|
|
||||||||




Departments of
*
Sexually Transmitted Diseases and Immunology and
Molecular Pathology, University College London, London, United Kingdom;
Clinical Research Center Institute for Cancer Studies, University of Birmingham, Birmingham, United Kingdom; and
The Edward Jenner Institute for Vaccine Research, Compton, Berkshire, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
herpes virus, worldwide in distribution, with
9095% of most adult populations showing serological evidence of
infection (1). The severe symptomatic nature of infectious
mononucleosis (IM)3
allows analysis of individuals with a defined onset of infection.
Resolution of acute infection is followed by life-long asymptomatic
persistent viral carriage in the vast majority of infected individuals.
The cellular immune response is known to be primarily responsible for
control of this virus and therefore provides a convenient model of a
successful T cell response to a chronic viral infection. However, EBV
is associated with a number of malignancies in cases where there is a
failure of normal cellular immunity. Detailed characterization of the
physiological T cell response capable of controlling EBV should
contribute to the optimization of CTL immunotherapy, a therapeutic
approach already under trial for EBV-associated malignancies
(2). Large CD8+ clonal expansions have been described in IM (3), and there is some evidence that clones seen in the memory CTL response are selected during the acute phase and may persist at high circulating frequencies (4), contributing to the CD8+ expansions seen in healthy adults (5). In contrast, CD4+ clonal expansions are rarely detectable in healthy individuals, even with highly sensitive techniques (6, 7, 8), but it is unclear whether this is because large clones do not arise during primary antigenic challenges or whether they are less persistent than the CD8 clones (9). If large CD4 expansions fail to develop during acute antigenic activation of CD4 cells, this could be a result of a smaller overall CD4 Ag-specific response or one that is composed of many smaller clones. New techniques for analyzing Ag-specific responses directly ex vivo have allowed a re-evaluation of antiviral CD8 responses for EBV (10, 11) and other viruses (reviewed in Ref. 12) and have highlighted the large proportion of the response lost during in vitro culture and therefore not detected by conventional cytotoxic assays. Much less is known about the size of CD4 responses in viral infections (13), and these may have been similarly underestimated by limiting dilution analyses (14). Equivalent techniques for direct analysis of responding CD4 cells have only become available more recently and have not yet allowed parallel dissection of the CD4 and CD8 components of a human antiviral response.
TCR repertoire analysis with a sensitive, global method should allow a direct comparison of the clonotypic composition of CD4 and CD8 cells. This approach was chosen to avoid the need for in vitro selection of responding clones, which inevitably involves focusing on functionally delineated responses and can introduce bias into TCR usage (15). Studies of TCR usage, because of their laborious nature, have tended to concentrate on responses to one or two well-described or immunodominant epitopes, particularly the highly conserved EBV-specific response restricted by HLA-B8 (4, 16, 17), which may not be typical of EBV responses restricted by other alleles (18, 19). Although studies with HLA-peptide tetramers have highlighted the striking potential magnitude of responses specific for single EBV epitopes (10), other work has revealed that the numerically immunodominant response is not necessarily that which is most protective (20). In addition, accumulating data stress the role of a multispecific T cell response in maximizing viral control (21, 22, 23), all of which points to the importance of also analyzing smaller responses to subdominant epitopes. Epitopes recognized in class II-restricted responses have not been well defined in many viral infections such as EBV, so that a functionally directed analysis of virus-specific CD4 clonotypes has not been feasible.
Thus, the modified heteroduplex technique (7, 24) is used in this study to provide as broad coverage as possible of the in vivo repertoire of clones responding to acute infection with EBV (regardless of epitope) and to allow sensitive tracking of their fate following disease resolution. Analysis of the CD4 and CD8 fractions is undertaken in parallel to determine whether the well-recognized difference in oligoclonality of these subsets in steady state situations is also detectable during the challenge of an acute lymphoproliferative antiviral response. We combine this method with phenotypic separation of T cell subsets to investigate the CD45 phenotype of persistent EBV-specific clones in the light of increasing evidence that the differentially spliced isoforms of the CD45 molecule may not have a straightforward association with naive and memory pools.
| Materials and Methods |
|---|
|
|
|---|
Eight patients (age range, 1824 years) diagnosed with acute IM
on the basis of characteristic clinical features, atypical
lymphocytosis, and a positive monospot test were recruited through
University College Hospital hematology department and local student
general practitioner services. EBV infection was confirmed by
serological tests for viral capsid Ag IgM Abs. Patients were first
sampled within 10 days of symptom onset and underwent longitudinal
follow-up for up to 1 year (Table I
). Controls were age-matched healthy
laboratory volunteers who had not had an illness suggestive of IM.
Local ethical committee approval for the study was obtained, and all
donors gave written informed consent.
|
PBMC were isolated from heparinized blood samples by Ficoll-Hypaque density centrifugation, and the nonadherent fraction was recovered after a 1-h plastic adherence step at 37°C. CD4 and CD8 T cell subsets were isolated by positive selection using directly conjugated anti-CD4 or anti-CD8 MiniMacs magnetic beads (Miltenyi Biotech, Bisley, Surrey, U.K.). Separated fractions were always >95% pure as assessed by mAb staining and FACS analysis.
Purification of CD45RA and CD45RO subsets was achieved by incubation of nonadherent PBMC with saturating concentrations of a mixture of mAb supernatants (anti-CD14, anti-CD19, anti-CD11b, anti-CD4, and either UCHL1 or SN130 for CD45RA or CD45RO negative selection, respectively). Unwanted stained populations were then removed using goat anti-mouse Ig MiniMacs beads (Miltenyi Biotech). CD45RA populations were highly purified by repeating this process until the number of contaminating CD45RO cells was <1%.
Phenotyping
Expression of different BV segments and activation markers by CD4+ and CD8+ subsets was assessed by flow cytometric analysis following triple staining of nonadherent PBMC with directly conjugated Abs to CD3, CD4, or CD8 and a panel of BV-specific mAbs (Immunotech, Marseilles, France) or CD45RO or HLA-DR (all from Sigma, Poole, U.K.) or CD28 (Becton Dickinson, San Jose, CA). Expression of these markers by BV expansions was analyzed by gating on CD8+ T cells that had also been stained with the relevant BV-specific mAbs and CD45RO or HLA-DR or CD28.
Induction of EBV-specific CTL
PBMC were washed and resuspended in RPMI 1640 and 10% FCS with 1% human serum at a concentration of 1 x 106/ml in a 24-well plate. PBMC from acute IM samples stored in liquid nitrogen were thawed directly in IL-2-enriched medium (containing 30% (v/v) supernatant from the IL-2-secreting cell line MLA-144 (MLA-SN) and 100 U/ml of rIL-2) as described previously (25). The autologous B lymphoblastoid cell line was irradiated (10,000 cGy) and added to give a responder to stimulator ratio of 40:1. Restimulation was conducted 7 days later with the autologous lymphoblastoid cell line at a responder to stimulator ratio of 4:1 and subsequently weekly at a ratio of 10:1. After 2 wk the culture medium was IL-2 enriched as described above. Chromium release assays for EBV specificity and HLA restriction were conducted as described previously (25).
RNA extraction and cDNA synthesis
Total RNA was extracted from 2 to 4 x 106 PBMC or purified subsets of T cells by the guanidinium thiocyanate/acid phenol method using RNAzol B (Biogenesis, Bournemouth, U.K.). Approximately 5 µg of total RNA was used for first-strand cDNA synthesis using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) with RNasin (Promega, Madison, WI) and random hexamer primers.
Oligonucleotides
Oligonucleotides were synthesized and HPLC purified by the
Imperial Cancer Research Fund (London, U.K.). Two BC primers were used:
the consensus internal BC primer (5'-CACCCACGAGCTCAGCTCCACGTGGTC) and
an external BC primer (5'-TGCTGA CCCCACTGTCGACCTCCTTCCCATT), which is
30 bp 3' to the internal primer. The BV primers used were as previously
described (24) for the heteroduplex PCRs. Amplification of
the C
-chain to estimate the total amount of TCR
-chain mRNA in
different samples was conducted using two primers for the C region of
the
-chain (5'-TGGGAAGGAGGTCGACAGTG and
5'-TGGCCTTCCCTAGCAGGATCT) in conjunction with the PCRs below.
Heteroduplex analysis
Twenty-six PCRs were conducted for each analysis in a final
volume of 50 µl and using one-fortieth of the cDNA each. Hot start
PCR was conducted with initial denaturation at 95°C for 5 min,
followed by 30 cycles of 95°C for 30 s, 58°C for 30 s,
and 72°C for 1 min with a final extension period at 72°C for 10
min. Ten microliters of the PCR products was visualized on a 1%
agarose gel. DNA carriers consisting of cDNAs encoding BV124 cloned
from T cell clones or lines were as described previously and were
provided by G. Casorati (24). These were amplified using
the same TCRBV primers and reaction conditions as those for the sample
cDNAs, but with the external BC primer. A 20-µl aliquot of each
sample PCR product was mixed with 400 ng of the appropriate BV-matched
carrier PCR product, denatured at 95°C for 5 min, and allowed to
reanneal at 50°C for 1 h. The mixtures were kept on ice until
loading on a 12% nondenaturing polyacrylamide gel run at 10 mA for
16 h at 4°C. Heteroduplex gels were stained with ethidium
bromide for 30 min for initial visualization of DNA and then blotted
onto nylon Hybond N+ membranes in 20x SSC. The
DNA was denatured and fixed to the membrane by a 20-min incubation in
0.4 M NaOH. The external BC probe was end labeled with
[
-32P]ATP using polynucleotide kinase
(Amersham Pharmacia Biotech, Piscataway, NJ). Membranes were
prehybridized for 15 min in Rapid Hyb Buffer (Amersham Pharmacia
Biotech) at 42°C, hybridized at 42°C for 1 h, and then washed
in 5x SSC/0.1% SDS for 20 min at room temperature, followed by two
washes of 15 min in 1x SSC/0.1% SDS at 42°C. Filters were exposed
to film at -70°C for 6 h. For clonotypic probing, the filter
was stripped by washing in 0.5% SDS at 80°C and rehybridized with
the appropriate N region probe (5'-AGGATCCCCCAACGAGC), with a final
wash with 0.2x SSC/0.1% SDS at 50°C.
Cloning and sequencing of BV PCR products
Cloning of PCR products was conducted using the TA cloning kit (Invitrogen, San Diego, CA). The ligation reaction was incubated at 14°C overnight and then used immediately for transformation of TOP10F' One Shot competent Escherichia coli cells (Invitrogen). White colonies were distinguished from blue colonies not containing an insert and were further tested for inserts by plasmid Miniprep and restriction digestion with EcoRI (Amersham Pharmacia Biotech). Plasmid DNA was purified using Wizard Plus Minipreps (Promega) and sequenced using a modified version of the dideoxy chain termination DNA sequencing method with T7 DNA polymerase from the Sequenase version 2.0 kit (Amersham Pharmacia Biotech).
| Results |
|---|
|
|
|---|
Eight patients with acute infectious mononucleosis were recruited,
six of them within 10 days of symptom onset, and their TCR repertoires
were analyzed directly ex vivo. All six patients analyzed very early in
the course of the infection had lymphocytosis composed mainly of
activated CD8 cells and had one or more large TCRBV-restricted
expansions detectable by mAb staining (Table I
) as previously noted in a larger cohort
(3). However, molecular dissection of their T cell
repertoire showed a much more diverse set of oligoclonal expansions
than had been visualized with mAb staining alone. Available mAbs only
cover half the repertoire, and because the percentage of cells staining
with them can be highly variable in healthy individuals, only large
expansions will be detectable. By contrast, TCR analysis by the
modified heteroduplex technique has been shown to detect clonal
expansions down to a frequency of 1 cell in 10,000, visualized as
discrete bands with a unique, reproducible migration pattern (7, 24). The heteroduplex technique demonstrated not only
oligoclonal expansions in those BV families that were expanded by mAb
staining but also in many of those that appeared within the reference
range with mAb. This is illustrated for donor 7, who had four TCRBV
expansions detectable with a panel of 16 BV-specific mAbs (Table I
)
compared with at least one expansion demonstrable in 21 of 22
BV-specific PCR-heteroduplex tracks (Fig. 1
A). Almost every BV PCR
product from all patient PBMC samples was dominated by oligoclonal
expansions, often with little background polyclonal smear
remaining.
|
All expansions detected are CD8+, whereas the CD4 cells remain polyclonal
The CD4+ helper response is known to be
important in the immune control of acute viral infections, and an
increase in total CD4+ T cell numbers has been
documented in IM despite the inversion in CD4/CD8 ratio resulting from
the far larger increase in CD8+ numbers. There
was also evidence of some activation of CD4+ T
cells in IM compared with healthy controls (data not shown and
demonstrated previously (26, 27)), although, again, this
was far outweighed by the dramatic activation in the
CD8+ fraction. However, as shown in Table I
,
there were no expansions in the CD4+ T cells
detectable with V region-specific mAb staining in any of the IM donors.
More surprisingly, there were no clonal expansions detected in the
CD4+ purified fraction of any of the IM patients,
even by the highly sensitive heteroduplex method. This is demonstrated
for one representative patient in Fig. 2
, for whom IM T cells have been fractionated using magnetic beads into
CD4+ and CD8+ fractions
(purity >97%) and analyzed in parallel, with similar inputs of total
TCR
-chain mRNA, as suggested by the TCRBC PCR control. All the
visible clones are in the CD8+ T cells, with
polyclonal smear patterns throughout the CD4+ T
cells. Parallel molecular TCR analysis of highly purified CD4 and CD8
subsets in five other IM patients showed the same segregation of all
clones detectable by heteroduplex analysis with the CD8, not CD4, cells
(Table I
).
|
Longitudinal follow-up of donors with the heteroduplex technique
showed that many of the TCR expansions seen in the acute response
persisted at a level where they could be detected directly ex vivo
despite full symptom resolution. A large proportion (
50%) of the
bands seen in the first sample taken at the height of the illness
remained visible for the duration of follow-up (up to 11 mo; Fig. 3
). Longitudinal tracking was also
performed in purified CD8+ T cells to remove the
variability attributable to the decrease in the percentage of
circulating CD8+ T cells with time after IM (Fig. 3
B). A number of clones became undetectable in the PBMC
compartment over time and were only visible in purified CD8 cells,
indicating a decrease in clone size, while other clones contracted to
below the threshold of detection even in purified CD8 cells (Fig. 3
B). A marked reduction in clone size was also evidenced by
the quantitation of large TCRBV expansions by mAb staining, showing
contraction of most expansions to within the reference ranges by 3 wk
after symptom onset (data not shown). Thus, the circulating memory pool
of CD8 cells in healthy carriers was composed of a large subset of the
effectors present in acute infection. No new clones appeared on
recovery that had not been visualized in IM (Fig. 3
).
|
EBV-specific CTL comprise many of the same clonotypes seen in fresh ex vivo samples
To investigate the functional specificity of the clones visualized, EBV-specific CTL lines were generated from two of the donors using restimulation with the autologous B lymphoblastoid cell line to gain as broad a representation as possible of the physiological in vivo repertoire of EBV-CTL. In the case of donor 3, the T cell line was generated from PBMC taken 6 mo after acute disease; for donor 4 both acute and memory (4 mo after IM) PBMC were restimulated in parallel. All T cell lines generated exhibited a high percentage (3575%) of EBV-specific lysis of the autologous B lymphoblastoid cell line with which they had been stimulated, detectable at low E:T cell ratios and in repeated CTL assays over a number of weeks.
The CD8+ cells from the T cell lines were
purified and used for heteroduplex analysis. Samples from fresh
CD8+ T cells and the T cell line generated from
the same PBMC were run in adjacent tracks for comparison
(representative examples in Fig. 4
). The
T cell lines were enriched for many of the same clonotypes seen in the
acute ex vivo sample, some of which had subsequently become barely
detectable or undetectable, even in the
CD8+-enriched fraction (Fig. 4
A). This
provided strong supporting evidence that the clonotypes of the
effectors expanded in acute disease overlapped with the clonotypes
involved in the memory CTL response when these individuals were
rechallenged with EBV in vitro. Clonotypic identity between the fresh
and CTL samples was further confirmed by sequencing (see below). The
results of the selective in vitro expansion of EBV-specific CTL
suggested that some of the clones that became undetectable in fresh
circulating CD8+ T cells had not undergone clonal
exhaustion and were capable of re-expansion.
|
There is a disproportionate loss of the CD45RO+ phenotype within oligoclonally expanded CD8+ T cells following IM
At the onset of acute infectious mononucleosis, there was a
striking CD8+ lymphocytosis of
HLA-DR+ CD45RO+ T
lymphocytes. Oligoclonal expansions detectable by TCRBV mAb staining
were also enriched for the HLA-DR+ phenotype, as
noted in a previous study (3). This enrichment persisted
on follow-up, even when the percentage of CD8+ T
cells within a TCRBV family had contracted to within reference ranges,
suggesting ongoing EBV-related activation. This is illustrated for one
donor in Fig. 5
A, for whom a
BV22 expansion accounting for 10.5% of CD8+ T
cells is shown to have a higher fraction positive for HLA-DR than the
rest of the CD8+ T cells both at the onset of
symptoms (time 0) and on full recovery (2 mo).
|
Molecular TCR analysis reveals an accumulation of clonal expansions in the CD45RA+ pool following IM resolution
The phenotypic data showing accumulation of activated,
Ag-experienced CD8 cells with a CD45RA phenotype after IM suggested
that there may be reversion of individual clones from a CD45RO to an RA
phenotype. The CD45 phenotype of clonal expansions in the response to
EBV was therefore further investigated by probing TCR usage at the
molecular level. T cells taken from two individuals during the acute
stage of IM were fractionated into CD45RA and CD45RO subsets. The
CD45RA fractions were highly purified by negative selection, such that
the level of contaminating CD45RO+ or
CD45RA+RO+ double-positive
T cells was <1%. Heteroduplex analysis was conducted simultaneously
for the two fractions to allow the phenotype of multiple different T
cell clonotypes to be identified directly ex vivo. For this purpose,
RT-PCR was conducted on the purified fractions in parallel, and TCR
BV-matched samples were run in adjacent tracks for comparison.
Initially, most of the clonal expansions segregated with the
CD45RO+ fraction, with only a few of the clones
also faintly detectable in the CD45RA+ T cells
(Fig. 6
, A and C).
If this were a result of small amounts of contaminating
CD45RO+ T cells being picked up by the highly
sensitive PCR analysis of the CD45RA+ T cells,
carryover would be expected to be most obvious for the most intense
bands, rather than to occur with this selective pattern.
|
EBV-specific CTL precursors with proliferative potential in vitro were derived from the CD45RO clonotypes
EBV-specific CTL precursors (CTLp) were likely to reside in the
CD45RO fraction in IM, since almost all circulating CD8 cells and
detectable clonotypes had a CD45RO+ phenotype at
this time point (Fig. 6
A). However, in the memory phase,
many of the same clonotypes could also be visualized in the CD45RA pool
(Fig. 6
B), making it difficult to be certain that the CTLp
were still derived from the CD45RO fraction.
The differential segregation of two clones according to CD45 isoform
was therefore used as an opportunity to investigate their contribution
to the memory CTL response. In donor 3, two distinct clones were
visualized in BV23, one segregating with CD45RA, and one segregating
with CD45RO (Fig. 7
A, first
two tracks). To validate this unexpected finding of a prominent
heteroduplex unique to the CD45RA fraction, the BV23
CD45RA+ T cell PCR amplification products were
cloned and sequenced. Twelve of 13 inserts sequenced from the PCR
product were identical across the VDJ junction, confirming the presence
of a large monoclonal CD45RA+ expansion (with the
junctional region sequence shown in Fig. 7
C). The BV23
expansion represented 9.3% of circulating CD8+ T
cells and 13% of circulating CD8+
CD45RA+ T cells by mAb staining. Thus, this
single clone accounted for an estimated 12% of the total
CD8+ naive (CD45RA+)
repertoire and had an approximate clone size of 5 x
107 cells/l in the periphery alone. Tracking of
this large clone by its heteroduplex footprint and by clonotypic
probing (data not shown) confirmed that it persisted at high frequency
in the periphery for at least 9 mo, demonstrating that long-lived
monoclonal expansions can occur in the CD45RA pool. Cloning and
sequencing of the BV23 CD45RO+ T cell PCR product
from the same donor showed the presence of a different expansion,
accounting for 4 of 10 inserts (Fig. 7
C).
|
To investigate this further, we extended the phenotypic analysis of the
BV23CD45RA+ cells, since recent studies in
healthy donors have described a
CD45RA+CD28-CD27-
subset within the CD45RA pool that exhibits direct cytolytic, but not
CTL precursor, activity (28). The percentage of BV23 cells
staining for CD45RA increased following IM, consistent with the
development of the large monoclonal expansion described above.
Costaining with CD28 and CD45RA of the BV23 expansion (Fig. 7
D) revealed that the BV23 CD45RA+
subset contained a high proportion of CD28-
cells by 1 mo after IM onset, which increased further over time after
disease resolution. The proportion of CD27-
cells in the CD45RA+ subset increased over time
in parallel with that of CD28- cells (data not
shown). Thus we documented the development of monoclonal expansions in
the CD45RA subset following acute EBV infection with a phenotype
consistent with that described for CD8 effectors.
| Discussion |
|---|
|
|
|---|
A number of studies have shown that there is a much greater propensity
for detectable clonal expansions to develop in the CD8 than the CD4
compartment over time in healthy donors, and some of these have now
been clearly linked to ongoing responses to persistent viral infections
such as EBV (5). Lack of detectable, persistent CD4 clones
could result from the smaller overall CD4 responses to antigenic
challenges encountered and the smaller individual CD4 clonal burst
sizes. Recent data using methods for direct ex vivo analysis suggest
that the size of the total Ag-specific CD4 response is at least 35-fold
smaller than that of the CD8 response in acute and memory phases of
lymphocytic choriomeningitis virus (31). Virus-specific
CD4 frequencies decreased substantially following resolution of acute
murine
herpes infection (32), and study of a human
class II-restricted response using HLA-peptide tetramers necessitated
in vitro expansion to detect CD4 cells specific for an influenza
epitope in chronic carriers (33). Thus it was of interest
to compare the clonality of the CD4 and CD8 subsets in IM, since no
previous studies have examined either the size of the CD4 Ag-specific
response or CD4 clonality in this infection. It was striking that no
CD4+ T cell expansions were detectable, even in
the early stages of acute infection with EBV in this study and despite
the high sensitivity of the heteroduplex technique. The other study in
which CD4 and CD8 TCR clonality were analyzed simultaneously in an
acute immune response found a few transient CD4+
clonal expansions in the two individuals examined, with a brief
undefined flu-like illness (34). However, the
CD4+ T cell expansions documented by
single-stranded conformation polymorphism were far fewer than those in
the CD8+ fraction and disappeared more rapidly
(by 21 days after infection), consistent with murine data indicating a
shorter duration of CD4 than CD8 responses (13). Thus, it
is possible that transient CD4+ T cell clonal
expansions occurred in the relatively long incubation period of IM and
had already resolved by the time of symptom onset and recruitment. The
CD4 T cell response contributes to the maintenance of effective CTL
responses (35, 36), as illustrated by the association of
EBV-related lymphoproliferative disease with CD4+
T cell depletion in AIDS. However, far fewer
CD4+ T cells of a given clonotype may be
required, since their effects are amplified through the actions of
secreted cytokines. This difference in clonal dynamics observed in an
immune response where both CD4+ and
CD8+ T cells are known to participate suggests a
much tighter control on CD4 clone size.
Termination of the acute response to EBV infection resulted in a rapid reduction of CD8 clone size in most cases, presumably due to the massive apoptosis known to occur (37). However on longitudinal repertoire analysis, a large proportion of the acute clonotypes remained detectable in fresh ex vivo CD8+ T cells after the full resolution of IM, and no new clonal expansions arose. Thus, the initial EBV memory repertoire (followed up to 1 year) represented a large subset of the primary array of clonal expansions. This requires clones to undergo numerous divisions to generate the initial expansion of effectors and yet to retain the capacity to enter the memory pool and divide further following rechallenge with the virus; such maintenance of replicative reserve may be mediated by up-regulation of telomerase (38). The evolution of the total EBV-specific CD8 response is compatible with the findings of a study focusing on TCR usage in the CTL response to two HLA-B8-restricted epitopes within EBNA-3 during IM and convalescence (17). By analyzing this functionally defined component (following in vitro expansion of CTL clones), maintenance of multiple responding TCR was demonstrated for 6 mo after IM despite the highly focused public TCR response reported to one of these epitopes in the long term memory response (16). A similar approach showed preservation of diverse TCR usage in the CTL response to an epitope within the lytic trans-activator protein BZLF1 during primary and persistent infection (19). Maintenance of the broad repertoire of clones visualized by heteroduplex analysis, which is likely to represent responses to a number of different epitopes, may be a crucial immunoprotective feature of the antiviral response, particularly in the case of less genetically stable viruses.
The CD45 phenotype of the clonal expansions documented in this
work is in line with accumulating data that CD45RA does not reliably
identify only naive CD8+ T cells
(39, 40, 41, 42). The correlation between clonotypes identified in
the CD45RO+ fraction and those capable of
re-expansion in EBV-CTL cultures is congruent with the original data
showing segregation of most EBV-CTLp with this subset
(43). It is now clear that EBV-specific CTL effectors
might not have been detected by these limiting dilution analyses, since
they would have been prone to apoptose in vitro. Some
CD8+ CTL effectors have been suggested to have a
CD45RA+CCR7- or
CD45RA+CD27-CD28-
phenotype outside the setting of an acute infection (28, 44), consistent with the accumulation of clonal expansions in
the latter subset following acute EBV infection. The analysis of CD45
isoform expression of tetramer-positive CD8+ T
cells following the resolution of IM also showed a partial switch to
CD45RA expression (10). The heteroduplex data presented
here reveal that cells from the same clones (and therefore using the
same TCRs) can express both CD45 phenotypes, as has been demonstrated
for a single CMV-specific clonotype (45). This could be
attributed to CD45RO to CD45RA reversion following an acute response or
could indicate that some cells within a dividing clone are capable of
maintaining expression of the CD45RA isoform. However, the very high
initial proportion of CD45RO+ CD8 cells and the
progressive increase in the number of clonotypes in the CD45RA fraction
over time following the acute antigenic challenge support the former
interpretation. The functional specificity of the CD45RA clones could
be explored for defined epitopes by techniques such as enzyme-linked
immunospot or intracytoplasmic staining for IFN-
, which do not
require in vitro expansion. This would enable assessment of whether
there was also functional reversion to a naive state or whether these
EBV-related CD45RA clones actually have direct ex vivo effector
function, as suggested by their phenotypic resemblance to those
described in healthy individuals (28, 44). The
demonstration of a large, long-lived CD45RA clone underscores the fact
that Ag-driven CD8+ T cells can maintain this
phenotype for prolonged periods, accounting for a significant
proportion of the circulating naive CD8 pool.
This is the first analysis of CD4 clonality in EBV infection and reveals profound differences in the heterogeneity of the responding population compared with that of the CD8 compartment. The clonal composition of CD4+ and CD8+ fractions needs to be compared simultaneously in other acute immune responses to support the assertion that the CD4+ T cell response to Ag is composed of smaller clones. This would be congruent with their differing effector functions, with larger CD8+ clones being required to achieve efficient direct CTL killing, whereas CD4+ effects are mediated via cytokines. Most of the extensive repertoire of CD8 clones responding to primary symptomatic EBV infection persists at surprisingly high circulating frequencies following disease resolution. The data indicate that a relatively heterogeneous repertoire of CTL can be maintained at least initially under the pressure of a persistent, genetically stable, virus infection. The assessment of clonality by mAb staining and heteroduplex analysis confirm that most acutely Ag-activated CD8+ T cells express the low molecular weight isoform CD45RO. CD45RA is not a clear-cut naive marker for CD8s, in that large Ag-driven clones are found in this fraction. Thus, the ability to identify persistent clones constituting the ongoing cellular response, not only those capable of expansion in vitro, has allowed reassessment of a highly effective antiviral T cell response.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Mala K. Maini, Department of Sexually Transmitted Diseases, The Mortimer Market Center, off Capper Street, London, U.K. WC1E 6AU. ![]()
3 Abbreviations used in this paper: IM, infectious mononucleosis; CTLp, CTL precursor; BC, constant region of the
-chain; BV, variable region of the
-chain. ![]()
Received for publication April 6, 2000. Accepted for publication August 15, 2000.
| References |
|---|
|
|
|---|

T cell repertoire due to different clonal expansions in the CD4+ and CD8+ subsets. Int. Immunol. 10:1281.
-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.This article has been cited by other articles:
![]() |
P Fisicaro, C Valdatta, C Boni, M Massari, C Mori, A Zerbini, A Orlandini, L Sacchelli, G Missale, and C Ferrari Early kinetics of innate and adaptive immune responses during hepatitis B virus infection Gut, July 1, 2009; 58(7): 974 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lecuroux, I. Girault, A. Urrutia, J.-M. Doisne, C. Deveau, C. Goujard, L. Meyer, M. Sinet, and A. Venet Identification of a particular HIV-specific CD8+ T-cell subset with a CD27+ CD45RO-/RA+ phenotype and memory characteristics after initiation of HAART during acute primary HIV infection Blood, April 2, 2009; 113(14): 3209 - 3217. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Wells, C. J. Cowled, F. Farzaneh, and A. Noble Combined Triggering of Dendritic Cell Receptors Results in Synergistic Activation and Potent Cytotoxic Immunity J. Immunol., September 1, 2008; 181(5): 3422 - 3431. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L-L. Chiang, J. A. Ledermann, E. Aitkens, E. Benjamin, D. R. Katz, and B. M. Chain Oxidation of Ovarian Epithelial Cancer Cells by Hypochlorous Acid Enhances Immunogenicity and Stimulates T Cells that Recognize Autologous Primary Tumor Clin. Cancer Res., August 1, 2008; 14(15): 4898 - 4907. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Wlodarski, Z. Nearman, A. Jankowska, N. Babel, J. Powers, P. Leahy, H.-D. Volk, and J. P. Maciejewski Phenotypic differences between healthy effector CTL and leukemic LGL cells support the notion of antigen-triggered clonal transformation in T-LGL leukemia J. Leukoc. Biol., March 1, 2008; 83(3): 589 - 601. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Crompton, N. Khan, R. Khanna, L. Nayak, and P. A. H. Moss CD4+ T cells specific for glycoprotein B from cytomegalovirus exhibit extreme conservation of T-cell receptor usage between different individuals Blood, February 15, 2008; 111(4): 2053 - 2061. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Asquith, Y. Zhang, A. J. Mosley, C. M. de Lara, D. L. Wallace, A. Worth, L. Kaftantzi, K. Meekings, G. E. Griffin, Y. Tanaka, et al. In vivo T lymphocyte dynamics in humans and the impact of human T-lymphotropic virus 1 infection PNAS, May 8, 2007; 104(19): 8035 - 8040. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Whitmire, N. Benning, and J. L. Whitton Precursor Frequency, Nonlinear Proliferation, and Functional Maturation of Virus-Specific CD4+ T Cells. J. Immunol., March 1, 2006; 176(5): 3028 - 3036. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Wlodarski, C. O'Keefe, E. C. Howe, A. M. Risitano, A. Rodriguez, I. Warshawsky, T. P. Loughran Jr, and J. P. Maciejewski Pathologic clonal cytotoxic T-cell responses: nonrandom nature of the T-cell-receptor restriction in large granular lymphocyte leukemia Blood, October 15, 2005; 106(8): 2769 - 2780. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Obst, H.-M. van Santen, D. Mathis, and C. Benoist Antigen persistence is required throughout the expansion phase of a CD4+ T cell response J. Exp. Med., May 16, 2005; 201(10): 1555 - 1565. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Reed, M. Vukmanovic-Stejic, J. M. Fletcher, M. V. D. Soares, J. E. Cook, C. H. Orteu, S. E. Jackson, K. E. Birch, G. R. Foster, M. Salmon, et al. Telomere Erosion in Memory T Cells Induced by Telomerase Inhibition at the Site of Antigenic Challenge In Vivo J. Exp. Med., May 17, 2004; 199(10): 1433 - 1443. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Landais, X. Saulquin, E. Scotet, L. Trautmann, M.-A. Peyrat, J. L. Yates, W. W. Kwok, M. Bonneville, and E. Houssaint Direct killing of Epstein-Barr virus (EBV)-infected B cells by CD4 T cells directed against the EBV lytic protein BHRF1 Blood, February 15, 2004; 103(4): 1408 - 1416. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. D. Soares, F. J. Plunkett, C. S. Verbeke, J. E. Cook, J. M. Faint, L. L. Belaramani, J. M. Fletcher, N. Hammerschmitt, M. Rustin, W. Bergler, et al. Integration of apoptosis and telomere erosion in virus-specific CD8+ T cells from blood and tonsils during primary infection Blood, January 1, 2004; 103(1): 162 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bickham, K. Goodman, C. Paludan, S. Nikiforow, M. L. Tsang, R. M. Steinman, and C. Munz Dendritic Cells Initiate Immune Control of Epstein-Barr Virus Transformation of B Lymphocytes In Vitro J. Exp. Med., December 1, 2003; 198(11): 1653 - 1663. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Lopes, A. Jaye, L. Dorrell, S. Sabally, A. Alabi, N. A. Jones, D. R. Flower, A. De Groot, P. Newton, R. M. Lascar, et al. Greater CD8+ TCR Heterogeneity and Functional Flexibility in HIV-2 Compared to HIV-1 Infection J. Immunol., July 1, 2003; 171(1): 307 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Dunne, J. M. Faint, N. H. Gudgeon, J. M. Fletcher, F. J. Plunkett, M. V. D. Soares, A. D. Hislop, N. E. Annels, A. B. Rickinson, M. Salmon, et al. Epstein-Barr virus-specific CD8+ T cells that re-express CD45RA are apoptosis-resistant memory cells that retain replicative potential Blood, July 18, 2002; 100(3): 933 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
P C L Beverley Immunology of vaccination Br. Med. Bull., July 1, 2002; 62(1): 15 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sester, U. Sester, B. Gartner, B. Kubuschok, M. Girndt, A. Meyerhans, and H. Kohler Sustained High Frequencies of Specific CD4 T Cells Restricted to a Single Persistent Virus J. Virol., March 19, 2002; 76(8): 3748 - 3755. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Plumbley, H. Fan, P. A. Eagan, A. Ehsan, B. Schnitzer, and M. L. Gulley Lymphoid Tissues from Patients with Infectious Mononucleosis Lack Monoclonal B and T Cells J. Mol. Diagn., February 1, 2002; 4(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Wedderburn, A. Patel, H. Varsani, and P. Woo Divergence in the degree of clonal expansions in inflammatory T cell subpopulations mirrors HLA-associated risk alleles in genetically and clinically distinct subtypes of childhood arthritis Int. Immunol., December 1, 2001; 13(12): 1541 - 1550. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Voehringer, C. Blaser, P. Brawand, D. H. Raulet, T. Hanke, and H. Pircher Viral Infections Induce Abundant Numbers of Senescent CD8 T Cells J. Immunol., November 1, 2001; 167(9): 4838 - 4843. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Wedderburn, R. Jeffery, H. White, A. Patel, H. Varsani, D. Linch, K. Murray, and P. Woo Autologous stem cell transplantation for paediatric-onset polyarteritis nodosa: changes in autoimmune phenotype in the context of reduced diversity of the T- and B-cell repertoires, and evidence for reversion from the CD45RO+ to RA+ phenotype Rheumatology, November 1, 2001; 40(11): 1299 - 1307. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Varela-Calvino, G. Sgarbi, L. R. Wedderburn, C. M. Dayan, J. Tremble, and M. Peakman T Cell Activation by Coxsackievirus B4 Antigens in Type 1 Diabetes Mellitus: Evidence for Selective TCR V{beta} Usage Without Superantigenic Activity J. Immunol., September 15, 2001; 167(6): 3513 - 3520. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Bitmansour, S. L. Waldrop, C. J. Pitcher, E. Khatamzas, F. Kern, V. C. Maino, and L. J. Picker Clonotypic Structure of the Human CD4+ Memory T Cell Response to Cytomegalovirus J. Immunol., August 1, 2001; 167(3): 1151 - 1163. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |