The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qi, L.
Right arrow Articles by Ostrand-Rosenberg, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qi, L.
Right arrow Articles by Ostrand-Rosenberg, S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 2000, 165: 5451-5461.
Copyright © 2000 by The American Association of Immunologists

Tumor Cells Present MHC Class II-Restricted Nuclear and Mitochondrial Antigens and Are the Predominant Antigen Presenting Cells In Vivo1

Ling Qi, José-Manuel Rojas2 and Suzanne Ostrand-Rosenberg3

Department of Biological Sciences, University of Maryland, Baltimore, MD 21250


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MHC class II-restricted tumor Ags presented by class II+ tumor cells identified to date are derived from proteins expressed in the cytoplasm or plasma membrane of tumor cells. It is unclear whether MHC class II+ tumor cells present class II-restricted epitopes derived from other intracellular compartments, such as nuclei and/or mitochondria, and whether class II+ tumor cells directly present Ag in vivo. To address these questions, a model Ag, hen egg lysozyme, was targeted to various subcellular compartments of mouse sarcoma cells, and the resulting cells were tested for presentation of three lysozyme epitopes in vitro and for presentation of nuclear Ag in vivo. In in vitro studies, Ags localized to all tested compartments (nuclei, cytoplasm, mitochondria, and endoplasmic reticulum) are presented in the absence invariant chain and H-2M. Coexpression of invariant chain and H-2M inhibit presentation of some, but not all, of the epitopes. In vivo studies demonstrate that class II+ tumor cells, and not host-derived cells, are the predominant APC for class II-restricted nuclear Ags. Because class II+ tumor cells are effective APC in vivo and probably present novel tumor Ag epitopes not presented by host-derived APC, their inclusion in cancer vaccines may enhance activation of tumor-reactive CD4+ T cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Optimal antitumor immunity usually requires activation of CD8+ and CD4+ tumor-specific T lymphocytes (1, 2, 3, 4, 5, 6, 7). Naive CD8+ and CD4+ T cells are activated by APCs that deliver an Ag-specific signal plus a costimulatory signal to the responding T cells (8). In the case of tumor-specific CD8+ and CD4+ T cell activation, the Ag-specific signal consists of an epitope derived from a tumor-associated Ag bound to an MHC class I or II molecule, respectively. Tumor Ags are either presented by tumor cells themselves (direct Ag presentation) (9, 10, 11) or by professional, host-derived APC, such as dendritic cells, macrophages, or B cells (indirect Ag presentation or cross-priming) (9, 12, 13, 14).

Numerous MHC class I-restricted tumor-associated Ag epitopes have been identified, and the proteins from which they are derived reside in diverse subcellular compartments, such as nuclei (e.g., CDK4; Ref. 15), cytosol (e.g., {beta}-catenin; Ref. 16), or plasma membrane (e.g., her2/neu; Ref. 17). In contrast, many fewer MHC class II-restricted tumor Ags have been identified, and these molecules are derived from proteins restricted to the cytoplasm (18) or plasma membrane (19) of tumor cells. Whether MHC class II+ tumor cells directly present class II-restricted epitopes from diverse subcellular compartments or are APC in vivo remains unknown.

To study this question we have generated MHC class II+ tumor cells by gene transfection, and further transfected them with a test Ag (hen egg lysozyme, HEL4) targeted to various subcellular sites. The resulting cells were tested as APC for three HEL epitopes in vitro. Ags localized to all tested compartments (nuclei, cytoplasm, mitochondria, and endoplasmic reticulum (ER)) are efficiently presented in vitro in the absence of the class II-associated invariant chain (Ii) and H-2M (DM). In contrast, epitopes derived from these endogenous compartments are differentially inhibited by coexpression of the class II-associated accessory molecules, Ii and DM. In vivo immunization experiments, using the class II+ tumor cells containing HEL localized to the nucleus, demonstrated that the tumor cells are the predominant APC in vivo for priming naive CD4+ T cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

A/J, BALB/c, C57BL/6, (BALB/c x A/J)F1, and BALB/c nude mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and/or bred and maintained in the University of Maryland animal facility according to National Institutes of Health guidelines for the humane treatment of laboratory animals. All animal procedures have been approved by the University of Maryland Baltimore County Institutional Animal Care and Use Committee.

Cells

Mouse SaI sarcoma, MHC class II I-Ak-transfected (SaI/Ak), and class II transactivator (CIITA)-transduced (SaI/CIITA, Ak+Ii+DM+) cells were maintained as previously described (20). HEL-transfected tumor cells were maintained in the same medium supplemented with 400 µg/ml G418 (Calbiochem, La Jolla, CA) and 1.5 µg/ml puromycin (Clontech, Palo Alto, CA). The following I-Ak-restricted CD4+ T cell hybridomas were used: 3A9 (HEL46–61; Ref. 21), 2B6.3 (HEL25–43; Ref. 22), and 3B11.1 (HEL34–45; Ref. 23). SaI/Ak/erHEL and SaI/CIITA/erHEL cells (SaI/Ak and SaI/CIITA cells transfected with ER-retained HEL) were previously described (20).

Antibodies

Mouse mAbs HyHEL7 and HyHEL10 specific for HEL (24), 10–2.16 specific for the {beta}-chain of I-Ak (25), 2.43 specific for CD8 (26), GK1.5 specific for CD4 (27), rat mAb IN-1 specific for Ii (28), and the rabbit polyclonal Ab K553 specific for DM (29) have been previously described (30, 31). Human anti-fibrillarin mAb (32) was used at 1:600. CD3-FITC (145-2C11), CD4-PE (GK1.5), CD8-PE (53-6.7), and H-2Kk-PE (36-7-5) Abs were purchased from PharMingen (San Diego, CA) and were used at 2 µg/ml/2 x 105 cells. Secondary Abs used for flow cytometry (goat anti-mouse IgG (GAMIgG) FITC, mouse anti-rat FITC, goat anti-rabbit IgG-FITC), and Fab of GAMIgG used for panning were purchased from ICN Pharmaceuticals (Costa Mesa, CA). Secondary Abs (donkey anti-mouse IgG-FITC and donkey anti-human IgG-tetramethylrhodamine isothiocyanate, minimally cross-reactive to other species) used for microscopy were purchased from Jackson ImmunoResearch (West Grove, PA).

Construction of plasmids encoding nuclear, cytoplasmic, or mitochondrial HEL

For the nuclear and cytoplasmic constructs, a 435-bp HEL fragment was generated by PCR from the pHYK plasmid containing ER-targeted HEL (pHYK/erHEL; Ref. 33); 5' primer: GAGGTCTTTGCTAATCTTGGTGC; 3' primer: TGGCAGCCTCTGATCCACGCCTGGA). PCR was performed on a GeneAmp PCR system 2400 (Perkin-Elmer, Foster City, CA) using the following conditions: starting temperature of 95°C x 2 min followed by 30 cycles of 95°C x 30 s, 60°C x 30 s, and 72°C x 30 s. The PCR product was cloned into the pGEM-T vector (Promega, Madison, WI) and, for the nuclear construct (nucHEL), subcloned into the pCMV/nuc/myc vector (Invitrogen, Carlsbad, CA) using the 5' NcoI and 3' NotI sites (462-bp fragments). The pCMV/nuc/myc vector (Fig. 1GoA) contains the 3' nuclear localization signal from SV40 large T Ag (DPKKKRKV) in triplicate. The mitochondrial HEL construct was generated by PCR amplifying the HEL insert from the pHYK/erHEL plasmid including PstI and XhoI restriction sites at the 5' and 3' ends, respectively (5' primer: AACTGCAGAGGTCTTTGCTAATCTTGGTGC, PstI site underlined; 3' primer CCGCTCGAGGCAGCCTCTGATCCACGCCT, XhoI site underlined) using the same conditions as per the nucHEL construct. The 438-bp PCR product was cloned into the pCMV/mito/myc vector (Invitrogen) using the 5' PstI and 3' XhoI sites. The pCMV/mito/myc vector contains a 5' mitochondrial matrix-targeting sequence from human cytochrome c oxidase (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). The cytoplasmic HEL construct was generated by inserting the HEL gene from the pGEM-T vector into the 5' NcoI and 3' NotI sites of the pCMV/cyto/myc vector (Invitrogen). HEL insert and surrounding bases of all constructs were sequenced in both directions to ascertain correct sequence and reading frame.



View larger version (68K):
[in this window]
[in a new window]
  		FIGURE 1. SaI/Ak tumor cells transfected with nuclear-targeted HEL express HEL in their nuclei. A, pCMV/nucHEL/myc construct. B, HEL expression in SaI/Ak/nucHEL clones. SaI, SaI/Ak, SaI/Ak/nucHEL clones 7.4, 16.1, and 16.3 stained by indirect immunofluorescence for plasma membrane I-Ak (a–e) or internal HEL (f–j) (solid lines). Dotted lines denote background staining without primary Ab. C, SaI/Ak/nucHEL cells express HEL in their nuclei. SaI/Ak/nucHEL.16.3 and SaI/Ak/erHEL cells stained for internal HEL (a and d), nuclei stained with DAPI (b and e), and overlay of HEL and DAPI patterns (c and f). D, I-Ak molecules of transfectants are SDS-stable dimers. Boiled (B) or unboiled (NB) cell lysates were electrophoresed on 12% SDS-PAGE gels under reducing conditions, transferred to nitrocellulose, and probed with mAb 10.2–16. "C" and "{beta} " indicate compact I-Ak {alpha}{beta} dimers and free {beta}-chain, respectively. "% C" indicates the percentage of SDS-stable I-Ak dimers relative to the total amount of I-Ak protein as quantitated by densitometry.

 
Transfections

SaI/Ak/nucHEL, SaI/Ak/cytoHEL, SaI/CIITA/mitoHEL, SaI/CIITA/ nucHEL, SaI/CIITA/cytoHEL, and SaI/Ak/mitoHEL stable transfectants were generated by transfecting SaI/Ak or SaI/CIITA cells with the appropriate HEL plasmid plus pPUR containing the puromycin resistance gene (Clontech) using lipofectin (Life Technologies, Gaithersburg, MD) as previously described (31).

Immunofluorescence and flow cytometry

Tumor cells and splenocytes were stained by direct or indirect immunofluorescence either internally (Ii, DM, or HEL) or externally (MHC class I, class II, CD3, CD4, CD8) as previously described (11, 31).

Immunofluorescence microscopy

Cells were harvested, washed once with PBS, and fixed with fresh 3–4% paraformaldehyde (Sigma, St. Louis, MO) for 20 min at room temperature. Fixed cells were then washed twice with PBS supplemented with 5% donkey serum (Jackson ImmunoResearch) and 0.1% saponin (Sigma) or 1% Triton X-100 (Sigma) and distributed into 96-well plates at 5 x 104 cells per well. Cells were stained for HEL expression with 40 µl mAbs HyHEL7 and HyHEL10 at 0.1 µg/ml for 45 min. After staining, cells were washed twice with PBS, and then incubated with donkey anti-mouse IgG-FITC (1:400) for 30 min. Nuclei were stained with 2 µg/ml 4',6'-diamidine-2-phenylindole (DAPI; Sigma) per well for 15 min. Cells were then transferred to a Polyprep microscope slide (Sigma) and 5 µl of Fluoromount-G (Southern Biotechnology Associates, Birmingham, AL) was added; this was then sealed with a coverslip. Microscopy was performed on a Zeiss Axioplan 2 microscope equipped for FITC and DAPI excitation at 490 and 355 nm, respectively, and emission at 510–540 and 420 nm, respectively. Superimposition of FITC- and DAPI-stained samples was performed by overlaying coincident images. For confocal microscopy, mitochondria were visualized by staining with 10 nM MitoTracker Red CMXRos (Molecular Probes, Eugene, OR).

Western blots

Cells were incubated for 40 min on ice in lysis buffer (150 mM NaCl, 20 mM Tris, pH 7.5, 1% Nonidet P-40, 5 mM EDTA, 1 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml aprotinin at 107/ml for tumor cells or 108/ml for splenocytes). Cell extracts were microfuged at 4°C for 30 min to remove nuclei, and clarified lysates were stored at -80°C until used. Frozen lysates were thawed on ice, resuspended in 2x SDS sample buffer (288 mM 2-ME, 4% SDS, 20% glycerol, 125 mM Tris, pH 6.8, and 0.001% bromophenol blue), and boiled (100°C x 5 min) or unboiled samples run on 12% mini-SDS-PAGE gels under reducing conditions (20 V x the first 40 min; 100 V x 2 h). Following electrophoresis, proteins were transferred to Hybond-P membrane (Amersham Pharmacia Biotech, Piscataway, NJ) at 80 mA for 40 min using a Milliblot Electroblotter-SDE system (Millipore, Bedford, MA). The following procedures were performed at room temperature with gentle agitation: membranes were blocked with 2% BSA/TBST (20 mM Tris-Cl, 130 mM NaCl, 0.1% Tween 20, pH 7.5) for 1 h, rinsed twice with double distilled H2O, and probed for 1–1.5 h with mAb 10–2.16 at 1 µg/ml diluted in 0.5% BSA/TBST. Following primary Ab incubation, membranes were washed twice with TBST x 5 min, and sheep anti-mouse IgG-HRP was added (1/10,000 in 0.5% BSA/TBST; Amersham). Bands were developed using ECL detection reagents (Amersham), exposed to X-Omat Blue XB-1 film (NEN Life Science, Boston, MA), and quantified by densitometry using an Alpha ChemiImager (Alpha Innotech, San Leandro, CA).

Ag presentation/priming assays

In vitro APC assays using the T cell hybridomas were performed as previously described (20, 31), and each experiment was repeated at least three times. For presentation of exogenous HEL (Sigma) by SaI/CIITA cells, APC were pulsed with 70 or 300 µM HEL for the 3B11.1 and 2B6.3 hybridomas, respectively. For in vivo Ag priming studies, responder splenocytes were prepared using the following scheme: BALB/c nude (KdAdDd) mice were reconstituted i.p. with 3–3.5 x 107 splenocytes from 5- to 8-wk-old (BALB/c x A/J)F1 (KdAdDd x KkAkDd) mice. Before reconstitution, the F1 splenocytes were depleted of B cells and adherent cells by panning on T flasks coated with GAMIgG as previously described (11). On day 2, the reconstituted mice were injected i.p. with 106 live SaI/Ak/nucHEL cells. On day 10 the reconstituted mice were sacrificed, their spleens removed and depleted of B lymphocytes, and the resulting T cells were used as responder cells in APC assays. Tumor challenge did not affect splenic T cell reconstitution. For some experiments, splenocytes were depleted by panning for CD4+ or CD8+ T cells using GK1.5 or 2.43 mAbs (11) before use in the APC assays. APC assays using splenocytes from reconstituted nude mice were performed as follows: 5 x 105 responder splenocytes were mixed with 5 x 105 presenting cells (splenocytes from A/J, BALB/c, or C57BL/6 mice) in the presence or absence of 1 mg/ml native HEL for 20 h at 37°C. IL-2 release was measured by ELISA using an Endogen IL-2 kit (Cambridge, MA) as previously described (31). SD of triplicate samples was <=10% and is included in the relevant figures.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Endogenously synthesized Ags from the nucleus are presented by MHC class II molecules of tumor cells

To determine whether MHC class II+ tumor cells present peptides derived from endogenously synthesized Ags localized to the nucleus, a cDNA encoding the HEL gene was subcloned into a vector upstream of three copies of the "DPKKKRKV" nuclear targeting sequence (Fig. 1GoA). Tumor cells previously transfected with I-Ak genes and not expressing Ii or DM (SaI/Ak sarcoma cells) were further transfected with the nucHEL plasmid, and transfectants were selected by drug resistance, screened by flow cytometry for expression of HEL, and cloned by limiting dilution.

Fig. 1GoB shows the flow cytometry histograms of three SaI/Ak/nucHEL clones (7.4, 16.1, and 16.3) and control parental SaI/Ak and class II- SaI tumor cells. The three SaI/Ak/nucHEL clones express varying levels of HEL, whereas I-Ak levels on all MHC class II+ clones (SaI/Ak and SaI/Ak/nucHEL clones) are similar. Localization of HEL to the nucleus was ascertained by immunofluorescence microscopy. Fig. 1GoC shows the HEL staining of one SaI/Ak/nucHEL clone (16.3) and, as a comparison, a clone in which HEL is localized to the ER (SaI/Ak/erHEL cells; a and d, respectively). Nuclei are visualized by DAPI staining (b and e, respectively). The HEL and DAPI images for each clone are overlaid in c and f, respectively. As seen in a–c, HEL in the SaI/Ak/nucHEL cells is localized within nuclei, but is not evenly distributed. Because the HEL staining pattern resembles the distribution of nucleoli, the SaI/Ak/nucHEL cells were double stained for HEL and fibrillarin, a nucleolar protein (34). However, the staining patterns for HEL and fibrillarin do not overlap (data not shown), indicating that nucHEL is not restricted to nucleoli. SaI/Ak cells transfected for HEL targeted to nuclei, therefore, express HEL in the nuclei and not in other intracellular compartments.

To ascertain that the MHC class II heterodimers are functional and bind high affinity peptides in the absence of Ii and DM, Western blots were performed. As shown in Fig. 1GoD, SaI/Ak and SaI/Ak/nucHEL transfectants both contain SDS stable dimers (~55- to 60-kDa bands) if the samples are not boiled before electrophoresis. Densitometry quantitation of the bands shows that 45 and 43% of the class II of SaI/Ak and SaI/Ak/nucHEL cells, respectively, are compact dimers, as compared with 73% of control A/J splenocytes. Therefore, transfectants contain properly conformed MHC class II molecules, despite the absence of Ii and DM and in agreement with other studies with I-Ak molecules (35, 36).

In vitro presentation of three independent HEL epitopes by the SaI/Ak/nucHEL transfectants was tested using the 3A9, 2B6.3, and 3B11.1 T cell hybridomas that secrete IL-2 in response to presentation of the HEL 46-61, 25-43, and 34-45 epitopes, respectively, bound to MHC class II I-Ak molecules. As shown in Fig. 2Go, the three SaI/Ak/nucHEL clones present the three HEL epitopes, although the efficiency of presentation varies among the clones. HEL-negative SaI/Ak cells do not present HEL. Therefore, class II+Ii-DM- tumor cells efficiently present multiple MHC class II-restricted peptides derived from endogenously synthesized Ags localized to the nucleus.



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 2. MHC class II+Ii-DM- tumor cells present HEL localized to nuclei. SaI/Ak ({circ}), SaI/Ak/nucHEL 7.4 ({blacksquare}), SaI/Ak/nucHEL 16.1 (•), or SaI/Ak/nucHEL 16.3 ({blacktriangleup}) tumor cells were incubated in Ag presentation assays with I-Ak-restricted, HEL-specific 3A9 hybridoma cells (HEL46–61), 2B6.3 (HEL25–43), or 3B11.1 (HEL34–45). IL-2 release (pg/ml) was measured by ELISA.

 
SaI/Ak/nucHEL cells are APCs for HEL in vivo

To determine whether nuclear localized molecules are directly presented by the MHC class II+ tumor cells in vivo or whether presentation is via cross-priming (37, 38), we modified a nude mouse system originally adapted by (9) for assessing presentation of MHC class I-restricted Ags. The design of these experiments is shown in Fig. 3GoA. BALB/c nude mice were reconstituted on day 1 with 3–3.5 x 107 (BALB/c x A/J)F1 splenocytes that were depleted for B cells and adherent cells. One day later, the chimeric mice were immunized i.p. with 106 live SaI/Ak/nucHEL 16.3 cells. Splenocytes were harvested on day 10, and their restriction pattern was tested using BALB/c, A/J, or negative control C57BL/6 APC ± HEL. Following reconstitution, the chimeric mice have CD4+ T cells that potentially recognize I-Ak and/or I-Ad-restricted Ag, but only have professional APC of the I-Ad genotype (i.e., host-derived cells). Therefore, if professional APC are the principal APC for tumor-derived HEL, then splenocytes of immunized chimeras will be restricted to the host genotype APC (I-Ad). In contrast, if the tumor cells directly present HEL to CD4+ T cells, then the chimeric splenocytes will be predominantly restricted to the genotype of the immunizing tumor cells (I-Ak). If both cell types present Ag, then T cells will respond to both APC genotypes (I-Ad and I-Ak).



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 3. A, Schematic outline of in vivo Ag presentation experiments. On day 1, BALB/c nude mice were reconstituted with B cell-depleted (BALB/c x A/J)F1 splenocytes. Twenty-four hours later, mice were immunized with live SaI/Ak/nucHEL cells. On day 10, mice were sacrificed and their spleens were removed. The resulting splenocytes were depleted of B cells and used as responders in Ag presentation assays with A/J, BALB/c, or C57BL/6 splenocytes as APCs. In some experiments, responding splenocytes were also depleted of CD4+ or CD8+ T cells. B, Reconstituted nude mice contain F1 donor T cells. Splenocytes from donor, recipient, day 2 reconstituted recipient, and day 10 reconstituted/immunized recipients were double stained for CD3 plus CD4 or CD3 plus CD8. Day 10 splenocytes were also stained following CD4 or CD8 T cell depletion. The percentages of each population are indicated within each quadrant.

 
To ascertain that the reconstitution is successful, splenocytes from nude mice were tested for CD4+ and CD8+ T cells on days 2 and 10. As shown in Fig. 3GoB, spleens of unreconstituted mice contain 1.4 and 0.6% CD4+ and CD8+ T cells, respectively, whereas 1 day after reconstitution, splenocytes are 5.8 and 3.3% CD4+ and CD8+ T cells, respectively. On day 10, splenocytes are 8.2 and 5% CD4+ and CD8+ T cells, respectively. Day 2 splenocytes were also tested for donor MHC class I genotype to ascertain that the T cells are of the donor genotype (H-2Kk), and 5–8% of splenocytes are H-2Kk positive. Table IGo shows the results of an Ag presentation assay using day 10 splenocytes as responders and A/J, BALB/c, or irrelevant C57BL/6 naive splenocytes pulsed with HEL as APC. Only A/J APC stimulate HEL-specific IL-2 release, indicating that the tumor cells are the predominant APC for HEL and that nucHEL presentation by the tumor cells is direct and not via cross-priming. It is unlikely that this result reflects a preference for presentation of a high affinity I-Ak peptide (e.g., HEL46–61; Ref. 39) because the assay measures all HEL peptide, including I-Ad high affinity peptides (e.g., HEL11–25; Ref. 40), which could be presented during cross-priming.


View this table:
[in this window]
[in a new window]
  		Table I. SaI/Ak/nucHEL cells are the predominant APC in vivo for priming HEL-specific CD4+ T cells1

 
To identify the responding T cells, day 10 splenocytes were depleted for CD4+ or CD8+ T lymphocytes before performing the Ag presentation assay. As shown in Fig. 3GoB, depleted splenocytes have 0.1 and 0.5% CD4+ or CD8+ T cells, respectively, demonstrating that the depletions have been effective. HEL-specific Ag presentation by the depleted populations is shown in Table IGo. Depletion of CD4+ T cells eliminates 100% of IL-2 production for A/J APC. Depletion of CD8+ T cells modestly reduces IL-2 production, probably due to nonspecific effects of the depletion procedure. Therefore, HEL-specific CD4+ T cells are restricted to the tumor genotype (I-Ak), demonstrating that SaI/Ak/nucHEL tumor cells are the exclusive APC in vivo for activating tumor-specific CD4+ T cells, and that direct presentation is the predominant route of CD4+ T cell activation.

Coexpression of Ii and DM inhibits presentation of HEL25–43 and HEL34–45, but not presentation of HEL46–61 derived from Ag localized to the nucleus

In previous studies we demonstrated that SaI/Ak cells efficiently present ER-retained HEL in vitro to hybridoma cells and in vivo to naive CD4+ T cells (11, 20). However, in the presence of Ii (either SaI/Ak/Ii or SaI/CIITA cells) ER-retained HEL was not presented. DM expression did not affect erHEL presentation (31). To determine whether presentation of nuclear localized Ag is also blocked by Ii, SaI/CIITA cells were further transfected with the nucHEL construct to generate SaI/CIITA/nucHEL cells.

Fig. 4GoA shows the flow cytometry profiles of three SaI/CIITA/nucHEL clones (clones 29, 40, and 53), control SaI/CIITA, and SaI/Ak cells stained for I-Ak, Ii, DM, and HEL. To evaluate the effect of the level of nucHEL on presentation, transfectants expressing similar quantities of I-Ak, Ii, and DM (data not shown), but with different levels of HEL, were selected. Immunofluorescence microscopy showed that HEL staining was restricted to the nucleus in a pattern similar to that seen for SaI/Ak/nucHEL cells (data not shown). Western blot analysis using mAb 10–2.16 revealed that ~80–90% of I-Ak molecules form SDS-stable compact dimers (Fig. 1GoD), demonstrating proper conformation.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 4. SaI/CIITA tumor cells transfected with a nucHEL construct express HEL and present multiple HEL epitopes in vitro. A, SaI/CIITA/nucHEL clones (29, 40, and 53) and SaI/Ak cells were stained by indirect immunofluorescence for plasma membrane I-Ak (a–e), for internal Ii (f–j), for internal DM (H-2M, k–o), or for internal HEL (p–s) (solid lines). Dotted lines denote background staining without primary Ab. B, SaI/CIITA/nucHEL ({blacktriangleup}, •, {blacksquare}) present HEL46–61, but not HEL25–43 or HEL34–45. Functionality of the T cell hybridomas is demonstrated by presentation of exogenous HEL. IL-2 release (pg/ml) was measured by ELISA.

 
In vitro presentation of endogenously synthesized, nuclear-localized HEL was tested using the three T cell hybridomas and the SaI/CIITA/nucHEL transfectants. As shown in Fig. 4GoB, the three SaI/CIITA/nucHEL transfectants present the HEL46–61 epitope, but do not present the HEL25–43 or HEL34–45 epitopes. However, parental SaI/CIITA cells present the HEL25–43 and HEL34–45 epitopes when pulsed with exogenous HEL. Therefore, coexpression of Ii and DM differentially affects presentation of epitopes derived from nuclear-localized molecules.

Class II+ tumor cells present Ags localized to mitochondria

To determine whether MHC class II+ tumor cells present Ag localized to mitochondria, a mitoHEL construct containing the 5' mitochondrial targeting sequence of cytochrome c oxidase was generated (Fig. 5GoA). SaI/Ak and SaI/CIITA cells were transfected with the construct to generate SaI/Ak/mitoHEL and SaI/CIITA/mitoHEL cells, respectively. Fig. 5GoB shows flow cytometry profiles of two SaI/Ak/mitoHEL and two SaI/CIITA/mitoHEL clones stained for HEL. Immunofluorescent confocal microscopy shows colocalization of HEL and mitochondria (data not shown). Clones were chosen for consistent I-Ak, Ii, and DM expression (data not shown) and varied HEL expression.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 5. SaI/Ak/mitoHEL cells present a larger repertoire of epitopes derived from mitochondrial Ag than SaI/CIITA/mitoHEL tumor cells. A, pCMV/mitoHEL/myc construct. B, SaI/Ak/mitoHEL (clones 11 and 23) and SaI/CIITA/mitoHEL (clones 8 and 14) express internal HEL. Cells were stained by indirect immunofluorescence for internal HEL (solid lines). Dotted lines denote background staining without primary Ab. C, SaI/Ak/mitoHEL ({triangleup}, {square}) and SaI/CIITA/mitoHEL ({blacktriangleup}, {blacksquare}) cells present HEL46–61, whereas only SaI/Ak/mitoHEL cells present HEL25–43 and HEL34–45. IL-2 release (pg/ml) was measured by ELISA.

 
MHC class II-restricted Ag presentation of endogenously synthesized Ag localized to mitochondria is shown in Fig. 5GoC. SaI/Ak/mitoHEL clones present all three HEL epitopes, whereas SaI/CIITA/mitoHEL clones only present HEL46–61. Therefore, class II+Ii-DM- tumor cells present peptides derived from molecules localized to mitochondria, and coexpression of Ii and DM differentially affects epitope presentation in a pattern identical with that of nuclear localized Ag.

Class II+ tumor cells present Ag localized to the cytosol

Previous studies by others demonstrated presentation of cytoplasmically localized tumor Ags by MHC class II+ tumor cells (18, 41, 42, 43). These studies examined class II+ tumor cells that coexpress Ii. To determine whether Ii expression is required for presentation of cytoplasmic Ags in tumor cells, SaI/Ak and SaI/CIITA cells were transfected with a plasmid targeting HEL to the cytoplasm (cytoHEL; Fig. 6GoA). Fig. 6GoB shows the flow cytometry profiles of two SaI/Ak/cytoHEL and four SaI/CIITA/cytoHEL clones. Clones were chosen for consistent I-Ak, Ii, and DM expression (data not shown), and variation in HEL expression.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 6. SaI/Ak/cytoHEL cells present a larger repertoire of epitopes derived from cytosolic Ag than SaI/CIITA/cytoHEL tumor cells. A, pCMV/cytoHEL/myc construct. B, SaI/Ak/cytoHEL (clones 3 and 10) and SaI/CIITA/cytoHEL (clones 1, 2, 3, and 13) express internal HEL. Cells were stained by indirect immunofluorescence for internal HEL (solid lines). Dotted lines denote background staining without primary Ab. C, SaI/Ak/cytoHEL clones ({circ}, {square}) and one SaI/CIITA/cytoHEL clone ({blacktriangleup}) present HEL46–61, whereas HEL25–43 and HEL34–45 are presented by SaI/Ak/cytoHEL and not by SaI/CIITA/cytoHEL cells. IL-2 release (pg/ml) was measured by ELISA.

 
Ag presentation of endogenously synthesized, cytoplasmic HEL by SaI/Ak/cytoHEL and SaI/CIITA/cytoHEL cells is shown in Fig. 6GoC. The two SaI/Ak/cytoHEL clones present all three HEL epitopes. In contrast, none of the four SaI/CIITA/cytoHEL clones presents HEL25–43 or HEL34–45, whereas only one SaI/CIITA/cytoHEL clone (no. 1) presents HEL46–61.

Coexpression of Ii differentially inhibits presentation of endogenous Ag from diverse compartments

Table IIGo summarizes the Ag presentation activity and mean channel fluorescence of HEL for the transfectants containing HEL localized to nuclei, mitochondria, cytosol, or ER. Coexpression of Ii completely inhibits presentation of HEL25–43 and HEL34–45. In contrast, presentation of HEL46–61 by SaI/CIITA cells with nuclear or mitochondrial localized Ag is not inhibited by Ii and is comparable to presentation by SaI/Ak cells. However, SaI/CIITA/erHEL cells and three of four SaI/CIITA/cytoHEL clones do not present endogenous HEL. Interestingly, the single SaI/CIITA/cytoHEL clone that presents HEL46–61 (clone no. 1) has a very high level of endogenous HEL.


View this table:
[in this window]
[in a new window]
  		Table II. MHC class II+Ii-DM- tumor cells (Sal/Ak) present a larger repertoire of epitopes derived from nuclear, mitochondrial, cytosolic, and ER Ags than class II+Ii+DM+ tumor cells (Sal/CIITA)

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Renewed enthusiasm for cancer vaccines has focused interest on MHC class II+ tumor cells as potential APC for tumor-encoded, endogenously synthesized Ag. There is compelling evidence demonstrating that MHC class II+ APC present epitopes derived from endogenously synthesized proteins localized to the cytosol (44), and several epitopes derived from cytosol-resident proteins of tumor cells have been reported as tumor Ags (18, 41, 42, 43). In this study, we show that epitopes derived from Ags localized to nuclei and mitochondria are also presented by MHC class II+ tumor cells, and that the tumor cells, rather than host-derived cells, are the principle APC in vivo for priming naive CD4+ T cells to nuclear-derived Ags. These results are in agreement with earlier studies assessing in vivo presentation of ER-retained Ag using bone marrow chimeras (10, 11); however, they are unexpected because presentation of tumor-encoded class I-restricted epitopes is via cross-priming and host-derived APC (12, 13). Combined with our earlier studies with ER-retained and membrane-anchored Ag (11, 20), these results demonstrate that MHC II+ tumor cells play an important role in CD4+ T cell activation and are potential APC for epitopes derived from many subcellular locales.

MHC II-restricted exogenous Ags are principally processed by cathepsin proteases (45), and the resulting epitopes bound to MHC class II molecules in endosomal/lysosomal compartments or MIIC (46). In contrast, it is not clear where endogenous Ag is degraded and loaded onto MHC class II molecules in class II+ tumor cells. If peptides from all subcellular compartments are loaded onto class II molecules in the MIIC, then Ii expression should equally affect presentation of peptides regardless of their source. However, the present data demonstrate that Ii expression differentially affects peptide presentation. The differential effect of Ii is unexpected and suggests that processing and/or loading of Ag occurs in multiple cellular compartments, and possibly not in endosomes. This hypothesis is supported by the observations that 1) SaI/CIITA cells pulsed with exogenous HEL efficiently present HEL25–43 and HEL34–45, whereas SaI/CIITA cells do not present these epitopes when HEL is endogenously encoded (Table IIGo) 2) in the SaI sarcoma system, cathepsin inhibitors such as E64 (47) and the cysteine protease inhibitor leupeptin (48) block presentation of endocytosed HEL, but do not inhibit presentation of endogenously synthesized erHEL (31) or nucHEL (L. Q. and S. O.-R., unpublished results); 3) recent studies by Blum and colleagues (49) demonstrate that presentation of the cytosolic endogenous Ag glutamate decarboxylase by B lymphoblastoid tumor cells requires cytosolic proteases that are not required for presentation of exogenous glutamate decarboxylase; and 4) studies by van der Bruggen and colleagues (50) indicate that dendritic cells pulsed with the MAGE-3 tumor Ag generate DR13-restricted epitopes, whereas MAGE-3+ melanoma cells do not generate these peptides. Therefore, at least some MHC II-restricted endogenous Ags are not processed by endosome-resident proteases, suggesting that some processing occurs in compartments other than the MIIC. The presence of proteases in other cellular compartments, including the cytosol (proteosome, calpains), mitochondria, and nuclei, provides ample alternative locales for Ag degradation (51, 52, 53, 54).

Tumor cells transfected with MHC class II and costimulatory molecule genes were originally designed as tumor vaccines to stimulate tumor-specific CD4+ T cells in tumor-bearing individuals (55) and have been shown in animal models to be effective against established, dispersed metastatic disease (56, 57, 58). Their therapeutic efficacy may be due to several factors. First, class II+ (Ii+ or Ii-) tumor cells may present a novel set of MHC II-restricted tumor epitopes that are not presented by professional APC. If tumor Ags are processed in nonendocytic compartments by proteases other than cathepsins, it is likely that class II+ tumor cells present different epitopes than those presented by professional APC via cross-priming. Therefore, class II+ tumor cells may stimulate a different repertoire of CD4+ T cells than professional APC presenting tumor Ags via cross-priming. Second, as shown in this study, SaI/Ak and SaI/CIITA cells process and present endogenous Ag differently (Table IIGo). Therefore, class II+Ii- tumor cells may present a novel set of tumor Ags and epitopes that are not presented by professional APC due to the absence of Ii expression. The finding that SaI/Ak cells are immunogenic and not tumorigenic, whereas SaI/CIITA cells are highly tumorigenic and not immunogenic (20, 31, 59), supports this hypothesis. Third, the vaccines may present novel tumor epitopes to which the tumor bearer is not tolerant. Because many tumor Ags are self-Ags (18, 60), tumor-bearing individuals may be tolerant or anergized to epitopes derived from these Ags and presented by professional APC. In contrast, if the class II-restricted epitopes presented by the vaccines are novel epitopes, then tumor-bearing individuals may not be tolerant to them or ignore them, and the vaccines may activate previously quiescent tumor-reactive CD4+ T cells.

These studies also have implications for CD4+ T cell activation by wild-type tumor cells. Most human tumors do not express MHC class II molecules, and the direct presentation pathway for activation of CD4+ T cells, therefore, is not available. CD4+ T cell activation for these tumors depends exclusively on indirect presentation via professional APC, and limited CD4+ T cell responses to such tumors may reflect the inefficiency of cross-priming. However, a subset of human tumors constitutively expresses MHC class II molecules (e.g., melanoma and mammary carcinoma). Furthermore, these and other tumor types are frequently induced for class II expression by agents such as IFN-{gamma} (61). Human tumor cells that constitutively express MHC class II or are induced by IFN-{gamma} usually coexpress Ii and DM (V. Clements, L. Qi, and S. Ostrand-Rosenberg, unpublished results). Because these accessory molecules block presentation of some class II-restricted endogenous Ag, wild-type tumor cells may effectively present fewer epitopes than class II+Ii-DM- vaccine cells. Whether class II+ wild-type tumor cells activate CD4+ T cells depends on the availability of costimulatory signals. In the presence of costimulation, either by the tumor cells themselves or by third party APC, CD4+ T cells may be activated. In contrast, if costimulation is not available, then class II+ wild-type tumor may tolerize/anergize potentially tumor-reactive T cells. For some tumors, class II expression correlates with a more favorable prognosis (e.g., larynx and breast carcinomas; Refs. 62, 63), whereas for other tumors MHC class II expression correlates with a more aggressive malignancy (e.g., melanoma; Ref. 64). In the case of mouse SaI sarcoma cells, even if the tumor cells do not constitutively express costimulatory molecules, they are induced to express CD80 and CD86 during the immunization process (65) and can deliver both of the signals necessary for activation of naive CD4+ T cells. It is not clear whether other tumor cells are similarly induced to express costimulatory molecules. If not, then MHC class II-positive, costimulatory signal-negative tumor cells may tolerize, rather than activate, naive CD4+ T cells.

As demonstrated here, class II-transfected tumor cells are effective APC for endogenously synthesized Ags derived from nuclear, mitochondrial, cytosolic, or ER compartments, and class II+Ii-DM- tumor cells present a broader repertoire of endogenous epitopes than class II+Ii+DM+ tumor cells. Therefore, immunotherapy strategies relying on professional class II+Ii+DM+ APC to process and present intact tumor Ags or epitopes identified using professional APC may not include the broadest repertoire of tumor Ag epitopes. In contrast, MHC II+ cell-based vaccines capable of direct presentation of tumor epitopes may induce a wider repertoire of tumor-reactive T cells and thereby stimulate a more efficacious tumor-specific CD4+ T cell response.


   Acknowledgments
 
We thank Drs. H. Pelham, M. Fritzler, and L. Karlsson for providing their pHYK/erHEL plasmid, anti-fibrillarin mAb, and K553 polyclonal Ab, respectively, and Dr. R. Germain for providing Dr. Adorini’s 2B6.3 and 3B11.1 T cell hybridomas. We also appreciate the excellent technical support provided by V. Clements and the immunofluorescence microscopy advice provided by Dr. D. Eisenmann and P. Joshi.


   Footnotes
 
1 These studies were supported by grants from the National Institutes of Health (CA52527) and U.S. Department of Defense (DAMD94-J-4323). Back

2 Current address: Department of Life Sciences, The Nottingham Trent University, Nottingham, NG11 8NS, U.K. Back

3 Address correspondence and reprint requests to Dr. Suzanne Ostrand-Rosenberg, Department of Biological Sciences, University of Maryland, 1000 Hilltop Circle, Baltimore, MD 21250. Back

4 Abbreviations used in this paper: HEL, hen egg lysozyme; Ii, invariant chain; DAPI, 4',6'-diamidine-2-phenylindole; ER, endoplasmic reticulum; MIIC, MHC class II compartments; SaI/Ak, SaI sarcoma cells transfected with I-Ak genes; SaI/CIITA, SaI sarcoma cells transduced with the MHC class II transactivator gene CIITA; nucHEL, HEL targeted to the nuclei; mitoHEL, HEL targeted to mitochondria; cytoHEL, HEL targeted to the cytosol; erHEL, HEL targeted to the ER; DM, H-2M; GAMIgG, goat anti-mouse IgG. Back

Received for publication May 17, 2000. Accepted for publication August 25, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Greenberg, P., M. Cheever, A. Fefer. 1981. Eradication of disseminated murine leukemia by chemoimmunotherapy with cyclophosphamide and adoptively transferred immune syngeneic Lyt-1+2- lymphocytes. J. Exp. Med. 154:952.[Abstract/Free Full Text]
  2. Kern, D., J. Klarnet, M. Jensen, P. Greenberg. 1986. Requirement for recognition of class II molecules and processed tumor antigen for optimal generation of syngeneic tumor-specific class I-restricted CTL. J. Immunol. 136:4303.[Abstract]
  3. Schild, H., B. Kyewski, P. Von Hoegen, V. Schirrmacher. 1987. CD4+ helper cells are required for resistance to a highly metastatic murine tumor. Eur. J. Immunol. 17:1863.[Medline]
  4. Romerdahl, C., M. Kripke. 1988. Role of helper T lymphocytes in rejection of UV-induced murine skin cancers. Cancer Res. 48:2325.[Abstract/Free Full Text]
  5. Ostrand-Rosenberg, S., A. Thakur, V. Clements. 1990. Rejection of mouse sarcoma cells after transfection of MHC class II genes. J. Immunol. 144:4068.[Abstract]
  6. Hung, K., R. Hayashi, A. Lafond-Walker, C. Lowenstein, D. Pardoll, H. Levitsky. 1998. The central role of CD4+ T cells in the antitumor immune response. J. Exp. Med. 188:2357.[Abstract/Free Full Text]
  7. Ossendorp, F., E. Mengede, M. Camps, R. Filius, C. Melief. 1998. Specific T helper cell requirement for optimal induction of cytotoxic T lymphocytes against major histocompatibility complex class II negative tumors. J. Exp. Med. 187:693.[Abstract/Free Full Text]
  8. Chambers, C., J. Allison. 1997. Co-stimulation in T cell responses. Curr. Opin. Immunol. 9:396.[Medline]
  9. Cayeux, S., G. Richter, G. Noffz, B. Dorken, T. Blankenstein. 1997. Influence of gene-modified (IL-7, IL-4, and B7) tumor cell vaccines on tumor antigen presentation. J. Immunol. 158:2834.[Abstract]
  10. Armstrong, T., B. Pulaski, S. Ostrand-Rosenberg. 1998. Tumor antigen presentation: changing the rules. Cancer Immunol. Immunother. 46:70.[Medline]
  11. Armstrong, T., V. Clements, S. Ostrand-Rosenberg. 1998. MHC class II-transfected tumor cells directly present antigen to tumor-specific CD4+ T lymphocytes. J. Immunol. 160:661.[Abstract/Free Full Text]
  12. Huang, A., A. Bruce, D. Pardoll, H. Levitsky. 1996. Does B7-1 expression confer antigen-presenting cell capacity to tumors in vivo?. J. Exp. Med. 183:769.[Abstract/Free Full Text]
  13. Huang, A., P. Golumbek, M. Ahmadzadeh, E. Jaffee, D. Pardoll, H. Levitsky. 1994. Role of bone marrow-derived cells in presenting MHC class I-restricted tumor antigens. Science 264:961.[Abstract/Free Full Text]
  14. Pulaski, B., K. Yeh, N. Shastri, K. Maltby, D. Penney, E. Lord, J. Frelinger. 1996. IL-3 enhances CTL development and class I MHC presentation of exogenous antigen by tumor-infiltrating macrophages. Proc. Natl. Acad. Sci. USA 93:3669.[Abstract/Free Full Text]
  15. Wolfel, T., M. Hauer, J. Schneider, M. Serrano, C. Wolfel, E. Klehmann-Hieb, E. De Plaen, T. Hankeln, K. Meyer zum Buschenfelde, D. Beach. 1995. A p16 INK4a insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 269:1281.[Abstract/Free Full Text]
  16. Robbins, P., M. El-Gamil, Y. Li, Y. Kawakami, D. Loftus, E. Appella, S. Rosenberg. 1996. A mutated {beta}-catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J. Exp. Med. 183:1185.[Abstract/Free Full Text]
  17. Fisk, B., T. Blevins, J. Wharton, C. Ionnides. 1995. Identification of an immunodominant peptide of HER2/enu protooncogene recognized by ovarian tumor-specific cytotoxic T lymphocyte lines. J. Exp. Med. 181:2109.[Abstract/Free Full Text]
  18. Wang, R., S. Rosenberg. 1999. Human tumor antigens for cancer vaccine development. Immunol. Rev. 170:85.[Medline]
  19. Disis, M., J. Gralow, H. Bernhard, S. Hand, W. Rubin, M. Cheever. 1996. Peptide-based, but now whole protein, vaccines elicit immunity to HER-2/neu, an oncogenic self-protein. J. Immunol. 156:3151.[Abstract]
  20. Armstrong, T., V. Clements, B. Martin, J. P.-Y. Ting, S. Ostrand-Rosenberg. 1997. Major histocompatibility complex class II-transfected tumor cells present endogenous antigen and are potent inducers of tumor-specific immunity. Proc. Natl. Acad. Sci. USA 120:123.
  21. Glimcher, L., T. Hamano, R. Asofsky, D. Sachs, M. Pierres, L. Samelson, S. Sharrow, W. Paul. 1983. IA mutant functional antigen-presenting cell lines. J. Immunol. 130:2287.[Abstract]
  22. Adorini, L., J. Moreno, F. Momburg, G. Hammerling, J. Guery, A. Valli, S. Fuchs. 1991. Exogenous peptides compete for the presentation of endogenous antigens to major histocompatibility complex class II-restricted T cells. J. Exp. Med. 174:945.[Abstract/Free Full Text]
  23. Adorini, L., J. Guery, S. Fuchs, V. Ortiz-Navarrete, G. Hammerling, F. Momburg. 1993. Processing of endogenously synthesized hen egg-white lysozyme retained in the endoplasmic reticulum or in secretory form gives rise to a similar but not identical set of epitopes recognized by class II-restricted T cells. J. Immunol. 151:3576.[Abstract]
  24. Smith-Gill, S., T. Lavoie, C. Mainhart. 1984. Antigenic regions defined by monoclonal antibodies correspond to structural domains of avian lysozyme. J. Immunol. 133:384.[Abstract]
  25. Oi, V., P. Jones, J. Goding, L. Herzenberg, L. Herzenberg. 1978. Properties of monoclonal antibodies to mouse Ig allotypes, H-2, and Ia antigens. Curr. Top. Microbiol. Immunol. 81:115.[Medline]
  26. Sarmiento, M., A. Glasebrook, F. Fitch. 1980. IgG or IgM monoclonal antibodies reactive with different determinants on the molecular complex bearing Lyt2 antigen block T cell mediated cytolysis in the absence of complement. J. Immunol. 125:2665.[Abstract]
  27. Wilde, D., P. Marrack, J. Kappler, D. Dialynis, F. Fitch. 1983. Evidence implicating L3T4 in class II MHC antigen reactivity: monoclonal antibody GK1.5 blocks class II MHC antigen-specific proliferation, release of lymphokines, and binding by cloned murine helper T lymphocyte lines. J. Immunol. 131:2178.[Abstract]
  28. Koch, N., S. Koch, G. Hammerling. 1982. Ia invariant chain detected on lymphocyte surfaces by monoclonal antibody. Nature 299:644.[Medline]
  29. Karlsson, L., A. Peleraux, R. Lindstedt, M. Liljedahl, P. A. Peterson. 1994. Reconstitution of an operational MHC class II compartment in nonantigen-presenting cells. Science 266:1569.[Abstract/Free Full Text]
  30. Ostrand-Rosenberg, S., V. Clements, L. Marr. 1986. 402AX teratocarcinoma MHC class I antigen expression is regulated in vivo by Lyt1, Lyt2, and L3T4 expressing splenic T cells. Cell. Immunol. 98:257.[Medline]
  31. Qi, L., S. Ostrand-Rosenberg. 2000. MHC class II-restricted ER-localized endogenous antigen traffics via the endocytic pathway and is unaffected by H-2M expression in cell-based cancer vaccines. Traffic 1:152.[Medline]
  32. Arnett, F., J. Reveille, R. Goldstein, K. Pollard, K. Leaird, E. Smith, E. Leroy, M. Fritzler. 1996. Autoantibodies to fibrillarin in systemic sclerosis (scleroderma). An immunogenetic, serologic, and clinical analysis. Arthritis Rheum. 39:1151.[Medline]
  33. Munro, S., H. Pelham. 1987. A C-terminal signal prevents secretion of luminal ER proteins. Cell 48:899.[Medline]
  34. Turley, S., E. Tan, K. Pollard. 1993. Molecular cloning and sequence analysis of U3 snoRNA-associated mouse fibrillarin. Biochim. Biophys. Acta 1216:119.[Medline]
  35. Bikoff, E., R. Germain, E. Robertson. 1995. Allelic differences affecting invariant chain dependence of MHC class II subunit assembly. Immunity 2:301.[Medline]
  36. Stebbins, C., G. J. Loss, C. Elias, A. Chervonsky, A. Sant. 1995. The requirement for DM in class II-restricted antigen presentation and SDS-stable dimer formation is allele and species dependent. J. Exp. Med. 181:223.[Abstract/Free Full Text]
  37. Bevan, M.. 1976. Cross-priming for a secondary cytotoxic response to minor H antigens with H-2 congenic cells which do not cross-react in the cytotoxic assay. J. Exp. Med. 143:1283.[Abstract/Free Full Text]
  38. Bevan, M.. 1976. Minor H antigens introduced on H-2 different stimulating cells cross-react at the cytotoxic T cell level during in vivo priming. J. Immunol. 117:2233.[Abstract/Free Full Text]
  39. Nelson, C., S. Petzold, E. Unanue. 1994. Peptides determine the lifespan of MHC class II molecules in the antigen-presenting cell. Nature 371:250.[Medline]
  40. Adams, S., R. Humphreys. 1995. Invariant chain peptides enhancing or inhibiting the presentation of antigenic peptides by major histocompatibility complex class II molecules. Eur. J. Immunol. 25:1693.[Medline]
  41. Zarour, H., J. Kirkwood, L. Kierstead, W. Herr, V. Brusic, C. Slingluff, J. Sidney, A. Sette, W. Storkus. 2000. Melan-A/MART-1(51-73) represents an immunogenic HLA-DR4-restricted epitope recognized by melanoma-reactive CD4+ T cells. Proc. Natl. Acad. Sci. USA 97:400.[Abstract/Free Full Text]
  42. Jager, E., D. Jager, J. Karbach, Y. Chen, G. Ritter, Y. Nagata, S. Gnjatic, E. Stockert, M. Arand, L. Old, A. Knuth. 2000. Identification of NY-ESO-1 epitopes presented by human histocompatibility antigen (HLA)-DRB4*0101-0103 and recognized by CD4+ T lymphocytes of patients with NY-ESO-1-expressing melanoma. J. Exp. Med. 191:625.[Abstract/Free Full Text]
  43. Touloukian, C., W. Leitner, S. Topalian, F. Yong, P. Robbins, S. Rosenberg, N. Restifo. 2000. Identification of a MHC class II-restricted human gp100 epitope using DR4-IE transgenic mice. J. Immunol. 164:3535.[Abstract/Free Full Text]
  44. Sant, A.. 1994. Endogenous antigen presentation by MHC class II molecules. Immunol. Res. 13:253.[Medline]
  45. Villadangos, J., H. Ploegh. 2000. Proteolysis in MHC class II antigen presentation: who’s in charge?. Immunity 12:233.[Medline]
  46. Busch, R., R. Doebele, N. Patil, A. Pashine, E. Mellins. 2000. Accessory molecules for MHC class II peptide loading. Curr. Opin. Immunol. 12:99.[Medline]
  47. Barrett, A., A. Kembhaui, M. Brown, H. Kirschke, C. Knight, M. Tamai, K. Hanada. 1982. L-trans-epoxysuccinyl-leucylamide (4-guianidino) butane (E-64) and its analogies as inhibitors of cysteine proteinases including cathepsins B, H and L. Biochem. J. 201:189.[Medline]
  48. Rock, K., C. Gramm, L. Rothstein, K. Clark, R. Stein, L. Dick, D. Hwang, A. Goldberg. 1994. Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78:761.[Medline]
  49. Lich, J., J. Elliott, J. Blum. 2000. Cytoplasmic processing is a prerequisite for presentation of an endogenous antigen by MHC class II proteins. J. Exp. Med. 191:1513.[Abstract/Free Full Text]
  50. Chaux, P., V. Vantomme, V. Stroobant, K. Thielemans, J. Corthals, R. Luiten, A. Eggermont, T. Boon, P. Van der Bruggen. 1999. Identification of MAGE-3 epitopes presented by HLA-DR molecules to CD4+ T lymphocytes. J. Exp. Med. 189:767.[Abstract/Free Full Text]
  51. Salvat, C., C. Aquaviva, I. Jariel-Encontre, P. Ferrara, M. Pariat, A. Steff, S. Carillo, M. Piechaczyk. 1999. Are there multiple proteolytic pathways contributing to c-Fos, c-Jun and p53 protein degradation in vivo?. Mol. Biol. Rep. 26:45.[Medline]
  52. Wagner, I., H. Arlt, L. van Dyck, T. Langer, W. Neupert. 1994. Molecular chaperones cooperate with PIM1 protease in the degradation of misfolded proteins in mitochondria. EMBO J. 13:5135.[Medline]
  53. Pariat, M., S. Carillo, M. Molinari, C. Salvat, L. Debussche, L. Bracco, J. Milner, M. Piechaczyk. 1997. Proteolysis by calpains: a possible contribution to degradation of p53. Mol. Cell. Biol. 17:2806.[Abstract]
  54. Rivett, A.. 1998. Intracellular distribution of proteasomes. Curr. Opin. Immunol. 10:110.[Medline]
  55. Baskar, S., S. Ostrand-Rosenberg, N. Nabavi, L. M. Nadler, G. J. Freeman, L. H. Glimcher. 1993. Constitutive expression of B7 restores immunogenicity of tumor cells expressing truncated major histocompatibility complex class II molecules. Proc. Natl. Acad. Sci. USA 90:5687.[Abstract/Free Full Text]
  56. Pulaski, B., D. Terman, S. Khan, E. Muller, S. Ostrand-Rosenberg. 2000. Cooperativity of SEB superantigen, MHC class II, and CD80 in immunotherapy of advanced metastases in a clinically relevant post-operative breast cancer model. Cancer Res. 60:2710.[Abstract/Free Full Text]
  57. Pulaski, B., V. Clements, M. Pipeling, S. Ostrand-Rosenberg. 2000. Immunotherapy with vaccines combining MHC class II/CD80+ tumor cells with IL-12 reduces established metastatic disease and stimulates immune effectors and monokine-induced by interferon-{gamma}. Cancer Immunol. Immunother. 49:34.[Medline]
  58. Pulaski, B., S. Ostrand-Rosenberg. 1998. MHC class II and B7.1 immunotherapeutic cell-based vaccine reduces spontaneous mammary carcinoma metastases without affecting primary tumor growth. Cancer Res. 58:1486.[Abstract/Free Full Text]
  59. Clements, V. K., T. Armstrong, S. Baskar, S. Ostrand-Rosenberg. 1992. Invariant chain alters the malignant phenotype of MHC class II+ tumor cells. J. Immunol. 149:2391.[Abstract]
  60. Van den Eynde, B., P. van der Bruggen. 1997. T cell-defined tumor antigens. Curr. Opin. Immunol. 9:684.[Medline]
  61. Garrido, F., T. Cabrera, A. Concha, S. Glew, F. Ruiz-Cabello, P. Stern. 1993. Natural history of HLA expression during tumour development. Immunol. Today 14:491.[Medline]
  62. Concha, A., F. Esteban, T. Cabrera, F. Ruiz-Cabello, F. Garrido. 1991. Tumor aggressiveness and MHC class I and II antigens in laryngeal and breast cancer. Semin. Cancer Biol. 2:47.[Medline]
  63. Brunner, C., J. Gokel, G. Riethmuller, J. Johnson. 1991. Expression of HLA-D subloci DR and DQ by breast carcinomas is correlated with distinct parameters of favourable prognois. Eur. J. Cancer 27:411.
  64. Lopez-Nevot, M., E. Garcia, C. Romero, M. Oliva, S. Serrano, F. Garrido. 1988. Phenotypic and genetic analysis of HLA class I and HLA-DR antigen expression on human melanomas. Exp. Clin. Immunogenet. 5:203.[Medline]
  65. Baskar, S., V. Clements, L. Glimcher, N. Nabavi, S. Ostrand-Rosenberg. 1996. Rejection of MHC class II-transfected tumor cells requires induction of tumor-encoded B7-1 and/or B7-2 costimulatory molecules. J. Immunol. 156:3821.[Abstract]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
Y. Su, G. Carey, M. Maric, and D. W. Scott
B Cells Induce Tolerance by Presenting Endogenous Peptide-IgG on MHC Class II Molecules via an IFN-{gamma}-Inducible Lysosomal Thiol Reductase-Dependent Pathway
J. Immunol., July 15, 2008; 181(2): 1153 - 1160.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. J. Bosch, J. A. Thompson, M. K. Srivastava, U. K. Iheagwara, T. G. Murray, M. Lotem, B. R. Ksander, and S. Ostrand-Rosenberg
MHC Class II-Transduced Tumor Cells Originating in the Immune-Privileged Eye Prime and Boost CD4+ T Lymphocytes that Cross-react with Primary and Metastatic Uveal Melanoma Cells
Cancer Res., May 1, 2007; 67(9): 4499 - 4506.
[Abstract] [Full Text] [PDF]

Home page
 J. Gen. Virol.Home page
C. Sinzger, K. Eberhardt, Y. Cavignac, C. Weinstock, T. Kessler, G. Jahn, and J.-L. Davignon
Macrophage cultures are susceptible to lytic productive infection by endothelial-cell-propagated human cytomegalovirus strains and present viral IE1 protein to CD4+ T cells despite late downregulation of MHC class II molecules
J. Gen. Virol., July 1, 2006; 87(7): 1853 - 1862.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
L. Mortara, P. Castellani, R. Meazza, G. Tosi, A. De Lerma Barbaro, F. A. Procopio, A. Comes, L. Zardi, S. Ferrini, and R. S. Accolla
CIITA-Induced MHC Class II Expression in Mammary Adenocarcinoma Leads to a Th1 Polarization of the Tumor Microenvironment, Tumor Rejection, and Specific Antitumor Memory.
Clin. Cancer Res., June 1, 2006; 12(11): 3435 - 3443.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. P. Dolan, K. D. Gibbs Jr., and S. Ostrand-Rosenberg
Tumor-Specific CD4+ T Cells Are Activated by "Cross-Dressed" Dendritic Cells Presenting Peptide-MHC Class II Complexes Acquired from Cell-Based Cancer Vaccines
J. Immunol., February 1, 2006; 176(3): 1447 - 1455.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. A. Thompson, S. K. Dissanayake, B. R. Ksander, K. L. Knutson, M. L. Disis, and S. Ostrand-Rosenberg
Tumor Cells Transduced with the MHC Class II Transactivator and CD80 Activate Tumor-Specific CD4+ T Cells Whether or Not They Are Silenced for Invariant Chain
Cancer Res., January 15, 2006; 66(2): 1147 - 1154.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. K. Dissanayake, N. Tuera, and S. Ostrand-Rosenberg
Presentation of Endogenously Synthesized MHC Class II-Restricted Epitopes by MHC Class II Cancer Vaccines Is Independent of Transporter Associated with Ag Processing and the Proteasome
J. Immunol., February 15, 2005; 174(4): 1811 - 1819.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. E. D. Chamuleau, Y. Souwer, S. M. van Ham, A. Zevenbergen, T. M. Westers, J. Berkhof, C. J. L. M. Meijer, A. A. van de Loosdrecht, and G. J. Ossenkoppele
Class II-Associated Invariant Chain Peptide Expression on Myeloid Leukemic Blasts Predicts Poor Clinical Outcome
Cancer Res., August 15, 2004; 64(16): 5546 - 5550.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Muntasell, M. Carrascal, I. Alvarez, L. Serradell, P. van Veelen, F. A. W. Verreck, F. Koning, J. Abian, and D. Jaraquemada
Dissection of the HLA-DR4 Peptide Repertoire in Endocrine Epithelial Cells: Strong Influence of Invariant Chain and HLA-DM Expression on the Nature of Ligands
J. Immunol., July 15, 2004; 173(2): 1085 - 1093.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. K. Dissanayake, J. A. Thompson, J. J. Bosch, V. K. Clements, P. W. Chen, B. R. Ksander, and S. Ostrand-Rosenberg
Activation of Tumor-specific CD4+ T Lymphocytes by Major Histocompatibility Complex Class II Tumor Cell Vaccines: A Novel Cell-based Immunotherapy
Cancer Res., March 1, 2004; 64(5): 1867 - 1874.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. P. Dolan, T. P. Phelan, D. Ilkovitch, L. Qi, W. F. Wade, T. M. Laufer, and S. Ostrand-Rosenberg
Invariant Chain and the MHC Class II Cytoplasmic Domains Regulate Localization of MHC Class II Molecules to Lipid Rafts in Tumor Cell-Based Vaccines
J. Immunol., January 15, 2004; 172(2): 907 - 914.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. Becart, N. Setterblad, S. Ostrand-Rosenberg, S. J. Ono, D. Charron, and N. Mooney
Intracytoplasmic domains of MHC class II molecules are essential for lipid-raft-dependent signaling
J. Cell Sci., June 15, 2003; 116(12): 2565 - 2575.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. Le Roy, M. Baron, W. Faigle, D. Clement, D. M. Lewinsohn, D. N. Streblow, J. A. Nelson, S. Amigorena, and J.-L. Davignon
Infection of APC by Human Cytomegalovirus Controlled Through Recognition of Endogenous Nuclear Immediate Early Protein 1 by Specific CD4+ T Lymphocytes
J. Immunol., August 1, 2002; 169(3): 1293 - 1301.
[Abstract] [Full Text] [PDF]

Home page
 CVIHome page
H. Pilch, H. Hohn, C. Neukirch, K. Freitag, P. G. Knapstein, B. Tanner, and M. J. Maeurer
Antigen-Driven T-Cell Selection in Patients with Cervical Cancer as Evidenced by T-Cell Receptor Analysis and Recognition of Autologous Tumor
Clin. Vaccine Immunol., March 1, 2002; 9(2): 267 - 278.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Qi and S. Ostrand-Rosenberg
H2-O Inhibits Presentation of Bacterial Superantigens, but Not Endogenous Self Antigens
J. Immunol., August 1, 2001; 167(3): 1371 - 1378.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qi, L.
Right arrow Articles by Ostrand-Rosenberg, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qi, L.
Right arrow Articles by Ostrand-Rosenberg, S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS