The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tai, Y.-T.
Right arrow Articles by Anderson, K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tai, Y.-T.
Right arrow Articles by Anderson, K. C.
The Journal of Immunology, 2000, 165: 6347-6355.
Copyright © 2000 by The American Association of Immunologists

Ku86 Variant Expression and Function in Multiple Myeloma Cells Is Associated with Increased Sensitivity to DNA Damage1

Yu-Tzu Tai, Gerrard Teoh, Boris Lin, Faith E. Davies, Dharminder Chauhan, Steven P. Treon, Noopur Raje, Teru Hideshima, Yoshihito Shima, Klaus Podar and Kenneth C. Anderson2

Department of Adult Oncology, Dana-Farber Cancer Institute, and Department of Medicine, Harvard Medical School, Boston, MA 02115


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ku is a heterodimer of Ku70 and Ku86 that binds to double-stranded DNA breaks (DSBs), activates the catalytic subunit (DNA-PKcs) when DNA is bound, and is essential in DSB repair and V(D)J recombination. Given that abnormalities in Ig gene rearrangement and DNA damage repair are hallmarks of multiple myeloma (MM) cells, we have characterized Ku expression and function in human MM cells. Tumor cells (CD38+CD45RA-) from 12 of 14 (86%) patients preferentially express a 69-kDa variant of Ku86 (Ku86v). Immunoblotting of whole cell extracts (WCE) from MM patients shows reactivity with Abs targeting Ku86 N terminus (S10B1) but no reactivity with Abs targeting Ku86 C terminus (111), suggesting that Ku86v has a truncated C terminus. EMSA confirmed a truncated C terminus in Ku86v and further demonstrated that Ku86v in MM cells had decreased Ku-DNA end binding activity. Ku86 forms complexes with DNA-PKcs and activates kinase activity, but Ku86v neither binds DNA-PKcs nor activates kinase activity. Furthermore, MM cells with Ku86v have increased sensitivity to irradiation, mitomycin C, and bleomycin compared with patient MM cells or normal bone marrow donor cells with Ku86. Therefore, this study suggests that Ku86v in MM cells may account for decreased DNA repair and increased sensitivity to radiation and chemotherapeutic agents, whereas Ku86 in MM cells confers resistance to DNA damaging agents. Coupled with a recent report that Ku86 activity correlates with resistance to radiation and chemotherapy, these results have implications for the potential role of Ku86 as a novel therapeutic target.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human multiple myeloma (MM)3 is characterized by the monoclonal expansion of plasma cells in the bone marrow (BM). Although MM is initially responsive to therapy, drug resistance evolves in most patients, and this disease remains incurable. Novel biologically based therapies are urgently needed. At present, the development of MM is believed to proceed through a multiple-step transformation (1). Recent elegant studies of myeloma cell lines and freshly isolated tumor cells have shown chromosomal translocations involving the switch regions of the Ig heavy-chain (IgH) locus and multiple partner chromosomes (2). However, an underlying central molecular abnormality to account for chromosomal instability in MM has not to date been identified.

Double-stranded DNA breaks (DSBs) are generated during initiation of meiotic recombination or V(D)J recombination of Ig and TCR genes. Ionizing radiation (IR) and certain chemotherapeutic drugs also induce DSBs. Due to the instability of DSBs and disruption of the genome, highly efficient mechanisms have evolved for both recognition and repair of DSBs. Specifically, DSBs are repaired in mammalian cells primarily via nonhomologous or illegitimate recombination (3, 4), which is dependent upon Ku/DNA-dependent protein kinase (DNA-PK) (5, 6). Ku, originally identified as a target Ag in a patient with autoimmune disease (7), is an abundant nuclear protein that binds selectively to free double-stranded DNA (8). It consists of Ku70 and Ku86 subunits that bind with high affinity to altered DNA, including DSBs (9, 10). Ku is the regulatory subunit of DNA-PK and is required for DNA-PK activity (11): Ku binds to DSBs, recruits the catalytic subunit of the 460-kDa protein DNA-PKcs, and activates its kinase function (12) to phosphorylate DNA-bound proteins (13). Cells deficient in Ku86 are hypersensitive to IR in vitro, due to defects in DSB rejoining (14); conversely, transfection of human or hamster Ku86 gene into Ku86 mutant cells can restore DSB repair (15, 16, 17). Ku-deficient cells are also deficient in DNA-PK activity, further suggesting that Ku DNA-binding is required for DNA-PK activation in vivo (18). The observation that Ku86 (19, 20) or Ku70 (21) knockout mice demonstrate hypersensitivity to IR further confirms the role of Ku in DSB repair in vivo. Ku86 has also been shown to be required for normal Ig rearrangement and IgH class switch recombination (22, 23). This may be relevant in MM because chromosome translocations involving the IgH switch regions are common. In addition, Ku80 has been implicated in maintaining the integrity of the genome via suppression of chromosomal rearrangements (24).

Despite many studies with established cell lines, little is known about Ku activity and its regulation in fresh human cells and tissues. Studies in resting murine B cells showed low levels of Ku, and that Ku expression could be up-regulated by culturing the cells with CD40L and IL-4 (25). In addition, Ku was found in the cytoplasm without any identified biological function (25, 26). Altered forms of Ku86 with lesser m.w. have also been described (27, 28, 29). We have previously demonstrated ectopic localization of Ku86 in the cell membrane of human MM cells after CD40L activation (30). The Ku86 on the membrane of activated MM cells mediates both homotypic tumor cell adhesion and heterotypic adhesion of tumor cells to fibronectin and BM stromal cells. These results, coupled with the abnormalities in DNA repair and Ig gene rearrangement characteristic of human MMs, suggest that abnormalities in the Ku86 may play a role in the biology of MM.

In this study, we characterized the expression and function of Ku86 in human MM. We demonstrate that a variant of Ku86 (Ku86v) is expressed in freshly prepared tumor cell lysates from a majority of MM patient BM aspirates. Immunoblotting studies show reactivity with Abs for Ku86 N terminus, but not with Abs directed against Ku86 C terminus, suggesting C terminus truncation. EMSA with these Abs confirmed truncation of C terminus in Ku86v and further demonstrated decreased DNA end binding (DEB) activity and DNA-PKcs binding, resulting in a lack of detectable DNA-PKcs complexes and kinase activity. 5' end Ku86 transcripts are detectable in all samples, whereas 3' end Ku86 transcripts are somehow altered or reduced in patients expressing only Ku86v protein, suggesting posttranscriptional modification. Finally, patient MM cells expressing Ku86v exhibit hypersensitivity to DNA-damaging agents, including mitomycin C, bleomycin, and {gamma} irradiation compared with patient MM cells or normal BM (NBM) donors with normal Ku86. Therefore, these studies provide mechanisms for both decreased DSB repair and sensitivity to DNA damaging agents in those MM cells expressing Ku86v, and further suggest that Ku86 in MM cells may confer relative resistance to treatment and, therefore, represent a novel therapeutic target.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BM cell preparation

BM aspirates from patients with MM (>70% CD38+CD45RA- cells) were collected in heparinized tubes following Institutional guidelines with informed consent. Suspensions enriched for tumor cells were prepared by density gradient centrifugation (Ficoll-Hypaque; Pharmacia, Uppsala, Sweden) followed by depletion of erythrocytes and non-MM cells using immunomagnetic bead separation (31). Briefly, cell suspensions were incubated with a cocktail of mouse mAbs directed against CD3 (T cells); CD11b and CD14 (monocytes); CD33 (myeloid cells); CD45 and CD45RA (leukocyte common Ag); CD32 (Fc{gamma}RIIA); as well as glycophorin A (erythrocytes) for 30 min in the cold room, with constantly gentle agitation. Then, non-MM cells were removed by incubation with goat anti-mouse IgG (Fc) Ab coupled to immunomagnetic beads (Dynabeads M450; Dynal, Oslo, Norway). Resultant populations were >95% MM cells (CD38+CD45RA-) and >=98% viable, assessed by trypan blue exclusion. MM cells were also >95% positive for CD138 or syndecan-1 (32, 33). Cells were resuspended in complete medium (CM: RPMI 1640 media containing 10% heat-inactivated FBS, 25 IU/ml penicillin, 25 µg/ml streptomycin, and 2 mM L-glutamine) for further analysis.

After informed consent, NBM was obtained from healthy donors at the time of allogeneic BM harvest. Mononuclear cell suspensions separated by Ficoll-Hypaque gradient centrifugation were resuspended in CM (1 x 106 cells/ml) and incubated in tissue culture flasks for 1 h at 37°C. Monocytes were removed by adherence, and the resultant lymphocyte cell suspensions contained <=0.5% CD14+ cells with >95% viability. They were immediately used as controls for further analysis, as described below.

Cell culture

Cell lines (CESS, Jurkat, 293) (American Type Culture Collection, Manassas, VA) were grown at 37°C in CM. IR was performed at room temperature using a Gammacell-1000 (Atomic Energy of Canada, Ottawa, ON, Canada) under aerobic conditions with 137Cs source emitting at a fixed dose rate of 300 rad/min.

Cell extract preparation

To prepare whole cell extracts (WCE), cells were washed in PBS, pelleted, and resuspended in extraction buffer: 0.5% Nonidet P-40; 20 mM HEPES pH 8.0; 20% glycerol (v/v); 400 mM NaCl containing 0.5 mM DTT; 0.2 mM EDTA; 1 µg/ml aprotinin; 10 µg/ml leupeptin; 0.5 mM PMSF; 1.5 µg/ml pepstatin with 0.5 µg/ml proteinase inhibitors (proteinase inhibitor cocktail tablets; Boehringer Mannheim, Indianapolis, IN, and Calbiochem, La Jolla, CA); as well as phosphatase inhibitors, 50 mM NaF and 1 mM Na3VO4. pH was carefully maintained to assure inhibitor activity. We also performed experiments to lyse MM cells directly in SDS lysing buffer (62.5 mM Tris-Cl, pH 7.0, 2% SDS, 720 mM 2-ME, 5 mg bromophenol blue) and boiled samples for 5 min, a process that inactivates proteases. After incubation on ice for 30 min and microcentrifugation at 4°C, supernatants were transferred to new microfuge tubes. Protein concentrations were determined using Bradford assay (Bio-Rad, Hercules, CA) and samples aliquoted and stored at -80°C.

Western blot analysis

Protein lysates were subjected to electrophoresis on a 6 or 8% SDS-PAGE. Routinely, 15 µg of WCE from each sample was then transferred into polyvinylidene difluoride membrane (Millipore, Freehold, NJ) and the membrane blocked with TBST/5% milk. The membrane was next hybridized with Ab overnight in the cold room, washed, and then incubated with anti-mouse IgG-HRP Ab (1:2000; Santa Cruz Biotechnology, Santa Cruz, CA) for 1 h. The reaction was visualized using the ECL system (DuPont-NEN, Boston, MA). Abs used in Western blotting experiments were as follows: murine anti-Ku mAbs 111 (antiKu86 aa 610–705), S10B1 (antiKu86 aa 8–221), NC91 (antiKu86 aa 1–374), N3H10 (antiKu70 aa 506–541), anti-DNA-PKcs mAb 18–2 (aa 1–2713), anti-DNA-PKcs (aa 42–27) (Labvision, Fremont, CA), 5E2 (antiKu86 aa 535–543) (30), anti-{alpha}-tubulin DM1A mAb (Sigma, St. Louis. MO), and B-B4 mAb (syndecan-1; Serotec, Raleigh, NC).

DEB assay

EMSA was performed as described previously (27, 34) to determine Ku-DEB activity and complex formation, specifically to define whether the Ku86v-DNA protein complexes demonstrate distinct electrophoretic mobility. To obtain the radiolabeled DNA probe, two 25 mer-oligonucleotides (5'-ACTTGATTAGTTACGTAACGTTATG-3' and 5'-CATAACGTTACGTAACTAATCAAGT-3') were annealed and end-labeled with T4 polynucleotide kinase in the presence of [{gamma}-32P]ATP (6000 Ci/mmol; 1 Ci = 37 GBq; NEN, Cambridge, MA). The probes were purified by chromatography through Sephadex G-50 (Amersham Pharmacia Biotech, Piscataway, NJ).

The radiolabeled 25-mer DNA probe (4 ng; 100,000 cpm) was incubated with WCE (1 µg) in 15 µl of binding buffer (10 mM Tris/pH 8.0, 1 mM EDTA, 10% glycerol, 50 mM KCl, 0.5 mM PMSF) for 20 min on ice, in the presence of 1 µg of unlabeled supercoiled plasmid DNA to compete for nonspecific DNA-binding proteins. The protein-bound and free oligonucleotides were electrophoretically separated on 5% native polyacrylamide gels at room temperature for 3 h at 130 V in 0.5x TBE (90 mM Tris-borate, 2 mM EDTA) running buffer. Gels were dried and exposed to X-OMAT films (Eastman Kodak, Rochester, NY) at -80°C. For gel mobility supershift experiments, mAbs against Ku70/Ku86 heterodimer (162), Ku86 (111, S10B1), or BAX (rabbit polyclonal Ab as a control Ab unreactive with Ku86; PharMingen, San Diego, CA) were preincubated with WCE and added to binding mixtures. To control for DNA binding activities in the same cell extracts, EMSA was also conducted in the absence of nonspecific competitor DNA (either plasmids or poly(dI:dC)).

DNA-PK activity assay

The DNA-PK "pull down" kinase assay was performed as previously described (18). WCE prepared as described above were tested for DNA-PK activity by first absorbing protein onto double-stranded DNA cellulose beads, which was then assayed for ability to phosphorylate a p53 peptide substrate. Each sample was assayed in the presence of either wild-type peptide or mutated peptide, as well as in the absence of peptide as negative controls. In brief, 150 µg of WCE was incubated with 50 µl of dsDNA cellulose (30 mg/ml) in 1 ml K buffer (25 mM Tris-HCl, pH 7.9, 10 mM KCl, 5 mM MgCl2, 1 mM DTT, 2.5% glycerol) containing 60 mM NaCl for 30 min at 4°C. The DNA cellulose was then washed by centrifugation three times in 1 ml of Z'0.05 buffer (25 mM HEPES pH 7.9, 50 mM KCl, 10 mM MgCl2, 20% glycerol, 0.1% Nonidet P-40, 1 mM DTT) and resuspended in 50 µl of Z'0.05 buffer. An aliquot (15 µl) of the DNA cellulose was assayed for DNA-PK activity by adding 0.5 µl of [{gamma}-32P]ATP (300 µCi/mmol; 1 Ci = 37 GBq) in the presence of 4 nmol (0.2 mM) of synthetic DNA-PK peptide substrates derived from the N-terminal transcriptional activation domain of murine p53 (wild-type peptide, EPPLSQEAFADLLKK; mutated peptide, EPPLSEQAFADLLKK). Reactions were stopped and analyzed by spotting onto phosphocellulose paper, washing, and liquid scintillation counting. DNA-PK activity for a given WCE was expressed in cpm incorporated in the wild-type or mutated peptide minus the background signal in the absence of peptides. To determine the status of Ku86, Ku70, and DNA-PKcs in the kinase reaction, an aliquot of beads was washed with Z'0.05 buffer and incubated for 1 h in 50 mM Tris-HCl (pH 9.0)/Triton 1%, with constant agitation to elute proteins bound to the beads. The eluted proteins were electrophoresed in 7% SDS-PAGE and transferred onto a polyvinylidene difluoride membrane, which was subjected to Western blot analysis for the presence of DNA-PKcs, Ku86, and Ku70 proteins.

Radiation/drug sensitivity assay

Highly viable (98%, assessed by trypan blue exclusion) MM (CD38+CD45RA-) cells that either express both wild-type Ku86 and Ku86v or Ku86v alone were isolated and suspended in CM. Cells with only full-length Ku86 (as NBM) were used as positive control. Cells were treated with {gamma} irradiation (0–10 Gy), mitomycin C (0–5 µg/ml) (Ben Venue Laboratories, Bedford, OH), or bleomycin (0–5 µg/ml) (Blenoxane; Bristol-Myers Squibb, Princeton, NJ) on day 0. Both control (untreated) and treated MM cells (1–2 x 106 cells/ml) were seeded into 96-well microculture plates (200 µl/well) and incubated at 37°C in a 5% CO2 incubator. Quadruplicate experiments were performed at each treatment dose. The sensitivity/cytotoxicity assays were used to define viable tumor cells remaining after treatment. Specifically, viable cells were enumerated in control vs treated cultures using trypan blue exclusion 2 days after treatment. In contrast, apoptosis in MM cells was assessed using annexin V-FITC (PharMingen, San Diego, CA) staining, and FACS analysis. When it is possible, MM cells were cultured for 24 h after treatment, incubated with 1 µCi of tritiated thymidine ([3H]TdR; DuPont-NEN) for 18 h, harvested onto glass filters using the Harvestar 96 MACH II harvester (Tomtec, Orange, CT), and analyzed on the 1205 Betaplate {beta}-counter (Wallac, Gaithersburg, MD).

Northern blot analysis

Total cellular RNA from patient MM cells (CD38+CD45RA-) was extracted by RNeasy kit (Qiagen, Valencia, CA). Five micrograms of total cellular RNA from each sample were separated on a 1.2% agarose-formaldehyde gel, transferred to Nitropure membrane (Micron Separation, Westboro, MA) in 10x SSC, and hybridized with 32P-labeled probes. Two cDNA probes were used that were specific for 5' and 3' Ku86 RNA, respectively. They were obtained through RT-PCR using primer pairs (5'-1/5'-2; 3'-1/3'-2) as described below. The resultant 5' probe (1097 bp) and 3' probe (1082 bp) were purified and labeled with [{alpha}-32P]dCTP to ~109 cpm/µg of specific activity using the random primer method. An 18S rRNA oligonucleotide, 5' ACGGTATCTGATCGTCTTCGAACC 3' with 32P end labeling was used as the loading control. Hybridization was conducted at 68°C in QuickHyb (Stratagene, La Jolla, CA) in the presence of 100 µg/ml of salmon sperm DNA. After washing, the blots were dried and analyzed by autoradiography.

Sequencing for Ku86 cDNA

Total cellular RNA (2.5 µg) was used for 20-µl reverse transcription reaction with Random Primer and Superscript II RNaseH- reverse transcriptase (Life Technologies, Gaithersburg, MD). RT (2 µl) was used for RT-PCR on the TC-480 thermocycler (Perkin-Elmer, Norwalk, CT) using this program: 94°C for 3 min followed by 30 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 2 min and an extension at 72°C for 7 min. Each RT-PCR product was directly sequenced using Dye Terminator Cycle Sequencing Kits and an ABI Prism 377 DNA Sequencer (Perkin-Elmer). Both sense and antisense primers were used to confirm the fidelity of the sequence. Primers used in this study were as follows (schematic diagram shown in Fig. 8GoA): 5'-1: 5'-TTGTACAGCGACAGGTGT-3'/5'-2: 5'-GCCGACTTGAGGATTAGC-3'; 3'-1: 5'-CTCCCTGATTCATGCTTT-3'/3'-2: 5'-CCCATACATCCACGACCT 3'; F2: 5'-ATGTGCAGCTGCCTTTCATGGAAG-3'/B2: 5'-TTTGTCTTTGGGGGCCAGAAACTT-3'; F3: 5'-GCTGTTGATGCTTTGATTGACTCC-3'/B3: 5'-TGCTGTGTCTCCACTTGGTTTG-3'. As a control for RT-PCR, a primer pair to amplify a 630-bp fragment of {beta}-actin was used: upper primer: 5'-TCACCCACACTGTGCCCAT-3' and lower primer: 5'-GCATTTGCGGTGGACGATG-3'.



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 8. Patient MM cells (CD38+CD45RA-) with Ku86v have detectable Ku86 transcripts. A, Design and location of primers used in RT-PCR. Shown are the coding regions of Ku86 cDNA (position 28 to 2226). The location of primers are shown by arrow [sense (->) and antisense (<-)]. B and C, Agarose gel electrophoresis of RT-PCR products. Shown here are products of RT-PCR using primer pairs 5'-1 and 5'-2 (B), 3'-1 and 3'-2 (C). Duplex PCR were performed for each sample, using a primer pair to amplify {beta}-actin as an internal control (PCR product: 630 bp). An aliquot of the RT-PCR was size fractionated on 0.8% agarose gel and stained with ethidium bromide. 100 bp DNA ladder markers are shown in lane 1; NBM in lane 2; patient MM 1–2 in lanes 3 and 4; and patient MM 3–13 in lanes 5–15.

 
These primers allowed the amplification of sequences from coding regions of Ku86 cDNA.

Protein microsequencing and mass spectrometry

Protein microsequencing and mass spectrometry were performed by Harvard Microchemistry Facility at Harvard University (Cambridge, MA). In brief, WCE from MM with only Ku86v expression were prepared as described before, incubated with N terminus Ku86 Ab (S10B1 mAb or 5E2 mAb), and then overnight with protein A-Sepharose (Sepharose CL-4B; Amersham Pharmacia Biotech, Piscataway, NJ). The immunopurified protein was washed and then resolved on 8% SDS-PAGE, followed by staining with Coomassie Brilliant Blue R-250 (CBB) (Bio-Rad). Protein species at the expected m.w. were dissected out from the gel for further proteolytic digestion. Peptide sequence analysis was then performed by microcapillary reverse-phase HPLC nano-electrospray tandem mass spectrometry (µlC/MS/MS) on a Finnigan LCQ quadrupole ion trap mass spectrometer.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ku86v is expressed in patient MM cells

To characterize Ku86 expression in MM patients, WCE from patient MM (>97% CD38+CD45RA-CD138+) cells were immunoblotted with Ku86-specific Abs. NBM served as a control for the expression of Ku86. As shown in Fig. 1GoA, immunoblotting of MM patient lysates with Ab directed at Ku86 N terminus (S10B1: aa 8–221) demonstrated a 69-kDa protein that was not detected in NBM. Twelve of fourteen (86%) MM patient samples expressed only this 69-kDa protein and lacked Ku86 (Fig. 1GoA, MM 3–14), whereas two patients expressed both the 69-kDa protein and Ku86 (MM 1–2). Immunoblotting of six additional NBM samples from healthy donors detected only normal Ku86 (data not shown). Immunoblotting with anti-Ku70 Ab detected Ku70 in all samples, including those patient MM cells lacking normal Ku86 (Fig. 1GoC).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 1. Ku86v is expressed in patient MM cells and has truncated C terminus. A, WCE (15 µg/lane) of either NBM (lane 1) or patient MM (CD38+CD45RA-) cells (lanes 2–15) were immunoblotted with the following mAbs: S10B1 (Ku86, aa 8–221) (A); 111 (Ku86, aa 610–705) (B); N3H10 (Ku70, aa 506–541) (C); and DM1A ({alpha}-tubulin) (D). E, Immunoblotting using S10B1 mAb of cell lysate preparations was performed, in the presence of protease inhibitors (lanes 1 and 2) and in SDS-PAGE sample buffer without protease inhibitors (lanes 3 and 4). Lanes 1 and 3 are MM cells of an individual patient, whereas lanes 2 and 4 are MM cells from another patient. Protein markers are at 66 and 97 kDa.

 
To further characterize this 69-kDa protein, immunoblotting of WCE of patient MM cells and NBM was performed using mAbs targeting distinct Ku86 epitopes. Ab directed to Ku86 N terminus (S10B1) was immunoreactive with Ku86 in the NBM control, both Ku86 and Ku86v in two MM patient samples (MM 1 and 2), and Ku86v only in the remainder of patient MM cells (Fig. 1GoA, MM 3–14). Immunoblotting with other Abs targeting Ku86 N terminus (NC91: aa 1–374 and 5E2: aa 535–543) demonstrated a similar pattern of reactivity (data not shown). In contrast, immunoblotting with mAb directed at Ku86 C terminus (111) precipitated Ku86 in NBM control and in two MM patient samples (MM 1 and 2), but no reactivity was noted in those patient MM cells expressing only Ku86v (MM 3–14) (Fig. 1GoB). Moreover, increased loading of WCE (75–100 µg/lane) before immunoblotting with mAb 111 did not alter results. Because Ku86 associates with Ku70, we also examined the expression of Ku70 in these WCE. Immunoblotting with mAb N3H10, which targets aa 506–541 of Ku70, demonstrated Ku70 in NBM and all patient MM cells (Fig. 1GoC). Immunoblotting with {alpha}-tubulin Ab further confirmed integrity of protein lysates (Fig. 1GoD). Finally, to ensure that the Ku86v is expressed in vivo and not the product of in vitro proteolysis during lysate preparation, MM cells (CD38+CD45RA-) from two patients were divided into two aliquots. Cell lysates from the first aliquot in each case were prepared in the presence of protease inhibitors, as described in Materials and Methods. Cell lysates were prepared from the second aliquot of MM cells from each patient directly in SDS-PAGE sample buffers. Immunoblotting was performed using mAb against Ku86 N terminus (S10B1). As shown in Fig. 1GoE, the expression of Ku86v was similarly detected in the presence or absence of protease inhibitors. In addition, the ratio of Ku86 to Ku86v was not changed either in the presence or absence of protease inhibitors. Similar results were obtained using another Ku86 N terminus mAb 5E2 (data not shown).

Ku86v in patient MM cells exhibits differential electrophoretic mobility

Ku binds to double-stranded (ds) DNA ends, which is required for formation of Ku-DNA-PK complex formation and kinase activity. Therefore, we first tested the binding activity of Ku86 and Ku86v to synthetic dsDNA fragments in an EMSA to determine whether Ku86v induces differential DNA-protein complex formation and electrophoretic mobility. We used a 25-mer dsDNA probe for EMSA analysis, because a 25- to 30-bp dsDNA fragment is the minimum length required for the binding of a single Ku heterodimer (8). WCE from two patient MM cells expressing both Ku86 and Ku86v (MM 1 and 2), as well as NBM and CESS cells, were studied. As can be seen in Fig. 2Go, WCE from CESS, patient MM 1 and 2, as well as NBM formed a complex with the oligomer probe (complex A). EMSA using mAb against Ku86/Ku70 heterodimer (162), Ku86 C terminus (111), and Ku86 N terminus (S10B1) supershifted complex A in all of these samples. Another complex of WCE with the oligomer probe (complex B) was observed only in patients MM 1 and 2. EMSA using S10B1 Ab, but not 162 or 111 Abs, supershifted complex B. These results show that complex B contains Ku86v and suggest that Ku86v might form a Ku86v-DNA complex with differential mobility.



View larger version (78K):
[in this window]
[in a new window]
 
FIGURE 2. Differential electrophoretic mobility and DEB activity of Ku86v vs Ku86 in patient MM cells. WCE (1 µg) obtained from CESS, patient MM cells with both Ku86 and Ku86v (MM 1 and 2), and NBM were incubated with 25-bp radiolabeled dsDNA probe in the presence of 1 µg of closed circular plasmid DNA as a nonspecific competitor. Either no Ab (control) or (1.5–2.0 µg) of the following mAbs were preincubated with WCE before adding to binding mixtures: Ab 162 (against Ku86/Ku70 heterodimer); Ab 111 (targets aa 610–705 of Ku86 C terminus); and Ab S10B1 (against aa 8–221 of Ku86 N terminus). The mixtures were then subjected to EMSA analysis on a 5% polyacrylamide gel; the gel was dried and subsequently exposed to x-ray film. Complex A contains Ku86 protein-DNA complexes, and complex B contains Ku86v-DNA complex.

 
To confirm the formation of this distinct Ku86v-DNA complex in patient MM cells, WCE of patient MM cells with only Ku86v were similarly evaluated in EMSA. As can be seen in Fig. 3Go, protein-DNA complex formation (complex A) was observed in WCE from three NBM. However, in those patient MM cells expressing only Ku86v (MM 3–14), only Ku86v-DNA (complex B) was observed, confirming the distinct mobility of Ku86v-DNA vs Ku86-DNA complexes. All cell extracts retain DNA binding activity, because DNA-protein complexes were readily detectable on EMSA in the absence of either plasmids or poly(dI:dC) as nonspecific competitors (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 3. Electrophoretic mobility and DEB activity of Ku86v in patient MM cells. WCE (1 µg) obtained from 3 NBM, 2 MM patients with both Ku86 and Ku86v, and 12 MM patients that express only Ku86v (MM 3–14) were incubated with 25-bp radiolabeled dsDNA probe in the presence of 1 µg of closed circular plasmid DNA as a nonspecific competitor. Complex A contains Ku86-DNA and complex B contains Ku86v-DNA.

 
MM patient WCE demonstrate decreased Ku-DNA-PKcs complex formation and kinase activity

After formation of Ku-DNA complexes, DNA-PKcs is recruited and kinase activity is induced. To assay for Ku-DNA-PKcs complex formation and kinase activity, DNA-cellulose was added to WCE from CESS cells, NBM, and patient MM cells, and centrifugation used to "pull-down" DNA-binding proteins, as previously described (18). Proteins associated with DNA cellulose were next eluted and subjected to Western blot analysis. As can be seen in Fig. 4GoA, Ku86, Ku70 and DNA-PKcs were associated with DNA in NBM and CESS cells. In patients MM 1 and 2, known to express both Ku86 and Ku86v, Ku86, Ku70, and DNA-PKcs were similarly associated with DNA. However, in patients MM 3–6, which express Ku86v but lack Ku86, only Ku70 (but little, if any, DNA-PKcs) was associated with DNA. Patients MM 7–14, which express Ku86v alone, also showed similar association of DNA with Ku70, but not with DNA-PKcs (data not shown). Immunoblotting of WCE from CESS cells, NBM, and patient MM cells confirmed the presence of DNA-PKcs in all samples (Fig. 4GoB). These results demonstrate that the Ku86v-DNA complex in patient MM cells cannot interact with DNA-PKcs.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 4. Ku-DNA-PKcs complex formation is reduced in patient MM cells with Ku86v. DNA-cellulose was added to WCE from CESS cells, NBM, and patient MM cells, and centrifugation used to "pull-down" DNA-binding proteins, as previously described (18 ). A, DNA-binding proteins (150 µg) were immunoblotted with anti-DNA-PKcs Ab (), anti-Ku70 Ab (N3H10), and anti-Ku86 Ab (S10B1). B, WCE (15 µg) from CESS cells, NBM, and patient MM cells were subjected to immunoblotting with anti-DNA-PKcs Ab (18-2).

 
Given that Ku-DNA-PKcs is required for activation of DNA-PKcs kinase activity, we next determined whether the lack of DNA-PKcs interaction with Ku86v-DNA in patient MM cells correlated with a lack of DNA-PK activity. The DNA cellulose pellets from WCE "pull down" experiments of patient MM cells and NBM were assayed for DNA-PK activity, using wild-type p53 peptide as substrate in the presence of [{gamma}-32P]ATP. To assure specificity of DNA-PK-catalyzed phosphorylation and to control for DNA-PK independent, nonspecific phosphorylation of the p53 peptide, assays were also performed either in the absence of substrate or using mutated p53 peptide as substrate. As shown in Fig. 5Go, DNA-PK activity was demonstrable in NBM and in CESS cells, as well as in patient MM 1 and 2 cells, but was absent in patients MM 3–6. In patients MM 7–14 that express Ku86v alone, DNA-PK activity was similarly undetectable (data not shown). These results show that DNA-PK activity was detectable only in those MM cells expressing both Ku86 and Ku86v (MM 1 and 2) and is absent in MM cells with only Ku86v (MM 3–6), further confirming the lack of interaction of Ku86v with DNA-PKcs.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 5. Ku-DNA-PKcs kinase activity is reduced in patient MM cells with Ku86v. DNA-cellulose was added to WCE from CESS, NBM, and patient MM cells, and centrifugation used to "pull-down" DNA-binding proteins as previously described (18 ). DNA binding proteins (150 µg) were assayed for DNA-PK activity, using wild-type p53 peptide (filled columns) as substrate in the presence of [{gamma}-32P]ATP. To assure specificity of DNA-PK-catalyzed phosphorylation and control for DNA-PK independent, nonspecific phosphorylation of the p53 peptide, assays were also performed either in the absence of substrate or using mutated p53 peptide (dotted columns) as substrate. Values represent mean ± SEM of three experiments.

 
Patient MM cells with Ku86v have increased sensitivity to DNA damage

Because Ku-DNA-PKcs is required for DSB repair and Ku86v-DNA is incapable of forming complexes with DNA-PKcs, we next examined the sensitivity of patient MM cells to DNA damaging agents including {gamma} irradiation, mitomycin C, and bleomycin. Specifically, we delineated the number of viable and preapoptotic MM cells, using trypan blue exclusion and annexin V-FITC/FACS analysis, respectively, before and after treatment with these agents. Viability studies using trypan blue exclusion showed that patient MM cells expressing only Ku86v were more sensitive to {gamma} irradiation, mitomycin C, and bleomycin, than patient MM cells expressing both Ku86v and Ku86 or control NBM cells expressing only full-length Ku86 (Fig. 6Go, left). Annexin-V staining also revealed increased apoptotic cells after treatment of Ku86v MM cells vs MM cells expressing both Ku86 and Ku86v or control NBM cells expressing only full-length Ku86 (Fig. 6Go, right).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 6. Patient MM cells (CD38+CD45RA-) with Ku86v have increased sensitivity to DNA damage. Patient MM cells expressing either both Ku86 and Ku86v ({diamond}, {square}) or Ku86v alone ({blacktriangleup}, {diamondsuit}, {blacksquare}, •) and the control NBM cells (x, {circ}, {triangleup}) were treated with {gamma} irradiation (A), mitomycin C (B), or bleomycin (C). Cells were then cultured for 2 days, and the percentage of viable cells in control vs treated cultures was evaluated by trypan blue exclusion (left). The percentage of apoptotic cells was determined by staining with annexin-V and FACS analysis (right). For each dose, the average ± SE of triplicates or quadruplicates is given.

 
Ku86 transcripts are detected in patient MM cells with Ku86v

To determine whether the Ku86v in human MM cells is derived from altered Ku86 transcripts, we performed Northern blot analysis using Ku86 cDNA probes. The 5' and 3' probes for the analysis were obtained by RT-PCR using 5'-1/5'-2 and 3'-1/3'-2 primer pairs in Fig. 8GoA. As shown in Fig. 7Go, A and B, Ku86 cDNA probes hybridized to two mRNAs of 2.6 and 3.4 kb in the control NBM sample as previously described in human cell line and normal tissues (35). When 5' probe was used, both Ku86 transcripts were detected in MM samples expressing Ku86v alone (Fig. 7GoA, lanes 4–6). When 3' probe was used, neither band was detected in RNA samples from MM cells expressing Ku86v alone (Fig. 7GoB, lanes 4–6). A 32P end-labeled oligonucleotide probe for 18S rRNA was used as an internal control to ensure the loading and quality of RNA. These results suggest that human MM cells expressed Ku86 transcripts truncated at the 3' end.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 7. Patient MM cells (CD38+CD45RA-) with Ku86v have altered Ku86 transcripts on Northern blot analysis. Five micrograms of total cellular RNA from control NBM (lane 1), patient MM 1–2 (lanes 2 and 3), and patient MM 3–5 (lanes 4–6) were separated on a 1.2% agarose-formaldehyde gel, transferred to nitrocellulose membrane, and hybridized with 32P-labeled Ku86 cDNA probes: 5' probe (1097 bp) (A) and 3' probe (1082 bp) (B). A 32P end-labeled oligonucleotide probe for 18S rRNA was used as the loading control. The size of the two Ku86 transcripts detected is indicated in control NBM sample (lane 1).

 
Due to the limits in the sensitivity of Northern blotting, we further performed RT-PCR of patient MM samples using primer pairs listed in Fig. 8GoA. These primer pairs allowed the amplification of coding regions of Ku86 cDNA (accession number M30938). RT-PCR for {beta}-actin was served as an internal control for integrity of RNA. RNA from NBM (Fig. 8Go, B and C, lane 2) was served as a positive control. As shown in Fig. 8GoB, when primers for 5' Ku86 transcript (5'-1/5'-2) were used, RT-PCR products were detected in all patient MM samples (1097 bp, lanes 3-15). This 5' end product (1097 bp) contains 366 N terminus amino acids of the Ku86 protein from residue 40 to 406. When primers for 3' Ku86 transcript were used (e.g., 3'-1/3'-2), MM samples with both Ku86 and Ku86v (MM 1–2 in lanes 3 and 4) have easily detectable 1082 bp product (Fig. 8GoC), which is either absent or weakly detected in MM samples with Ku86v alone (MM 3–13 in lanes 5–15). The 3' end product contains 362 C terminus amino acids of the Ku 86 protein from residue 377 to 732, plus 18 bp of untranslated region of Ku transcript. Other 3' Ku86 primer pairs (F2/B2 and F3/B3) similarly amplified detectable RT-PCR products in samples MM 1 and 2, which were either absent or weakly detectable in patients with Ku86v alone (patient MM 3–13) (data not shown). {beta}-actin was readily detected in all patient samples (Fig. 8Go, B and C). We were able to obtain sufficient purified RT-PCR product for sequencing from the positive samples and confirmed normal Ku86 sequences (36) without mutations or deletions.

Sequencing of Ku86v protein

Ku86v protein (69 kDa) was excised from an 8% SDS-PAGE gel and sequencing was performed. Twenty peptides (6–18 amino acid residues) contained within this 69-kDa protein were sequenced and identical with Ku86.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we characterized Ku86 protein and function in freshly isolated patient MM cells. We demonstrated that Ku86v, a 69-kDa variant of Ku86, is expressed in patient MM cells. Immunoblotting using Abs specific for either C or N terminus of Ku86 suggested that Ku86v has truncated C terminus, which was confirmed in EMSA supershift experiments. Ku86v had decreased DEB activity and ability to form complexes with DNA-PKcs, resulting in decreased DNA-PK activity. Ku86v in MM cells correlates with sensitivity to DNA damaging agents and responsiveness to {gamma} irradiation and chemotherapy. In contrast, Ku86 in patient MM cells is associated with resistance to these agents. This study, coupled with reports that increased expression and activity of Ku86 is correlated with chemoresistance, suggests that Ku86 may be a therapeutic target to modulate resistance.

The presence of Ku86v with a truncated C terminus in patient MM cells was suggested by immunoblotting using Abs targeting Ku86 N terminus (S10B1, NC91, and 5E2) and Ab targeting Ku86 C terminus (111), and confirmed using EMSA supershift experiments. To date, the mechanism for generation of Ku86v in MM cells remains undefined and under active investigation. Although Ku86v may be derived from spliced variants of Ku86 transcripts, we have not to date observed additional species of Ku86 mRNA on Northern blotting of patient MM cells. In Northern blotting, we have detected normal Ku86 mRNA using 5' probe (Fig. 7GoA) in all samples; however, no Ku86 transcript (3.4 kb) was detected in those patient MM cells expressing Ku86v alone (patient MM 3–5) using 3' probe (Fig. 7GoB). Given the limits of detection of Northern blotting, we next used RT-PCR with primer pairs to amplify 5' and 3' Ku86 transcripts. 5' Ku86 transcripts were readily detectable in all patient samples (Fig. 8GoB), but as shown in Fig. 8GoC, 3' Ku86 transcripts were either absent or weakly detectable in samples from the majority of patient MM cells expressing Ku86v alone (patient MM 3–13). Specifically, the 5' end product (1097 bp) is present in both normal and all MM cells, whereas the 3' end product (1082 bp) is either absent or weakly detectable in those MM cells with Ku 86v alone. These data are consistent with two possibilities. The first is posttranscriptional modification because the 5' end can be amplified in RT-PCR in all cases, whereas the 3' end cannot be amplified in some samples. The second possibility is that at least some of the MM cells being analyzed are heterozygous at the Ku locus, that wild-type mRNA might be produced from one allele but not both, and that the mutated Ku (Ku86v) has a dominant effect in tumorigenesis.

In these and ongoing studies, the protein lysates were prepared in the presence of proteinase inhibitors, e.g., aprotinin, leupeptin, PMSF, pepstatin, and proteinase inhibitors (proteinase inhibitor cocktail tablets due to reports of an elevated proteolytic activity in human fibroblasts (37). pH was carefully maintained to assure inhibitor activity. We have also performed experiments to lyse MM cells directly in SDS lysing buffer and boiled samples for 5 min immediately before Western blot analysis, a process that inactivates protease activity. Finally, Ku86v (69 kDa) was reproducibly detected in preparations from the majority of MM patients, but not from NBM donors, under identical experimental conditions. The integrity of the protein lysates was assured by immunoblotting for tubulin. In addition, as shown in Fig. 1GoE, the Ku86v was similarly detected in lysates prepared using SDS-PAGE sample buffer. Therefore, truncated Ku86 protein, as described by Jeng et al. (37), was not present in this study.

Our studies demonstrated that C terminus truncation to form Ku86v has several functional sequelae. First, Ku86v demonstrates distinct electrophoretic mobility than Ku86, with supershifting on EMSA using Ab against Ku86 N terminus, but not with Ab against C terminus. In our hands, Ab against the Ku86/Ku70 heterodimer (38) did not supershift Ku86v in MM cells, suggesting either the lack of heterodimer formation of Ku70 with Ku86v or formation of a Ku70/Ku86v complex that is not recognized by this Ab. Our studies further suggest that Ku70 does form complexes with Ku86v, based upon supershifting of Ku86v EMSA using Ab specific for Ku70. Moreover our "pull down" experiments to characterize DNA binding proteins within patient MM WCE demonstrate the presence of both Ku86v and Ku70. Interestingly, a Ku86 variant with truncated C terminus has been reported in HL-60 promyelocytic leukemia cells and CLL cells that form heterodimers with Ku70 (27, 28, 29). This Ku86 variant has molecular mass (~69–71 kDa) similar to the Ku86v in patient MM cells (69 kDa). Therefore, it appears that both Ku86v in HL-60 or CLL cells and Ku86v in patient MM cells can bind Ku70. EMSA demonstrated that Ab against the Ku86/Ku70 heterodimer completely supershifted the DNA-protein complex formed from HL60 cell nuclear extracts (27). However, Ku86v in HL-60 was not sequenced, either at the nucleic acid or peptide level; therefore, we cannot conclude at present whether Ku86v in HL-60 cells is the same Ku86 variant as we have identified in MM cells.

Our studies suggest that Ku86v in patient MM cells has decreased DEB activity compared with Ku86. Numerous yeast hybrid studies have permitted mapping of those regions of Ku86 and Ku70 subunits that bind to each other or to DNA (39, 40, 41, 42, 43). A region in the C terminus of both Ku70 and Ku86 (150 aa) appears to be essential for heterodimer formation, whereas larger regions of both Ku70 and Ku86 are required for effective DEB activity (44). Wang et al. (45) has reported that amino acids 371–510 of Ku86 interact with Ku70, and that amino acids 179–732 of Ku86 (C terminus) are required for DEB. Our results are in accordance with these findings, because the Ku86v in patient MM cells has C terminus truncation and related decreased DEB activity.

Perhaps the most important effect of C terminus truncation on the functional repertoire of Ku86v in patient MM cells is its inability to complex with DNA-PKcs and activate DNA-PKcs, which is essential for repair of DNA damage. Singleton et al. (46) have used a series of C-terminal truncated Ku86 mutants to define the C terminus region required for interaction with DNA-PKcs and kinase activation. This report and the current study both demonstrate that truncation of Ku86 C terminus can result in loss of DNA-PKcs binding and kinase activity. Moreover, in their model using CHO mutants with C terminus deletions (46) as well as in this study of Ku86v in patient MM cells, this lack of Ku86v complex formation with DNA-PKcs and kinase activity resulted in sensitivity to {gamma} irradiation, due to decreased DNA repair. We extended these studies to other DNA damaging agents, namely mitomycin C and bleomycin, and showed that sensitivity of MM cells to these agents correlated with Ku86v expression, and conversely, that expression of Ku86 in patient MM cells conferred relative resistance to these treatments. Therefore these studies shed insight into the mechanism of sensitivity to DNA damage in some MM cells and further suggest that Ku86 may be a potential target to overcome resistance to radiation or chemotherapy. Ongoing studies will examine MM cells freshly isolated from patients both before and after treatment with DNA damaging agents, to correlate Ku86 status with response in vivo, and conversely, to determine whether drug resistant cells have increased expression of normal Ku86. Recent reports have also demonstrated increased Ku86 expression, Ku-DEB activity, and DNA-PK activity both in human chronic lymphocytic leukemia cells resistant to radiation and chemotherapy (47) and in a murine model of leukemia (48). Finally, the recent observation that Ku86-null ES cells exhibit hypersensitivity to chemotherapeutic agents (e.g., etoposide VP-16, bleomycin) (49, 50) further supports the potential utility of targeting Ku86 to modulate chemosensitivity.


    Acknowledgments
 
We thank Dr. Guillermo E. Taccioli for critical discussion in the preparation for this manuscript and Gloria Young for technical assistance.


    Footnotes
 
1 This study was supported by a Kathy Giusti Multiple Myeloma Research Foundation Fellowship (to Y.T.T.) and a Doris Duke Distinguished Clinical Scientist Award (to K.C.A.). Back

2 Address correspondence and reprint requests to Dr. Kenneth C. Anderson, Department of Adult Oncology, Dana-Farber Cancer Institute, M557, 44 Binney Street, Boston, MA 02115. Back

3 Abbreviations used in this paper: MM, multiple myeloma; DSBs, double-stranded DNA breaks; WCE, whole cell extracts; DEB, DNA end binding; CM, complete medium; BM, bone marrow; IR, ionizing radiation; NBM, normal BM; DNA-PK, DNA-dependent protein kinase; DNA-PKcs, DNA-dependent protein kinase catalytic subunit. Back

Received for publication March 2, 2000. Accepted for publication August 30, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hallek, M., P. Leif Bergsagel, K. C. Anderson. 1998. Multiple myeloma: increasing evidence for a multistep transformation process. Blood 91:3.[Free Full Text]
  2. Bergsagel, P. L., E. Nardini, L. Brents, M. Chesi, W. M. Kuehl. 1997. IgH translocations in multiple myeloma: a nearly universal event that rarely involves c-myc. Curr. Top. Microbiol. Immunol. 224:283.[Medline]
  3. Chu, G.. 1997. Double strand break repair. J. Biol. Chem. 272:24097.[Free Full Text]
  4. Karanjawala, Z. E., U. Grawunder, C. L. Hsieh, M. R. Lieber. 1999. The nonhomologous DNA end joining pathway is important for chromosome stability in primary fibroblasts. Curr. Biol. 9:1501.[Medline]
  5. Jackson, S. P., P. A. Jeggo. 1995. DNA double-strand break repair and V(D)J recombination: involvement of DNA-PK. Trends Biochem. Sci. 20:412.[Medline]
  6. Dynan, W. S., S. Yoo. 1998. Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids. Nucleic Acids Res. 26:1551.[Abstract/Free Full Text]
  7. Mimori, T., M. Akizuki, H. Yamagata, S. Inada, S. Yoshida, M. Homma. 1981. Characterization of a high m.w. acidic nuclear protein recognized by autoantibodies in sera from patients with polymyositis-scleroderma overlap. J. Clin. Invest. 68:611.
  8. Mimori, T., J. A. Hardin. 1986. Mechanism of interaction between Ku protein and DNA. J. Biol. Chem. 261:10375.[Abstract/Free Full Text]
  9. Falzon, M., J. W. Fewell, E. L. Kuff. 1993. EBP-80, a transcription factor closely resembling the human autoantigen Ku, recognizes single- to double-strand transitions in DNA. J. Biol. Chem. 268:10546.[Abstract/Free Full Text]
  10. Blier, P. R., A. J. Griffith, J. Craft, J. A. Hardin. 1993. Binding of Ku protein to DNA: measurement of affinity for ends and demonstration of binding to nicks. J. Biol. Chem. 268:7594.[Abstract/Free Full Text]
  11. Suwa, A., M. Hirakata, Y. Takeda, S. A. Jesch, T. Mimori, J. A. Hardin. 1994. DNA-dependent protein kinase (Ku protein-p350 complex) assembles on double-stranded DNA. Proc. Natl. Acad. Sci. USA 91:6904.[Abstract/Free Full Text]
  12. Gottlieb, T. M., S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku Ag. Cell 72:131.[Medline]
  13. Lees-Miller, S. P., Y. R. Chen, C. W. Anderson. 1990. Human cells contain a DNA-activated protein kinase that phosphorylates SV40 T: Ag, mouse p53, and the human Ku autoantigen. Mol. Cell. Biol. 10:6472.[Abstract/Free Full Text]
  14. Jeggo, P. A.. 1998. Identification of genes involved in repair of DNA double-strand breaks in mammalian cells. Radiat. Res. 150:S80.[Medline]
  15. Smider, V., W. K. Rathmell, M. R. Lieber, G. Chu. 1994. Restoration of x-ray resistance and V(D)J recombination in mutant cells by Ku cDNA. Science 266:288.[Abstract/Free Full Text]
  16. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson, P. A. Jeggo. 1994. Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination. Science 265:1442.[Abstract/Free Full Text]
  17. Errami, A., V. Smider, W. K. Rathmell, D. M. He, E. A. Hendrickson, M. A. Zdzienicka, G. Chu. 1996. Ku86 defines the genetic defect and restores x-ray resistance and V(D)J recombination to complementation group 5 hamster cell mutants. Mol. Cell. Biol. 16:1519.[Abstract]
  18. Finnie, N. J., T. M. Gottlieb, T. Blunt, P. A. Jeggo, S. P. Jackson. 1995. DNA-dependent protein kinase activity is absent in xrs-6 cells: implications for site-specific recombination and DNA double-strand break repair. Proc. Natl. Acad. Sci. USA 92:320.[Abstract/Free Full Text]
  19. Zhu, C., M. A. Bogue, D. S. Lim, P. Hasty, D. B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86:379.[Medline]
  20. Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, G. C. Li. 1996. Requirement for Ku80 in growth and Ig V(D)J recombination. Nature 382:551.[Medline]
  21. Ouyang, H., A. Nussenzweig, A. Kurimasa, V. C. Soares, X. Li, C. Cordon-Cardo, W. Li, N. Cheong, M. Nussenzweig, G. Iliakis, et al 1997. Ku70 is required for DNA repair but not for T cell Ag receptor gene recombination in vivo. J. Exp. Med. 186:921.[Abstract/Free Full Text]
  22. Casellas, R., A. Nussenzweig, R. Wuerffel, R. Pelanda, A. Reichlin, H. Suh, X. F. Qin, E. Besmer, A. Kenter, K. Rajewsky, M. C. Nussenzweig. 1998. Ku80 is required for Ig isotype switching. EMBO J. 17:2404.[Medline]
  23. Rolink, A., F. Melchers, J. Andersson. 1996. The SCID but not the RAG-2 gene product is required for S µ-S {epsilon} heavy chain class switching. Immunity 5:319.[Medline]
  24. Difilippantonio, M. J., J. Zhu, H. T. Chen, E. Meffre, M. C. Nussenzweig, E. E. Max, T. Ried, A. Nussenzweig. 2000. DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation. Nature 404:510.[Medline]
  25. Zelazowski, P., E. E. Max, M. R. Kehry, C. M. Snapper. 1997. Regulation of Ku expression in normal murine B cells by stimuli that promote switch recombination. J. Immunol. 159:2559.[Abstract]
  26. Grawunder, U., N. Finnie, S. P. Jackson, B. Riwar, R. Jessberger. 1996. Expression of DNA-dependent protein kinase holoenzyme upon induction of lymphocyte differentiation and V(D)J recombination. Eur. J. Biochem. 241:931.[Medline]
  27. Han, Z., C. Johnston, W. H. Reeves, T. Carter, J. H. Wyche, E.A. Hendrickson. 1996. Characterization of a Ku86 variant protein that results in altered DNA binding and diminished DNA-dependent protein kinase activity. J. Biol. Chem. 271:14098.[Abstract/Free Full Text]
  28. Muller, C., B. Salles. 1997. Regulation of DNA-dependent protein kinase activity in leukemic cells. Oncogene 15:2343.[Medline]
  29. Muller, C., C. Dusseau, P. Calsou, B. Salles. 1998. Human normal peripheral blood B-lymphocytes are deficient in DNA-dependent protein kinase activity due to the expression of a variant form of the Ku86 protein. Oncogene 16:2553.
  30. Teoh, G., M. Urashima, E. A. Greenfield, K. A. Nguyen, J. F. Lee, D. Chauhan, A. Ogata, S. P. Treon, K. C. Anderson. 1998. The 86-kDa subunit of Ku autoantigen mediates homotypic and heterotypic adhesion of multiple myeloma cells. J. Clin. Invest. 101:1379.[Medline]
  31. Tai, Y. T., G. Teoh, Y. Shima, D. Chauhan, S. P. Treon, N. Raje, T. Hideshima, F. E. Davies, K. C. Anderson. 2000. Isolation and characterization of human multiple myeloma cell enriched populations. J. Immunol. Methods 235:11.[Medline]
  32. Jourdan, M., M. Ferlin, E. Legouffe, M. Horvathova, J. Liautard, J. F. Rossi, J. Wijdenes, J. Brochier, B. Klein. 1998. The myeloma cell Ag syndecan-1 is lost by apoptotic myeloma cells. Br. J. Hematol. 100:637.[Medline]
  33. Sun, R. X., Z. Y. Lu, J. Wijdenes, J. Brochier, C. Hertog, J. F. Rossi, B. Klein. 1997. Large scale and clinical grade purification of syndecan-1+ malignant plasma cells. J. Immunol. Methods 205:73.[Medline]
  34. Calsou, P., P. Frit, O. Humbert, C. Muller, D. J. Chen, B. Salles. 1999. The DNA-dependent protein kinase catalytic activity regulates DNA end processing by means of Ku entry into DNA. J. Biol. Chem. 274:7848.[Abstract/Free Full Text]
  35. Cai, Q. Q., A. Plet, J. Imbert, M. Lafage-Pochitaloff, C. Cerdan, J. M. Blanchard. 1994. Chromosomal location and expression of the genes coding for Ku p70 and p80 in human cell lines and normal tissues. Cytogenet. Cell Genet. 65:221.[Medline]
  36. Mimori, T., Y. Ohosone, N. Hama, A. Suwa, M. Akizuki, M. Homma, A. J. Griffith, J. A. Hardin. 1990. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome. Proc. Natl. Acad. Sci. USA 87:1771.
  37. Jeng, Y.-W, H.-C. Chao, C.-F. Chiu, W.-G. Chou. 1999. Senescent human fibroblasts have elevated Ku86 proteolytic cleavage activity. Mutat. Res. 435:225.[Medline]
  38. Wang, J., M. Satoh, A. Pierani, J. Schmitt, C. H. Chou, H. G. Stunnenberg, R. G. Roeder, W. H. Reeves. 1994. Assembly and DNA binding of recombinant Ku (p70/p80) autoantigen defined by a novel mAb specific for p70/p80 heterodimers. J. Cell Sci. 107:3223.[Abstract]
  39. Wu, X., M. R. Lieber. 1996. Protein-protein and protein-DNA interaction regions within the DNA end-binding protein Ku70-Ku86. Mol. Cell. Biol. 16:5186.[Abstract]
  40. Lieber, M. R., U. Grawunder, X. Wu, M. Yaneva. 1997. Tying loose ends: roles of Ku and DNA-dependent protein kinase in the repair of double-strand breaks. Curr. Opin. Genet. Dev. 7:99.[Medline]
  41. Jin, S., D. T. Weaver. 1997. Double-strand break repair by Ku70 requires heterodimerization with Ku80 and DNA binding functions. EMBO J. 16:6874.[Medline]
  42. Osipovich, O., S. K. Durum, K. Muegge. 1997. Defining the minimal domain of Ku80 for interaction with Ku70. J. Biol. Chem. 272:27259.[Abstract/Free Full Text]
  43. Cary, R. B., F. Chen, Z. Shen, D. J. Chen. 1998. A central region of Ku80 mediates interaction with Ku70 in vivo. Nucleic Acids Res. 26:974.[Abstract/Free Full Text]
  44. Smith, G. C., S. P. Jackson. 1999. The DNA-dependent protein kinase. Genes Dev. 13:916.[Free Full Text]
  45. Wang, J., X. Dong, W. H. Reeves. 1998. A model for Ku heterodimer assembly and interaction with DNA: implications for the function of Ku Ag. J. Biol. Chem. 273:31068.[Abstract/Free Full Text]
  46. Singleton, B. K., M. I. Torres-Arzayus, S. T. Rottinghaus, G. E. Taccioli, P. A. Jeggo. 1999. The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit. Mol. Cell. Biol. 19:3267.[Abstract/Free Full Text]
  47. Muller, C., G. Christodoulopoulos, B. Salles, L. Panasci. 1998. DNA-dependent protein kinase activity correlates with clinical and in vitro sensitivity of chronic lymphocytic leukemia lymphocytes to nitrogen mustards. Blood 92:2213.[Abstract/Free Full Text]
  48. Frit, P., Y. Canitrot, C. Muller, N. Foray, P. Calsou, E. Marangoni, J. Bourhis, B. Salles. 1999. Cross-resistance to IR in a murine leukemic cell line resistant to cis-dichlorodiammineplatinum(II): role of Ku autoantigen. Mol. Pharmacol. 56:141.[Abstract/Free Full Text]
  49. Jin, S., S. Inoue, D. T. Weaver. 1998. Differential etoposide sensitivity of cells deficient in the Ku and DNA-PKcs components of the DNA-dependent protein kinase. Carcinogenesis 19:965.[Abstract/Free Full Text]
  50. Kim, S. H., D. Kim, J. S. Han, C. S. Jeong, B. S. Chung, C. D. Kang, G. C. Li. 1999. Ku autoantigen affects the susceptibility to anticancer drugs. Cancer Res. 59:4012.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
P. J. Hayden, P. Tewari, D. W. Morris, A. Staines, D. Crowley, A. Nieters, N. Becker, S. de Sanjose, L. Foretova, M. Maynadie, et al.
Variation in DNA repair genes XRCC3, XRCC4, XRCC5 and susceptibility to myeloma
Hum. Mol. Genet., December 15, 2007; 16(24): 3117 - 3127.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
D. Schaue and W. H. McBride
Counteracting tumor radioresistance by targeting DNA repair
Mol. Cancer Ther., October 1, 2005; 4(10): 1548 - 1550.
[Full Text] [PDF]


Home page
BloodHome page
L. Deriano, O. Guipaud, H. Merle-Beral, J.-L. Binet, M. Ricoul, G. Potocki-Veronese, V. Favaudon, Z. Maciorowski, C. Muller, B. Salles, et al.
Human chronic lymphocytic leukemia B cells can escape DNA damage-induced apoptosis through the nonhomologous end-joining DNA repair pathway
Blood, June 15, 2005; 105(12): 4776 - 4783.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. H. Um, J. K. Kwon, C.-D. Kang, M. J. Kim, D. S. Ju, J. H. Bae, D. W. Kim, B. S. Chung, and S. H. Kim
Relationship between Antiapoptotic Molecules and Metastatic Potency and the Involvement of DNA-Dependent Protein Kinase in the Chemosensitization of Metastatic Human Cancer Cells by Epidermal Growth Factor Receptor Blockade
J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 1062 - 1070.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Podar, G. Mostoslavsky, M. Sattler, Y.-T. Tai, T. Hayashi, L. P. Catley, T. Hideshima, R. C. Mulligan, D. Chauhan, and K. C. Anderson
Critical Role for Hematopoietic Cell Kinase (Hck)-mediated Phosphorylation of Gab1 and Gab2 Docking Proteins in Interleukin 6-induced Proliferation and Survival of Multiple Myeloma Cells
J. Biol. Chem., May 14, 2004; 279(20): 21658 - 21665.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Podar, Y.-T. Tai, C. E. Cole, T. Hideshima, M. Sattler, A. Hamblin, N. Mitsiades, R. L. Schlossman, F. E. Davies, G. J. Morgan, et al.
Essential Role of Caveolae in Interleukin-6- and Insulin-like Growth Factor I-triggered Akt-1-mediated Survival of Multiple Myeloma Cells
J. Biol. Chem., February 14, 2003; 278(8): 5794 - 5801.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. G. Richardson, R. L. Schlossman, E. Weller, T. Hideshima, C. Mitsiades, F. Davies, R. LeBlanc, L. P. Catley, D. Doss, K. Kelly, et al.
Immunomodulatory drug CC-5013 overcomes drug resistance and is well tolerated in patients with relapsed multiple myeloma
Blood, October 16, 2002; 100(9): 3063 - 3067.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. J. Difilippantonio, S. Petersen, H. T. Chen, R. Johnson, M. Jasin, R. Kanaar, T. Ried, and A. Nussenzweig
Evidence for Replicative Repair of DNA Double-Strand Breaks Leading to Oncogenic Translocation and Gene Amplification
J. Exp. Med., August 19, 2002; 196(4): 469 - 480.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Rodgers, S. J. Jordan, and J. D. Capra
Transient Association of Ku with Nuclear Substrates Characterized Using Fluorescence Photobleaching
J. Immunol., March 1, 2002; 168(5): 2348 - 2355.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y.-T. Tai, K. Podar, D. Gupta, B. Lin, G. Young, M. Akiyama, and K. C. Anderson
CD40 activation induces p53-dependent vascular endothelial growth factor secretion in human multiple myeloma cells
Blood, February 15, 2002; 99(4): 1419 - 1427.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
W. S. Dalton, P. L. Bergsagel, W. M. Kuehl, K. C. Anderson, and J. L. Harousseau
Multiple Myeloma
Hematology, January 1, 2001; 2001(1): 157 - 177.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tai, Y.-T.
Right arrow Articles by Anderson, K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tai, Y.-T.
Right arrow Articles by Anderson, K. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS