|
|
||||||||
Division of Human Immunology, Hanson Centre For Cancer Research, Institute for Medical and Veterinary Science, Adelaide, Australia
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
enhancer assemble
transcription factors to form discrete oligomeric structures termed
enhanceosomes (11 ; reviewed in Ref. 12) that
are difficult to dissect without destroying activity. Consequently,
there are few, if any, examples in which it has been clearly
demonstrated that the combinatorial regulation of composite elements is
sufficient to account for a specific pattern of gene expression. Even
in the well-documented area of NFAT and AP-1, these factors regulate
many differentially expressed genes and it is difficult to determine
the role played by NFAT in establishing specific patterns of gene
expression. To attempt to define the minimum requirements for combinatorial regulation of tissue-specific transcription in the immune system, we investigated regulatory elements controlling cytokine gene expression. Cytokine genes are tightly regulated and are induced by immune and proinflammatory signals in a wide variety of cell types, and they exhibit many distinct but overlapping tissue-specific expression profiles (13). In T cells, cytokine genes such as IL-2, IL-3, and GM-CSF are turned on via the Ca2+ and kinase signaling pathways linked to the TCR. NFAT appears to play a critical role in their regulation and is activated via the cyclosporin A-suppressible Ca2+/calcineurin pathway (reviewed in Refs. 3, 4, 5, 6, 7, 8, 9, 10). NFAT is a family of at least four related proteins that appears to regulate cytokine gene expression not only in T cells, but also in myeloid cells and endothelial cells (5, 14, 15). NFAT does not usually function alone, but in strict cooperation with other factors, and contributes to many different patterns of combinatorial regulation (7). NFAT and AP-1 bind cooperatively to the consensus sequence GGAAANNNTGANTCA, in which the arrangement of NFAT and AP-1 sites is rigidly conserved (10). In the IL-3 enhancer, NFAT synergizes with Oct family proteins even in the absence of cooperative binding (16).
We adopted the IL-3/GM-CSF locus as a model for studying combinatorial
regulation because these evolutionarily related cytokine genes are
closely linked in the genome and are turned on by the same TCR
signaling pathways, yet they have distinct patterns of gene expression
(4, 8, 13). IL-3 expression is restricted primarily to
activated T cells, while GM-CSF expression can be induced in a wide
range of tissues that include T cells, myeloid cells, endothelial
cells, epithelial cells, and fibroblasts (13). The
IL-3/GM-CSF locus is regulated by two separate inducible enhancers
situated 14 kb upstream of the IL-3 gene and 3 kb upstream of the
GM-CSF gene (9, 10, 14, 15, 16). These enhancers have distinct
tissue-specific activities that mirror IL-3 and GM-CSF expression
patterns. IL-3 enhancer function has only been detected in T cells
(16), while the GM-CSF enhancer is known to function in T
cells, endothelial cells, and myeloid cells (9, 10, 15).
Although they differ in their composite nature, the IL-3 and GM-CSF
enhancers have a similar organization, as they both contain an array of
four NFAT sites (Fig. 1
A),4 and in each case
the central two sites exist within an inducible cyclosporin
A-suppressible DNase I-hypersensitive
(DH)5 site. NFAT has
been implicated in the chromatin-remodeling events responsible for DH
site formation, and this activity may contribute to the strong synergy
in function observed between NFAT and other factors (9, 10, 16).
|
| Materials and Methods |
|---|
|
|
|---|
RNA was prepared from unstimulated cells and cells stimulated for 9 h with 20 ng/ml PMA and 1 µM A23187. IL-3, GM-CSF, and OCA-B transcripts were assayed by Northern blot hybridization analysis. 32P-labeled probes contained the 480-bp BamHI/XmnI 3' region of the human IL-3 gene, the 700-bp EcoRI/BamHI fragment of the human GM-CSF gene, and the human OCA-B gene isolated as a 2-kb EcoRI/NotI fragment of the expression plasmid pCDNA/OBF-1 (see below). Membranes were reprobed with the 400-bp EcoRI/HindIII fragment from the human GAPDH gene to control for RNA integrity and uniformity of sample loading.
DH site analyses
GM-CSF and IL-3 enhancer DH sites in Jurkat cells, CEM cells, KG1a cells, 5637 cells, K562 cells, and Raji cells were assayed as described previously (9, 16, 17). For each cell line, a DNase I titration was performed and samples that had optimal extents of DNase I digestion were selected for Southern blot hybridization analysis of DH sites. The membrane containing BamHI-digested samples used in the analysis of the IL-3 enhancer DH site was reprobed with a probe designed to detect a ubiquitous DH site immediately downstream of the IL-3 gene (12, 15) to confirm that DH sites could be detected in each sample.
Plasmid construction
All of the luciferase reporter gene constructs described in this work contained oligonucleotides or enhancers inserted upstream of a minimal promoter in pXPG-GM55 (18), which was made by cloning a minimal core fragment of the human GM-CSF promoter (-55 to +28) into the HindIII site of the luciferase reporter plasmid pXPG (18). pXPG is a modified form of pXP1 (19) that has the firefly luciferase gene replaced by the Luc+ gene from pGL3 (Promega, Madison, WI), and the pBR322 ori converted to a high copy ori. Like pXP1, pXPG has four upstream polyadenylation signals to block read-through transcription effects that in the past have affected equivalent pGL3-based plasmids employed by us (16, 18).
pIL3E contained the 330-bp NruI/AccI fragment of
the IL-3 enhancer (16), and pGME contained the 425-bp
BamHI/BalI fragment of the GM-CSF enhancer
(10). Mutations in the IL-3 enhancer were generated by
site-directed mutagenesis of the 330-bp IL-3 enhancer using
oligonucleotides containing the following sequences: IL140
N,
GGCAAGAACCCTTGCTTTggCCACTGGGCCTTTCTT; IL190
N,
GGGTGCTCCATGGccAATGCAAATCTACTTAACTGA; IL190
Oct,
TCCATGGAAAATGCccATCTACTTAACTGA; IL280
N,
GCTGTGAGCTACAGTTggCCAGCCTCTAGAGCC; IL3-AP-1,
CTCCATGGAAAATGagAgTCaACTTAACTGACTTT. (Altered bases shown in
lower case.) pGM420 contained a single copy of GM420 (10).
Because IL190 is a weaker enhancer than GM420, we created pIL190 by
inserting three copies of IL190 into pXPG-GM55 to increase the ability
to detect residual activity in cells other than T cells.
pIL140/IL190 contains the sequence
CGGCAAGAACCCTTGCTTTTTCCACTGGGCCTTTCTTCCTCCCACCCTGAGGGTGCTCCATGGAAAATGCAAATCTACT.
All DNA fragments were inserted in the same orientation relative to the
promoters as they exist in the GM-CSF/IL-3 locus. The NFATp expression
plasmid pLGP-NFAT1c was a gift from A. Rao (Harvard Medical School,
Boston, MA; Ref. 20), the human OCA-B expression plasmid
pCDNA/OBF-1 was a gift from P. Matthias (Friedrich Miescher Institute,
Basel, Switzerland), the Oct-1 expression plasmid pWS1 and the Oct-2
expression plasmid pWS2 originated from W. Schaffner (21)
and were gifts from T. Wirth (Ulm University, Ulm, Germany), the mouse
NIP45 expression plasmid pCI-NIP45 was a gift of L. Glimcher (Harvard
Medical School, Ref. 22), and the Brn-2 expression plasmid
pCDNA3.1/Brn-2 was a gift of R. Sturm (University of Queensland,
Brisbane, Australia).
Oligonucleotides
Previously described oligonucleotide duplexes (10, 16) used as probes and competitors incorporated the following sequences: IL190, GGGTGCTCCATGGAAAATGCAAATCTACT; GM420, CCATCTTTCTCATGGAAAGATGACATCAGGG; GM430, TCACACATCTTTCTCATGGAAAGATGA; octamer, CCTAATTTGCATG; AP-1, TGGATCACCCGCAGCTTGACTCATCCTTGCA.
Cell culture
The Jurkat T leukemic cell line, CEM T leukemic cell line, Raji B leukemic cell line, KG1a myeloid leukemic cell line, and K562 proerythroid/megakaryotic CML cell line were cultured in RPMI containing 10% FCS. The 5637 bladder carcinoma epithelial cell line was cultured in RPMI containing 7% FCS.
Transient transfections and luciferase assays
All cells were transfected with CsCl-purified plasmid DNA by electroporation, cultured for 2024 h, stimulated with 20 ng/ml PMA and 1 µM calcium ionophore A23187 for 9 h, and assayed for luciferase reporter gene activities, as previously described (16). In all transfections, 5 µg of luciferase reporter plasmid was used. In cotransfection experiments, 5 µg of each expression plasmid or parent vector was also transfected.
Gel EMSAs
Nuclear extracts were prepared and EMSAs performed as previously described (9), except that assays employed 4 µg of nuclear extract and 2 µg of poly(dI-dC) in a 15 µl volume. EMSAs employed nuclear extracts prepared from unstimulated cells and cells stimulated for 23 h with 20 ng/ml PMA and 2 µM A23187. Some assays included specific antisera. The Brn-2 antisera raised against the C terminus of human Brn-2 (23) and the Oct-1 Ab (24) were gifts from R. Sturm. The Oct-2 antisera raised against the N terminus of mouse Oct-2 was a gift from L. Corcoran (Walter and Eliza Hill Institute, Melbourne, Australia).
| Results |
|---|
|
|
|---|
Before studying the tissue-specific regulation of the IL-3/GM-CSF
locus, it was necessary to establish a well-defined model system that
included a range of cell types that reflected the different properties
of the two genes, and mirrored the activities of normal cells. To this
end, we assayed IL-3 and GM-CSF gene expression in a variety of
hemopoietic and nonhemopoietic cell lines following stimulation with a
combination of the phorbol ester PMA and the calcium ionophore A23187
(Fig. 1
B). These signals
directly activate the protein kinase C and calcium pathways in T cells
and are known to synergize in the activation of IL-3 and GM-CSF gene
expression. For consistency, the same activation protocol was adopted
for each of the cell types employed in this study. As anticipated, the
Jurkat and CEM human T cell lines both expressed IL-3 and GM-CSF mRNA
in a highly inducible fashion. The myeloblastic cell line KG1a, the
epithelial cell line 5637, and the CML cell line K562 all expressed
GM-CSF, but not IL-3 in response to stimulation with PMA and A23187.
These signals did not elicit expression of either gene in the Raji
human B cell line. The ubiquitously expressed GAPDH gene was used as a
control in this study to enable comparison of mRNA levels in the
different cell lines.
To assess the activation status of the endogenous IL-3 and GM-CSF
enhancers in the same panel of cells, we assayed the enhancer regions
for the presence of inducible DH sites (top two
panels, Fig. 1
C). This approach identifies
chromatin-remodeling events and typically provides the first indication
that a locus is undergoing activation. To confirm that we had selected
appropriate DNase I-digested samples for this analysis, we also assayed
the same samples for a ubiquitous constitutive DH site immediately
downstream of the IL-3 gene (IL-3 +2.8 kb, Fig. 1
C
(15). A strong correlation between the induction of DH
sites in the enhancers and the activation of gene expression was
observed for both genes. The IL-3 enhancer DH site was restricted to
activated T cells (Jurkat and CEM), while the GM-CSF enhancer DH site
was also induced in KG1a cells and K562 cells, but not in Raji cells.
Although 5637 cells expressed moderate levels of GM-CSF, they did not
contain a DH site within the GM-CSF enhancer. However, 5637 cells do
exhibit a strong constitutive DH site in the GM-CSF promoter
(15), and the GM-CSF promoter is highly inducible in
transfected 5637 cells (15). These results infer that the
GM-CSF gene is activated via enhancer-dependent mechanisms in cells
such as Jurkat, CEM, and KG1a, which express NFAT, but
enhancer-independent mechanisms in 5637 cells, allowing us to employ
5637 cells as a useful control in subsequent studies.
To correlate enhancer function with the above structural and expression
data, the two enhancers were placed upstream of a minimal promoter in a
luciferase reporter gene plasmid and tested in a representative group
of four of the six cell lines (Fig. 2
A). Enhancer activity was
assessed in transfected cells stimulated with PMA and A23187. The IL-3
and GM-CSF enhancers were both very active in the two T cell lines,
increasing promoter activity by up to 80-fold. However, the two
enhancers behaved very differently in KG1a cells in which the IL-3
enhancer was completely inactive, while the GM-CSF enhancer increased
promoter activity by 110-fold. The two enhancers were both inactive in
5637 cells, in contrast to the full-length GM-CSF promoter and the SV40
enhancer that are both highly active when analyzed in 5637 cells by the
same procedure in parallel assays (15). Hence, the
activities of the two transfected enhancers directly paralleled the
appearance of DH sites within the endogenous enhancers, reinforcing the
direct link between chromatin remodeling and cytokine gene activation.
These data are also consistent with other published and unpublished
studies, demonstrating that the GM-CSF enhancer is active and the IL-3
enhancer is inactive in endothelial cells (15, 16) and
mast cells (data not shown). All of the enhancer activities reported in
this work represented inducible activity, as no significant luciferase
activity was detected in any instance in the absence of stimulation
(data not shown).
|
Having established that the IL-3 and GM-CSF enhancers had
inducible activities that paralleled the activities of the endogenous
genes, we sought the mechanisms that enabled activation of both
enhancers in T cells, but just the GM-CSF enhancer in other cell types.
As both enhancers consist primarily of arrays of NFAT sites, we focused
on the properties of the two distinct classes of composite NFAT sites
found within these two enhancers (Figs. 1
A and
2B). To select an example of a composite NFAT/AP-1 site, we
chose the GM420 element from the GM-CSF enhancer. The GM420 element is
the most active element in the enhancer and the only functional NFAT
site with the capacity to bind NFAT independently of AP-1
(10). The GM420 element is located within the minimum
enhancer core region associated with the DH site and is likely to
contribute to cyclosporin A-sensitive chromatin-remodeling events
within the enhancer. From the IL-3 enhancer, we selected the IL190
NFAT/Oct element that has overlapping NFAT and Oct elements that are
both essential to its function as an enhancer element
(16). The IL190 element is also the feature that best
distinguishes the IL-3 enhancer from the GM-CSF enhancer. Although the
IL-3 enhancer also contains a composite NFAT/AP-1 element (IL280, Fig. 1
A), it was not regarded as significant in this analysis, as
it does not fit the preferred consensus needed for cooperativity
(16), and it did not contribute to overall enhancer
activity (see below).
The two different composite NFAT elements were assayed for enhancer
function in the same system used above to test the full-length
enhancers (Fig. 2
B). Oligonucleotides containing either the
IL190 NFAT/Oct site or the GM420 NFAT/AP-1 site were introduced
upstream of the promoter in the luciferase reporter gene plasmid. As
observed with the full-length IL-3 enhancer, the IL190 element was very
active in Jurkat and CEM T cells, but had little activity in KG1a or
5637 cells. Likewise, the GM420 element had the same profile of
activity as the GM-CSF enhancer, as it was active in Jurkat, CEM, and
KG1a cells, but generated little activity in 5637 cells. Additional
analyses demonstrated that the IL190 element was also inactive in
endothelial cells and mast cells under conditions in which the GM420
element was highly inducible (data not shown). To extend the
observations made with GM420 to other composite NFAT/AP-1 sites, we
performed similar assays with the GM550 element (Fig. 1
A)
(10), which also functioned as an inducible enhancer in
both Jurkat cells and KG1a cells (data not shown).
To ensure that the pXPG-GM55 promoter was not partly responsible for
the tissue specificity of pIL190 and pGM420, similar studies were
performed linking just one copy of either an NFAT/AP-1 site or an
NFAT/Oct site to a promoter construct truncated at -33 to include just
the TATA box. The NFAT/AP-1 element was sufficient to convert the TATA
box to an inducible promoter in both Jurkat cells and endothelial
cells. In contrast, the NFAT/Oct-TATA construct functioned in Jurkat
cells, but not endothelial cells (data not shown). These observations
not only confirmed the results in Fig. 2
B, but defined a
single composite NFAT site linked to a TATA box as an entity sufficient
to constitute an inducible tissue-specific promoter.
Mechanisms of IL-3 enhancer activation
To formally identify the DNA elements responsible for IL-3
enhancer activation in T cells, we performed site-directed mutagenesis
on each of the three NFAT sites known to be able to function as
enhancer elements and assayed these altered enhancers for function in
transfection assays (Fig. 3
, A
and C). Mutations in either the Oct or the NFAT motif of the
IL190 element reduced the activity of the enhancer in Jurkat cells by
6070%. Mutation of the adjacent high affinity IL140 NFAT similarly
reduced enhancer activity by 60%. In contrast, a mutation in the IL280
NFAT/AP-1 site had no effect, but this was not unexpected, as this is a
weak enhancer element with a poor AP-1 site. When an array of three
copies of the IL280 element was tested in pXPG-GM55, it was only
510% as active as equivalent arrays of IL140 or IL190 elements (data
not shown). This low activity may be due to the fact that the IL280
AP-1 site is 1 bp further apart from the NFAT site than is observed for
sites that bind NFAT and AP-1 cooperatively (10, 16), and
previous studies of the GM-CSF enhancer have found that lack of
cooperativity in binding equates to lack of function
(10).
|
The above findings implied that the NFAT and Oct elements were not only
necessary, but perhaps sufficient for the T cell-specific activity of
the IL-3 enhancer. However, as the Oct family protein Oct-1 is
ubiquitous and NFAT controls both the IL-3 and the GM-CSF enhancer, we
assumed that additional factors would be required to drive the T
cell-specific activation of the IL-3 enhancer. To identify potential
regulators of the IL-3 and GM-CSF enhancers, we conducted gel mobility
shift analyses of NFAT, AP-1, and Oct family proteins present in
nuclear extracts prepared from the six cell lines employed in the above
studies (Fig. 4A
). In each case,
AP-1-like proteins were induced by PMA and A23187. Strong induction of
NFAT-like proteins was detected in three cell lines in which the GM-CSF
enhancer was active (Jurkat, CEM, and KG1a), whereas K562 expressed
very low levels and no NFAT was detected in Raji6
or 5637 cells. As expected, all of the cells expressed
Oct-1 ubiquitously, and Raji B cells also expressed substantial amounts
of Oct-2. However, we were surprised to also detect another Oct-like
factor that comigrated with the N-Oct-3 complex derived from the human
Brn-2 Oct family protein that is expressed in the brain and in melanoma
(26, 27). Brn-2 was expressed at a high level in Jurkat
cells and at low levels in CEM and K562 cells. The identities of the
Oct-1, Oct-2, and Brn-2 factors seen in Fig. 4
A were
confirmed in this study using a combination of Oct family Abs that
eliminated the specific complexes described above and generated
supershifted complexes above the Oct-1 band (Fig. 4
B). In
addition, this analysis revealed that CEM cells also expressed a small
amount of Oct-2. A minor species resembling Oct-2 in Jurkat, KG1a, and
5637 cells was not considered further, as it did not react with any of
the Abs and may represent a simple artifact. The properties of the NFAT
and AP-1 complexes have been described previously (10) and
were not analyzed further. Note, however, that the GM420 AP-1 site can
also associate with the closely related cAMP response element binding
protein/activating transcription factor family of proteins
(10).
|
The preceding analyses of the factors and cofactors present in T cells highlighted Oct-1, Oct-2, Brn-2, OCA-B, and NFAT family proteins as potential activators of the IL-3 enhancer. An additional cofactor that had to be considered as a candidate was the NFAT-binding cofactor NIP45 that is expressed predominantly in lymphoid cells (22). However, the NIP45 expression pattern in the cell lines employed in this study was not determined, as a human NIP45 probe was unavailable, and we were unsuccessful in our attempts to detect NIP45 using a mouse NIP45 probe.
The roles of these potential regulators of the IL-3 enhancer were
investigated by introducing them on expression plasmids in
cotransfections with the pIL190 luciferase plasmid containing three
copies of the IL190 element (Fig. 4
D). In activated Jurkat
cells, Oct-1, OCA-B, and NFAT were the most potent activators of
pIL190, increasing its inducible activity by 58-fold, whereas Oct-2
increased expression by about 2-fold. The NFAT cofactor NIP45 also
increased pIL190 activity 2-fold and had the capacity to cooperate with
NFAT in this process to increase the degree of enhancement to 8-fold
compared with the 5-fold activation seen with NFAT alone. In contrast,
Brn-2 was a strong repressor of pIL190. Parallel assays in CEM T cells
confirmed that Brn-2 was a repressor of the IL190 element in cells, in
which it was normally active, as overexpression of Brn-2 reduced
activity by 60% and transfection of a Brn-2 antisense RNA expression
plasmid increased IL190 activity by 40% (data not shown). Along these
lines, it was also interesting to note that Jurkat cells produced the
highest levels of Brn-2 and that the IL-3 enhancer was less active in
Jurkat cells than CEM cells. Hence, the activation of the IL190
NFAT/Oct element in T cells is likely to involve a complex assembly of
at least four distinct factors, with Brn-2 working to dampen
Oct-dependent activation.
Reconstitution of T cell-specific Oct/NFAT-dependent transcription
The above studies indicated that at least two distinct
transcription factors plus their specific cofactors were necessary for
efficient activation of the IL190 NFAT/Oct element. In a bid to
recapitulate the environment of a T cell, we introduced OCA-B, NFAT,
and NIP45 expression plasmids in cotransfections of K562 cells that
express high levels of Oct-1, but low levels of NFAT and no detectable
OCA-B. Following activation with PMA and A23187, the combination of
NFATp, NIP45, and OCA-B gave rise to a striking 50-fold increase in the
activity of pIL190, which had previously supported an activity
indistinguishable from that of a plasmid containing just the core
promoter (Fig. 5
A). The
effects of these three factors were specific for the IL190 element, as
they had no influence on the plasmid containing just the promoter. The
restoration of IL190 activity was highly dependent upon OCA-B, as the
combination of NFATp and NIP45 had negligible effect, while OCA-B alone
increased pIL190 activity by 10-fold.
|
The pIL190 plasmid was next assayed in cotransfections of KG1a myeloid
cells, which express high levels of Oct-1 and NFAT, but relatively low
levels of OCA-B compared with Jurkat, CEM, and Raji. In this instance,
OCA-B and NIP45 cooperated to increase inducible pIL190 activity 6-fold
(Fig. 5
C), whereas OCA-B alone increased activity 3-fold and
NIP45 alone increased activity 2-fold. The actions of these factors
were again seen to be specific for the IL190 element, as they had no
effect on the promoter alone. As in Jurkat cells (Fig. 4
D),
Brn-2 was also implicated as an antagonist of Oct/OCA-B-dependent
transcription in KG1a cells (Fig. 5
C). Cotransfection of a
Brn-2 expression plasmid suppressed the weak inducible enhancer
activity supported by the IL190 element in KG1a cells, and suppressed
its activation by cotransfection of either OCA-B or NIP45 (Fig. 5
C).
The otherwise inactive IL190 element was similarly activated by the combination of OCA-B and NIP45 in mast cells and endothelial cells that express Oct-1 and NFAT, but not OCA-B (data not shown).
The above transfections of pIL190 (containing an array of three
Oct/NFAT elements) (Fig. 5
) produced some Oct-dependent activities that
were not observed below with the native IL-3 enhancer, which contains
just one Oct element (Fig. 6
). Assays of
pIL190 in K562 and Raji cells indicated that three linked Oct/NFAT
elements were sufficient to support a modest degree of activity in the
presence of just Oct-1 and OCA-B, but required NFAT for maximum effect
(Fig. 5
, A and C). Even in the absence of any
cotransfected factors, the IL190 plasmid had some activity in Raji B
cells that express Oct-1, Oct-2, and OCA-B constitutively (Fig. 5
C). In contrast to the normally inducible native IL-3
enhancer, the weak pIL190 activity seen in Raji cells in the absence of
cotransfection was entirely constitutive, while the increased activity
seen after NFATp cotransfection was inducible (data not shown).
|
Having shown that an array of NFAT/Oct elements could be activated
by a specific combination of factors, it was now necessary to determine
whether the same group of four factors was sufficient to activate the
native IL-3 enhancer that contains an array of NFAT sites, but only one
Oct element. This question was addressed by assaying the activity of
pIL3E in K562 and Raji cells that had been cotransfected with the NFAT,
NIP45, and OCA-B expression vectors and stimulated with PMA and A23187,
as above. In the absence of cotransfected factors, the IL-3 enhancer
was completely inactive in both K562 and Raji cells (Fig. 6
, A and B). However, the activity of the IL-3
enhancer was restored in K562 cells by the combination of NFATp, NIP45,
and OCA-B (Fig. 6
A) and in Raji cells by NFATp and NIP45
(Fig. 6
B). As was the case with pIL190, NIP45 and NFATp
synergized in the activation of pIL3E and, as expected, NIP45 was
highly dependent on NFAT for its ability to activate. This restoration
of IL-3 enhancer activity required just the core IL140/IL190 region
because a similar 19-fold activation of pIL140/IL190 was observed in
transfected Raji cells overexpressing NFATp and NIP45 (data not
shown).
The above studies implied that the NFAT/Oct element was the significant
site that distinguished the IL-3 enhancer from the GM-CSF enhancer and
dictated its T cell specificity. To determine whether a single site in
a complex enhancer could in fact govern cell specificity, we performed
the simple operation of converting the Oct site to an AP-1 site to
recreate an element resembling the NFAT/AP-1 sites present in the
GM-CSF enhancer (pIL3-AP1, Fig. 3
C). Remarkably, this
mutation was sufficient to generate an enhancer that could now function
in KG1a cells, whereas the native IL-3 enhancer is completely inactive
in the cells (Fig. 6
C). From these studies, we conclude that
NFAT can activate transcription by at least two distinct mechanisms
(Fig. 6
D): a T cell-specific pathway in which NFAT recruits
or assists binding of Oct factors and the cofactors NIP45 and OCA-B,
and a more general pathway in which NFAT activates transcription by
recruiting the ubiquitous transcription factor AP-1 with no apparent
need for additional tissue-specific cofactors.
| Discussion |
|---|
|
|
|---|
Contributions of NFAT and Oct elements to tissue-specific gene expression
There are many examples in which NFAT and Oct elements contribute to activation of tissue-specific gene expression, but their role in directing a specific pattern of expression has not previously been determined. The T cell-specific IL-2 promoter contains an array of four composite NFAT/AP-1 elements (39) that, while essential for its activity, cannot account for its T cell specificity. When introduced into transgenic mice, the distal IL-2 NFAT/AP-1 element was sufficient to support activation of transcription, but its activity was not confined to T cells (40). The IL-4 promoter depends on interactions between NFAT and AP-1 (41), but this is insufficient for T cell-specific expression as it also requires factors such as c-maf (42).
Our studies have highlighted the importance of Oct elements in T cell-specific transcription, and the replacement of the sole Oct element by an AP-1 element was sufficient to relieve restrictions on the activity of the IL-3 enhancer. The T cell-specific IL-2, IL-3, and IL-4 promoters each contain Oct elements in addition to NFAT and AP-1 elements (43, 44, 45, 46, 47 ; unpublished data). Hence, the combination of NFAT, AP-1, Oct, NIP45, and OCA-B proteins may provide a general mechanism for activating the T cell-specific expression of a subset of cytokine genes.
Oct elements also contribute to B cell-specific transcription (reviewed in Ref. 48), and they are conserved features of the promoters of B cell-specific Ig genes. An isolated Oct element linked to a TATA box supports transcription in B cells, but not fibroblasts (49), and OCA-B is essential for Oct-dependent transcription in B cells (50). However, although the predominantly lymphoid proteins Oct-2 and OCA-B have both been proposed as mediators of B cell-specific transcription (28, 29, 30, 51), neither protein is necessary or sufficient for activation of B cell-specific promoters. Ig genes are still expressed in both OCA-B and Oct-2-deficient B cells (32, 52), and Oct-2 expression has been detected in a variety of hemopoietic cell types (53). In the case of the IgH enhancer, the octamer is dispensable for enhancer function as a tripartite unit comprising sites for Ets-1, TFE3, and PU.1 and is sufficient to reconstitute enhancer activity in B cells, but not fibroblasts (reviewed in Ref. 54). These observations highlight the degree of redundancy employed in the combinatorial regulation of Ig genes.
The activity of Oct elements may also be regulated by the ratio in the expression of different Oct family proteins, and in this study the IL-3 enhancer had a greater relative activity in the T cell line that expressed the least amount of Brn-2 relative to Oct-1. Unlike Oct-1 and Oct-2, Brn-2 lacks the ability to recruit OCA-B (30). Hence, we hypothesize that Brn-2 may in some situations function as a repressor of Oct elements by serving as a competitive inhibitor of the Oct/OCA-B complex.
Mechanisms of T cell-specific transcription
Although we have presented the first clear mechanism for
inducible T cell-specific transcription, there are other examples of
developmentally regulated T cell-specific enhancers, and individual
transcription factors that contribute to programs of T cell-specific
gene regulation (reviewed in Refs. 55, 56). The best
example is the TCR
enhancer, which contains an array of individual
binding sites for the transcription factors ATF (activating
transcription factor), AML-1, and Ets-1, and the architectural proteins
lymphocyte enhancer-binding factor-1 or T cell-specific factor-1
(TCF-1) that are required for the assembly of an enhanceosome (reviewed
in Refs. 12, 55). In this instance, T cell specificity
is also derived from combinatorial regulation as the predominantly
lymphoid factors Ets-1, lymphocyte enhancer-binding factor-1, and TCF-1
cooperate with AML-1, which is expressed by T cells and myeloid cells,
but not B cells. Interestingly, AML-1 also regulates the activities of
the IL-3 promoter (57) and the GM-CSF promoter and
enhancer (58), and thereby has the potential to contribute
to the T cell-specific activation of IL-3 in T cells and the activation
of GM-CSF expression in both T cells and myeloid cells.
The IL-3 locus is regulated via several distinct mechanisms
Although the combination of NFAT, Oct, NIP45, and OCA-B is able to activate the IL-3 enhancer, it is not sufficient to activate the whole IL-3 locus, as the endogenous IL-3 gene remained silent upon cotransfection of these factors into a variety of non-T cell types (data not shown). The enhancer may not even be essential for IL-3 expression, as OCA-B-deficient T cells still express normal levels of IL-2 and IL-3 (32). Similar to the situation in Ig genes (54), the IL-3 locus appears to be controlled by a complex and redundant set of mechanisms. Activation of the IL-3 locus outside of T cells also requires activation of the T cell-specific IL-3 promoter, which has binding sites for AML-1 and GATA proteins in addition to NFAT, Oct, and AP-1 sites.
In the IL-3 locus, the IL-3 enhancer responds to TCR signals when an
immune response is elicited, but we believe this only represents the
end stage of a complex series of events that begin much earlier in T
cell development. An array of constitutive T cell-specific DH sites
extends up to 5 kb upstream of the IL-3 gene (9). Because
they exist even in primitive T cell lines such as Molt4 that do not
express IL-3 and in which the IL-3 enhancer is inactive (unpublished
data), we suggest that they function as a chromatin-opening domain that
primes the locus for subsequent activation via the TCR. This
developmental pathway resembles the chromatin remodeling that occurs in
the IFN-
and IL-4 genes during the course of T cell differentiation
(59). When naive T cells differentiate down distinct
pathways, DH sites appear in the IL-4 locus in Th2 T cells and in the
IFN-
locus in Th1 T cells, where these genes gain the potential to
be induced via the TCR.
Given the complexity of the IL-3 locus, it is not surprising then that activation of the IL190 element alone was insufficient to activate IL-3 gene expression outside of T cells. This is in contrast to studies of the IL-4 locus, in which association of NFAT, NIP45, and c-maf with proximal elements of the promoter was sufficient to induce expression of the endogenous IL-4 gene in B lymphoma cells (22). Although our studies have not identified a mechanism that is sufficient to drive IL-3 expression, they have clearly identified an important mechanism driving T cell-specific transcription that may be widely used.
Combinatorial regulation maintains tight control over gene expression
In this study, we demonstrated that complex enhancers can be broken down to simple composite elements that retain the properties of the intact enhancers. In doing so, we have provided an example of the power of combinatorial regulation to fix patterns of gene expression. Composite NFAT/Oct and NFAT/AP-1 elements retained the inducible tissue-specific properties of their parent enhancers, and these patterns were essentially the same as those of the endogenous IL-3 and GM-CSF genes to which they were linked. The IL190 element represented the minimal unit that could function as a T cell-specific enhancer, but in the context of the native IL-3 enhancer it appeared to function in concert with the closely linked IL140 NFAT site. An array of IL190 elements was not as active as the IL140/IL190 enhancer core region, suggesting that correct enhancer function may require assembly of a specific enhanceosome-like complex. Such a complex could also include architectural proteins such as HMGI(Y) because NFAT binding is promoted by HMGI(Y) (60) and the NFAT and Oct sites in the IL-3 enhancer encompass A/T-rich segments likely to favor HMGI(Y) binding.
Composite NFAT sites also represent points at which major signaling pathways converge, thus ensuring very tight regulation of cytokine gene expression. Furthermore, NFAT/AP-1 complexes and OCA-B each require both a calcium and a kinase signal to efficiently activate transcription (5, 31). This presents a requirement for additional specific kinases to phosphorylate proteins such as Jun and OCA-B. The complexity and interdependence of the signaling pathways and factors involved means that cytokine genes require correctly delivered signals in the right cell type for gene activation to occur.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 A.G.B. and J.B. contributed equally to this work and should be considered as first authors. ![]()
3 Address correspondence and reprint requests to Dr. Peter Cockerill, Division of Human Immunology, Hanson Center for Cancer Research, Institute for Medical and Veterinary Science, P.O. Box 14, Rundle Mall Post Office, Adelaide 5000, Australia. ![]()
4 The IL140, IL190, GM330, GM420, and GM550 elements can each function independently as efficient enhancer elements (10 16 ) in T cells. The GM170 and IL280 NFAT/AP-1 elements appear to play little role in enhancer function because they lack the organization required for cooperative binding of NFAT and AP-1. Although the weak IL70 NFAT lacks enhancer function, the high affinity IL140 NFAT site can function alone as an enhancer element (16 ). ![]()
5 Abbreviations used in this paper: DH, DNase I-hypersensitive; TCF, T cell-specific factor. ![]()
6 Note that the Raji cells employed in this study were selected as a useful model of a lymphoid cell line that expresses AP-1 and Oct-2, but not NFAT, GM-CSF, or IL-3, even though some other sources of Raji cells do express NFAT (e.g., Ref. 25 ). ![]()
Received for publication May 30, 2000. Accepted for publication August 22, 2000.
| References |
|---|
|
|
|---|
gene expression requires the assembly of an enhanceosome. Cell 83:1091.[Medline]
This article has been cited by other articles:
![]() |
S. R. Bowers, F. Mirabella, F. J. Calero-Nieto, S. Valeaux, S. Hadjur, E. W. Baxter, M. Merkenschlager, and P. N. Cockerill A Conserved Insulator That Recruits CTCF and Cohesin Exists between the Closely Related but Divergently Regulated Interleukin-3 and Granulocyte-Macrophage Colony-Stimulating Factor Genes Mol. Cell. Biol., April 1, 2009; 29(7): 1682 - 1693. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Bert, B. V. Johnson, E. W. Baxter, and P. N. Cockerill A Modular Enhancer Is Differentially Regulated by GATA and NFAT Elements That Direct Different Tissue-Specific Patterns of Nucleosome Positioning and Inducible Chromatin Remodeling Mol. Cell. Biol., April 15, 2007; 27(8): 2870 - 2885. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. V. Johnson, A. G. Bert, G. R. Ryan, A. Condina, and P. N. Cockerill Granulocyte-Macrophage Colony-Stimulating Factor Enhancer Activation Requires Cooperation between NFAT and AP-1 Elements and Is Associated with Extensive Nucleosome Reorganization Mol. Cell. Biol., September 15, 2004; 24(18): 7914 - 7930. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goodall, S. Martinozzi, T. J. Dexter, D. Champeval, S. Carreira, L. Larue, and C. R. Goding Brn-2 Expression Controls Melanoma Proliferation and Is Directly Regulated by {beta}-Catenin Mol. Cell. Biol., April 1, 2004; 24(7): 2915 - 2922. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goodall, C. Wellbrock, T. J. Dexter, K. Roberts, R. Marais, and C. R. Goding The Brn-2 Transcription Factor Links Activated BRAF to Melanoma Proliferation Mol. Cell. Biol., April 1, 2004; 24(7): 2923 - 2931. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Hogan, L. Chen, J. Nardone, and A. Rao Transcriptional regulation by calcium, calcineurin, and NFAT Genes & Dev., September 15, 2003; 17(18): 2205 - 2232. [Full Text] [PDF] |
||||
![]() |
T. T. C. Yang and C.-W. Chow Transcription Cooperation by NFAT{middle dot}C/EBP Composite Enhancer Complex J. Biol. Chem., April 25, 2003; 278(18): 15874 - 15885. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Bower, R. W. Zeller, W. Wachsman, T. Martinez, and K. L. McGuire Correlation of Transcriptional Repression by p21SNFT with Changes in DNA{middle dot}NF-AT Complex Interactions J. Biol. Chem., September 13, 2002; 277(38): 34967 - 34977. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hawwari, J. Burrows, M. A. Vadas, and P. N. Cockerill The Human IL-3 Locus Is Regulated Cooperatively by Two NFAT-Dependent Enhancers That Have Distinct Tissue-Specific Activities J. Immunol., August 15, 2002; 169(4): 1876 - 1886. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhou, R. Q. Cron, B. Wu, A. Genin, Z. Wang, S. Liu, P. Robson, and H. S. Baldwin Regulation of the Murine Nfatc1 Gene by NFATc2 J. Biol. Chem., March 15, 2002; 277(12): 10704 - 10711. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lefevre, J. Kontaraki, and C. Bonifer Identification of factors mediating the developmental regulation of the early acting -3.9 kb chicken lysozyme enhancer element Nucleic Acids Res., November 15, 2001; 29(22): 4551 - 4560. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Houlard, R. Arudchandran, F. Regnier-Ricard, A. Germani, S. Gisselbrecht, U. Blank, J. Rivera, and N. Varin-Blank Vav1 Is a Component of Transcriptionally Active Complexes J. Exp. Med., May 6, 2002; 195(9): 1115 - 1127. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |