The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trop, S.
Right arrow Articles by Zúñiga-Pflücker, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trop, S.
Right arrow Articles by Zúñiga-Pflücker, J. C.
The Journal of Immunology, 2000, 165: 5566-5572.
Copyright © 2000 by The American Association of Immunologists

Competitive Displacement of pT{alpha} by TCR-{alpha} During TCR Assembly Prevents Surface Coexpression of Pre-TCR and {alpha}{beta} TCR1

Sébastien Trop*,{dagger}, Michele Rhodes{ddagger}, David L. Wiest{ddagger}, Patrice Hugo{dagger},§ and Juan Carlos Zúñiga-Pflücker2,*

* Department of Immunology, University of Toronto, Toronto, Ontario, Canada; {dagger} Department of Medicine, Division of Experimental Medicine, McGill University, Montreal, Quebec, Canada; {ddagger} Immunobiology Working Group, Division of Basic Sciences, Fox Chase Cancer Center, Philadelphia, PA 19111; and § PROCREA BioSciences Inc., Montreal, Quebec, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During {alpha}{beta} T cell development, CD4-CD8- thymocytes first express pre-TCR (pT{alpha}/TCR-{beta}) before their differentiation to the CD4+CD8+ stage. Positive selection of self-tolerant T cells is then determined by the {alpha}{beta} TCR expressed on CD4+CD8+ thymocytes. Conceivably, an overlap in surface expression of these two receptors would interfere with the delicate balance of thymic selection. Therefore, a mechanism ensuring the sequential expression of pre-TCR and TCR must function during thymocyte development. In support of this notion, we demonstrate that expression of TCR-{alpha} by immature thymocytes terminates the surface expression of pre-TCR. Our results reveal that expression of TCR-{alpha} precludes the formation of pT{alpha}/TCR-{beta} dimers within the endoplasmic reticulum, leading to the displacement of pre-TCR from the cell surface. These findings illustrate a novel posttranslational mechanism for the regulation of pre-TCR expression, which may ensure that {alpha}{beta} TCR expression on thymocytes undergoing selection is not compromised by the expression of pre-TCR.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During intrathymic T cell development, thymocytes committed to the {alpha}{beta} TCR lineage sequentially express two different TCRs, the pre-TCR and the {alpha}{beta} TCR (1). Signaling through these receptors regulates thymocyte survival, proliferation, and differentiation (2). Immature CD4-CD8- (double negative, DN)3 thymocytes must successfully generate a TCR-{beta} chain able to associate with pT{alpha} and CD3 chains to form the pre-TCR complex (2). This first developmental checkpoint is termed {beta} selection (3, 2). Pre-TCR-derived signals mediate the transition of DN thymocytes to the CD4+CD8+ double-positive (DP) stage of T cell development. Signaling through this receptor also leads to rescue from apoptosis, down-regulation of CD25 surface expression, intense proliferation, allelic exclusion at the TCR-{beta} gene locus, and initiation of transcription at the TCR-{alpha} gene loci (2).

At the DP stage, the productive rearrangement at one or both TCR-{alpha} gene loci results in the surface expression of mature {alpha}{beta} TCRs (4). This allows thymocytes to be selected based on the strength of the signals delivered through the TCR (5). Thymocytes expressing a TCR with high affinity/avidity for self-MHC–peptide complexes undergo apoptosis (negative selection), as do thymocytes expressing a TCR with low or no affinity/avidity for self-MHC–peptide complexes (neglect) (5). Thymocytes expressing TCR with intermediate affinity/avidity for their ligand are allowed to mature and exit the thymus (positive selection). Therefore, the strength of the interaction between TCR and self-MHC–peptide complexes has been proposed to play a pivotal role in determining the outcome between negative or positive selection (6). This notion is supported by the finding that a decrease in the surface density of TCR attenuates TCR signaling and impairs negative selection, thereby permitting thymocytes expressing potentially self-reactive TCRs to escape negative selection and become positively selected (7, 8).

In light of this, we hypothesized that surface expression of pre-TCR and TCR must occur sequentially to allow for proper selection of developing thymocytes, as an overlap in surface expression of these two receptors would interfere with the delicate balance of the selection process. Indeed, it has been shown that expression of pre-TCR at the cell surface is sufficient to elicit signaling through this receptor complex without the requirement of an external ligand (9, 10). Consequently, expression of pre-TCR at the cell surface of DP thymocytes might augment the signals transduced by the TCR complexes, leading to aberrant negative selection of otherwise self-tolerant thymocytes. Alternatively, pre-TCR might indirectly influence the fate of DP thymocytes by limiting the amount of TCR-{beta} available to associate with TCR-{alpha}, thereby lowering the surface density of {alpha}{beta} TCR complexes. This would result in a decrease of TCR-mediated signals, leading to impaired negative selection of thymocytes expressing potentially autoreactive TCRs. Either way, coexpression of pre-TCR and TCR on developing thymocytes would compromise their ability to effectively undergo positive and/or negative selection.

The mechanism ensuring the exclusive expression of {alpha}{beta} TCR at the surface of DP thymocytes has not been elucidated. However, it has been speculated that this regulation might be achieved at the transcriptional level by limiting the expression of pT{alpha} to DN and early DP thymocytes (1, 11, 12, 13). Alternatively, this control may be enforced at the translational or posttranslational level. In the present study, we have examined this issue and provide evidence supporting the latter possibility. Our findings show that pre-TCR cannot be coexpressed with TCR on the cell surface of immature thymocytes. Using a SCID mouse-derived thymic lymphoma cell line, SL-12{beta}.12 (14), we show that in the presence of TCR-{alpha}, pT{alpha} is disallowed from associating with TCR-{beta}, thus preventing the formation of the pre-TCR complex. Our results indicate that pT{alpha} is degraded within the endoplasmic reticulum, providing a mechanism for the inhibition of pre-TCR surface expression in the presence of TCR-{alpha}. Our findings shed new light on the structural characteristics of the pT{alpha} chain and illustrate a novel posttranslational mechanism for the regulation of pre-TCR expression, which may ensure that only {alpha}{beta} TCRs are expressed on the surface of DP thymocytes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6 mice were purchased from the National Cancer Institute, Frederick Cancer Research and Development Center (Frederick, MD). TCR-{alpha}-deficient (TCR{alpha}-/-; B6, 129-Tcratm/Mom) mice (15) were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were bred in our specific pathogen-free facility.

RNA preparation and RT-PCR

Total RNA was prepared from purified thymocyte populations or from spleen and lymph node leukocyte preparations using the RNeasy mini kit (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions. cDNA was produced with the Omniscript RT kit (Qiagen) using random hexamers. PCR was performed in a final volume of 25 µl containing 1x PCR buffer (Roche Diagnostic Systems, Laval, Quebec, Canada), 0.5 mM dNTPs, 2.5 mM MgCl2, 2.5 U Taq polymerase, and appropriate dilutions of cDNA. Cycle conditions were 94°C for 2 min, followed by 25 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30–60 s, depending on the size of the expected PCR product. After a final incubation at 72°C for 10 min, reactions were run on a 1.6% agarose gel, and PCR products were visualized by ethidium bromide staining. pT{alpha} cDNA was amplified using the pT{alpha} forward (CAGAGCCTCCTCCCCCAACAG) and pT{alpha} reverse (GCTCAGAGGGGTGGGTAAGAT) oligonucleotides, generating a 707-bp product. {beta}-actin cDNA was amplified using the {beta}-actin forward (GTGGGCCGCTCTAGGCACCAA) and {beta}-actin reverse (CTCTTTGATGTCACGCACGATTTC) oligonucleotides, generating a 539-bp product. V{alpha}3-TCR{alpha} cDNA was isolated from lymph node T cells of a C57BL/6 mouse and amplified using the V{alpha}3 forward (CCTGTTCCAGAGTTCCTCCAC) and C{alpha} reverse (CCACTAGTCAGGCTCTGTCAG) oligonucleotides for cloning into the pcDNA3.1-V5-His mammalian expression vector (Invitrogen, Carlsbad, CA). The cloned PCR product was verified by DNA sequencing.

DNA and retrovirus constructs

V{alpha}-pT{alpha} chimeric constructs, comprising either the V{alpha}11.1 and J{alpha} domains of the AD10 TCR-{alpha} chain (16) or the V{alpha}3 and J{alpha} domains of a C57BL/6-derived TCR-{alpha} chain fused to pT{alpha} cDNA lacking the leader sequence and the first five N-terminal amino acid residues (12), were generated using overlapping oligonucleotides (available upon request) and PCR. The same methodology was used to generate a mutant of the AD10 TCR-{alpha} chain lacking the interchain Cys residue (TCR{alpha}CS). An additional mutant of the AD10 TCR-{alpha} chain was generated which lacks the wild-type interchain Cys residue and bears a Lys to Cys mutation 11 residues N-terminal to the transmembrane (TM) domain (TCR{alpha}CSKC), allowing the formation of an ectopic cystine bridge with the TCR-{beta} chain. Wild-type V{alpha}3-TCR{alpha} and chimeric V{alpha}3-pT{alpha} DNA constructs were cloned into the SR{alpha}Puro mammalian expression vector (a kind gift from F. Denis, Institut Armand-Frappier, Montreal, Quebec, Canada). Wild-type and mutant V{alpha}11-TCR{alpha} constructs, as well as the V{alpha}11-pT{alpha} construct, were cloned into the pcDNA3.1-V5-His mammalian expression vector. These plasmids were then digested with BglII and NotI to excise a fragment containing the CMV promoter and {alpha}-chain construct, which was subcloned into the MIEV retroviral vector (kindly provided by R. Hawley, Holland Laboratory, American Red Cross, Rockville, MD) (17) digested with the same restriction endonucleases. The MSCV-based MIEV retroviral vector was constructed by replacing the neomycin phosphotransferase (neo) gene in the MINV retroviral vector (18) with the enhanced green fluorescent protein (GFP) from the pEGFP-1 plasmid (Clontech, Palo Alto, CA), linked to an altered encephalomyocarditis virus internal ribosome entry site (19, 20).

Cell lines

The SL-12{beta}.12 cell line is a pre-T cell line derived from a spontaneous SCID mouse thymoma that was stably transfected to express the functionally rearranged 2B4 TCR-{beta} chain at the cell surface with endogenous pT{alpha} to form a pre-TCR (14, 21). SL-12{beta}.12 lines expressing V{alpha}3-TCR{alpha} or V{alpha}3-pT{alpha} constructs were transfected by electroporation with the appropriate SR{alpha}Puro expression vector, followed by antibiotic selection with 1 µg/ml puromycin (Life Technologies, Burlington, Ontario, Canada), as previously described (21). V{alpha}3 high expressing cells were subsequently isolated by flow cytometry. The SL-12{beta}.12 cell line and its derivatives were maintained in high glucose DMEM (Sigma-Aldrich Canada, Oakville, Ontario, Canada) supplemented with 10% FCS (Life Technologies, Rockville, MD), 10 mM HEPES, 50 µM 2-ME, 2 mM GlutaMAX (Life Technologies), 1 mM sodium pyruvate, 100 IU/ml penicillin, 100 µg/ml streptomycin, 10 µg/ml gentamicin, and 0.5 mg/ml geneticin (G418; Life Technologies). The RetroPack PT67 cell line was purchased from Clontech; the GP+E 86 retroviral packaging cell line (22) was obtained from P. Ohashi (University of Toronto). Both cell lines were maintained in high-glucose DMEM supplemented as above, except that geneticin was not added to the culture medium.

Retroviral gene transfer

PT67 retroviral packaging cells were transfected transiently with 1 µg MIEV retroviral vector DNA using Effectene transfection reagent (Qiagen) according to the manufacturer’s instructions. Retroviral supernatant was harvested 48 h posttransfection, diluted 2-fold with fresh culture medium, and supplemented with 4 µg/ml hexadimethrine bromide (Sigma-Aldrich) to infect GP+E 86 cells. Stable retrovirus-producing GP+E 86 cells expressing enhanced GFP were isolated by flow cytometry 48 h later and subsequently used to infect SL-12{beta}.12 cells, or SL-12{beta}.12 cells expressing V{alpha}3-TCR{alpha} or V{alpha}3-pT{alpha}-chains. Briefly, 5 x 105 SL-12{beta}.12 cells and 1 x 106 GP+E 86 cells were seeded onto a 60-mm tissue culture dish in 4 ml culture medium supplemented with 4 µg/ml hexadimethrine bromide and incubated for 48 h at 37°C, after which stably transfected cells expressing GFP were removed from the producer monolayer and purified by flow cytometry.

Abs and flow cytometry

For flow cytometric analysis, FITC-, PE-, or biotin-conjugated Abs specific for CD3{epsilon} (145-2C11), CD4 (RM4-5), CD8 (53-6.7), CD117 (2B8), V{alpha}3.2 (RR3-16), and V{alpha}11 (RR8-1), and APC-conjugated streptavidin were purchased from PharMingen (Mississauga, Ontario, Canada). Flow cytometry was performed by washing 1 x 106 cells in staining buffer (0.1% BSA/0.1% sodium azide/HBSS) and staining with the indicated mAbs for 30 min at 4°C, followed by analysis on a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA). Cytoplasmic staining was performed using the Cytofix/Cytoperm kit (PharMingen) according to the manufacturer’s instructions. Data analysis was performed using the CellQuest software (Becton Dickinson); data were live-gated by size and lack of propidium iodide uptake. Purified DP and single-positive (SP) thymocytes were obtained by staining single-cell suspensions from adult C57BL/6 and TCR{alpha}-/- mice with anti-CD4-FITC and anti-CD8-APC. For purification of TCR{alpha}{beta}+ thymocytes, single-cell suspensions from adult CD1 mice were stained with anti-CD4-FITC, anti-TCR{beta}-PE, and anti-CD8-APC; DP cells were defined by a CD4+CD8+TCR{beta}int phenotype, and SP cells were defined by a CD4+CD8-TCR{beta}high or CD4-CD8+TCR{beta}high phenotype. Cells were sorted using a Coulter Elite flow cytometer (Coulter Electronics, Montreal, Quebec, Canada); in all cases, sort purity was >99%.

Metabolic labeling, immunoprecipitation, and electrophoresis

Approximately 1.5 x 108 cells of the indicated cell line were metabolically labeled for 30 min at 37°C at a density of 2 x 107 cells/ml in methionine-free medium supplemented with 0.5 mCi/ml [35S]methionine (EXPRE35S35S protein labeling mix; NEN Life Science Products, Boston, MA). Following labeling, the cells were lysed at a density of 5 x 107/ml for 20 min on ice in buffer containing 1% digitonin (High Purity; Calbiochem, La Jolla, CA) as described elsewhere (14). Detergent extracts were clarified by centrifugation at 14,000 rpm for 10 min in a 4°C refrigerated microcentrifuge. Clarified extracts were precleared by rocking end-over-end at 4°C for 1 h with 15 µl protein A-Sepharose beads (Sigma-Aldrich). The extracts were then divided into three equal parts, each of which were immunoprecipitated in parallel for 2 h at 4°C with one of the indicated mAbs adsorbed to protein A-Sepharose: anti-TCR-{beta} (H57-597), anti-CD3{epsilon} (145-2C11), or rabbit anti-pT{alpha} cytoplasmic tail (14). The resultant immune complexes were washed three times with 2% digitonin washing buffer and once with PBS, after which they were subjected to recapture analysis. The recapture assay was performed by boiling the immune complexes for 5 min in 100 µl 1% SDS and quenching the SDS-solubilized complexes with 900 µl of 1% Nonidet P-40 (Calbiochem, La Jolla, CA) lysis buffer. The solution containing the solubilized proteins was divided in half and the halves were reimmunoprecipitated as above with anti-TCR-{alpha} (H28-710) or rabbit anti-pT{alpha} cytoplasmic tail Ab. The recaptured immune complexes were then resolved by SDS-PAGE on 11% acrylamide gels. Radiolabeled proteins were visualized by fluorography using PPO (ICN Pharmaceuticals, Costa Mesa, CA) and autoradiography at -70°C.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of pT{alpha} mRNA during T cell development

Previous studies have shown that pT{alpha} mRNA is detectable among DP thymocytes (1, 11, 12, 13), thereby challenging the notion that expression of the pre-TCR could be regulated by transcriptional control of the pT{alpha} gene. To further support this notion, we obtained total RNA from highly purified thymocyte subsets and analyzed the expression of pT{alpha} mRNA by RT-PCR (Fig. 1GoA). In keeping with previously published findings, we observed high levels of pT{alpha} mRNA in DP thymocytes, whereas pT{alpha} mRNA was undetectable in SP thymocytes and peripheral (spleen and lymph node) T cells. Furthermore, DP thymocytes from TCR{alpha}-/- mice expressed abundant levels of pT{alpha} mRNA (Fig. 1GoA). This observation, combined with the fact that pre-TCR can be immunoprecipitated from the surface of thymocytes derived from TCR-{alpha}-/- mice (14), strongly suggests that pre-TCR can be expressed at the surface of DP thymocytes in the absence of a productively rearranged TCR-{alpha} chain. To determine whether functional rearrangement of a TCR-{alpha} gene prevented further transcription of the pT{alpha} gene, we purified {alpha}{beta} TCR-expressing DP thymocytes and assessed the presence of pT{alpha} transcripts within this population (Fig. 1GoB). We found that DP thymocytes expressing {alpha}{beta} TCR at the cell surface contained pT{alpha} mRNA. These results indicate that DP thymocytes have the potential to translate pT{alpha} at a stage where {alpha}{beta} TCR is expressed and therefore may coexpress pre-TCR with {alpha}{beta} TCR at their surface.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 1. mRNA for pT{alpha} is expressed at the CD4+CD8+TCR{alpha}{beta}+ stage of T cell development. A, Single-cell suspensions were obtained from the thymus, spleen, and lymph nodes (LN) of C57BL/6 and TCR{alpha}-/- mice. Where indicated, thymocytes were further fractionated according to surface expression of CD4 and CD8 (DP and SP) as described in Materials and Methods. B, Thymocytes were obtained from the thymus of CD1 mice, and DP and SP thymocytes expressing TCR{alpha}{beta} at the cell surface were isolated. cDNAs were prepared from total RNA and analyzed for expression of {beta}-actin and pT{alpha} mRNA by RT-PCR. As control (H2O), RT-PCR lacking template were amplified simultaneously. PCR products corresponded to the expected molecular weights.

 
A model for posttranslational regulation of pre-TCR expression

Since transcriptional regulation of pT{alpha} cannot account for the absence of pre-TCR and TCR coexpression at the DP stage, we envisaged an alternate mechanism whereby pT{alpha} and TCR-{alpha} would compete for assembly with the TCR-{beta} and CD3 subunits shared by both receptors. According to this model, the formation of TCR-{alpha}{beta} heterodimers would be favored over pT{alpha}/TCR-{beta} heterodimers, owing either to structural characteristics intrinsic to pT{alpha} or to the intervention of a chaperone molecule within the endoplasmic reticulum. To examine this possibility, we developed a competition assay (Fig. 2Go) that takes advantage of the immature thymic lymphoma cell line SL-12{beta}.12 expressing a transfected TCR-{beta} gene (Fig. 2GoA) (14). Following transfection with a plasmid encoding a V{alpha}3-TCR{alpha} chain or a V{alpha}3-pT{alpha} chain (a chimeric molecule comprising a V{alpha}3 domain fused to pT{alpha}), these cells should express TCR or pre-TCR at the cell surface, respectively (Fig. 2Go, B and C). Thus, two stably transfected SL-12{beta}.12 cell lines were established, one expressing V{alpha}3-TCR{alpha}-chains in conjunction with TCR-{beta} and the other expressing V{alpha}3-pT{alpha} chains and TCR-{beta} (Fig. 3Go, top row: middle and right panels, respectively). As outlined in Fig. 2Go, each of these cell lines was subsequently infected with retroviral constructs encoding either a V{alpha}11-TCR{alpha} chain (Fig. 2Go, D, F, and H) or a V{alpha}11-pT{alpha} chimeric chain (Fig. 2Go, E, G, and I), along with a GFP reporter gene. Fig. 3Go shows that retroviral infection of SL-12{beta}.12 cells resulted in the surface expression of V{alpha}11+ TCR or pre-TCR complexes on the cell surface (Fig. 3Go, left column: middle and bottom panels, respectively). Thus, staining of GFP-expressing cells with V{alpha}3- or V{alpha}11-specific mAbs would allow us to determine the outcome of competition between pT{alpha} and TCR-{alpha} chains on surface expression of pre-TCR and TCR. The predicted outcome for each receptor combination is depicted in Fig. 2Go.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 2. Experimental design. The SL-12{beta}.12 cell line (A) was stably transfected with a plasmid encoding either a V{alpha}3-TCR{alpha} chain (thin line: B) or a V{alpha}3-pT{alpha} chain (thin-thick line: C). The parental cell line or the transfectants were then infected with a retroviral vector encoding either a V{alpha}11-TCR{alpha} chain (thin line: D, F, and H) or a V{alpha}11-pT{alpha} chain (thin-thick line: E, G, and I). The TCR-{beta} chain is depicted as a dashed line. The proposed competition model predicts that structurally similar TCR-{alpha} chains or pT{alpha} chains should be able to compete equally against each other for surface expression. Thus, coexpression on the cell surface of both V{alpha}3-TCR{alpha} and V{alpha}11-TCR{alpha} chains (F) or V{alpha}3-pT{alpha} and V{alpha}11-pT{alpha} chains (I) should be observed. The model also predicts that, in contrast, a TCR-{alpha} chain would preclude surface expression of a pT{alpha} chain. Therefore, retroviral transfer of V{alpha}11-TCR{alpha} into V{alpha}3-pT{alpha}-expressing cells should result in loss of surface expression of V{alpha}3-pT{alpha} chains (H). Furthermore, retroviral transfer of V{alpha}11-pT{alpha} into V{alpha}3-TCR{alpha}-expressing cells should not result in surface expression of V{alpha}11-pT{alpha} (G).

 


View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of TCR-{alpha} in SL-12{beta}.12 cells displaces pre-TCR from the cell surface. SL-12{beta}.12 cells (left column) and SL-12{beta}.12 cells transfected with a plasmid encoding either a V{alpha}3-TCR{alpha} chain (middle column) or a V{alpha}3-pT{alpha}-chain (right column) were infected with a control retrovirus (top row), or a retroviral construct encoding either a V{alpha}11-TCR{alpha} chain (middle row), or a V{alpha}11-pT{alpha} chain (bottom row). GFP-expressing cells were analyzed by flow cytometry for surface expression of V{alpha}3- and V{alpha}11-bearing molecules. Percentages of cells in each quadrant are shown in the upper right corner.

 
Surface expression of pT{alpha} is prevented by TCR-{alpha}

Thymocytes and peripheral T cells are capable of coexpressing two different TCR-{alpha} chains on their cell surface (4, 7). This is presumably because TCR-{alpha} chains are essentially identical to one another, except for the hypervariable V{alpha} domain. Using our model system (Fig. 2Go), we could observe coexpression of two different TCR-{alpha} chains on the cell surface of V{alpha}3-TCR{alpha}-transfected SL-12{beta}.12 cells retrovirally infected with V{alpha}11-TCR{alpha} chains (Fig. 3Go, center panel). Based on this, we expected that different V{alpha}-pT{alpha} chains would likewise be coexpressed on the cell surface. In agreement with this prediction, we observed that V{alpha}3-pT{alpha}-transfected SL-12{beta}.12 cells retrovirally infected with V{alpha}11-pT{alpha} chains expressed both V{alpha}3-pT{alpha} and V{alpha}11-pT{alpha} chains on their cell surface (Fig. 3Go, bottom right panel). In contrast, cells coexpressing V{alpha}11-TCR{alpha} with V{alpha}3-pT{alpha} expressed only V{alpha}11-TCR{alpha}-containing receptors on the cell surface (Fig. 3Go, middle right panel). Moreover, V{alpha}3-TCR{alpha}-transfected SL-12{beta}.12 cells retrovirally infected with V{alpha}11-pT{alpha} chains failed to express V{alpha}11-pT{alpha}, as only V{alpha}3-TCR{alpha} could be detected on the cell surface (Fig. 3Go, bottom middle panel). These results demonstrate that V{alpha}-pT{alpha} and TCR-{alpha} cannot be coexpressed at the cell surface, indicating that expression of TCR-{alpha} blocks surface expression of pT{alpha}.

The absence of retrovirally encoded V{alpha}11-pT{alpha} from the cell surface of V{alpha}3-TCR{alpha}-transfected SL-12{beta}.12 cells (Fig. 3Go, bottom middle panel) might be due to a failure of this cell line to express the V{alpha}11-pT{alpha} chain. Therefore, we performed cytoplasmic staining to ensure that V{alpha}11-pT{alpha} chains were functionally expressed within these cells. Whereas the V{alpha}11-pT{alpha} chain remained undetectable on the cell surface, we could readily demonstrate its presence in the cytoplasm (Fig. 4Go). As expected, SL-12{beta}.12 cells transfected only with V{alpha}3-TCR{alpha} did not stain for V{alpha}11 either at the cell surface or within the cytoplasm (Fig. 4Go).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. SL-12{beta}.12 cells express pre-TCR intracellularly in the presence of TCR-{alpha} chain. SL-12{beta}.12 cells were stably transfected with a V{alpha}3-TCR{alpha} chain and infected with a control retrovirus or with a retrovirus encoding a V{alpha}11-pT{alpha} chain. The cells were analyzed by flow cytometry for surface expression of V{alpha}3- and V{alpha}11-bearing receptors (upper panels) or for intracellular expression of V{alpha}3- and V{alpha}11-bearing molecules (lower panels) as described in Materials and Methods. Percentages of cells in each quadrant are shown in the upper right corner.

 
Expression of TCR-{alpha} interferes with the formation of pT{alpha}/TCR-{beta} heterodimers

The preceding experiments demonstrate that the absence of pre-TCR complexes from the surface of cells expressing TCR-{alpha} must be due to a failure of these complexes to form or to be exported to the cell surface. To distinguish between these possibilities, the presence of nascent pT{alpha}/TCR-{beta} heterodimers was assessed in SL-12{beta}.12 cells lacking TCR-{alpha} chains, and in SL-12{beta}.12 cells transfected with a V{alpha}11-TCR{alpha} construct; a third cell line, transfected with a V{alpha}11-pT{alpha} chimeric construct, was also analyzed. Cells were labeled with [35S]methionine and subsequently solubilized with digitonin, thus maintaining the integrity of pre-TCR and TCR complexes (14, 23). Because the assembly of TCR, and presumably pre-TCR, complexes proceeds in a stepwise manner (24), we examined three distinct steps of the assembly process by immunoprecipitating cellular extracts with anti-TCR-{beta}, anti-CD3{epsilon}, or anti-pT{alpha} Abs. To determine the presence of TCR-{alpha} or pT{alpha} within these complexes, immunoprecipitates were solubilized in SDS and subsequently recaptured (reimmunoprecipitated) with either anti-TCR-{alpha} or anti-pT{alpha} Abs.

Using an Ab specific for the pT{alpha} cytoplasmic tail (14) for the first immunoprecipitation step, we confirmed that all three cell lines synthesized full-length pT{alpha} proteins, and thus fulfilled the first requirement for the assembly of pre-TCR complexes (Fig. 5Go, lanes 6, 12, and 18). As expected, we were able to recover pT{alpha}/TCR-{beta} heterodimers from SL-12{beta}.12 cells, which express only wild-type pre-TCR (Fig. 5Go, lane 2) (14). The weak signal observed correlates well with the low level of pre-TCR measured at the surface of these cells by flow cytometry (Refs. 14, 21 ; data not shown). In contrast, we could not detect pT{alpha}/TCR-{beta} heterodimers from SL-12{beta}.12 cells that also expressed a TCR-{alpha} chain (Fig. 5Go, lane 8), whereas TCR-{alpha}{beta} dimers were abundant in these cells (Fig. 5Go, lane 7). Surprisingly, pT{alpha}/TCR-{beta} dimers were absent in SL-12{beta}.12 cells expressing V{alpha}11-pT{alpha} chains (Fig. 5Go, lane 14), whereas V{alpha}11-pT{alpha}–TCR-{beta} complexes were readily observed. The presence of pT{alpha}-CD3{epsilon} complexes in all three cell lines (Fig. 5Go, lanes 3, 4, 9, 10, 15, and 16) indicates that nascent pT{alpha} chains can pair with CD3{epsilon} in the absence of TCR-{beta}, suggesting that pT{alpha} associates with CD3{epsilon} before covalent linkage with TCR-{beta}, and that this event is not favored in the presence of TCR-{alpha}. Moreover, the observation that a chimeric pT{alpha} chain comprising a V{alpha} domain can prevent the formation of pT{alpha}-TCR-{beta} complexes suggests that the formation of symmetrical TCR-like heterodimers may be favored over that of asymmetrical pre-TCR heterodimers.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 5. TCR-{alpha} expression inhibits the formation of pre-TCR complexes by preventing assembly of pT{alpha} with TCR-{beta}. SL-12{beta}.12 cells (lanes 1–6) and SL-12{beta}.12 cells stably transfected with plasmids encoding a V{alpha}3-TCR{alpha} chain (lanes 7–12) or a V{alpha}3-pT{alpha} chain (lanes 13–18) were metabolically labeled with [35S]methionine for 30 min. Cells were solubilized with digitonin, and the lysates were divided in thirds, which were immunoprecipitated with Abs specific for TCR-{beta} (H57-597), CD3{epsilon} (145-2C11), or pT{alpha} cytoplasmic tail (14 ). The resulting immune complexes were then solubilized by boiling in SDS, divided in half, and the halves were recaptured (reimmunoprecipitated) with Abs specific for TCR-{alpha} or pT{alpha} cytoplasmic tail. The recaptured proteins were resolved by SDS-PAGE and visualized by fluorography and autoradiography. The migration positions of TCR-{beta}, pT{alpha}, TCR-{alpha}, and V{alpha}-pT{alpha} are indicated.

 
Normal disulfide linkage between TCR-{alpha} and TCR-{beta} is required to displace pT{alpha} from the cell surface

To gain further insight into the mechanism by which TCR-{alpha} prevents the association of pT{alpha} with TCR-{beta}, we examined the role of disulfide linkage between TCR-{alpha} and TCR-{beta}. Two mutants of the V{alpha}11-TCR{alpha} chain were generated, one lacking the interchain Cys residue present within the connecting peptide domain (TCR{alpha}CS) and therefore unable to form a cystine bridge with the TCR-{beta}-chain. In the second mutant, also lacking the interchain Cys residue, the Lys located 13 amino acids away from the start of the TM domain was replaced with a Cys (V{alpha}11-TCR{alpha}CSKC), thus placing the new Cys residue at the same relative position occupied by the bridging Cys residue present in the pT{alpha} chain. Retroviral vectors encoding these constructs were introduced into SL-12{beta}.12 cells previously transfected with plasmids encoding either V{alpha}3-TCR{alpha} or V{alpha}3-pT{alpha} chains, paralleling the scheme presented in Figs. 2Go and 3Go.

Although both mutant V{alpha}11-TCR{alpha} chains could be expressed at the surface of SL-12{beta}.12 cells in the absence of competing V{alpha}3-TCR{alpha} or V{alpha}3-pT{alpha} chains (Fig. 6Go, left column: middle and bottom panels), neither could be efficiently expressed at the cell surface in the presence of V{alpha}3-TCR{alpha} (Fig. 6Go, center and bottom middle panels). Moreover, surface expression of the V{alpha}11-TCR{alpha}CS mutant was not readily detected when placed in competition with V{alpha}3-pT{alpha} (Fig. 6Go, middle right panel), whereas the V{alpha}11-TCR{alpha}CSKC mutant appeared to compete successfully with V{alpha}3-pT{alpha} for surface expression (Fig. 6Go, bottom right panel). These results demonstrate that the presence of a Cys residue in the correct position within the connecting peptide domain of TCR-{alpha} is necessary to ensure its ability to forestall the assembly and surface expression of pT{alpha}/TCR-{beta} heterodimers.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 6. Covalent association of TCR-{alpha} with TCR-{beta} is required to exclude pre-TCR from the cell surface. SL-12{beta}.12 cells (left column) and SL-12{beta}.12 cells transfected with a plasmid encoding either a V{alpha}3-TCR{alpha} chain (middle column) or a V{alpha}3-pT{alpha} chain (right column) were infected with a control retrovirus (top row), or a retroviral construct encoding either a V{alpha}11-TCR{alpha}CS chain (middle row), or a V{alpha}11-TCR{alpha}CSKC chain (bottom row). In the V{alpha}11-TCR{alpha}CS chain, the interchain Cys required to form a disulfide bridge with TCR-{beta} was replaced with a Ser residue. The V{alpha}11-TCR{alpha}CSKC chain also lacks the interchain Cys, but is capable of forming an ectopic (pT{alpha}-like) cystine bridge with TCR-{beta} due to the replacement of a Lys for a Cys residue (see Materials and Methods for details). GFP-expressing cells were analyzed by flow cytometry for surface expression of V{alpha}3- and V{alpha}11-bearing receptors. Percentages of cells in each quadrant are shown in the upper right corner.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we sought to uncover the regulatory mechanism controlling the sequential expression of pre-TCR and TCR during T cell development. The necessity for such a mechanism is implicit in the nature of the thymic selection process, whereby DP thymocytes are positively or negatively selected on the basis of the affinity of their TCR for self-MHC–peptide complexes (6, 7, 8). Indeed, failure of DP thymocytes to express a functional TCR-{alpha} chain leads to cell death, indicating that pre-TCR signaling cannot substitute for positive selection signals mediated by the TCR. Clear evidence for this is provided by the study of TCR-{alpha}-/- mice, in which all thymocytes are arrested at the DP stage, despite abundant expression of pT{alpha} (Fig. 1Go). This regulatory mechanism must not only impose the ordered expression of pre-TCR and TCR, but must also fulfill at least two other criteria to ensure efficient and accurate thymic selection: 1) TCR signals must not be attenuated or enhanced by surface receptors other than those normally recruited to the TCR complex and 2) the density of TCR at the surface of SP thymocytes must rapidly reach steady state and should not increase following completion of the selection process, to avoid potential autoreactivity. Consequently, the presence of pre-TCR at the cell surface must be rapidly and efficiently suppressed, as it may interfere with these events.

Transcriptional regulation of the pT{alpha} gene cannot be invoked as a mechanism controlling surface expression of pre-TCR, since pT{alpha} mRNA is detectable in DP thymocytes that also express {alpha}{beta} TCR and becomes undetectable only after thymocytes have progressed to the SP stage of development (Fig. 1Go) (1, 11, 12, 13). These observations make it clear that DP thymocytes have the potential to express pre-TCR. An alternative mechanism involves the requirement for an additional pre-TCR-associated chain, analogous to the surrogate light chain employed by the pre-B cell receptor, which would be required for surface expression of the pre-TCR. This Vpre-B-like chain would be absent in DP and more mature thymocytes, and thus prevent surface expression of pre-TCR. The latter hypothesis is rooted in the observation that some T cell lines possessing a phenotype similar to that of more mature T cells fail to express pre-TCR upon transfection with cDNA-encoding pT{alpha} (12), suggesting these cells lack a crucial subunit of the pre-TCR complex. Although enticing, this mechanism has not been supported by experimental data. Moreover, we observed that, in a cell line capable of expressing pre-TCR, a wild-type pT{alpha} chain could not compete with a chimeric V{alpha}-pT{alpha} chain for association with TCR-{beta} (Fig. 5Go, lane 14). This finding suggests that, even if present, a Vpre-T chain would not allow pre-TCR expression in the presence of a TCR-{alpha} chain. Here, we provide a novel mechanism by which expression of TCR-{alpha} chains prevents surface expression of the pre-TCR (Fig. 3Go) due to the preferential formation of TCR-{alpha}{beta} heterodimers over that of pT{alpha}/TCR-{beta} heterodimers (Fig. 5Go).

Our findings directly demonstrate that the pT{alpha} chain is incapable of competing with TCR-{alpha} for pairing with TCR-{beta}, since pT{alpha}/TCR-{beta} heterodimers could not be observed in the presence of TCR-{alpha} (Fig. 5Go). Thus, it would appear that the structural features of pT{alpha} predicate its inability to compete with TCR-{alpha} for association with TCR-{beta}. How might the structure of pT{alpha} provide it with such an absolute competitive disadvantage against TCR-{alpha}? Apart from having very different primary structures, two major structural differences distinguish pT{alpha} from TCR-{alpha}: the absence of a V{alpha} domain in pT{alpha} and the lack of homology over the entire length of the connecting peptide (CP) domain. In TCR-{alpha}, this region is 38 amino acid residues in length, with the interchain Cys located 20 amino acid residues from the start of the TM domain; in pT{alpha}, the CP domain comprises 41 amino acid residues, with the interchain Cys located 13 residues from the start of the TM domain.

As mentioned, we observed that pT{alpha} chains possessing a V{alpha} domain (V{alpha}-pT{alpha}) prevented the formation of pT{alpha}/TCR-{beta} heterodimers in the endoplasmic reticulum (Fig. 5Go, lane 14). This establishes a role for the V{alpha} domain in regulating assembly of TCR heterodimers, and further suggests that the formation of symmetrical heterodimers is favored over asymmetrical pT{alpha}/TCR-{beta} dimers (25). Perhaps pairing of the V{alpha} domain with TCR-{beta} stabilizes the conformation of the TCR-{beta} chain, thereby promoting further assembly with CD3 subunits and ultimately export to the cell surface. However, we could not formally exclude the possibility that the abundance of V{alpha}-pT{alpha} chains over endogenous pT{alpha} chains prevented the formation of pT{alpha}-TCR-{beta} complexes. Nevertheless, this concern is not relevant to the competition assays described in this study, as they were performed with cell lines expressing comparable amounts of competing pT{alpha} or TCR-{alpha} chains.

We also examined the role of covalent linkage with TCR-{beta} by generating mutants of TCR-{alpha} that lacked the ability to form a cystine bridge (TCR{alpha}CS) or possessed an interchain Cys residue in the same position as that found in the pT{alpha} chain (TCR{alpha}CSKC). TCR-{alpha} chains lacking an interchain Cys could not compete with V{alpha}-pT{alpha}, whereas the introduction of a Cys residue closer to the TM domain allowed this mutant TCR-{alpha} chain to cocompete with V{alpha}-pT{alpha} for surface expression (Fig. 6Go). This is in marked contrast to wild-type TCR-{alpha} chains that prohibited surface expression of both mutant TCR-{alpha} chains. Therefore, the capacity of the TCR-{alpha} chain to form an appropriate cystine bridge with the TCR-{beta} chain plays a crucial role in its ability to abrogate cell surface expression of the pre-TCR. The data in Fig. 5Go show that this competitive inhibition occurs early during the biosynthesis of the TCR complex. Taken together, these observations indicate that the presence and precise positioning of the interchain Cys within the CP domain of TCR-{alpha} are essential to allow proper regulation of pre-TCR expression.

The TCR constitutes a very elaborate signaling apparatus, employing at least seven different chains to provide a membrane-anchored scaffold upon which numerous kinases, phosphatases, phospholipases, and adaptor molecules congregate and interact to relay signals to downstream signaling cascades. The pre-TCR and TCR appear to use the same proximal signaling molecules and share downstream signaling pathways, yet possess very different signaling outcomes. Therefore, the ability to rapidly and irrevocably replace pT{alpha} with TCR-{alpha} within this signaling complex represents an elegant and efficient method of achieving a developmental switch in the type of receptor expressed by DP thymocytes. It is tempting to speculate that such a mechanism may be at play in other cell lineages, perhaps even during embryonic development, when cells must rapidly and irreversibly commit to a particular fate.

In this study, we have shown that the structural features of the pT{alpha} chain are sufficient to ensure the sequential and nonoverlapping expression of pre-TCR and TCR during T cell development. This regulatory mechanism underscores the necessity for DP thymocytes to express {alpha}{beta} TCR in the absence of pre-TCR, which might otherwise compromise the selection process. One can envisage that in the absence of this regulatory mechanism, interference by the pre-TCR at the DP stage might impair the production of self-tolerant T cells and lead to the generation of autoreactive T cells.


    Acknowledgments
 
We thank Dr. Alison M. Michie for critical review of this manuscript, Cheryl Smith for her expert technical assistance, Dr. Robert G. Hawley for the generous gift of the MIEV plasmid, and Dr. Pamela Ohashi for providing the GP+E 86 retroviral packaging cell line.


    Footnotes
 
1 This work was supported by a grant from the Medical Research Council of Canada. S.T. is supported by a Doctoral Research Award from the Medical Research Council of Canada. J.C.Z.-P. is supported by a Scientist Award from the Medical Research Council of Canada. Back

2 Address correspondence and reprint requests to Dr. J. C. Zúñiga-Pflücker, Department of Immunology, University of Toronto, Toronto, Ontario, M5S 1A8, Canada. Back

3 Abbreviations used in this paper: DN, double negative; CP, connecting peptide; DP, double positive; GFP, green fluorescent protein; TM, transmembrane; SP, single positive. Back

Received for publication June 13, 2000. Accepted for publication August 24, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. von Boehmer, H., H. J. Fehling. 1997. Structure and function of the pre-T cell receptor. Annu. Rev. Immunol. 15:433.[Medline]
  2. von Boehmer, H., I. Aifantis, J. Feinberg, O. Lechner, C. Saint-Ruf, U. Walter, J. Buer, O. Azogui. 1999. Pleiotropic changes controlled by the pre-T-cell receptor. Curr. Opin. Immunol. 11:135.[Medline]
  3. von Boehmer, H.. 1992. Thymic selection: a matter of life and death. Immunol. Today 13:454.[Medline]
  4. Petrie, H. T., F. L. Livak, D. G. Schatz, A. Strasser, I. N. Crispe, K. Shortman. 1993. Multiple rearrangements in T cell receptor {alpha} chain genes maximize the production of useful thymocytes. J. Exp. Med. 178:615.[Abstract/Free Full Text]
  5. Mariathasan, S., R. G. Jones, P. S. Ohashi. 1999. Signals involved in thymocyte positive and negative selection. Semin. Immunol. 11:263.[Medline]
  6. Delaney, J. R., Y. Sykulev, H. N. Eisen, S. Tonegawa. 1998. Differences in the level of expression of class I major histocompatibility complex proteins on thymic epithelial and dendritic cells influence the decision of immature thymocytes between positive and negative selection. Proc. Natl. Acad. Sci. USA 95:5235.[Abstract/Free Full Text]
  7. Dave, V. P., D. Allman, D. L. Wiest, D. J. Kappes. 1999. Limiting TCR expression leads to quantitative but not qualitative changes in thymic selection. J. Immunol. 162:5764.[Abstract/Free Full Text]
  8. Lin, S. Y., L. Ardouin, A. Gillet, M. Malissen, B. Malissen. 1997. The single positive T cells found in CD3-{zeta}{eta}-/- mice overtly react with self-major histocompatibility complex molecules upon restoration of normal surface density of T cell receptor-CD3 complex. J. Exp. Med. 185:707.[Abstract/Free Full Text]
  9. Irving, B. A., F. W. Alt, N. Killeen. 1998. Thymocyte development in the absence of pre-T cell receptor extracellular immunoglobulin domains. Science 280:905.[Abstract/Free Full Text]
  10. Jacobs, H., J. Iacomini, M. van de Ven, S. Tonegawa, A. Berns. 1996. Domains of the TCR{beta}-chain required for early thymocyte development. J. Exp. Med. 184:1833.[Abstract/Free Full Text]
  11. Bruno, L., B. Rocha, A. Rolink, H. von Boehmer, H. R. Rodewald. 1995. Intra- and extra-thymic expression of the pre-T cell receptor {alpha} gene. Eur. J. Immunol. 25:1877.[Medline]
  12. Saint-Ruf, C., K. Ungewiss, M. Groettrup, L. Bruno, H. J. Fehling, H. von Boehmer. 1994. Analysis and expression of a cloned pre-T cell receptor gene. Science 266:1208.[Abstract/Free Full Text]
  13. Wilson, A., H. Robson MacDonald. 1995. Expression of genes encoding the pre-TCR and CD3 complex during thymus development. Int. Immunol. 7:1659.[Abstract/Free Full Text]
  14. Berger, M. A., V. Davé, M. R. Rhodes, G. C. Bosma, M. J. Bosma, D. J. Kappes, D. L. Wiest. 1997. Subunit composition of pre-T cell receptor complexes expressed by primary thymocytes: CD3{delta} is physically associated but not functionally required. J. Exp. Med. 186:1461.[Abstract/Free Full Text]
  15. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara, J. J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, S. Tonegawa. 1992. Mutations in T-cell antigen receptor genes {alpha} and {beta} block thymocyte development at different stages. Nature 360:225.[Medline]
  16. Kaye, J., N. J. Vasquez, S. M. Hedrick. 1992. Involvement of the same region of the T cell antigen receptor in thymic selection and foreign peptide recognition. J. Immunol. 148:3342.[Abstract]
  17. Leung, B. L., L. Haughn, A. Veillette, R. G. Hawley, R. Rottapel, M. Julius. 1999. TCR-{alpha}{beta}-independent CD28 signaling and costimulation require non-CD4-associated Lck. J. Immunol. 163:1334.[Abstract/Free Full Text]
  18. Hawley, R. G., F. H. L. Lieu, A. Z. C. Fong, S. J. Goldman, J. P. Leonard, T. S. Hawley. 1996. Retroviral vectors for production of interleukin-12 in the bone marrow to induce a graft-versus-leukemia effect. Ann. NY Acad. Sci. 795:341.[Medline]
  19. Cheng, L., C. Du, D. Murray, X. Tong, Y. A. Zhang, B. P. Chen, R. G. Hawley. 1997. A GFP reporter system to assess gene transfer and expression in viable human hematopoietic progenitors. Gene Ther. 4:1013.[Medline]
  20. Ghattas, I. R., J. R. Sanes, J. E. Majors. 1991. The encephalomyocarditis virus internal ribosome entry site allows efficient coexpression of two genes from a recombinant provirus in cultured cells and in embryos. Mol. Cell. Biol. 11:5848.[Abstract/Free Full Text]
  21. Trop, S., A. M. Steff, F. Denis, D. L. Wiest, P. Hugo. 1999. The connecting peptide domain of pT{alpha} dictates weak association of the pre-T cell receptor with the TCR {zeta} subunit. Eur. J. Immunol. 29:2187.[Medline]
  22. Markowitz, D. G., S. P. Goff, A. Bank. 1988. Safe and efficient ecotropic and amphotropic packaging lines for use in gene transfer experiments. Trans. Assoc. Am. Physicians 101:212.[Medline]
  23. van Oers, N. S. C., H. von Boehmer, A. Weiss. 1995. The pre-T cell receptor (TCR) complex is functionally coupled to the TCR-{zeta} subunit. J. Exp. Med. 182:1585.[Abstract/Free Full Text]
  24. Bonifacino, J. S., C. Chen, J. Lippincott-Schwartz, J. D. Ashwell, R. D. Klausner. 1988. Subunit interactions within the T-cell antigen receptor: clues from the study of partial complexes. Proc. Natl. Acad. Sci. USA 85:6929.[Abstract/Free Full Text]
  25. Berger, M. A., M. Carleton, M. Rhodes, J. M. Sauder, S. Trop, R. L. Dunbrack, P. Hugo, and D. L. Wiest. 2000. Identification of a novel pre-TCR isoform in which the accessibility of the TCR{beta} subunit is determined by occupancy of the "missing" V domain of pT{alpha}. Int. Immunol. In press.



This article has been cited by other articles:


Home page
J. Immunol.Home page
D. L. Wiest
Identification of the Last Cog in a Ligand-Independent Signaling Machine?
J. Immunol., May 1, 2009; 182(9): 5163 - 5164.
[Full Text] [PDF]


Home page
J. Immunol.Home page
S. Xiao, D.-m. Su, and N. R. Manley
T Cell Development from Kit-Negative Progenitors in the Foxn1{Delta}/{Delta} Mutant Thymus
J. Immunol., January 15, 2008; 180(2): 914 - 921.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Serwold, K. Hochedlinger, M. A. Inlay, R. Jaenisch, and I. L. Weissman
Early TCR Expression and Aberrant T Cell Development in Mice with Endogenous Prerearranged T Cell Receptor Genes
J. Immunol., July 15, 2007; 179(2): 928 - 938.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-Y. Huang and B. P. Sleckman
Developmental Stage-Specific Regulation of TCR-{alpha}-Chain Gene Assembly by Intrinsic Features of the TEA Promoter
J. Immunol., July 1, 2007; 179(1): 449 - 454.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Aublin, M. Ciofani, N. Willkomm, A. Hamrouni, A. L. Szymczak-Workman, T. Takahashi, Y. Sandjeu, P. Guillaume, D. A. A. Vignali, O. Michielin, et al.
A Natural Structural Variant of the Mouse TCR beta-Chain Displays Intrinsic Receptor Function and Antigen Specificity
J. Immunol., December 15, 2006; 177(12): 8587 - 8594.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. I. Garbe, A. Krueger, F. Gounari, J. C. Zuniga-Pflucker, and H. von Boehmer
Differential synergy of Notch and T cell receptor signaling determines {alpha}{beta} versus {gamma}{delta} lineage fate
J. Exp. Med., June 12, 2006; 203(6): 1579 - 1590.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Touma, H.-C. Chang, T. Sasada, M. Handley, L. K. Clayton, and E. L. Reinherz
The TCR Cbeta FG Loop Regulates {alpha}beta T Cell Development.
J. Immunol., June 1, 2006; 176(11): 6812 - 6823.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. S. Maltzman, L. Kovoor, J. L. Clements, and G. A. Koretzky
Conditional deletion reveals a cell-autonomous requirement of SLP-76 for thymocyte selection
J. Exp. Med., October 3, 2005; 202(7): 893 - 900.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. A. Baldwin, M. M. Sandau, S. C. Jameson, and K. A. Hogquist
The timing of TCR{alpha} expression critically influences T cell development and selection
J. Exp. Med., July 5, 2005; 202(1): 111 - 121.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Ljutic, J. R. Carlyle, D. Filipp, R. Nakagawa, M. Julius, and J. C. Zuniga-Pflucker
Functional Requirements for Signaling through the Stimulatory and Inhibitory Mouse NKR-P1 (CD161) NK Cell Receptors
J. Immunol., April 15, 2005; 174(8): 4789 - 4796.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Gadue, L. Yin, S. Jain, and P. L. Stein
Restoration of NK T Cell Development in fyn-Mutant Mice by a TCR Reveals a Requirement for Fyn During Early NK T Cell Ontogeny
J. Immunol., May 15, 2004; 172(10): 6093 - 6100.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Ciofani, T. M. Schmitt, A. Ciofani, A. M. Michie, N. Cuburu, A. Aublin, J. L. Maryanski, and J. C. Zuniga-Pflucker
Obligatory Role for Cooperative Signaling by Pre-TCR and Notch during Thymocyte Differentiation
J. Immunol., May 1, 2004; 172(9): 5230 - 5239.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Borowski, X. Li, I. Aifantis, F. Gounari, and H. von Boehmer
Pre-TCR{alpha} and TCR{alpha} Are Not Interchangeable Partners of TCR{beta} during T Lymphocyte Development
J. Exp. Med., March 1, 2004; 199(5): 607 - 615.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. O. Holman, E. R. Walsh, and K. A. Hogquist
The Central Tolerance Response to Male Antigen in Normal Mice Is Deletion and Not Receptor Editing
J. Immunol., October 15, 2003; 171(8): 4048 - 4053.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Ito, S. Arai, N. S. C. van Oers, I. Aifantis, H. von Boehmer, and T. Miyazaki
Positive Selection by the Pre-TCR Yields Mature CD8+ T Cells
J. Immunol., November 1, 2002; 169(9): 4913 - 4919.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. D. Lacorazza, H. E. Porritt, and J. Nikolich-Zugich
Dysregulated Expression of Pre-T{alpha} Reveals the Opposite Effects of Pre-TCR at Successive Stages of T Cell Development
J. Immunol., November 15, 2001; 167(10): 5689 - 5696.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. R. Ramiro, M. N. Navarro, A. Carreira, Y. R. Carrasco, V. G. de Yebenes, G. Carrillo, J. L. San Millan, B. Rubin, and M. L. Toribio
Differential Developmental Regulation and Functional Effects on Pre-TCR Surface Expression of Human pT{alpha}a and pT{alpha}b Spliced Isoforms
J. Immunol., November 1, 2001; 167(9): 5106 - 5114.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. Gibbons, N. C. Douglas, D. F. Barber, Q. Liu, R. Sullo, L. Geng, H.-J. Fehling, H. von Boehmer, and A. C. Hayday
The Biological Activity of Natural and Mutant pT{alpha} Alleles
J. Exp. Med., September 4, 2001; 194(5): 695 - 704.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Polic, D. Kunkel, A. Scheffold, and K. Rajewsky
How alpha beta T cells deal with induced TCRalpha ablation
PNAS, July 5, 2001; (2001) 141218898.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Petersson and F. Ivars
Early TCR {{alpha}}{{beta}} Expression Promotes Maturation of T Cells Expressing Fc{{epsilon}}RI{{gamma}} Containing TCR/CD3 Complexes
J. Immunol., June 1, 2001; 166(11): 6616 - 6624.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y. R. Carrasco, A. R. Ramiro, C. Trigueros, V. G. de Yebenes, M. Garcia-Peydro, and M. L. Toribio
An Endoplasmic Reticulum Retention Function for the Cytoplasmic Tail of the Human Pre-T Cell Receptor (TCR) {{alpha}} Chain: Potential Role in the Regulation of Cell Surface pre-TCR Expression Levels
J. Exp. Med., April 30, 2001; 193(9): 1045 - 1058.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. D. Lacorazza, C. Tucek-Szabo, L. V. Vasovic, K. Remus, and J. Nikolich-Zugich
Premature TCR{{alpha}}{{beta}} Expression and Signaling in Early Thymocytes Impair Thymocyte Expansion and Partially Block Their Development
J. Immunol., March 1, 2001; 166(5): 3184 - 3193.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Polic, D. Kunkel, A. Scheffold, and K. Rajewsky
How alpha beta T cells deal with induced TCRalpha ablation
PNAS, July 17, 2001; 98(15): 8744 - 8749.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trop, S.
Right arrow Articles by Zúñiga-Pflücker, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trop, S.
Right arrow Articles by Zúñiga-Pflücker, J. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS