|
|
||||||||
by TCR-
During TCR Assembly Prevents Surface Coexpression of Pre-TCR and 
TCR1



,
*
Department of Immunology, University of Toronto, Toronto, Ontario, Canada;
Department of Medicine, Division of Experimental Medicine, McGill University, Montreal, Quebec, Canada;
Immunobiology Working Group, Division of Basic Sciences, Fox Chase Cancer Center, Philadelphia, PA 19111; and
PROCREA BioSciences Inc., Montreal, Quebec, Canada
| Abstract |
|---|
|
|
|---|

T cell development,
CD4-CD8- thymocytes first express pre-TCR
(pT
/TCR-
) before their differentiation to the
CD4+CD8+ stage. Positive selection of
self-tolerant T cells is then determined by the 
TCR expressed on
CD4+CD8+ thymocytes. Conceivably, an overlap in
surface expression of these two receptors would interfere with the
delicate balance of thymic selection. Therefore, a mechanism ensuring
the sequential expression of pre-TCR and TCR must function during
thymocyte development. In support of this notion, we demonstrate that
expression of TCR-
by immature thymocytes terminates the surface
expression of pre-TCR. Our results reveal that expression of TCR-
precludes the formation of pT
/TCR-
dimers within the endoplasmic
reticulum, leading to the displacement of pre-TCR from the cell
surface. These findings illustrate a novel posttranslational mechanism
for the regulation of pre-TCR expression, which may ensure that 
TCR expression on thymocytes undergoing selection is not compromised by
the expression of pre-TCR. | Introduction |
|---|
|
|
|---|

TCR
lineage sequentially express two different TCRs, the pre-TCR and the

TCR (1). Signaling through these receptors
regulates thymocyte survival, proliferation, and differentiation
(2). Immature
CD4-CD8- (double
negative, DN)3
thymocytes must successfully generate a TCR-
chain able to associate
with pT
and CD3 chains to form the pre-TCR complex (2).
This first developmental checkpoint is termed
selection (3, 2). Pre-TCR-derived signals mediate the transition of DN
thymocytes to the CD4+CD8+
double-positive (DP) stage of T cell development. Signaling through
this receptor also leads to rescue from apoptosis, down-regulation of
CD25 surface expression, intense proliferation, allelic exclusion at
the TCR-
gene locus, and initiation of transcription at the TCR-
gene loci (2).
At the DP stage, the productive rearrangement at one or both TCR-
gene loci results in the surface expression of mature 
TCRs
(4). This allows thymocytes to be selected based on the
strength of the signals delivered through the TCR (5).
Thymocytes expressing a TCR with high affinity/avidity for
self-MHCpeptide complexes undergo apoptosis (negative selection), as
do thymocytes expressing a TCR with low or no affinity/avidity for
self-MHCpeptide complexes (neglect) (5). Thymocytes
expressing TCR with intermediate affinity/avidity for their ligand are
allowed to mature and exit the thymus (positive selection). Therefore,
the strength of the interaction between TCR and self-MHCpeptide
complexes has been proposed to play a pivotal role in determining the
outcome between negative or positive selection (6). This
notion is supported by the finding that a decrease in the surface
density of TCR attenuates TCR signaling and impairs negative selection,
thereby permitting thymocytes expressing potentially self-reactive TCRs
to escape negative selection and become positively selected (7, 8).
In light of this, we hypothesized that surface expression of pre-TCR
and TCR must occur sequentially to allow for proper selection of
developing thymocytes, as an overlap in surface expression of these two
receptors would interfere with the delicate balance of the selection
process. Indeed, it has been shown that expression of pre-TCR at the
cell surface is sufficient to elicit signaling through this receptor
complex without the requirement of an external ligand (9, 10). Consequently, expression of pre-TCR at the cell surface of
DP thymocytes might augment the signals transduced by the TCR
complexes, leading to aberrant negative selection of otherwise
self-tolerant thymocytes. Alternatively, pre-TCR might indirectly
influence the fate of DP thymocytes by limiting the amount of TCR-
available to associate with TCR-
, thereby lowering the surface
density of 
TCR complexes. This would result in a decrease of
TCR-mediated signals, leading to impaired negative selection of
thymocytes expressing potentially autoreactive TCRs. Either way,
coexpression of pre-TCR and TCR on developing thymocytes would
compromise their ability to effectively undergo positive and/or
negative selection.
The mechanism ensuring the exclusive expression of 
TCR at the
surface of DP thymocytes has not been elucidated. However, it has been
speculated that this regulation might be achieved at the
transcriptional level by limiting the expression of pT
to DN and
early DP thymocytes (1, 11, 12, 13). Alternatively, this
control may be enforced at the translational or posttranslational
level. In the present study, we have examined this issue and provide
evidence supporting the latter possibility. Our findings show that
pre-TCR cannot be coexpressed with TCR on the cell surface of immature
thymocytes. Using a SCID mouse-derived thymic lymphoma cell line,
SL-12
.12 (14), we show that in the presence of TCR-
,
pT
is disallowed from associating with TCR-
, thus preventing the
formation of the pre-TCR complex. Our results indicate that pT
is
degraded within the endoplasmic reticulum, providing a mechanism for
the inhibition of pre-TCR surface expression in the presence of
TCR-
. Our findings shed new light on the structural characteristics
of the pT
chain and illustrate a novel posttranslational mechanism
for the regulation of pre-TCR expression, which may ensure that only

TCRs are expressed on the surface of DP thymocytes.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were purchased from the National Cancer Institute,
Frederick Cancer Research and Development Center (Frederick, MD).
TCR-
-deficient (TCR
-/-; B6,
129-Tcratm/Mom) mice (15) were
purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were bred
in our specific pathogen-free facility.
RNA preparation and RT-PCR
Total RNA was prepared from purified thymocyte populations or
from spleen and lymph node leukocyte preparations using the RNeasy mini
kit (Qiagen, Mississauga, Ontario, Canada) according to the
manufacturers instructions. cDNA was produced with the Omniscript RT
kit (Qiagen) using random hexamers. PCR was performed in a final volume
of 25 µl containing 1x PCR buffer (Roche Diagnostic Systems, Laval,
Quebec, Canada), 0.5 mM dNTPs, 2.5 mM MgCl2, 2.5
U Taq polymerase, and appropriate dilutions of cDNA. Cycle
conditions were 94°C for 2 min, followed by 25 cycles of 94°C
for 30 s, 55°C for 30 s, and 72°C for 3060 s,
depending on the size of the expected PCR product. After a final
incubation at 72°C for 10 min, reactions were run on a 1.6% agarose
gel, and PCR products were visualized by ethidium bromide staining.
pT
cDNA was amplified using the pT
forward
(CAGAGCCTCCTCCCCCAACAG) and pT
reverse (GCTCAGAGGGGTGGGTAAGAT)
oligonucleotides, generating a 707-bp product.
-actin cDNA was
amplified using the
-actin forward (GTGGGCCGCTCTAGGCACCAA) and
-actin reverse (CTCTTTGATGTCACGCACGATTTC) oligonucleotides,
generating a 539-bp product. V
3-TCR
cDNA was isolated from lymph
node T cells of a C57BL/6 mouse and amplified using the V
3 forward
(CCTGTTCCAGAGTTCCTCCAC) and C
reverse (CCACTAGTCAGGCTCTGTCAG)
oligonucleotides for cloning into the pcDNA3.1-V5-His mammalian
expression vector (Invitrogen, Carlsbad, CA). The cloned PCR product
was verified by DNA sequencing.
DNA and retrovirus constructs
V
-pT
chimeric constructs, comprising either the V
11.1
and J
domains of the AD10 TCR-
chain (16) or the
V
3 and J
domains of a C57BL/6-derived TCR-
chain fused to
pT
cDNA lacking the leader sequence and the first five N-terminal
amino acid residues (12), were generated using overlapping
oligonucleotides (available upon request) and PCR. The same methodology
was used to generate a mutant of the AD10 TCR-
chain lacking the
interchain Cys residue (TCR
CS). An additional mutant of the AD10
TCR-
chain was generated which lacks the wild-type interchain Cys
residue and bears a Lys to Cys mutation 11 residues N-terminal to the
transmembrane (TM) domain (TCR
CSKC), allowing the formation of an
ectopic cystine bridge with the TCR-
chain. Wild-type V
3-TCR
and chimeric V
3-pT
DNA constructs were cloned into the SR
Puro
mammalian expression vector (a kind gift from F. Denis, Institut
Armand-Frappier, Montreal, Quebec, Canada). Wild-type and mutant
V
11-TCR
constructs, as well as the V
11-pT
construct, were
cloned into the pcDNA3.1-V5-His mammalian expression vector. These
plasmids were then digested with BglII and NotI
to excise a fragment containing the CMV promoter and
-chain
construct, which was subcloned into the MIEV retroviral vector (kindly
provided by R. Hawley, Holland Laboratory, American Red Cross,
Rockville, MD) (17) digested with the same restriction
endonucleases. The MSCV-based MIEV retroviral vector was constructed by
replacing the neomycin phosphotransferase (neo) gene in the
MINV retroviral vector (18) with the enhanced green
fluorescent protein (GFP) from the pEGFP-1 plasmid (Clontech, Palo
Alto, CA), linked to an altered encephalomyocarditis virus internal
ribosome entry site (19, 20).
Cell lines
The SL-12
.12 cell line is a pre-T cell line derived from a
spontaneous SCID mouse thymoma that was stably transfected to express
the functionally rearranged 2B4 TCR-
chain at the cell surface with
endogenous pT
to form a pre-TCR (14, 21). SL-12
.12
lines expressing V
3-TCR
or V
3-pT
constructs were
transfected by electroporation with the appropriate SR
Puro
expression vector, followed by antibiotic selection with 1 µg/ml
puromycin (Life Technologies, Burlington, Ontario, Canada), as
previously described (21). V
3 high expressing cells
were subsequently isolated by flow cytometry. The SL-12
.12 cell line
and its derivatives were maintained in high glucose DMEM (Sigma-Aldrich
Canada, Oakville, Ontario, Canada) supplemented with 10% FCS (Life
Technologies, Rockville, MD), 10 mM HEPES, 50 µM 2-ME, 2 mM GlutaMAX
(Life Technologies), 1 mM sodium pyruvate, 100 IU/ml penicillin, 100
µg/ml streptomycin, 10 µg/ml gentamicin, and 0.5 mg/ml geneticin
(G418; Life Technologies). The RetroPack PT67 cell line was purchased
from Clontech; the GP+E 86 retroviral packaging cell line
(22) was obtained from P. Ohashi (University of Toronto).
Both cell lines were maintained in high-glucose DMEM supplemented as
above, except that geneticin was not added to the culture medium.
Retroviral gene transfer
PT67 retroviral packaging cells were transfected transiently
with 1 µg MIEV retroviral vector DNA using Effectene transfection
reagent (Qiagen) according to the manufacturers instructions.
Retroviral supernatant was harvested 48 h posttransfection,
diluted 2-fold with fresh culture medium, and supplemented with 4
µg/ml hexadimethrine bromide (Sigma-Aldrich) to infect GP+E 86 cells.
Stable retrovirus-producing GP+E 86 cells expressing enhanced GFP were
isolated by flow cytometry 48 h later and subsequently used to
infect SL-12
.12 cells, or SL-12
.12 cells expressing V
3-TCR
or V
3-pT
-chains. Briefly, 5 x 105
SL-12
.12 cells and 1 x 106 GP+E 86 cells
were seeded onto a 60-mm tissue culture dish in 4 ml culture medium
supplemented with 4 µg/ml hexadimethrine bromide and incubated for
48 h at 37°C, after which stably transfected cells expressing
GFP were removed from the producer monolayer and purified by flow
cytometry.
Abs and flow cytometry
For flow cytometric analysis, FITC-, PE-, or biotin-conjugated
Abs specific for CD3
(145-2C11), CD4 (RM4-5), CD8 (53-6.7), CD117
(2B8), V
3.2 (RR3-16), and V
11 (RR8-1), and APC-conjugated
streptavidin were purchased from PharMingen (Mississauga, Ontario,
Canada). Flow cytometry was performed by washing 1 x
106 cells in staining buffer (0.1% BSA/0.1%
sodium azide/HBSS) and staining with the indicated mAbs for 30 min at
4°C, followed by analysis on a FACSCalibur flow cytometer (Becton
Dickinson, San Jose, CA). Cytoplasmic staining was performed using the
Cytofix/Cytoperm kit (PharMingen) according to the manufacturers
instructions. Data analysis was performed using the CellQuest software
(Becton Dickinson); data were live-gated by size and lack of propidium
iodide uptake. Purified DP and single-positive (SP) thymocytes were
obtained by staining single-cell suspensions from adult C57BL/6 and
TCR
-/- mice with anti-CD4-FITC and
anti-CD8-APC. For purification of TCR
+
thymocytes, single-cell suspensions from adult CD1 mice were stained
with anti-CD4-FITC, anti-TCR
-PE, and anti-CD8-APC; DP
cells were defined by a
CD4+CD8+TCR
int
phenotype, and SP cells were defined by a
CD4+CD8-TCR
high
or
CD4-CD8+TCR
high
phenotype. Cells were sorted using a Coulter Elite flow cytometer
(Coulter Electronics, Montreal, Quebec, Canada); in all cases, sort
purity was >99%.
Metabolic labeling, immunoprecipitation, and electrophoresis
Approximately 1.5 x 108 cells
of the indicated cell line were metabolically labeled for 30 min at
37°C at a density of 2 x 107 cells/ml in
methionine-free medium supplemented with 0.5 mCi/ml
[35S]methionine
(EXPRE35S35S protein
labeling mix; NEN Life Science Products, Boston, MA). Following
labeling, the cells were lysed at a density of 5 x
107/ml for 20 min on ice in buffer containing 1%
digitonin (High Purity; Calbiochem, La Jolla, CA) as described
elsewhere (14). Detergent extracts were clarified by
centrifugation at 14,000 rpm for 10 min in a 4°C refrigerated
microcentrifuge. Clarified extracts were precleared by rocking
end-over-end at 4°C for 1 h with 15 µl protein A-Sepharose
beads (Sigma-Aldrich). The extracts were then divided into three equal
parts, each of which were immunoprecipitated in parallel for 2 h
at 4°C with one of the indicated mAbs adsorbed to protein
A-Sepharose: anti-TCR-
(H57-597), anti-CD3
(145-2C11), or
rabbit anti-pT
cytoplasmic tail (14). The resultant
immune complexes were washed three times with 2% digitonin washing
buffer and once with PBS, after which they were subjected to recapture
analysis. The recapture assay was performed by boiling the immune
complexes for 5 min in 100 µl 1% SDS and quenching the
SDS-solubilized complexes with 900 µl of 1% Nonidet P-40
(Calbiochem, La Jolla, CA) lysis buffer. The solution containing the
solubilized proteins was divided in half and the halves were
reimmunoprecipitated as above with anti-TCR-
(H28-710) or rabbit
anti-pT
cytoplasmic tail Ab. The recaptured immune complexes
were then resolved by SDS-PAGE on 11% acrylamide gels. Radiolabeled
proteins were visualized by fluorography using PPO (ICN
Pharmaceuticals, Costa Mesa, CA) and autoradiography at -70°C.
| Results |
|---|
|
|
|---|
mRNA during T cell development
Previous studies have shown that pT
mRNA is detectable among DP
thymocytes (1, 11, 12, 13), thereby challenging the notion
that expression of the pre-TCR could be regulated by transcriptional
control of the pT
gene. To further support this notion, we obtained
total RNA from highly purified thymocyte subsets and analyzed the
expression of pT
mRNA by RT-PCR (Fig. 1
A). In keeping with
previously published findings, we observed high levels of pT
mRNA in
DP thymocytes, whereas pT
mRNA was undetectable in SP thymocytes and
peripheral (spleen and lymph node) T cells. Furthermore, DP thymocytes
from TCR
-/- mice expressed abundant levels
of pT
mRNA (Fig. 1
A). This observation, combined with the
fact that pre-TCR can be immunoprecipitated from the surface of
thymocytes derived from TCR-
-/- mice (14),
strongly suggests that pre-TCR can be expressed at the surface of DP
thymocytes in the absence of a productively rearranged TCR-
chain.
To determine whether functional rearrangement of a TCR-
gene
prevented further transcription of the pT
gene, we purified 
TCR-expressing DP thymocytes and assessed the presence of pT
transcripts within this population (Fig. 1
B). We found that
DP thymocytes expressing 
TCR at the cell surface contained pT
mRNA. These results indicate that DP thymocytes have the potential to
translate pT
at a stage where 
TCR is expressed and therefore
may coexpress pre-TCR with 
TCR at their surface.
|
Since transcriptional regulation of pT
cannot account for the
absence of pre-TCR and TCR coexpression at the DP stage, we envisaged
an alternate mechanism whereby pT
and TCR-
would compete for
assembly with the TCR-
and CD3 subunits shared by both receptors.
According to this model, the formation of TCR-
heterodimers would
be favored over pT
/TCR-
heterodimers, owing either to structural
characteristics intrinsic to pT
or to the intervention of a
chaperone molecule within the endoplasmic reticulum. To examine this
possibility, we developed a competition assay (Fig. 2
) that takes advantage of the immature
thymic lymphoma cell line SL-12
.12 expressing a transfected TCR-
gene (Fig. 2
A) (14). Following transfection
with a plasmid encoding a V
3-TCR
chain or a V
3-pT
chain (a
chimeric molecule comprising a V
3 domain fused to pT
), these
cells should express TCR or pre-TCR at the cell surface, respectively
(Fig. 2
, B and C). Thus, two stably transfected
SL-12
.12 cell lines were established, one expressing
V
3-TCR
-chains in conjunction with TCR-
and the other
expressing V
3-pT
chains and TCR-
(Fig. 3
, top row: middle and
right panels, respectively). As outlined in Fig. 2
, each of
these cell lines was subsequently infected with retroviral constructs
encoding either a V
11-TCR
chain (Fig. 2
, D,
F, and H) or a V
11-pT
chimeric chain (Fig. 2
, E, G, and I), along with a GFP
reporter gene. Fig. 3
shows that retroviral infection of SL-12
.12
cells resulted in the surface expression of
V
11+ TCR or pre-TCR complexes on the cell
surface (Fig. 3
, left column: middle and bottom
panels, respectively). Thus, staining of GFP-expressing cells with
V
3- or V
11-specific mAbs would allow us to determine the outcome
of competition between pT
and TCR-
chains on surface expression
of pre-TCR and TCR. The predicted outcome for each receptor combination
is depicted in Fig. 2
.
|
|
is prevented by TCR-
Thymocytes and peripheral T cells are capable of coexpressing two
different TCR-
chains on their cell surface (4, 7).
This is presumably because TCR-
chains are essentially identical to
one another, except for the hypervariable V
domain. Using our model
system (Fig. 2
), we could observe coexpression of two different TCR-
chains on the cell surface of V
3-TCR
-transfected SL-12
.12
cells retrovirally infected with V
11-TCR
chains (Fig. 3
, center panel). Based on this, we expected that different
V
-pT
chains would likewise be coexpressed on the cell surface. In
agreement with this prediction, we observed that
V
3-pT
-transfected SL-12
.12 cells retrovirally infected with
V
11-pT
chains expressed both V
3-pT
and V
11-pT
chains
on their cell surface (Fig. 3
, bottom right panel). In
contrast, cells coexpressing V
11-TCR
with V
3-pT
expressed
only V
11-TCR
-containing receptors on the cell surface (Fig. 3
, middle right panel). Moreover, V
3-TCR
-transfected
SL-12
.12 cells retrovirally infected with V
11-pT
chains failed
to express V
11-pT
, as only V
3-TCR
could be detected on the
cell surface (Fig. 3
, bottom middle panel). These results
demonstrate that V
-pT
and TCR-
cannot be coexpressed at the
cell surface, indicating that expression of TCR-
blocks surface
expression of pT
.
The absence of retrovirally encoded V
11-pT
from the cell surface
of V
3-TCR
-transfected SL-12
.12 cells (Fig. 3
, bottom
middle panel) might be due to a failure of this cell line to
express the V
11-pT
chain. Therefore, we performed cytoplasmic
staining to ensure that V
11-pT
chains were functionally expressed
within these cells. Whereas the V
11-pT
chain remained
undetectable on the cell surface, we could readily demonstrate its
presence in the cytoplasm (Fig. 4
). As
expected, SL-12
.12 cells transfected only with V
3-TCR
did not
stain for V
11 either at the cell surface or within the cytoplasm
(Fig. 4
).
|
interferes with the formation of
pT
/TCR-
heterodimers
The preceding experiments demonstrate that the absence of pre-TCR
complexes from the surface of cells expressing TCR-
must be due to a
failure of these complexes to form or to be exported to the cell
surface. To distinguish between these possibilities, the presence of
nascent pT
/TCR-
heterodimers was assessed in SL-12
.12 cells
lacking TCR-
chains, and in SL-12
.12 cells transfected with a
V
11-TCR
construct; a third cell line, transfected with a
V
11-pT
chimeric construct, was also analyzed. Cells were labeled
with [35S]methionine and subsequently
solubilized with digitonin, thus maintaining the integrity of pre-TCR
and TCR complexes (14, 23). Because the assembly of TCR,
and presumably pre-TCR, complexes proceeds in a stepwise manner
(24), we examined three distinct steps of the assembly
process by immunoprecipitating cellular extracts with
anti-TCR-
, anti-CD3
, or anti-pT
Abs. To
determine the presence of TCR-
or pT
within these complexes,
immunoprecipitates were solubilized in SDS and subsequently recaptured
(reimmunoprecipitated) with either anti-TCR-
or
anti-pT
Abs.
Using an Ab specific for the pT
cytoplasmic tail (14)
for the first immunoprecipitation step, we confirmed that all three
cell lines synthesized full-length pT
proteins, and thus fulfilled
the first requirement for the assembly of pre-TCR complexes (Fig. 5
, lanes 6, 12, and
18). As expected, we were able to recover pT
/TCR-
heterodimers from SL-12
.12 cells, which express only wild-type
pre-TCR (Fig. 5
, lane 2) (14). The weak signal
observed correlates well with the low level of pre-TCR measured at the
surface of these cells by flow cytometry (Refs. 14, 21 ;
data not shown). In contrast, we could not detect pT
/TCR-
heterodimers from SL-12
.12 cells that also expressed a TCR-
chain
(Fig. 5
, lane 8), whereas TCR-
dimers were abundant in
these cells (Fig. 5
, lane 7). Surprisingly, pT
/TCR-
dimers were absent in SL-12
.12 cells expressing V
11-pT
chains
(Fig. 5
, lane 14), whereas V
11-pT
TCR-
complexes
were readily observed. The presence of pT
-CD3
complexes in all
three cell lines (Fig. 5
, lanes 3, 4, 9, 10, 15,
and 16) indicates that nascent pT
chains can pair with
CD3
in the absence of TCR-
, suggesting that pT
associates with
CD3
before covalent linkage with TCR-
, and that this event is not
favored in the presence of TCR-
. Moreover, the observation that a
chimeric pT
chain comprising a V
domain can prevent the formation
of pT
-TCR-
complexes suggests that the formation of symmetrical
TCR-like heterodimers may be favored over that of asymmetrical pre-TCR
heterodimers.
|
and TCR-
is required to
displace pT
from the cell surface
To gain further insight into the mechanism by which TCR-
prevents the association of pT
with TCR-
, we examined the role of
disulfide linkage between TCR-
and TCR-
. Two mutants of the
V
11-TCR
chain were generated, one lacking the interchain Cys
residue present within the connecting peptide domain (TCR
CS) and
therefore unable to form a cystine bridge with the TCR-
-chain. In
the second mutant, also lacking the interchain Cys residue, the Lys
located 13 amino acids away from the start of the TM domain was
replaced with a Cys (V
11-TCR
CSKC), thus placing the new Cys
residue at the same relative position occupied by the bridging Cys
residue present in the pT
chain. Retroviral vectors encoding these
constructs were introduced into SL-12
.12 cells previously
transfected with plasmids encoding either V
3-TCR
or V
3-pT
chains, paralleling the scheme presented in Figs. 2
and 3
.
Although both mutant V
11-TCR
chains could be expressed at the
surface of SL-12
.12 cells in the absence of competing V
3-TCR
or V
3-pT
chains (Fig. 6
, left
column: middle and bottom panels), neither could be
efficiently expressed at the cell surface in the presence of
V
3-TCR
(Fig. 6
, center and bottom middle
panels). Moreover, surface expression of the V
11-TCR
CS
mutant was not readily detected when placed in competition with
V
3-pT
(Fig. 6
, middle right panel), whereas the
V
11-TCR
CSKC mutant appeared to compete successfully with
V
3-pT
for surface expression (Fig. 6
, bottom right
panel). These results demonstrate that the presence of a Cys
residue in the correct position within the connecting peptide domain of
TCR-
is necessary to ensure its ability to forestall the assembly
and surface expression of pT
/TCR-
heterodimers.
|
| Discussion |
|---|
|
|
|---|
chain leads to cell death, indicating that pre-TCR
signaling cannot substitute for positive selection signals mediated by
the TCR. Clear evidence for this is provided by the study of
TCR-
-/- mice, in which all thymocytes are
arrested at the DP stage, despite abundant expression of pT
(Fig. 1
Transcriptional regulation of the pT
gene cannot be invoked as a
mechanism controlling surface expression of pre-TCR, since pT
mRNA
is detectable in DP thymocytes that also express 
TCR and becomes
undetectable only after thymocytes have progressed to the SP stage of
development (Fig. 1
) (1, 11, 12, 13). These observations make
it clear that DP thymocytes have the potential to express pre-TCR. An
alternative mechanism involves the requirement for an additional
pre-TCR-associated chain, analogous to the surrogate light chain
employed by the pre-B cell receptor, which would be required for
surface expression of the pre-TCR. This Vpre-B-like chain would be
absent in DP and more mature thymocytes, and thus prevent surface
expression of pre-TCR. The latter hypothesis is rooted in the
observation that some T cell lines possessing a phenotype similar to
that of more mature T cells fail to express pre-TCR upon transfection
with cDNA-encoding pT
(12), suggesting these cells lack
a crucial subunit of the pre-TCR complex. Although enticing, this
mechanism has not been supported by experimental data. Moreover, we
observed that, in a cell line capable of expressing pre-TCR, a
wild-type pT
chain could not compete with a chimeric V
-pT
chain for association with TCR-
(Fig. 5
, lane 14). This
finding suggests that, even if present, a Vpre-T chain would not allow
pre-TCR expression in the presence of a TCR-
chain. Here, we provide
a novel mechanism by which expression of TCR-
chains prevents
surface expression of the pre-TCR (Fig. 3
) due to the preferential
formation of TCR-
heterodimers over that of pT
/TCR-
heterodimers (Fig. 5
).
Our findings directly demonstrate that the pT
chain is incapable of
competing with TCR-
for pairing with TCR-
, since pT
/TCR-
heterodimers could not be observed in the presence of TCR-
(Fig. 5
).
Thus, it would appear that the structural features of pT
predicate
its inability to compete with TCR-
for association with TCR-
. How
might the structure of pT
provide it with such an absolute
competitive disadvantage against TCR-
? Apart from having very
different primary structures, two major structural differences
distinguish pT
from TCR-
: the absence of a V
domain in pT
and the lack of homology over the entire length of the connecting
peptide (CP) domain. In TCR-
, this region is 38 amino acid residues
in length, with the interchain Cys located 20 amino acid residues from
the start of the TM domain; in pT
, the CP domain comprises 41 amino
acid residues, with the interchain Cys located 13 residues from the
start of the TM domain.
As mentioned, we observed that pT
chains possessing a V
domain
(V
-pT
) prevented the formation of pT
/TCR-
heterodimers in
the endoplasmic reticulum (Fig. 5
, lane 14). This
establishes a role for the V
domain in regulating assembly of TCR
heterodimers, and further suggests that the formation of symmetrical
heterodimers is favored over asymmetrical pT
/TCR-
dimers
(25). Perhaps pairing of the V
domain with TCR-
stabilizes the conformation of the TCR-
chain, thereby promoting
further assembly with CD3 subunits and ultimately export to the cell
surface. However, we could not formally exclude the possibility that
the abundance of V
-pT
chains over endogenous pT
chains
prevented the formation of pT
-TCR-
complexes. Nevertheless,
this concern is not relevant to the competition assays described in
this study, as they were performed with cell lines expressing
comparable amounts of competing pT
or TCR-
chains.
We also examined the role of covalent linkage with TCR-
by
generating mutants of TCR-
that lacked the ability to form a cystine
bridge (TCR
CS) or possessed an interchain Cys residue in the same
position as that found in the pT
chain (TCR
CSKC). TCR-
chains
lacking an interchain Cys could not compete with V
-pT
, whereas
the introduction of a Cys residue closer to the TM domain allowed this
mutant TCR-
chain to cocompete with V
-pT
for surface
expression (Fig. 6
). This is in marked contrast to wild-type TCR-
chains that prohibited surface expression of both mutant TCR-
chains. Therefore, the capacity of the TCR-
chain to form an
appropriate cystine bridge with the TCR-
chain plays a crucial role
in its ability to abrogate cell surface expression of the pre-TCR. The
data in Fig. 5
show that this competitive inhibition occurs early
during the biosynthesis of the TCR complex. Taken together, these
observations indicate that the presence and precise positioning of the
interchain Cys within the CP domain of TCR-
are essential to allow
proper regulation of pre-TCR expression.
The TCR constitutes a very elaborate signaling apparatus, employing at
least seven different chains to provide a membrane-anchored scaffold
upon which numerous kinases, phosphatases, phospholipases, and adaptor
molecules congregate and interact to relay signals to downstream
signaling cascades. The pre-TCR and TCR appear to use the same proximal
signaling molecules and share downstream signaling pathways, yet
possess very different signaling outcomes. Therefore, the ability to
rapidly and irrevocably replace pT
with TCR-
within this
signaling complex represents an elegant and efficient method of
achieving a developmental switch in the type of receptor expressed by
DP thymocytes. It is tempting to speculate that such a mechanism may be
at play in other cell lineages, perhaps even during embryonic
development, when cells must rapidly and irreversibly commit to a
particular fate.
In this study, we have shown that the structural features of the pT
chain are sufficient to ensure the sequential and nonoverlapping
expression of pre-TCR and TCR during T cell development. This
regulatory mechanism underscores the necessity for DP thymocytes to
express 
TCR in the absence of pre-TCR, which might otherwise
compromise the selection process. One can envisage that in the absence
of this regulatory mechanism, interference by the pre-TCR at the DP
stage might impair the production of self-tolerant T cells and lead to
the generation of autoreactive T cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. J. C. Zúñiga-Pflücker, Department of Immunology, University of Toronto, Toronto, Ontario, M5S 1A8, Canada. ![]()
3 Abbreviations used in this paper: DN, double negative; CP, connecting peptide; DP, double positive; GFP, green fluorescent protein; TM, transmembrane; SP, single positive. ![]()
Received for publication June 13, 2000. Accepted for publication August 24, 2000.
| References |
|---|
|
|
|---|
chain genes maximize the production of useful thymocytes. J. Exp. Med. 178:615.
-/- mice overtly react with self-major histocompatibility complex molecules upon restoration of normal surface density of T cell receptor-CD3 complex. J. Exp. Med. 185:707.
-chain required for early thymocyte development. J. Exp. Med. 184:1833.
gene. Eur. J. Immunol. 25:1877.[Medline]
is physically associated but not functionally required. J. Exp. Med. 186:1461.
and
block thymocyte development at different stages. Nature 360:225.[Medline]

-independent CD28 signaling and costimulation require non-CD4-associated Lck. J. Immunol. 163:1334.
dictates weak association of the pre-T cell receptor with the TCR
subunit. Eur. J. Immunol. 29:2187.[Medline]
subunit. J. Exp. Med. 182:1585.
subunit is determined by occupancy of the
"missing" V domain of pT
. Int. Immunol. In
press.This article has been cited by other articles:
![]() |
M. W.L. Leung, S. Shen, and J. J. Lafaille TCR-dependent differentiation of thymic Foxp3+ cells is limited to small clonal sizes J. Exp. Med., September 28, 2009; 206(10): 2121 - 2130. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Wiest Identification of the Last Cog in a Ligand-Independent Signaling Machine? J. Immunol., May 1, 2009; 182(9): 5163 - 5164. [Full Text] [PDF] |
||||
![]() |
S. Xiao, D.-m. Su, and N. R. Manley T Cell Development from Kit-Negative Progenitors in the Foxn1{Delta}/{Delta} Mutant Thymus J. Immunol., January 15, 2008; 180(2): 914 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Serwold, K. Hochedlinger, M. A. Inlay, R. Jaenisch, and I. L. Weissman Early TCR Expression and Aberrant T Cell Development in Mice with Endogenous Prerearranged T Cell Receptor Genes J. Immunol., July 15, 2007; 179(2): 928 - 938. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Huang and B. P. Sleckman Developmental Stage-Specific Regulation of TCR-{alpha}-Chain Gene Assembly by Intrinsic Features of the TEA Promoter J. Immunol., July 1, 2007; 179(1): 449 - 454. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aublin, M. Ciofani, N. Willkomm, A. Hamrouni, A. L. Szymczak-Workman, T. Takahashi, Y. Sandjeu, P. Guillaume, D. A. A. Vignali, O. Michielin, et al. A Natural Structural Variant of the Mouse TCR beta-Chain Displays Intrinsic Receptor Function and Antigen Specificity J. Immunol., December 15, 2006; 177(12): 8587 - 8594. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Garbe, A. Krueger, F. Gounari, J. C. Zuniga-Pflucker, and H. von Boehmer Differential synergy of Notch and T cell receptor signaling determines {alpha}{beta} versus {gamma}{delta} lineage fate J. Exp. Med., June 12, 2006; 203(6): 1579 - 1590. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Touma, H.-C. Chang, T. Sasada, M. Handley, L. K. Clayton, and E. L. Reinherz The TCR Cbeta FG Loop Regulates {alpha}beta T Cell Development. J. Immunol., June 1, 2006; 176(11): 6812 - 6823. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Maltzman, L. Kovoor, J. L. Clements, and G. A. Koretzky Conditional deletion reveals a cell-autonomous requirement of SLP-76 for thymocyte selection J. Exp. Med., October 3, 2005; 202(7): 893 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Baldwin, M. M. Sandau, S. C. Jameson, and K. A. Hogquist The timing of TCR{alpha} expression critically influences T cell development and selection J. Exp. Med., July 5, 2005; 202(1): 111 - 121. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ljutic, J. R. Carlyle, D. Filipp, R. Nakagawa, M. Julius, and J. C. Zuniga-Pflucker Functional Requirements for Signaling through the Stimulatory and Inhibitory Mouse NKR-P1 (CD161) NK Cell Receptors J. Immunol., April 15, 2005; 174(8): 4789 - 4796. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gadue, L. Yin, S. Jain, and P. L. Stein Restoration of NK T Cell Development in fyn-Mutant Mice by a TCR Reveals a Requirement for Fyn During Early NK T Cell Ontogeny J. Immunol., May 15, 2004; 172(10): 6093 - 6100. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ciofani, T. M. Schmitt, A. Ciofani, A. M. Michie, N. Cuburu, A. Aublin, J. L. Maryanski, and J. C. Zuniga-Pflucker Obligatory Role for Cooperative Signaling by Pre-TCR and Notch during Thymocyte Differentiation J. Immunol., May 1, 2004; 172(9): 5230 - 5239. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Borowski, X. Li, I. Aifantis, F. Gounari, and H. von Boehmer Pre-TCR{alpha} and TCR{alpha} Are Not Interchangeable Partners of TCR{beta} during T Lymphocyte Development J. Exp. Med., March 1, 2004; 199(5): 607 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. O. Holman, E. R. Walsh, and K. A. Hogquist The Central Tolerance Response to Male Antigen in Normal Mice Is Deletion and Not Receptor Editing J. Immunol., October 15, 2003; 171(8): 4048 - 4053. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ito, S. Arai, N. S. C. van Oers, I. Aifantis, H. von Boehmer, and T. Miyazaki Positive Selection by the Pre-TCR Yields Mature CD8+ T Cells J. Immunol., November 1, 2002; 169(9): 4913 - 4919. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Lacorazza, H. E. Porritt, and J. Nikolich-Zugich Dysregulated Expression of Pre-T{alpha} Reveals the Opposite Effects of Pre-TCR at Successive Stages of T Cell Development J. Immunol., November 15, 2001; 167(10): 5689 - 5696. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Ramiro, M. N. Navarro, A. Carreira, Y. R. Carrasco, V. G. de Yebenes, G. Carrillo, J. L. San Millan, B. Rubin, and M. L. Toribio Differential Developmental Regulation and Functional Effects on Pre-TCR Surface Expression of Human pT{alpha}a and pT{alpha}b Spliced Isoforms J. Immunol., November 1, 2001; 167(9): 5106 - 5114. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gibbons, N. C. Douglas, D. F. Barber, Q. Liu, R. Sullo, L. Geng, H.-J. Fehling, H. von Boehmer, and A. C. Hayday The Biological Activity of Natural and Mutant Pt{alpha} Alleles J. Exp. Med., September 3, 2001; 194(5): 695 - 704. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Petersson and F. Ivars Early TCR {{alpha}}{{beta}} Expression Promotes Maturation of T Cells Expressing Fc{{epsilon}}RI{{gamma}} Containing TCR/CD3 Complexes J. Immunol., June 1, 2001; 166(11): 6616 - 6624. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. R. Carrasco, A. R. Ramiro, C. Trigueros, V. G. de Yebenes, M. Garcia-Peydro, and M. L. Toribio An Endoplasmic Reticulum Retention Function for the Cytoplasmic Tail of the Human Pre-T Cell Receptor (Tcr) {alpha} Chain: Potential Role in the Regulation of Cell Surface Pre-Tcr Expression Levels J. Exp. Med., May 7, 2001; 193(9): 1045 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Lacorazza, C. Tucek-Szabo, L. V. Vasovic, K. Remus, and J. Nikolich-Zugich Premature TCR{{alpha}}{{beta}} Expression and Signaling in Early Thymocytes Impair Thymocyte Expansion and Partially Block Their Development J. Immunol., March 1, 2001; 166(5): 3184 - 3193. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Polic, D. Kunkel, A. Scheffold, and K. Rajewsky How alpha beta T cells deal with induced TCRalpha ablation PNAS, July 17, 2001; 98(15): 8744 - 8749. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |