
six additional NBM samples from healthy donors detected only normal
Ku86 (data not shown). Immunoblotting with anti-Ku70 Ab detected
Ku70 in all samples, including those patient MM cells lacking normal
Ku86 (Fig. 1
C).
|
-tubulin Ab further confirmed integrity of
protein lysates (Fig. 1Ku86v in patient MM cells exhibits differential electrophoretic mobility
Ku binds to double-stranded (ds) DNA ends, which is required for
formation of Ku-DNA-PK complex formation and kinase activity.
Therefore, we first tested the binding activity of Ku86 and Ku86v to
synthetic dsDNA fragments in an EMSA to determine whether Ku86v induces
differential DNA-protein complex formation and electrophoretic
mobility. We used a 25-mer dsDNA probe for EMSA analysis, because a 25-
to 30-bp dsDNA fragment is the minimum length required for the binding
of a single Ku heterodimer (8). WCE from two patient MM
cells expressing both Ku86 and Ku86v (MM 1 and 2), as well as NBM and
CESS cells, were studied. As can be seen in Fig. 2
, WCE from CESS, patient MM 1 and 2, as
well as NBM formed a complex with the oligomer probe (complex A). EMSA
using mAb against Ku86/Ku70 heterodimer (162), Ku86 C
terminus (111), and Ku86 N terminus (S10B1) supershifted
complex A in all of these samples. Another complex of WCE with the
oligomer probe (complex B) was observed only in patients MM 1 and 2.
EMSA using S10B1 Ab, but not 162 or 111 Abs, supershifted complex B.
These results show that complex B contains Ku86v and suggest that Ku86v
might form a Ku86v-DNA complex with differential mobility.
|
|
After formation of Ku-DNA complexes, DNA-PKcs is recruited and
kinase activity is induced. To assay for Ku-DNA-PKcs complex formation
and kinase activity, DNA-cellulose was added to WCE from CESS cells,
NBM, and patient MM cells, and centrifugation used to
"pull-down" DNA-binding proteins, as previously described
(18). Proteins associated with DNA cellulose were next
eluted and subjected to Western blot analysis. As can be seen in Fig. 4
A, Ku86, Ku70 and DNA-PKcs
were associated with DNA in NBM and CESS cells. In patients MM 1 and 2,
known to express both Ku86 and Ku86v, Ku86, Ku70, and DNA-PKcs were
similarly associated with DNA. However, in patients MM 36, which
express Ku86v but lack Ku86, only Ku70 (but little, if any, DNA-PKcs)
was associated with DNA. Patients MM 714, which express Ku86v alone,
also showed similar association of DNA with Ku70, but not with DNA-PKcs
(data not shown). Immunoblotting of WCE from CESS cells, NBM, and
patient MM cells confirmed the presence of DNA-PKcs in all samples
(Fig. 4
B). These results demonstrate that the Ku86v-DNA
complex in patient MM cells cannot interact with DNA-PKcs.
|
-32P]ATP. To assure specificity of
DNA-PK-catalyzed phosphorylation and to control for DNA-PK independent,
nonspecific phosphorylation of the p53 peptide, assays were also
performed either in the absence of substrate or using mutated p53
peptide as substrate. As shown in Fig. 5
|
Because Ku-DNA-PKcs is required for DSB repair and Ku86v-DNA is
incapable of forming complexes with DNA-PKcs, we next examined the
sensitivity of patient MM cells to DNA damaging agents including
irradiation, mitomycin C, and bleomycin. Specifically, we delineated
the number of viable and preapoptotic MM cells, using trypan blue
exclusion and annexin V-FITC/FACS analysis, respectively, before and
after treatment with these agents. Viability studies using trypan blue
exclusion showed that patient MM cells expressing only Ku86v were more
sensitive to
irradiation, mitomycin C, and bleomycin, than patient
MM cells expressing both Ku86v and Ku86 or control NBM cells expressing
only full-length Ku86 (Fig. 6
, left). Annexin-V staining also revealed increased apoptotic
cells after treatment of Ku86v MM cells vs MM cells expressing both
Ku86 and Ku86v or control NBM cells expressing only full-length Ku86
(Fig. 6
, right).
|
To determine whether the Ku86v in human MM cells is derived from
altered Ku86 transcripts, we performed Northern blot analysis using
Ku86 cDNA probes. The 5' and 3' probes for the analysis were obtained
by RT-PCR using 5'-1/5'-2 and 3'-1/3'-2 primer pairs in Fig. 8
A. As shown in Fig. 7
, A and B, Ku86
cDNA probes hybridized to two mRNAs of 2.6 and 3.4 kb in the control
NBM sample as previously described in human cell line and normal
tissues (35). When 5' probe was used, both Ku86
transcripts were detected in MM samples expressing Ku86v alone (Fig. 7
A, lanes 46). When 3' probe was used, neither
band was detected in RNA samples from MM cells expressing Ku86v alone
(Fig. 7
B, lanes 46). A
32P end-labeled oligonucleotide probe for 18S
rRNA was used as an internal control to ensure the loading and quality
of RNA. These results suggest that human MM cells expressed Ku86
transcripts truncated at the 3' end.
|
-actin was served as an internal control for integrity of RNA. RNA
from NBM (Fig. 8
-actin was readily detected in all patient
samples (Fig. 8Sequencing of Ku86v protein
Ku86v protein (69 kDa) was excised from an 8% SDS-PAGE gel and sequencing was performed. Twenty peptides (618 amino acid residues) contained within this 69-kDa protein were sequenced and identical with Ku86.
| Discussion |
|---|
|
|
|---|
irradiation and chemotherapy. In contrast, Ku86
in patient MM cells is associated with resistance to these agents. This
study, coupled with reports that increased expression and activity of
Ku86 is correlated with chemoresistance, suggests that Ku86 may be a
therapeutic target to modulate resistance.
The presence of Ku86v with a truncated C terminus in patient MM cells
was suggested by immunoblotting using Abs targeting Ku86 N terminus
(S10B1, NC91, and 5E2) and Ab targeting Ku86 C terminus (111), and
confirmed using EMSA supershift experiments. To date, the mechanism for
generation of Ku86v in MM cells remains undefined and under active
investigation. Although Ku86v may be derived from spliced variants of
Ku86 transcripts, we have not to date observed additional species of
Ku86 mRNA on Northern blotting of patient MM cells. In Northern
blotting, we have detected normal Ku86 mRNA using 5' probe (Fig. 7
A) in all samples; however, no Ku86 transcript (3.4 kb) was
detected in those patient MM cells expressing Ku86v alone (patient MM
35) using 3' probe (Fig. 7
B). Given the limits of
detection of Northern blotting, we next used RT-PCR with primer pairs
to amplify 5' and 3' Ku86 transcripts. 5' Ku86 transcripts were readily
detectable in all patient samples (Fig. 8
B), but as shown in
Fig. 8
C, 3' Ku86 transcripts were either absent or weakly
detectable in samples from the majority of patient MM cells expressing
Ku86v alone (patient MM 313). Specifically, the 5' end product (1097
bp) is present in both normal and all MM cells, whereas the 3' end
product (1082 bp) is either absent or weakly detectable in those MM
cells with Ku 86v alone. These data are consistent with two
possibilities. The first is posttranscriptional modification because
the 5' end can be amplified in RT-PCR in all cases, whereas the 3' end
cannot be amplified in some samples. The second possibility is that at
least some of the MM cells being analyzed are heterozygous at the Ku
locus, that wild-type mRNA might be produced from one allele but not
both, and that the mutated Ku (Ku86v) has a dominant effect in
tumorigenesis.
In these and ongoing studies, the protein lysates were prepared in the
presence of proteinase inhibitors, e.g., aprotinin, leupeptin, PMSF,
pepstatin, and proteinase inhibitors (proteinase inhibitor cocktail
tablets due to reports of an elevated proteolytic activity in human
fibroblasts (37). pH was carefully maintained to assure
inhibitor activity. We have also performed experiments to lyse MM cells
directly in SDS lysing buffer and boiled samples for 5 min immediately
before Western blot analysis, a process that inactivates protease
activity. Finally, Ku86v (69 kDa) was reproducibly detected in
preparations from the majority of MM patients, but not from NBM donors,
under identical experimental conditions. The integrity of the protein
lysates was assured by immunoblotting for tubulin. In addition, as
shown in Fig. 1
E, the Ku86v was similarly detected in
lysates prepared using SDS-PAGE sample buffer. Therefore, truncated
Ku86 protein, as described by Jeng et al. (37), was not
present in this study.
Our studies demonstrated that C terminus truncation to form Ku86v has
several functional sequelae. First, Ku86v demonstrates distinct
electrophoretic mobility than Ku86, with supershifting on EMSA using Ab
against Ku86 N terminus, but not with Ab against C terminus. In our
hands, Ab against the Ku86/Ku70 heterodimer (38) did not
supershift Ku86v in MM cells, suggesting either the lack of heterodimer
formation of Ku70 with Ku86v or formation of a Ku70/Ku86v complex that
is not recognized by this Ab. Our studies further suggest that Ku70
does form complexes with Ku86v, based upon supershifting of Ku86v EMSA
using Ab specific for Ku70. Moreover our "pull down" experiments to
characterize DNA binding proteins within patient MM WCE demonstrate the
presence of both Ku86v and Ku70. Interestingly, a Ku86 variant with
truncated C terminus has been reported in HL-60 promyelocytic leukemia
cells and CLL cells that form heterodimers with Ku70
(27, 28, 29). This Ku86 variant has molecular mass (
6971
kDa) similar to the Ku86v in patient MM cells (69 kDa). Therefore, it
appears that both Ku86v in HL-60 or CLL cells and Ku86v in patient MM
cells can bind Ku70. EMSA demonstrated that Ab against the Ku86/Ku70
heterodimer completely supershifted the DNA-protein complex formed from
HL60 cell nuclear extracts (27). However, Ku86v in HL-60
was not sequenced, either at the nucleic acid or peptide level;
therefore, we cannot conclude at present whether Ku86v in HL-60 cells
is the same Ku86 variant as we have identified in MM cells.
Our studies suggest that Ku86v in patient MM cells has decreased DEB activity compared with Ku86. Numerous yeast hybrid studies have permitted mapping of those regions of Ku86 and Ku70 subunits that bind to each other or to DNA (39, 40, 41, 42, 43). A region in the C terminus of both Ku70 and Ku86 (150 aa) appears to be essential for heterodimer formation, whereas larger regions of both Ku70 and Ku86 are required for effective DEB activity (44). Wang et al. (45) has reported that amino acids 371510 of Ku86 interact with Ku70, and that amino acids 179732 of Ku86 (C terminus) are required for DEB. Our results are in accordance with these findings, because the Ku86v in patient MM cells has C terminus truncation and related decreased DEB activity.
Perhaps the most important effect of C terminus truncation on the
functional repertoire of Ku86v in patient MM cells is its inability to
complex with DNA-PKcs and activate DNA-PKcs, which is essential for
repair of DNA damage. Singleton et al. (46) have used a
series of C-terminal truncated Ku86 mutants to define the C terminus
region required for interaction with DNA-PKcs and kinase activation.
This report and the current study both demonstrate that truncation of
Ku86 C terminus can result in loss of DNA-PKcs binding and kinase
activity. Moreover, in their model using CHO mutants with C terminus
deletions (46) as well as in this study of Ku86v in
patient MM cells, this lack of Ku86v complex formation with DNA-PKcs
and kinase activity resulted in sensitivity to
irradiation, due to
decreased DNA repair. We extended these studies to other DNA damaging
agents, namely mitomycin C and bleomycin, and showed that sensitivity
of MM cells to these agents correlated with Ku86v expression, and
conversely, that expression of Ku86 in patient MM cells conferred
relative resistance to these treatments. Therefore these studies shed
insight into the mechanism of sensitivity to DNA damage in some MM
cells and further suggest that Ku86 may be a potential target to
overcome resistance to radiation or chemotherapy. Ongoing studies will
examine MM cells freshly isolated from patients both before and after
treatment with DNA damaging agents, to correlate Ku86 status with
response in vivo, and conversely, to determine whether drug resistant
cells have increased expression of normal Ku86. Recent reports have
also demonstrated increased Ku86 expression, Ku-DEB activity, and
DNA-PK activity both in human chronic lymphocytic leukemia cells
resistant to radiation and chemotherapy (47) and in a
murine model of leukemia (48). Finally, the recent
observation that Ku86-null ES cells exhibit hypersensitivity to
chemotherapeutic agents (e.g., etoposide VP-16, bleomycin) (49, 50) further supports the potential utility of targeting Ku86 to
modulate chemosensitivity.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenneth C. Anderson, Department of Adult Oncology, Dana-Farber Cancer Institute, M557, 44 Binney Street, Boston, MA 02115. ![]()
3 Abbreviations used in this paper: MM, multiple myeloma; DSBs, double-stranded DNA breaks; WCE, whole cell extracts; DEB, DNA end binding; CM, complete medium; BM, bone marrow; IR, ionizing radiation; NBM, normal BM; DNA-PK, DNA-dependent protein kinase; DNA-PKcs, DNA-dependent protein kinase catalytic subunit. ![]()
Received for publication March 2, 2000. Accepted for publication August 30, 2000.
| References |
|---|
|
|
|---|
heavy chain class switching. Immunity 5:319.[Medline]
This article has been cited by other articles:
![]() |
P. J. Hayden, P. Tewari, D. W. Morris, A. Staines, D. Crowley, A. Nieters, N. Becker, S. de Sanjose, L. Foretova, M. Maynadie, et al. Variation in DNA repair genes XRCC3, XRCC4, XRCC5 and susceptibility to myeloma Hum. Mol. Genet., December 15, 2007; 16(24): 3117 - 3127. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Schaue and W. H. McBride Counteracting tumor radioresistance by targeting DNA repair Mol. Cancer Ther., October 1, 2005; 4(10): 1548 - 1550. [Full Text] [PDF] |
||||
![]() |
L. Deriano, O. Guipaud, H. Merle-Beral, J.-L. Binet, M. Ricoul, G. Potocki-Veronese, V. Favaudon, Z. Maciorowski, C. Muller, B. Salles, et al. Human chronic lymphocytic leukemia B cells can escape DNA damage-induced apoptosis through the nonhomologous end-joining DNA repair pathway Blood, June 15, 2005; 105(12): 4776 - 4783. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Um, J. K. Kwon, C.-D. Kang, M. J. Kim, D. S. Ju, J. H. Bae, D. W. Kim, B. S. Chung, and S. H. Kim Relationship between Antiapoptotic Molecules and Metastatic Potency and the Involvement of DNA-Dependent Protein Kinase in the Chemosensitization of Metastatic Human Cancer Cells by Epidermal Growth Factor Receptor Blockade J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 1062 - 1070. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Podar, G. Mostoslavsky, M. Sattler, Y.-T. Tai, T. Hayashi, L. P. Catley, T. Hideshima, R. C. Mulligan, D. Chauhan, and K. C. Anderson Critical Role for Hematopoietic Cell Kinase (Hck)-mediated Phosphorylation of Gab1 and Gab2 Docking Proteins in Interleukin 6-induced Proliferation and Survival of Multiple Myeloma Cells J. Biol. Chem., May 14, 2004; 279(20): 21658 - 21665. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Podar, Y.-T. Tai, C. E. Cole, T. Hideshima, M. Sattler, A. Hamblin, N. Mitsiades, R. L. Schlossman, F. E. Davies, G. J. Morgan, et al. Essential Role of Caveolae in Interleukin-6- and Insulin-like Growth Factor I-triggered Akt-1-mediated Survival of Multiple Myeloma Cells J. Biol. Chem., February 14, 2003; 278(8): 5794 - 5801. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Richardson, R. L. Schlossman, E. Weller, T. Hideshima, C. Mitsiades, F. Davies, R. LeBlanc, L. P. Catley, D. Doss, K. Kelly, et al. Immunomodulatory drug CC-5013 overcomes drug resistance and is well tolerated in patients with relapsed multiple myeloma Blood, October 16, 2002; 100(9): 3063 - 3067. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Difilippantonio, S. Petersen, H. T. Chen, R. Johnson, M. Jasin, R. Kanaar, T. Ried, and A. Nussenzweig Evidence for Replicative Repair of DNA Double-Strand Breaks Leading to Oncogenic Translocation and Gene Amplification J. Exp. Med., August 19, 2002; 196(4): 469 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Rodgers, S. J. Jordan, and J. D. Capra Transient Association of Ku with Nuclear Substrates Characterized Using Fluorescence Photobleaching J. Immunol., March 1, 2002; 168(5): 2348 - 2355. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-T. Tai, K. Podar, D. Gupta, B. Lin, G. Young, M. Akiyama, and K. C. Anderson CD40 activation induces p53-dependent vascular endothelial growth factor secretion in human multiple myeloma cells Blood, February 15, 2002; 99(4): 1419 - 1427. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Dalton, P. L. Bergsagel, W. M. Kuehl, K. C. Anderson, and J. L. Harousseau Multiple Myeloma Hematology, January 1, 2001; 2001(1): 157 - 177. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |