The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maini, M. K.
Right arrow Articles by Beverley, P. C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maini, M. K.
Right arrow Articles by Beverley, P. C. L.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Infectious Mononucleosis
The Journal of Immunology, 2000, 165: 5729-5737.
Copyright © 2000 by The American Association of Immunologists

Clonal Expansions in Acute EBV Infection Are Detectable in the CD8 and not the CD4 Subset and Persist with a Variable CD45 Phenotype1

Mala K. Maini2,*, Nancy Gudgeon{ddagger}, Lucy R. Wedderburn{dagger}, Alan B. Rickinson{ddagger} and Peter C. L. Beverley§

Departments of * Sexually Transmitted Diseases and Immunology and {dagger} Molecular Pathology, University College London, London, United Kingdom; {ddagger} Clinical Research Center Institute for Cancer Studies, University of Birmingham, Birmingham, United Kingdom; and § The Edward Jenner Institute for Vaccine Research, Compton, Berkshire, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have applied a sensitive global analysis of TCR heterogeneity to compare clonal dynamics of CD4+ and CD8+ T cells in acute infectious mononucleosis. Using this approach, we are able to identify a broad representation of the total virus-specific population without the bias of in vitro culture and then to track their phenotype and fate by their unique molecular footprint. We demonstrate a large number of Ag-driven clones using different TCRs in the acute phase, all CD8+. The diverse large clones generated in the CD8 subset in response to this virus contrast with the complete lack of detectable clonal expansion in the CD4 compartment. Many of the same clones remain detectable in directly ex vivo CD8+ T cells for at least a year after resolution of infectious mononucleosis, although the clone size is reduced. Thus, memory CD8 cells following EBV infection persist at relatively high circulating frequency and represent a subset of the large range of clonotypes comprising the acute effectors. Separation of samples into CD45RA (naive) and CD45RO (memory) fractions shows the accumulation of identical CDR3 region defined clonotypes in both CD45RO and CD45RA fractions and sequencing confirms that dominant long-lived monoclonal expansions can reside in the CD45RA pool.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epstein-Barr virus is a ubiquitous human {gamma} herpes virus, worldwide in distribution, with 90–95% of most adult populations showing serological evidence of infection (1). The severe symptomatic nature of infectious mononucleosis (IM)3 allows analysis of individuals with a defined onset of infection. Resolution of acute infection is followed by life-long asymptomatic persistent viral carriage in the vast majority of infected individuals. The cellular immune response is known to be primarily responsible for control of this virus and therefore provides a convenient model of a successful T cell response to a chronic viral infection. However, EBV is associated with a number of malignancies in cases where there is a failure of normal cellular immunity. Detailed characterization of the physiological T cell response capable of controlling EBV should contribute to the optimization of CTL immunotherapy, a therapeutic approach already under trial for EBV-associated malignancies (2).

Large CD8+ clonal expansions have been described in IM (3), and there is some evidence that clones seen in the memory CTL response are selected during the acute phase and may persist at high circulating frequencies (4), contributing to the CD8+ expansions seen in healthy adults (5). In contrast, CD4+ clonal expansions are rarely detectable in healthy individuals, even with highly sensitive techniques (6, 7, 8), but it is unclear whether this is because large clones do not arise during primary antigenic challenges or whether they are less persistent than the CD8 clones (9). If large CD4 expansions fail to develop during acute antigenic activation of CD4 cells, this could be a result of a smaller overall CD4 Ag-specific response or one that is composed of many smaller clones. New techniques for analyzing Ag-specific responses directly ex vivo have allowed a re-evaluation of antiviral CD8 responses for EBV (10, 11) and other viruses (reviewed in Ref. 12) and have highlighted the large proportion of the response lost during in vitro culture and therefore not detected by conventional cytotoxic assays. Much less is known about the size of CD4 responses in viral infections (13), and these may have been similarly underestimated by limiting dilution analyses (14). Equivalent techniques for direct analysis of responding CD4 cells have only become available more recently and have not yet allowed parallel dissection of the CD4 and CD8 components of a human antiviral response.

TCR repertoire analysis with a sensitive, global method should allow a direct comparison of the clonotypic composition of CD4 and CD8 cells. This approach was chosen to avoid the need for in vitro selection of responding clones, which inevitably involves focusing on functionally delineated responses and can introduce bias into TCR usage (15). Studies of TCR usage, because of their laborious nature, have tended to concentrate on responses to one or two well-described or immunodominant epitopes, particularly the highly conserved EBV-specific response restricted by HLA-B8 (4, 16, 17), which may not be typical of EBV responses restricted by other alleles (18, 19). Although studies with HLA-peptide tetramers have highlighted the striking potential magnitude of responses specific for single EBV epitopes (10), other work has revealed that the numerically immunodominant response is not necessarily that which is most protective (20). In addition, accumulating data stress the role of a multispecific T cell response in maximizing viral control (21, 22, 23), all of which points to the importance of also analyzing smaller responses to subdominant epitopes. Epitopes recognized in class II-restricted responses have not been well defined in many viral infections such as EBV, so that a functionally directed analysis of virus-specific CD4 clonotypes has not been feasible.

Thus, the modified heteroduplex technique (7, 24) is used in this study to provide as broad coverage as possible of the in vivo repertoire of clones responding to acute infection with EBV (regardless of epitope) and to allow sensitive tracking of their fate following disease resolution. Analysis of the CD4 and CD8 fractions is undertaken in parallel to determine whether the well-recognized difference in oligoclonality of these subsets in steady state situations is also detectable during the challenge of an acute lymphoproliferative antiviral response. We combine this method with phenotypic separation of T cell subsets to investigate the CD45 phenotype of persistent EBV-specific clones in the light of increasing evidence that the differentially spliced isoforms of the CD45 molecule may not have a straightforward association with naive and memory pools.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients and volunteers

Eight patients (age range, 18–24 years) diagnosed with acute IM on the basis of characteristic clinical features, atypical lymphocytosis, and a positive monospot test were recruited through University College Hospital hematology department and local student general practitioner services. EBV infection was confirmed by serological tests for viral capsid Ag IgM Abs. Patients were first sampled within 10 days of symptom onset and underwent longitudinal follow-up for up to 1 year (Table IGo). Controls were age-matched healthy laboratory volunteers who had not had an illness suggestive of IM. Local ethical committee approval for the study was obtained, and all donors gave written informed consent.


View this table:
[in this window]
[in a new window]
 
Table I. Patient sampling and detection of clonal expansions

 
Isolation of PBMC and T cell subsets

PBMC were isolated from heparinized blood samples by Ficoll-Hypaque density centrifugation, and the nonadherent fraction was recovered after a 1-h plastic adherence step at 37°C. CD4 and CD8 T cell subsets were isolated by positive selection using directly conjugated anti-CD4 or anti-CD8 MiniMacs magnetic beads (Miltenyi Biotech, Bisley, Surrey, U.K.). Separated fractions were always >95% pure as assessed by mAb staining and FACS analysis.

Purification of CD45RA and CD45RO subsets was achieved by incubation of nonadherent PBMC with saturating concentrations of a mixture of mAb supernatants (anti-CD14, anti-CD19, anti-CD11b, anti-CD4, and either UCHL1 or SN130 for CD45RA or CD45RO negative selection, respectively). Unwanted stained populations were then removed using goat anti-mouse Ig MiniMacs beads (Miltenyi Biotech). CD45RA populations were highly purified by repeating this process until the number of contaminating CD45RO cells was <1%.

Phenotyping

Expression of different BV segments and activation markers by CD4+ and CD8+ subsets was assessed by flow cytometric analysis following triple staining of nonadherent PBMC with directly conjugated Abs to CD3, CD4, or CD8 and a panel of BV-specific mAbs (Immunotech, Marseilles, France) or CD45RO or HLA-DR (all from Sigma, Poole, U.K.) or CD28 (Becton Dickinson, San Jose, CA). Expression of these markers by BV expansions was analyzed by gating on CD8+ T cells that had also been stained with the relevant BV-specific mAbs and CD45RO or HLA-DR or CD28.

Induction of EBV-specific CTL

PBMC were washed and resuspended in RPMI 1640 and 10% FCS with 1% human serum at a concentration of 1 x 106/ml in a 24-well plate. PBMC from acute IM samples stored in liquid nitrogen were thawed directly in IL-2-enriched medium (containing 30% (v/v) supernatant from the IL-2-secreting cell line MLA-144 (MLA-SN) and 100 U/ml of rIL-2) as described previously (25). The autologous B lymphoblastoid cell line was irradiated (10,000 cGy) and added to give a responder to stimulator ratio of 40:1. Restimulation was conducted 7 days later with the autologous lymphoblastoid cell line at a responder to stimulator ratio of 4:1 and subsequently weekly at a ratio of 10:1. After 2 wk the culture medium was IL-2 enriched as described above. Chromium release assays for EBV specificity and HLA restriction were conducted as described previously (25).

RNA extraction and cDNA synthesis

Total RNA was extracted from 2 to 4 x 106 PBMC or purified subsets of T cells by the guanidinium thiocyanate/acid phenol method using RNAzol B (Biogenesis, Bournemouth, U.K.). Approximately 5 µg of total RNA was used for first-strand cDNA synthesis using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) with RNasin (Promega, Madison, WI) and random hexamer primers.

Oligonucleotides

Oligonucleotides were synthesized and HPLC purified by the Imperial Cancer Research Fund (London, U.K.). Two BC primers were used: the consensus internal BC primer (5'-CACCCACGAGCTCAGCTCCACGTGGTC) and an external BC primer (5'-TGCTGA CCCCACTGTCGACCTCCTTCCCATT), which is 30 bp 3' to the internal primer. The BV primers used were as previously described (24) for the heteroduplex PCRs. Amplification of the C{beta}-chain to estimate the total amount of TCR {beta}-chain mRNA in different samples was conducted using two primers for the C region of the {beta}-chain (5'-TGGGAAGGAGGTCGACAGTG and 5'-TGGCCTTCCCTAGCAGGATCT) in conjunction with the PCRs below.

Heteroduplex analysis

Twenty-six PCRs were conducted for each analysis in a final volume of 50 µl and using one-fortieth of the cDNA each. Hot start PCR was conducted with initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min with a final extension period at 72°C for 10 min. Ten microliters of the PCR products was visualized on a 1% agarose gel. DNA carriers consisting of cDNAs encoding BV1–24 cloned from T cell clones or lines were as described previously and were provided by G. Casorati (24). These were amplified using the same TCRBV primers and reaction conditions as those for the sample cDNAs, but with the external BC primer. A 20-µl aliquot of each sample PCR product was mixed with 400 ng of the appropriate BV-matched carrier PCR product, denatured at 95°C for 5 min, and allowed to reanneal at 50°C for 1 h. The mixtures were kept on ice until loading on a 12% nondenaturing polyacrylamide gel run at 10 mA for 16 h at 4°C. Heteroduplex gels were stained with ethidium bromide for 30 min for initial visualization of DNA and then blotted onto nylon Hybond N+ membranes in 20x SSC. The DNA was denatured and fixed to the membrane by a 20-min incubation in 0.4 M NaOH. The external BC probe was end labeled with [{gamma}-32P]ATP using polynucleotide kinase (Amersham Pharmacia Biotech, Piscataway, NJ). Membranes were prehybridized for 15 min in Rapid Hyb Buffer (Amersham Pharmacia Biotech) at 42°C, hybridized at 42°C for 1 h, and then washed in 5x SSC/0.1% SDS for 20 min at room temperature, followed by two washes of 15 min in 1x SSC/0.1% SDS at 42°C. Filters were exposed to film at -70°C for 6 h. For clonotypic probing, the filter was stripped by washing in 0.5% SDS at 80°C and rehybridized with the appropriate N region probe (5'-AGGATCCCCCAACGAGC), with a final wash with 0.2x SSC/0.1% SDS at 50°C.

Cloning and sequencing of BV PCR products

Cloning of PCR products was conducted using the TA cloning kit (Invitrogen, San Diego, CA). The ligation reaction was incubated at 14°C overnight and then used immediately for transformation of TOP10F' One Shot competent Escherichia coli cells (Invitrogen). White colonies were distinguished from blue colonies not containing an insert and were further tested for inserts by plasmid Miniprep and restriction digestion with EcoRI (Amersham Pharmacia Biotech). Plasmid DNA was purified using Wizard Plus Minipreps (Promega) and sequenced using a modified version of the dideoxy chain termination DNA sequencing method with T7 DNA polymerase from the Sequenase version 2.0 kit (Amersham Pharmacia Biotech).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In IM there is a diverse array of oligoclonal Ag-driven T cell expansions

Eight patients with acute infectious mononucleosis were recruited, six of them within 10 days of symptom onset, and their TCR repertoires were analyzed directly ex vivo. All six patients analyzed very early in the course of the infection had lymphocytosis composed mainly of activated CD8 cells and had one or more large TCRBV-restricted expansions detectable by mAb staining (Table IGo) as previously noted in a larger cohort (3). However, molecular dissection of their T cell repertoire showed a much more diverse set of oligoclonal expansions than had been visualized with mAb staining alone. Available mAbs only cover half the repertoire, and because the percentage of cells staining with them can be highly variable in healthy individuals, only large expansions will be detectable. By contrast, TCR analysis by the modified heteroduplex technique has been shown to detect clonal expansions down to a frequency of 1 cell in 10,000, visualized as discrete bands with a unique, reproducible migration pattern (7, 24). The heteroduplex technique demonstrated not only oligoclonal expansions in those BV families that were expanded by mAb staining but also in many of those that appeared within the reference range with mAb. This is illustrated for donor 7, who had four TCRBV expansions detectable with a panel of 16 BV-specific mAbs (Table IGo) compared with at least one expansion demonstrable in 21 of 22 BV-specific PCR-heteroduplex tracks (Fig. 1GoA). Almost every BV PCR product from all patient PBMC samples was dominated by oligoclonal expansions, often with little background polyclonal smear remaining.



View larger version (84K):
[in this window]
[in a new window]
 
FIGURE 1. A comparison of overall clonality in PBMC from two IM donors and a healthy age-matched control. RNA was extracted from fresh PBMC and subjected to heteroduplex analysis of global TCR usage. Samples were electrophoresed through a polyacrylamide gel, and gels were blotted and hybridized with a TCRBC probe. A, The autoradiograph shows heteroduplex samples BV1–22 from IM donor 7 taken 3 days after symptom onset (shown with TCRBV primer and carrier used above each track). The heteroduplexes show a specific migration pattern above the dense carrier homoduplex in each track. B, Heteroduplex analysis of a different IM patient (donor 3) sampled within 5 days of disease onset, in whom fresh PBMC are shown to contain multiple heteroduplexes with a different pattern from donor 7 and with little background smear. C, Heteroduplex analysis of PBMC from a healthy donor who had never had IM, showing the typical polyclonal smear patterns above each carrier homoduplex.

 
The pattern of heteroduplexes visualized in each patient was unique, consistent with a different set of Ag-driven clonal expansions occurring in each patient (shown for donors 7 and 3, Fig. 1Go, A and B). This was very different from the situation seen in healthy age-matched controls, exemplified in Fig. 1GoC, where fresh PBMC were polyclonal, as indicated by the smear pattern in every TCRBV track. Occasionally a few faint heteroduplex bands were visible in the healthy donors, which became more obvious on enriching for the CD8+ fraction (7). Thus, most of the different TCR expansions seen in IM could be assumed to be disease related.

All expansions detected are CD8+, whereas the CD4 cells remain polyclonal

The CD4+ helper response is known to be important in the immune control of acute viral infections, and an increase in total CD4+ T cell numbers has been documented in IM despite the inversion in CD4/CD8 ratio resulting from the far larger increase in CD8+ numbers. There was also evidence of some activation of CD4+ T cells in IM compared with healthy controls (data not shown and demonstrated previously (26, 27)), although, again, this was far outweighed by the dramatic activation in the CD8+ fraction. However, as shown in Table IGo, there were no expansions in the CD4+ T cells detectable with V region-specific mAb staining in any of the IM donors. More surprisingly, there were no clonal expansions detected in the CD4+ purified fraction of any of the IM patients, even by the highly sensitive heteroduplex method. This is demonstrated for one representative patient in Fig. 2Go, for whom IM T cells have been fractionated using magnetic beads into CD4+ and CD8+ fractions (purity >97%) and analyzed in parallel, with similar inputs of total TCR {beta}-chain mRNA, as suggested by the TCRBC PCR control. All the visible clones are in the CD8+ T cells, with polyclonal smear patterns throughout the CD4+ T cells. Parallel molecular TCR analysis of highly purified CD4 and CD8 subsets in five other IM patients showed the same segregation of all clones detectable by heteroduplex analysis with the CD8, not CD4, cells (Table IGo).



View larger version (112K):
[in this window]
[in a new window]
 
FIGURE 2. Segregation of all the IM heteroduplexes with the CD8+ purified T cells. Fresh T cells from IM donor 4 were fractionated into CD4+ and CD8+ subsets using magnetic beads (both >95% purity on mAb staining). Heteroduplex analysis was performed on the two fractions in parallel, and samples were run in adjacent tracks for comparison. Samples for CD4+ T cells (4+) and CD8+ T cells (8+) are shown for BV1–13.2, demonstrating segregation of all heteroduplex bands with the CD8+ subset. The last two tracks (BC) are the PCR product of the control amplification of cDNA with two {beta}-chain constant region primers, hybridized with the same probe for the external portion of the C region, which hybridizes with the carrier in the BV samples. PCR on serial dilutions of cDNA suggested equivalent inputs of mRNA for CD4+ and CD8+ subset PCR.

 
Persistence of clonotypes at detectable levels in unstimulated memory pool

Longitudinal follow-up of donors with the heteroduplex technique showed that many of the TCR expansions seen in the acute response persisted at a level where they could be detected directly ex vivo despite full symptom resolution. A large proportion (~50%) of the bands seen in the first sample taken at the height of the illness remained visible for the duration of follow-up (up to 11 mo; Fig. 3Go). Longitudinal tracking was also performed in purified CD8+ T cells to remove the variability attributable to the decrease in the percentage of circulating CD8+ T cells with time after IM (Fig. 3GoB). A number of clones became undetectable in the PBMC compartment over time and were only visible in purified CD8 cells, indicating a decrease in clone size, while other clones contracted to below the threshold of detection even in purified CD8 cells (Fig. 3GoB). A marked reduction in clone size was also evidenced by the quantitation of large TCRBV expansions by mAb staining, showing contraction of most expansions to within the reference ranges by 3 wk after symptom onset (data not shown). Thus, the circulating memory pool of CD8 cells in healthy carriers was composed of a large subset of the effectors present in acute infection. No new clones appeared on recovery that had not been visualized in IM (Fig. 3Go).



View larger version (81K):
[in this window]
[in a new window]
 
FIGURE 3. Longitudinal heteroduplex tracking of clones following IM. A, Samples from donor 3 were analyzed by heteroduplex on a total of six further occasions following the IM sample. Heteroduplex analysis of five representative families (BV1–5.1) from the acute sample (0) and two follow-up samples (1 and 6 mo) are shown. The analysis was conducted on total fresh PBMC, stored as cDNA and analyzed in parallel. Representative TCRBV (BV4 and BV5.1) illustrate maintenance of acute clonotypes, as evidenced by preservation of their heteroduplex footprint on follow-up, whereas other clonotypes (BV2) become undetectable by 1 mo. B, Fresh PBMC were taken from donor 2 at 2 mo, and CD4+ (4+) and CD8+ (8+) T cells were purified using magnetic bead separation (purity >95%). CD8+ T cells were also separated from PBMC 11 mo following disease onset. Stored cDNA samples from each sample were subjected to heteroduplex analysis in parallel. Representative TCRBV are shown, illustrating polyclonal patterns in CD4+ T cells and preservation of CD8+ heteroduplexes except in BV23.

 
The data shown in Fig. 3GoB highlight the polyclonality of the CD4+ T cell compartment, visualized by the uniform smear pattern. This lack of detectable clonal expansion in the CD4 cells persisted throughout follow-up (shown for 2 mo after IM, Fig. 3GoB).

EBV-specific CTL comprise many of the same clonotypes seen in fresh ex vivo samples

To investigate the functional specificity of the clones visualized, EBV-specific CTL lines were generated from two of the donors using restimulation with the autologous B lymphoblastoid cell line to gain as broad a representation as possible of the physiological in vivo repertoire of EBV-CTL. In the case of donor 3, the T cell line was generated from PBMC taken 6 mo after acute disease; for donor 4 both acute and memory (4 mo after IM) PBMC were restimulated in parallel. All T cell lines generated exhibited a high percentage (35–75%) of EBV-specific lysis of the autologous B lymphoblastoid cell line with which they had been stimulated, detectable at low E:T cell ratios and in repeated CTL assays over a number of weeks.

The CD8+ cells from the T cell lines were purified and used for heteroduplex analysis. Samples from fresh CD8+ T cells and the T cell line generated from the same PBMC were run in adjacent tracks for comparison (representative examples in Fig. 4Go). The T cell lines were enriched for many of the same clonotypes seen in the acute ex vivo sample, some of which had subsequently become barely detectable or undetectable, even in the CD8+-enriched fraction (Fig. 4GoA). This provided strong supporting evidence that the clonotypes of the effectors expanded in acute disease overlapped with the clonotypes involved in the memory CTL response when these individuals were rechallenged with EBV in vitro. Clonotypic identity between the fresh and CTL samples was further confirmed by sequencing (see below). The results of the selective in vitro expansion of EBV-specific CTL suggested that some of the clones that became undetectable in fresh circulating CD8+ T cells had not undergone clonal exhaustion and were capable of re-expansion.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 4. Comparison of heteroduplex footprints between ex vivo IM CD8+ T cells and EBV-specific CTL. A, Fresh CD8+ T cells from IM (0 mo) and 6 mo follow-up (donor 3) were analyzed by heteroduplex in parallel with CD8+ T cells purified from the CTL generated from the 6 mo PBMC sample. The T cell line demonstrated 70% specific lysis of the autologous lymphoblastoid cell line at the time cells were harvested for RNA extraction. Many of the heteroduplexes that were prominent in the ex vivo IM CD8+ T cells and barely detectable at 6 mo were enriched in the CTL population (arrowed). B, Heteroduplex was performed simultaneously on stored cDNA from fresh CD8+ T cells (0 and 4 mo) and the EBV-specific T cell lines derived from them (donor 4). Selected TCRBV run in adjacent tracks of the polyacrylamide gels are shown. Arrows indicate conserved clonal patterns, except the upper arrow in BV9, which indicates a clone visible only after in vitro restimulation.

 
The comparison of EBV-specific CD8 cells capable of proliferating in vitro in acute infection and in the memory phase from donor 4 revealed very similar patterns of EBV-specific CTL lysis in terms of HLA restriction (data not shown). Parallel visualization of the fresh CD8 cells and those from the T cell lines from both IM and memory (4 mo) samples revealed some clonotypic identity (BV6, Fig. 4GoB), whereas other clones were either preferentially expanded in the IM or memory T cell lines (BV9, Fig. 4GoB). Thus, global tracking of clonotypes by their molecular footprint showed that the memory population of EBV CTL circulating after disease resolution and capable of expanding in response to virus challenge in vitro was derived from the pool of disease-related CD8 cells found in acute infection.

There is a disproportionate loss of the CD45RO+ phenotype within oligoclonally expanded CD8+ T cells following IM

At the onset of acute infectious mononucleosis, there was a striking CD8+ lymphocytosis of HLA-DR+ CD45RO+ T lymphocytes. Oligoclonal expansions detectable by TCRBV mAb staining were also enriched for the HLA-DR+ phenotype, as noted in a previous study (3). This enrichment persisted on follow-up, even when the percentage of CD8+ T cells within a TCRBV family had contracted to within reference ranges, suggesting ongoing EBV-related activation. This is illustrated for one donor in Fig. 5GoA, for whom a BV22 expansion accounting for 10.5% of CD8+ T cells is shown to have a higher fraction positive for HLA-DR than the rest of the CD8+ T cells both at the onset of symptoms (time 0) and on full recovery (2 mo).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 5. Triple-color staining and FACS analysis of T cells during and after IM to examine the phenotype of TCRBV expansions. PBMC were analyzed by flow cytometry using mAb to CD8, HLA-DR, or CD45RO and a TCRBV (in this example, BV22, donor 7). Twelve thousand events were acquired within the live gate set on size and granularity, and data were then gated on CD8+ T cells during analysis. Left panels, Staining patterns in IM; right panels, Staining patterns at 2 mo when the disease had fully resolved. A, The percentage of BV22+ CD8+ T cells compared with remaining CD8+ T cells staining positive for HLA-DR was 95 vs 82% at time 0 and 61 vs 55% at 2 mo, respectively. B, The percentages of BV22+ CD8+ T cells and remaining CD8+ T cells staining positive for CD45RO were 93 and 90% at time 0 and 28 and 39% at 2 mo, respectively.

 
By contrast, the percentage of CD45RO+ CD8+ T cells was usually extremely high in acute disease, but fell much more rapidly and disproportionately more so in expansions (mirrored by an increase in CD45RA staining). Thus, in the same donor (Fig. 5GoB), 90% of circulating CD8+ T cells were CD45RO+ at time 0, but by 2 mo 39% were CD45RO+, and only 28% of the BV22 CD8+ T cells were still CD45RO+. There was therefore a discrepancy between staining of CD8+ T cells with CD45 isoform Abs and other markers of activation such as HLA-DR, particularly following resolution of the initial large Ag-driven lymphocytosis. This suggested that activated CD8 cells generated after the acute phase in this viral response could have the CD45RO-CD45RA+ phenotype previously associated with a naive resting status.

Molecular TCR analysis reveals an accumulation of clonal expansions in the CD45RA+ pool following IM resolution

The phenotypic data showing accumulation of activated, Ag-experienced CD8 cells with a CD45RA phenotype after IM suggested that there may be reversion of individual clones from a CD45RO to an RA phenotype. The CD45 phenotype of clonal expansions in the response to EBV was therefore further investigated by probing TCR usage at the molecular level. T cells taken from two individuals during the acute stage of IM were fractionated into CD45RA and CD45RO subsets. The CD45RA fractions were highly purified by negative selection, such that the level of contaminating CD45RO+ or CD45RA+RO+ double-positive T cells was <1%. Heteroduplex analysis was conducted simultaneously for the two fractions to allow the phenotype of multiple different T cell clonotypes to be identified directly ex vivo. For this purpose, RT-PCR was conducted on the purified fractions in parallel, and TCR BV-matched samples were run in adjacent tracks for comparison. Initially, most of the clonal expansions segregated with the CD45RO+ fraction, with only a few of the clones also faintly detectable in the CD45RA+ T cells (Fig. 6Go, A and C). If this were a result of small amounts of contaminating CD45RO+ T cells being picked up by the highly sensitive PCR analysis of the CD45RA+ T cells, carryover would be expected to be most obvious for the most intense bands, rather than to occur with this selective pattern.



View larger version (91K):
[in this window]
[in a new window]
 
FIGURE 6. Visualization of clonal segregation according to CD45 isoform expression in IM and memory samples. A, PBMC from IM donor 5 at time 0 were fractionated into CD45RA+ (RA+) and CD45RO+ (RO+) T cell subsets with mAbs and magnetic beads. Heteroduplex analysis was performed on the two subsets in parallel and run in adjacent tracks. The TCRBV shown here demonstrate predominant segregation of heteroduplexes with CD45RO+ T cells at this time point, although in some cases (TCRBV21) there is already evidence of selective overlap of clones between both isoforms (arrowed). B, Heteroduplex analysis of CD45RA+ and CD45RO+ fractionated T cells from donor 5 at 6 mo after IM, demonstrating the presence of the same clonotypes in both fractions (arrowed). C, PBMC from donor 3 at 0 and 9 mo after IM onset were separated according to expression of CD45 isoform, and fractionated subsets from both time points were analyzed in adjacent tracks to facilitate comparison of clonal segregation over time. Heteroduplexes that predominantly segregate with the CD45RO fraction in IM become more prominent in the CD45RA fraction by 9 mo, as illustrated for BV22 (arrowed).

 
T cells taken from the same donors 6 or 9 mo after the acute infection were also analyzed by heteroduplex according to CD45 phenotype and run in adjacent tracks. Following disease resolution, many of the clones that predominantly segregated with the CD45RO+ phenotype were also identified in the CD45RA+ fraction by the presence of the same heteroduplex band (indicated with arrows in Fig. 6Go, B and C). We therefore went on to investigate the cytolytic potential of CD45RA and CD45RO clonotypes.

EBV-specific CTL precursors with proliferative potential in vitro were derived from the CD45RO clonotypes

EBV-specific CTL precursors (CTLp) were likely to reside in the CD45RO fraction in IM, since almost all circulating CD8 cells and detectable clonotypes had a CD45RO+ phenotype at this time point (Fig. 6GoA). However, in the memory phase, many of the same clonotypes could also be visualized in the CD45RA pool (Fig. 6GoB), making it difficult to be certain that the CTLp were still derived from the CD45RO fraction.

The differential segregation of two clones according to CD45 isoform was therefore used as an opportunity to investigate their contribution to the memory CTL response. In donor 3, two distinct clones were visualized in BV23, one segregating with CD45RA, and one segregating with CD45RO (Fig. 7GoA, first two tracks). To validate this unexpected finding of a prominent heteroduplex unique to the CD45RA fraction, the BV23 CD45RA+ T cell PCR amplification products were cloned and sequenced. Twelve of 13 inserts sequenced from the PCR product were identical across the VDJ junction, confirming the presence of a large monoclonal CD45RA+ expansion (with the junctional region sequence shown in Fig. 7GoC). The BV23 expansion represented 9.3% of circulating CD8+ T cells and 13% of circulating CD8+ CD45RA+ T cells by mAb staining. Thus, this single clone accounted for an estimated 12% of the total CD8+ naive (CD45RA+) repertoire and had an approximate clone size of 5 x 107 cells/l in the periphery alone. Tracking of this large clone by its heteroduplex footprint and by clonotypic probing (data not shown) confirmed that it persisted at high frequency in the periphery for at least 9 mo, demonstrating that long-lived monoclonal expansions can occur in the CD45RA pool. Cloning and sequencing of the BV23 CD45RO+ T cell PCR product from the same donor showed the presence of a different expansion, accounting for 4 of 10 inserts (Fig. 7GoC).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 7. EBV-specific CTLp segregate with the CD45RO+ fraction, whereas the CD45RA pool contains a large monoclonal expansion with an effector phenotype. A, There are distinct BV23 heteroduplexes in the CD45RA+ (horizontal arrows) and CD45RO+ (vertical arrows) T cells from IM donor 3. Both sets are visible in BV23 PBMC (total track), but only the RO+ clone (and not the RA+ clone) expands in the BV23 product of the T cell line derived from PBMC from the same 6 mo point (CTL track, vertical arrows). B, Clonotypic probing with an N region probe specific for the BV23 CD45RA clone (derived from the sequence in C) highlights the RA+ clone forming a heteroduplex with the carrier in RA+ and total tracks (arrow) and as a heteroduplex with the RO+ clone (slightly lower pattern of migration) in the RO+ and total tracks. The CD45RA clonotypic probe does not hybridize with the heteroduplexes in the T cell line track (CTL), confirming that the CTL are not derived from the CD45RA clone. C, Sequencing across the CDR3 region confirms the monoclonality of the BV23+ CD45RA+ expansion. CD8 T cells from the 9-mo follow-up sample from donor 3 were fractionated into CD45RA+ and CD45RO subsets, and the RT-PCR product for BV23 was cloned and sequenced. Nucleotide and predicted protein sequences are shown, with the junctional (NDN) regions marked. Both dominant sequences used BJ2S7, but the CD45RO clone had an NDN region longer by 2 aa. D, The BV23 monoclonal expansion persists within the CD45RA pool and develops a CD28- phenotype following IM. CD8+ T cells were stained for CD45RA, CD28, and BV23 and analyzed by flow cytometry; dot plots are shown after gating on CD45RA+ cells from samples from donor 3 taken 1, 3, and 9 mo after IM. Percentages indicate the proportion of CD45RA+BV23+ cells staining positively for CD28+ at each time point.

 
The BV23 heteroduplex product from the CTL line raised in this donor was analyzed alongside the total PBMC and CD45RA and RO fractions from the same time point before stimulation (Fig. 7GoA). T cells expressing BV23 were known to be an important component of the CTL line, since they accounted for the largest expansion within it by mAb staining (12% of the CTL line; data not shown). The predominant heteroduplex pattern in the in vitro expanded CTL sample mirrored that seen in the CD45RO+ fraction, together with a new band not seen in any of the fresh samples. The molecular footprint formed by the CD45RA+ clone was not detectable in the CTL sample (Fig. 7GoA). This was confirmed by clonotypic probing with a probe specific for the N region of the CD45RA clonotype (derived from the N region sequence; Fig. 7GoC). This clonotypic probe hybridized with the CD45RA and total PBMC tracks, but did not hybridize with any of the heteroduplices in the T cell line track (Fig. 7GoB). These results indicated that the predominant clone in the T cell line was that derived from the CD45RO+ CD8+ T cells (confirmed by sequencing of the T cell line BV23 product; data not shown). The data suggest that, at least in the case of some clones, EBV-specific CTLp capable of expansion in vitro may selectively reside in CD45RO+ CD8+ T cells, whereas clonally expanded CD45RA+ CD8+ cells may constitute effectors (prone to apoptose in culture).

To investigate this further, we extended the phenotypic analysis of the BV23CD45RA+ cells, since recent studies in healthy donors have described a CD45RA+CD28-CD27- subset within the CD45RA pool that exhibits direct cytolytic, but not CTL precursor, activity (28). The percentage of BV23 cells staining for CD45RA increased following IM, consistent with the development of the large monoclonal expansion described above. Costaining with CD28 and CD45RA of the BV23 expansion (Fig. 7GoD) revealed that the BV23 CD45RA+ subset contained a high proportion of CD28- cells by 1 mo after IM onset, which increased further over time after disease resolution. The proportion of CD27- cells in the CD45RA+ subset increased over time in parallel with that of CD28- cells (data not shown). Thus we documented the development of monoclonal expansions in the CD45RA subset following acute EBV infection with a phenotype consistent with that described for CD8 effectors.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Global analysis of the direct ex vivo clonal composition of the dramatic CD8+ lymphocytosis at the onset of IM revealed extensive CDR3 region defined TCR expansions, with no restriction on V region usage. The presence of heteroduplex bands representing clonal expansions in almost every TCRBV examined, and the dramatic reduction in the polyclonal background smear usually seen, implied that most of the CD8+ proliferation was Ag driven. Accumulating data from mouse and human models acquired by a combination of highly sensitive techniques are consistent with this finding, indicating that there can be a large Ag-specific component to acute virus-driven CD8 proliferation (10, 29, 30). Although the magnitude of the EBV-specific CD8 expansion in IM has been demonstrated (10), the breadth of clones involved in the acute response was not previously recognized, since analysis after screening with TCRBV mAbs had only identified some of the largest expansions (3).

A number of studies have shown that there is a much greater propensity for detectable clonal expansions to develop in the CD8 than the CD4 compartment over time in healthy donors, and some of these have now been clearly linked to ongoing responses to persistent viral infections such as EBV (5). Lack of detectable, persistent CD4 clones could result from the smaller overall CD4 responses to antigenic challenges encountered and the smaller individual CD4 clonal burst sizes. Recent data using methods for direct ex vivo analysis suggest that the size of the total Ag-specific CD4 response is at least 35-fold smaller than that of the CD8 response in acute and memory phases of lymphocytic choriomeningitis virus (31). Virus-specific CD4 frequencies decreased substantially following resolution of acute murine {gamma} herpes infection (32), and study of a human class II-restricted response using HLA-peptide tetramers necessitated in vitro expansion to detect CD4 cells specific for an influenza epitope in chronic carriers (33). Thus it was of interest to compare the clonality of the CD4 and CD8 subsets in IM, since no previous studies have examined either the size of the CD4 Ag-specific response or CD4 clonality in this infection. It was striking that no CD4+ T cell expansions were detectable, even in the early stages of acute infection with EBV in this study and despite the high sensitivity of the heteroduplex technique. The other study in which CD4 and CD8 TCR clonality were analyzed simultaneously in an acute immune response found a few transient CD4+ clonal expansions in the two individuals examined, with a brief undefined flu-like illness (34). However, the CD4+ T cell expansions documented by single-stranded conformation polymorphism were far fewer than those in the CD8+ fraction and disappeared more rapidly (by 21 days after infection), consistent with murine data indicating a shorter duration of CD4 than CD8 responses (13). Thus, it is possible that transient CD4+ T cell clonal expansions occurred in the relatively long incubation period of IM and had already resolved by the time of symptom onset and recruitment. The CD4 T cell response contributes to the maintenance of effective CTL responses (35, 36), as illustrated by the association of EBV-related lymphoproliferative disease with CD4+ T cell depletion in AIDS. However, far fewer CD4+ T cells of a given clonotype may be required, since their effects are amplified through the actions of secreted cytokines. This difference in clonal dynamics observed in an immune response where both CD4+ and CD8+ T cells are known to participate suggests a much tighter control on CD4 clone size.

Termination of the acute response to EBV infection resulted in a rapid reduction of CD8 clone size in most cases, presumably due to the massive apoptosis known to occur (37). However on longitudinal repertoire analysis, a large proportion of the acute clonotypes remained detectable in fresh ex vivo CD8+ T cells after the full resolution of IM, and no new clonal expansions arose. Thus, the initial EBV memory repertoire (followed up to 1 year) represented a large subset of the primary array of clonal expansions. This requires clones to undergo numerous divisions to generate the initial expansion of effectors and yet to retain the capacity to enter the memory pool and divide further following rechallenge with the virus; such maintenance of replicative reserve may be mediated by up-regulation of telomerase (38). The evolution of the total EBV-specific CD8 response is compatible with the findings of a study focusing on TCR usage in the CTL response to two HLA-B8-restricted epitopes within EBNA-3 during IM and convalescence (17). By analyzing this functionally defined component (following in vitro expansion of CTL clones), maintenance of multiple responding TCR was demonstrated for 6 mo after IM despite the highly focused public TCR response reported to one of these epitopes in the long term memory response (16). A similar approach showed preservation of diverse TCR usage in the CTL response to an epitope within the lytic trans-activator protein BZLF1 during primary and persistent infection (19). Maintenance of the broad repertoire of clones visualized by heteroduplex analysis, which is likely to represent responses to a number of different epitopes, may be a crucial immunoprotective feature of the antiviral response, particularly in the case of less genetically stable viruses.

The CD45 phenotype of the clonal expansions documented in this work is in line with accumulating data that CD45RA does not reliably identify only naive CD8+ T cells (39, 40, 41, 42). The correlation between clonotypes identified in the CD45RO+ fraction and those capable of re-expansion in EBV-CTL cultures is congruent with the original data showing segregation of most EBV-CTLp with this subset (43). It is now clear that EBV-specific CTL effectors might not have been detected by these limiting dilution analyses, since they would have been prone to apoptose in vitro. Some CD8+ CTL effectors have been suggested to have a CD45RA+CCR7- or CD45RA+CD27-CD28- phenotype outside the setting of an acute infection (28, 44), consistent with the accumulation of clonal expansions in the latter subset following acute EBV infection. The analysis of CD45 isoform expression of tetramer-positive CD8+ T cells following the resolution of IM also showed a partial switch to CD45RA expression (10). The heteroduplex data presented here reveal that cells from the same clones (and therefore using the same TCRs) can express both CD45 phenotypes, as has been demonstrated for a single CMV-specific clonotype (45). This could be attributed to CD45RO to CD45RA reversion following an acute response or could indicate that some cells within a dividing clone are capable of maintaining expression of the CD45RA isoform. However, the very high initial proportion of CD45RO+ CD8 cells and the progressive increase in the number of clonotypes in the CD45RA fraction over time following the acute antigenic challenge support the former interpretation. The functional specificity of the CD45RA clones could be explored for defined epitopes by techniques such as enzyme-linked immunospot or intracytoplasmic staining for IFN-{gamma}, which do not require in vitro expansion. This would enable assessment of whether there was also functional reversion to a naive state or whether these EBV-related CD45RA clones actually have direct ex vivo effector function, as suggested by their phenotypic resemblance to those described in healthy individuals (28, 44). The demonstration of a large, long-lived CD45RA clone underscores the fact that Ag-driven CD8+ T cells can maintain this phenotype for prolonged periods, accounting for a significant proportion of the circulating naive CD8 pool.

This is the first analysis of CD4 clonality in EBV infection and reveals profound differences in the heterogeneity of the responding population compared with that of the CD8 compartment. The clonal composition of CD4+ and CD8+ fractions needs to be compared simultaneously in other acute immune responses to support the assertion that the CD4+ T cell response to Ag is composed of smaller clones. This would be congruent with their differing effector functions, with larger CD8+ clones being required to achieve efficient direct CTL killing, whereas CD4+ effects are mediated via cytokines. Most of the extensive repertoire of CD8 clones responding to primary symptomatic EBV infection persists at surprisingly high circulating frequencies following disease resolution. The data indicate that a relatively heterogeneous repertoire of CTL can be maintained at least initially under the pressure of a persistent, genetically stable, virus infection. The assessment of clonality by mAb staining and heteroduplex analysis confirm that most acutely Ag-activated CD8+ T cells express the low molecular weight isoform CD45RO. CD45RA is not a clear-cut naive marker for CD8s, in that large Ag-driven clones are found in this fraction. Thus, the ability to identify persistent clones constituting the ongoing cellular response, not only those capable of expansion in vitro, has allowed reassessment of a highly effective antiviral T cell response.


    Acknowledgments
 
We thank University College Hospitals Department of Hematology, local general practitioners, and the donors for their participation, and Giulia Casorati and Andreas Wack for transferring the heteroduplex technology.


    Footnotes
 
1 This work was supported by the Imperial Cancer Research Fund and the Medical Research Council. M.K.M. was supported by a Medical Research Council Clinical Training Fellowship and is now supported by a collaborative grant from The Edward Jenner Institute for Vaccine Research. L.R.W. is supported by a Wellcome Trust Clinician Scientist fellowship. N.G. is supported by a Cancer Research Campaign Studentship. Back

2 Address correspondence and reprint requests to Dr. Mala K. Maini, Department of Sexually Transmitted Diseases, The Mortimer Market Center, off Capper Street, London, U.K. WC1E 6AU. Back

3 Abbreviations used in this paper: IM, infectious mononucleosis; CTLp, CTL precursor; BC, constant region of the {beta}-chain; BV, variable region of the {beta}-chain. Back

Received for publication April 6, 2000. Accepted for publication August 15, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rickinson, A. B., C. D. Gregory. 1993. Immunology of Epstein-Barr virus infection. P. J. Lachmann, and D. K. Peters, and F. S. Rosen, and M. J. Walport, eds. In Clinical Aspects of Immunology Vol. 3:1519. Blackwell, Cambridge.
  2. Heslop, H. E., C. Y. Ng, C. Li, C. A. Smith, S. K. Loftin, R. A. Krance, M. K. Brenner, C. M. Rooney. 1996. Long-term restoration of immunity against Epstein-Barr virus infection by adoptive transfer of gene-modified virus-specific T lymphocytes. Nat. Med. 2:551.[Medline]
  3. Callan, M. F., N. Steven, P. Krausa, J. D. Wilson, P. A. Moss, G. M. Gillespie, J. I. Bell, A. B. Rickinson, A. J. McMichael. 1996. Large clonal expansions of CD8+ T cells in acute infectious mononucleosis. Nat. Med. 2:906.[Medline]
  4. Callan, M. F. C., N. Annels, N. Steven, L. Tan, J. Wilson, A. J. McMichael, A. B. Rickinson. 1998. T cell selection during the evolution of CD8+ T cell memory in vivo. Eur. J. Immunol. 28:4382.[Medline]
  5. Silins, S. L., S. M. Cross, K. G. Krauer, D. J. Moss, C. W. Schmidt, I. S. Misko. 1998. A functional link for TCR expansions in healthy adults caused by persistent Epstein-Barr infection. J. Clin. Invest. 102:1551.[Medline]
  6. Hingorani, R., I. H. Choi, P. Akolkar, B. Gulwani Akolkar, R. Pergolizzi, J. Silver, P. K. Gregersen. 1993. Clonal predominance of T cell receptors within the CD8+ CD45RO+ subset in normal human subjects. J. Immunol. 151:5762.[Abstract]
  7. Maini, M. K., L. R. Wedderburn, F. Hall, A. Wack, G. Casorati, P. C. L. Beverley. 1998. A comparison of two techniques for the molecular tracking of specific T cell responses; CD4+ human T cell clones persist in a stable hierarchy but at a lower frequency than clones in the CD8+ population. Immunology 94:529.[Medline]
  8. Wack, A., A. Cossarizza, S. Heltai, D. Barbieri, S. D’Addato, C. Fransceschi, P. Dellabona, G. Casorati. 1998. Age-related modifications of the human {alpha}{beta} T cell repertoire due to different clonal expansions in the CD4+ and CD8+ subsets. Int. Immunol. 10:1281.[Abstract/Free Full Text]
  9. Maini, M. K., G. Casorati, P. Dellabona, A. Wack, P. C. L. Beverley. 1999. T cell clonality in immune responses. Immunol. Today 20:262.[Medline]
  10. Callan, M. F., L. Tan, N. Annels, G. S. Ogg, J. D. Wilson, C. A. O’Callaghan, N. Steven, A. J. McMichael, A. B. Rickinson. 1998. Direct visualization of antigen-specific CD8+ T cells during the primary immune response to Epstein-Barr virus in vivo. J. Exp. Med. 187:1395.[Abstract/Free Full Text]
  11. Tan, L. C., N. Gudgeon, N. E. Annels, P. Hansasuta, C. A. O’Callaghan, S. Rowland-Jones, A. J. McMichael, A. B. Rickinson, M. F. C. Callan. 1999. A re-evaluation of the frequency of CD8+ T cells specific for EBV in healthy virus carriers. J. Immunol. 162:1827.[Abstract/Free Full Text]
  12. McMichael, A. J., C. A. O’Callaghan. 1998. A new look at T cells. J. Exp. Med. 187:1367.[Free Full Text]
  13. Doherty, P. C., D. J. Topham, R. A. Tripp. 1996. Establishment and persistence of virus-specific CD4+ and CD8+ T cell memory. Immunol. Rev. 150:23.[Medline]
  14. Varga, S. M., R. M. Welsh. 1998. Detection of a high frequency of virus-specific CD4+ T cells during acute infection with lymphocytic choriomeningitis virus. J. Immunol. 161:3215.[Abstract/Free Full Text]
  15. Dietrich, P. Y., P. R. Walker, V. Schnuriger, P. Saas, G. Perrin, M. Guillard, C. Gaudin, A. Caignard. 1997. TCR analysis reveals significant repertoire selection during in vitro lymphocyte culture. Int. Immunol. 9:1073.[Abstract/Free Full Text]
  16. Argaet, V. P., C. W. Schmidt, S. R. Burrows, S. L. Silins, M. G. Kurilla, D. L. Doolan, A. Suhrbier, D. J. Moss, E. Kieff, T. B. Suclley, et al 1994. Dominant selection of an invariant T cell antigen receptor in response to persistent infection by Epstein-Barr virus. J. Exp. Med. 180:2335.[Abstract/Free Full Text]
  17. Silins, S. L., S. M. Cross, S. L. Elliott, S. J. Pye, S. R. Burrows, J. M. Burrows, D. J. Moss, V. P. Argaet, I. S. Misko. 1996. Development of Epstein-Barr virus-specific memory T cell receptor clonotypes in acute infectious mononucleosis. J. Exp. Med. 184:1815.[Abstract/Free Full Text]
  18. Campos Lima, P. O., V. Levitsky, M. P. Imreh, R. Gavioli, M. G. Masucci. 1997. Epitope-dependent selection of highly restricted or diverse T cell receptor repertoires in response to persistent infection by Epstein-Barr virus. J. Exp. Med. 186:83.[Abstract/Free Full Text]
  19. Silins, S. L., S. M. Cross, S. L. Elliott, S. J. Pye, J. M. Burrows, D. J. Moss, I. S. Misko. 1997. Selection of a diverse TCR repertoire in response to an Epstein-Barr virus-encoded transactivator protein BZLF1 by CD8+ cytotoxic T lymphocytes during primary and persistent infection. Int. Immunol. 9:1745.[Abstract/Free Full Text]
  20. Gallimore, A., T. Dumrese, H. Hengartner, R. M. Zinkernagel, H. G. Rammensee. 1998. Protective immunity does not correlate with the hierarchy of virus-specific cytotoxic T cell responses to naturally processed peptides. J. Exp. Med. 187:1647.[Abstract/Free Full Text]
  21. Carrington, M., G. Nelson, M. Martin, T. Kissner, D. Vlahov, J. Goedert, R. Kaslow, S. Buchbinder, K. Hoots, S. O’Brien. 1999. HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage. Science 283:1748.[Abstract/Free Full Text]
  22. Hill, A.. 1999. Defence by diversity. Nature 398:668.[Medline]
  23. Cooper, S., A. L. Erickson, E. J. Adams, J. Kansopon, A. J. Weiner, D. Y. Chien, M. Houghton, P. Parham, C. M. Walker. 1999. Analysis of a successful immune response against hepatitis C virus. Immunity 10:439.[Medline]
  24. Wack, A., D. Montagna, P. Dellabona, G. Casorati. 1996. An improved PCR-heteroduplex method permits high-sensitivity detection of clonal expansions in complex T cell populations. J. Immunol. Methods 196:181.[Medline]
  25. Steven, N. M., A. M. Leese, N. E. Annels, S. P. Lee, A. B. Rickinson. 1996. Epitope focusing in the primary cytotoxic T cell response to Epstein-Barr virus and its relationship to T cell memory. J. Exp. Med. 184:1801.[Abstract/Free Full Text]
  26. Tomkinson, B. E., D. K. Wagner, D. L. Nelson, J. L. Sullivan. 1987. Activated lymphocytes during acute Epstein-Barr virus infection. J. Immunol. 139:3802.[Abstract]
  27. Miyawaki, T., Y. Kasahara, H. Kanegane, K. Ohta, T. Yokoi, A. Yachie, N. Taniguchi. 1991. Expression of CD45R0 (UCHL1) by CD4+ and CD8+ T cells as a sign of in vivo activation in infectious mononucleosis. Clin. Exp. Immunol. 83:447.[Medline]
  28. Hamann, D., P. A. Baars, M. H. Rep, B. Hooibrink, S. R. Kerkhof Garde, M. R. Klein, R. A. van Lier. 1997. Phenotypic and functional separation of memory and effector human CD8+ T cells. J. Exp. Med. 186:1407.[Abstract/Free Full Text]
  29. Butz, E. A., M. J. Bevan. 1998. Massive expansion of antigen-specific CD8+ T cells during an acute virus infection. Immunity 8:167.[Medline]
  30. Murali-Krishna, K., J. D. Altman, M. Suresh, D. J. D. Sourdive, A. J. Zajac, J. D. Miller, J. Slansky, R. Ahmed. 1998. Counting antigen-specific CD8 T cells: a reevaluation of bystander activation during viral infection. Immunity 8:177.[Medline]
  31. Whitmire, J. K., M. S. Asano, K. Murali-Krishna, M. Suresh, R. Ahmed. 1998. Long-term CD4 Th1 and Th2 memory following acute lymphocytic choriomeningitis virus infection. J. Virol. 72:8281.[Abstract/Free Full Text]
  32. Christensen, J. P., P. C. Doherty. 1999. Quantitative analysis of the acute and long-term CD4+ T cell response to a persistent gammaherpesvirus. J. Virol. 73:4279.[Abstract/Free Full Text]
  33. Novak, E. J., A. W. Liu, G. T. Nepom, W. W. Kwok. 1999. MHC class II tetramers identify peptide-specific human CD4+ T cells proliferating in response to influenza A antigen. J. Clin. Invest. 104:R63.
  34. Masuko, K., T. Kato, Y. Ikeda, M. Okubo, Y. Mizushima, K. Nishioka, K. Yamamoto. 1994. Dynamic changes of accumulated T cell clonotypes during antigenic stimulation in vivo and in vitro. Int. Immunol. 6:1959.[Abstract/Free Full Text]
  35. Cardin, R. D., J. W. Brooks, S. R. Sarawar, P. C. Doherty. 1996. Progressive loss of CD8+ T cell-mediated control of a {gamma}-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.[Abstract/Free Full Text]
  36. Zajac, A. J., J. N. Blattman, K. Murali-Krishna, D. J. D. Sourdive, M. Suresh, J. D. Altman, R. Ahmed. 1998. Viral immune evasion due to persistence of activated T cells without effector function. J. Exp. Med. 188:2205.[Abstract/Free Full Text]
  37. Akbar, A. N., N. Borthwick, M. Salmon, W. Gombert, M. Bofill, N. Shamsadeen, D. Pilling, S. Pett, J. E. Grundy, G. Janossy. 1993. The significance of low bcl-2 expression by CD45RO T cells in normal individuals and patients with acute viral infections: the role of apoptosis in T cell memory. J. Exp. Med. 178:427.[Abstract/Free Full Text]
  38. Maini, M. K., M. V. D. Soares, C. F. Zilch, A. N. Akbar, P. C. L. Beverley. 1999. Virus-induced CD8+ T cell clonal expansion is associated with telomerase up-regulation and telomere length preservation: a mechanism for rescue from replicative senescence. J. Immunol. 162:4521.[Abstract/Free Full Text]
  39. Michie, C. A., A. McLean, C. Alcock, P. C. Beverley. 1992. Lifespan of human lymphocyte subsets defined by CD45 isoforms. Nature 360:264.[Medline]
  40. Okumura, M., Y. Fujii, K. Inada, K. Nakahara, H. Matsuda. 1993. Both CD45RA+ and CD45RA- subpopulations of CD8+ T cells contain cells with high levels of lymphocyte function-associated antigen-1 expression, a phenotype of primed T cells. J. Immunol. 150:429.[Abstract]
  41. Tripp, R. A., S. Hou, P. C. Doherty. 1995. Temporal loss of the activated L-selectin-low phenotype for virus-specific CD8+ memory T cells. J. Immunol. 154:5870.[Abstract]
  42. Zimmerman, C., K. Brduscha Riem, C. Blaser, R. M. Zinkernagel, H. Pircher. 1996. Visualization, characterization, and turnover of CD8+ memory T cells in virus-infected hosts. J. Exp. Med. 183:1367.[Abstract/Free Full Text]
  43. Merkenschlager, M., P. C. Beverley. 1989. Evidence for differential expression of CD45 isoforms by precursors for memory-dependent and independent cytotoxic responses: human CD8 memory CTLp selectively express CD45RO (UCHL1). Int. Immunol. 1:450.[Abstract/Free Full Text]
  44. Sallusto, F., D. Lenig, R. Forster, M. Lipp, A. Lanzavecchia. 1999. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401:708.[Medline]
  45. Wills, M. R., A. J. Carmichael, M. P. Weekes, K. Mynard, G. Okecha, R. Hicks, J. G. P. Sissons. 1999. Human virus-specific CD8+ CTL clones revert from CD45ROhigh to CD45RAhigh in vivo: CD45RAhigh CD8+ T cells comprise both naive and memory cells. J. Immunol. 162:7080.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
GutHome page
P Fisicaro, C Valdatta, C Boni, M Massari, C Mori, A Zerbini, A Orlandini, L Sacchelli, G Missale, and C Ferrari
Early kinetics of innate and adaptive immune responses during hepatitis B virus infection
Gut, July 1, 2009; 58(7): 974 - 982.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Lecuroux, I. Girault, A. Urrutia, J.-M. Doisne, C. Deveau, C. Goujard, L. Meyer, M. Sinet, and A. Venet
Identification of a particular HIV-specific CD8+ T-cell subset with a CD27+ CD45RO-/RA+ phenotype and memory characteristics after initiation of HAART during acute primary HIV infection
Blood, April 2, 2009; 113(14): 3209 - 3217.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. W. Wells, C. J. Cowled, F. Farzaneh, and A. Noble
Combined Triggering of Dendritic Cell Receptors Results in Synergistic Activation and Potent Cytotoxic Immunity
J. Immunol., September 1, 2008; 181(5): 3422 - 3431.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. L-L. Chiang, J. A. Ledermann, E. Aitkens, E. Benjamin, D. R. Katz, and B. M. Chain
Oxidation of Ovarian Epithelial Cancer Cells by Hypochlorous Acid Enhances Immunogenicity and Stimulates T Cells that Recognize Autologous Primary Tumor
Clin. Cancer Res., August 1, 2008; 14(15): 4898 - 4907.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. W. Wlodarski, Z. Nearman, A. Jankowska, N. Babel, J. Powers, P. Leahy, H.-D. Volk, and J. P. Maciejewski
Phenotypic differences between healthy effector CTL and leukemic LGL cells support the notion of antigen-triggered clonal transformation in T-LGL leukemia
J. Leukoc. Biol., March 1, 2008; 83(3): 589 - 601.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Crompton, N. Khan, R. Khanna, L. Nayak, and P. A. H. Moss
CD4+ T cells specific for glycoprotein B from cytomegalovirus exhibit extreme conservation of T-cell receptor usage between different individuals
Blood, February 15, 2008; 111(4): 2053 - 2061.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Asquith, Y. Zhang, A. J. Mosley, C. M. de Lara, D. L. Wallace, A. Worth, L. Kaftantzi, K. Meekings, G. E. Griffin, Y. Tanaka, et al.
In vivo T lymphocyte dynamics in humans and the impact of human T-lymphotropic virus 1 infection
PNAS, May 8, 2007; 104(19): 8035 - 8040.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. K. Whitmire, N. Benning, and J. L. Whitton
Precursor Frequency, Nonlinear Proliferation, and Functional Maturation of Virus-Specific CD4+ T Cells.
J. Immunol., March 1, 2006; 176(5): 3028 - 3036.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. W. Wlodarski, C. O'Keefe, E. C. Howe, A. M. Risitano, A. Rodriguez, I. Warshawsky, T. P. Loughran Jr, and J. P. Maciejewski
Pathologic clonal cytotoxic T-cell responses: nonrandom nature of the T-cell-receptor restriction in large granular lymphocyte leukemia
Blood, October 15, 2005; 106(8): 2769 - 2780.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. Obst, H.-M. van Santen, D. Mathis, and C. Benoist
Antigen persistence is required throughout the expansion phase of a CD4+ T cell response
J. Exp. Med., May 16, 2005; 201(10): 1555 - 1565.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. R. Reed, M. Vukmanovic-Stejic, J. M. Fletcher, M. V. D. Soares, J. E. Cook, C. H. Orteu, S. E. Jackson, K. E. Birch, G. R. Foster, M. Salmon, et al.
Telomere Erosion in Memory T Cells Induced by Telomerase Inhibition at the Site of Antigenic Challenge In Vivo
J. Exp. Med., May 17, 2004; 199(10): 1433 - 1443.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Landais, X. Saulquin, E. Scotet, L. Trautmann, M.-A. Peyrat, J. L. Yates, W. W. Kwok, M. Bonneville, and E. Houssaint
Direct killing of Epstein-Barr virus (EBV)-infected B cells by CD4 T cells directed against the EBV lytic protein BHRF1
Blood, February 15, 2004; 103(4): 1408 - 1416.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. V. D. Soares, F. J. Plunkett, C. S. Verbeke, J. E. Cook, J. M. Faint, L. L. Belaramani, J. M. Fletcher, N. Hammerschmitt, M. Rustin, W. Bergler, et al.
Integration of apoptosis and telomere erosion in virus-specific CD8+ T cells from blood and tonsils during primary infection
Blood, January 1, 2004; 103(1): 162 - 167.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Bickham, K. Goodman, C. Paludan, S. Nikiforow, M. L. Tsang, R. M. Steinman, and C. Munz
Dendritic Cells Initiate Immune Control of Epstein-Barr Virus Transformation of B Lymphocytes In Vitro
J. Exp. Med., December 1, 2003; 198(11): 1653 - 1663.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. R. Lopes, A. Jaye, L. Dorrell, S. Sabally, A. Alabi, N. A. Jones, D. R. Flower, A. De Groot, P. Newton, R. M. Lascar, et al.
Greater CD8+ TCR Heterogeneity and Functional Flexibility in HIV-2 Compared to HIV-1 Infection
J. Immunol., July 1, 2003; 171(1): 307 - 316.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. J. Dunne, J. M. Faint, N. H. Gudgeon, J. M. Fletcher, F. J. Plunkett, M. V. D. Soares, A. D. Hislop, N. E. Annels, A. B. Rickinson, M. Salmon, et al.
Epstein-Barr virus-specific CD8+ T cells that re-express CD45RA are apoptosis-resistant memory cells that retain replicative potential
Blood, July 18, 2002; 100(3): 933 - 940.
[Abstract] [Full Text] [PDF]


Home page
Br Med BullHome page
P C L Beverley
Immunology of vaccination
Br. Med. Bull., July 1, 2002; 62(1): 15 - 28.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Sester, U. Sester, B. Gartner, B. Kubuschok, M. Girndt, A. Meyerhans, and H. Kohler
Sustained High Frequencies of Specific CD4 T Cells Restricted to a Single Persistent Virus
J. Virol., March 19, 2002; 76(8): 3748 - 3755.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
J. A. Plumbley, H. Fan, P. A. Eagan, A. Ehsan, B. Schnitzer, and M. L. Gulley
Lymphoid Tissues from Patients with Infectious Mononucleosis Lack Monoclonal B and T Cells
J. Mol. Diagn., February 1, 2002; 4(1): 37 - 43.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
L. R. Wedderburn, A. Patel, H. Varsani, and P. Woo
Divergence in the degree of clonal expansions in inflammatory T cell subpopulations mirrors HLA-associated risk alleles in genetically and clinically distinct subtypes of childhood arthritis
Int. Immunol., December 1, 2001; 13(12): 1541 - 1550.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Voehringer, C. Blaser, P. Brawand, D. H. Raulet, T. Hanke, and H. Pircher
Viral Infections Induce Abundant Numbers of Senescent CD8 T Cells
J. Immunol., November 1, 2001; 167(9): 4838 - 4843.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
L. R. Wedderburn, R. Jeffery, H. White, A. Patel, H. Varsani, D. Linch, K. Murray, and P. Woo
Autologous stem cell transplantation for paediatric-onset polyarteritis nodosa: changes in autoimmune phenotype in the context of reduced diversity of the T- and B-cell repertoires, and evidence for reversion from the CD45RO+ to RA+ phenotype
Rheumatology, November 1, 2001; 40(11): 1299 - 1307.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Varela-Calvino, G. Sgarbi, L. R. Wedderburn, C. M. Dayan, J. Tremble, and M. Peakman
T Cell Activation by Coxsackievirus B4 Antigens in Type 1 Diabetes Mellitus: Evidence for Selective TCR V{beta} Usage Without Superantigenic Activity
J. Immunol., September 15, 2001; 167(6): 3513 - 3520.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. D. Bitmansour, S. L. Waldrop, C. J. Pitcher, E. Khatamzas, F. Kern, V. C. Maino, and L. J. Picker
Clonotypic Structure of the Human CD4+ Memory T Cell Response to Cytomegalovirus
J. Immunol., August 1, 2001; 167(3): 1151 - 1163.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maini, M. K.
Right arrow Articles by Beverley, P. C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maini, M. K.
Right arrow Articles by Beverley, P. C. L.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Infectious Mononucleosis


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS