| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Immunology, Mayo Clinic and Mayo Graduate School, Rochester, MN 55905
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The design of simpler and more accessible therapeutic vaccines has been facilitated by the discovery and characterization of several tumor-associated Ags (TAA) that are found in various tumor types, such as melanoma and breast, prostate, and gastrointestinal malignancies (7, 8). These TAA represent cellular products (mostly proteins) that are preferentially expressed by tumor cells, although in many cases they are also found to some extent (but usually in lower amounts) in normal tissues. Studies from several groups have shown that small peptide fragments of 8–10 residues derived from some TAA can be recognized by patient-derived CTL (9). These peptides associate with products of MHC genes and are presented as complexes on the surface of tumor cells, which trigger the effector function of CTL, resulting in tumor cell lysis. In addition, we have shown that synthetic peptides that are selected from sequences of TAA and can bind to MHC molecules are able to elicit in vitro anti-tumor CTL responses by stimulating naive CTL precursors with peptide-pulsed APC (10, 11, 12). As a result of the above studies, several peptide epitopes for tumors, such as breast, colon, and melanoma have been identified that will elicit HLA-A2-, -A3-, -A24-, or -A1-restricted CTL with demonstrable anti-tumor activity (7, 10, 11, 12, 13). The identification of these CTL epitopes makes it possible to design and develop peptide-based therapeutic vaccines for the treatment of cancers expressing the relevant TAA.
The implementation of peptide-based vaccines to stimulate anti-tumor CTL responses in vivo becomes an attractive alternative to the use of live cell vaccines for the treatment of cancer. However, vaccination with proteins or synthetic peptides representing discrete CTL epitopes in most instances fails to induce sufficiently strong CTL responses, offering minimal therapeutic benefit against tumors expressing the relevant TAA. Moreover, in some circumstances peptide vaccination has shown to inhibit T cell responses, possibly by deleting or tolerizing the peptide-reactive T cells (14). The most likely explanation for these unsatisfactory results with peptide vaccination is that the immunizing peptides are not delivered to activated professional APC such as DC and when these epitopes are presented to CTL by cells that lack costimulatory activity, a state of tolerance or anergy is induced. Furthermore, it has been suggested and substantiated that the appropriate inflammatory and/or other danger signals are necessary to activate DC to stimulate naive CTL to attain their effector function (15, 16). Among the various types of danger signals to which the immune system responds are bacterial and viral products, such as toxins, LPS, and DNA, particularly those DNA sequences containing abundant cytosine guanine motifs (17, 18).
With the purpose of developing peptide-based vaccines for the therapy of cancer, we have initiated studies aimed at eliciting strong CTL responses effective against tumors. Herein, we report that repeated daily administration of synthetic oligonucleotides (ODN) containing cytosine-phosphorothiolated guanine (CpG) motifs significantly enhanced CTL responses to poorly immunogenic peptides representing CTL epitopes even in the absence of additional adjuvants. Surprisingly, CpG therapy was also effective in inducing strong CTL activity to soluble protein, resulting in significant prophylactic and therapeutic anti-tumor responses. The enhancement of CTL responses by CpG appears to be mediated by a large increase in the numbers of DC and CTL precursors in peripheral lymphoid organs and to depend, to some extent, on the presence of Th lymphocytes (HTL). These results should facilitate the utilization of well-characterized peptide- or protein-based vaccines for the therapy of cancer.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to 8-wk-old female C57BL/6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME) or Charles River Laboratories (Wilmington, MA). The OT-I TCR transgenic mice (19), developed by Dr. F. Carbone (Monash Medical School, Victoria, Australia) were obtained from Dr. M. Mescher (University of Minnesota, Minneapolis, MN). These mice are in the C57BL/6 background (H-2b) and express a transgenic TCR that reacts with the SIINFEKL peptide (positions 257–264 of OVA) in the context of MHC class I, H-2Kb. MHC class II knockout mice (CIIKO) in the C57BL/10 background (H-2b) were provided by Dr. C. David (Mayo Clinic, Rochester, MN).
Immunogens, synthetic peptides, and ODN
OVA protein (grade VI, 99% pure, purified by agarose electrophoresis) and IFA were purchased from Sigma (St. Louis, MO). The OVA-derived peptide SIINFEKL (OVA257–264), the SV40-IV CTL epitope (VVYDFLKC), and the HTL epitope Pan DR Epitope or PADRE (AK(cyclohexyl-alanine)VAAWTLKAAA) (20) were prepared by standard solid phase methods using an Applied Biosystems synthesizer (Foster City, CA) and were purified by HPLC as previously described (12). The purity (>95%) and identity of peptides were confirmed by mass spectrometry analysis. The previously described immunostimulatory synthetic ODN, 1826, containing two CpG motifs (underlined: TCCATGACGTTCCTGACGTT) was used throughout this work (21). CpG-1826 was synthesized with a nuclease-resistant phosphorothiolated backbone by the Mayo Molecular Core Facility. Synthetic ODNs were dried under vacuum, then resuspended in PBS (pH 7.0) and stored for no more than 2 wk at 4°C.
Cell lines
The B16 melanoma, the EL-4 thymoma (H-2b), and the EL-4 derivative, the OVA-expressing EG.7 cell line (22), were obtained from American Type Culture Collection (Manassas, VA). The SV40 T Ag-expressing cell lines, C57SV and 1803.1, both derived from C57BL/6 mice (23, 24), were provided by Dr. B. Knowles (The Jackson Laboratory). The OVA-transfected B16 melanoma cell line (B16-OVA) was obtained from Dr. E. Lord (University of Rochester Medical Center, Rochester, NY). All these cell lines were maintained in tissue culture in DMEM or RPMI containing 10% FBS, L-glutamine, and antibiotics.
Immunizations and CpG therapy
All experiments were routinely performed in groups of three to five mice each. Mice received nine daily injections of 100 µg of CpG-1826 (9X-CpG) in PBS or PBS alone, administered s.c. at the nape of the neck. On day 5 mice were vaccinated s.c. at a different, but proximal, site in the nape of the neck with 50 µg of CTL peptide (SV40-IV or SIINFEKL) or with soluble OVA protein, mixed with 140 µg of PADRE peptide and, unless otherwise stated, emulsified in IFA in a total volume of 100 µl.
CTL assays
Spleens and/or lymph nodes were removed 10–14 days after vaccination, and single-cell suspensions were produced by teasing the organs through a sterile nylon mesh. Cells were pooled from each group of mice. Splenocytes were restimulated with Ag in tissue culture as follows. Spleen cells (5 x 106) from SIINFEKL- or OVA-immunized mice were coincubated with 5 x 105 irradiated (15,000 rad) EG.7 cells in 1.0 ml of IMDM containing 10% FBS (complete IMDM) in 24-well flat-bottom plates. For mice immunized with SV40-IV peptide, the same number of spleen cells were coincubated with 5 x 105 irradiated C57SV cells. Approximately 10–15 wells (each containing 1.0 ml) were prepared for each experimental group. Cell cultures were maintained for 7 days in a humidified 7% CO2 incubator at 37°C. On day 2, the cultures were fed with fresh medium containing 25 IU/ml of human rIL-2. T cell cultures were fed with fresh medium containing IL-2. Lymph node cells were placed in tissue culture at 5 x 106 cells/ml in complete IMDM containing IL-2 for 4 days without the addition of Ag. The cytotoxic activity of the cells was usually determined by a 4-h 51Cr release assay as described previously (12) unless otherwise stated. Peptide-pulsed target cells were prepared by incubating EL-4 cells with 10 µg/ml peptide in tissue culture for 12–16 h. Approximately 1–2 x 106 target cells (EL-4, EG.7, 1803.1) were labeled with 200 µCi of Na51Cr (Amersham Pharmacia Biotech, Piscataway, NJ) for 90 min at 37°C. Cells were washed extensively and mixed with various numbers of effectors in 96-well round-bottom plates. The radioactivity in the supernatant was determined in a Topcount scintillation counter (Packard Instruments, Meriden, CT), and the percent specific lysis was defined by the formula: [(experimental 51Cr release - spontaneous 51Cr release)/(maximum 51Cr release - spontaneous 51Cr release)] x 100, where spontaneous release is the radioactivity of target cells in the absence of effectors (background), and maximum release is the radioactivity released by the targets incubated in 0.1% Triton X-100. All experimental determinations were performed in triplicate and the averages and SDs were consistently <15% of the mean. For some experiments the results are expressed as lytic units-30 (LU30) per 1 x 106 effector cells or per spleen (taking into account the total number of splenocytes). Each LU30 represents the number of effector cells required to produce 30% specific lysis of 1 x 104 target cells. For these determinations, the lysis of targets not expressing the CTL epitope (EL-4 minus peptide) was subtracted from the lysis obtained in the presence of Ag. In practical terms, 1 LU30 represents 30% specific lysis at an E:T cell ratio of 100:1; 10 LU30 = 30% lysis at an E:T cell ratio of 10:1, and 100 LU30 = 30% specific lysis at an E:T cell ratio of 1:1, etc. CTL precursor frequencies were determined by limiting dilution, by stimulating the splenocytes with C57SV cells and autologous irradiated spleen cells for 7 days with 25 IU/ml of rIL-2. Cultures were considered positive for CTL activity when the percent specific lysis of targets pulsed with peptide was at least 20% compared with the lysis obtained with the same targets in the absence of peptide.
Cytofluorometric analyses
Numbers of T cells and DC in lymphoid organs were determined by cytofluorography using fluoresceinated mAbs specific for these cell populations. For the analysis of cell surface expression, 1 x 106 cells were stained with mAb for 45 min at 4°C in 50 µl of PBS containing 0.1% sodium azide and 2% FCS. Cells were then washed and analyzed for CD8, CD3, CD4, CD11c, CD25, CD69, and CD44 expression on a Becton Dickinson FACScan (San Jose, CA). The mAbs used were purchased from PharMingen (San Diego, CA). The DEC-205 murine cell line produces an mAb reactive with mouse dendritic cell Ags (25) and purified from the supernatant of the DEC-205 hybridoma cell line (HB-290, American Type Culture Collection, Manassas, VA).
Evaluation of anti-tumor effects in vaccinated mice
The effect of protein vaccination (with and without 9X-CpG) on tumor growth and survival was evaluated in both prophylactic and therapeutic modes. For prophylaxis, groups of five mice were immunized with OVA protein (or vehicle/PADRE peptide alone) with or without 9X-CpG regimen as described above. Seven days later mice were challenged s.c. with 5 x 104 live B16-OVA cells in the rear leg flank. Mice were observed daily or every other day, and when tumors became evident, their perpendicular diameters were measured using a set of calipers. Although most tumor-bearing mice died on their own, some animals were euthanized when tumors became ulcerated or surpassed 600 mm2. Significance analysis for the prevention and therapeutic use of 9X-CpG in tumor growth results was performed using log-rank tests (26).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For our initial experiments, we selected a well-characterized
H-2Kb-restricted CTL epitope derived from the
SV40 T Ag, peptide SV40-IV (VVYDFLKC) (27). Normal C57BL/6
mice received a single injection of 50 µg of peptide SV40-IV mixed
with 140 µg of HTL epitope peptide, PADRE (20)
emulsified in IFA. This vaccine was administered s.c. either with or
without 100 µg of CpG-1826. The data presented in Fig. 1
demonstrate that a single injection of
peptide in the presence of CpG-1826 increased severalfold the CTL
response to peptide immunization. Similar results were obtained when
this peptide was administered without IFA, although the levels of
cytotoxicity were 10–20% lower than those observed with IFA (data not
shown).
|
show that repeated administration of
CpG was capable of further enhancing CTL responses, as measured by
lytic units (LU), to both peptide-sensitized targets (EL4 plus SV-40IV)
and 1803.1 cells, which express the SV40 T Ag. These results were
substantial when comparing the values of LU that were calculated per
spleen in each animal (shown in parentheses).
|
demonstrate that only those mice receiving the peptide vaccine in
combination with 9X-CpG produced significant CTL responses to the
SIINFEKL epitope.
|
Throughout these experiments, we observed that the spleens
from 9X-CpG mice that were removed 6 or 7 days after the last CpG
administration were 
3–4 times larger than spleens derived from
normal animals (or from mice that received a single CpG injection).
When we proceeded to quantify the total number of splenocytes in mice
that received one to nine daily s.c. injections of CpG, the results
showed a continuous increment of cells, which reached a 5-fold increase
in cell numbers with nine doses of CpG, reaching up to 3.7 x
108 cells/spleen by day 9, whereas control mice
receiving saline injections had 7 x 107
cells/spleen (data not shown). The dramatic increase in lymphoid cells
was also observed in most other lymphoid organs, especially those
draining near the injection sites, such as the axillary lymph nodes
(not shown). The numbers of DC, measured by cells expressing both the
DEC-205 and CD11c markers, in the spleens of mice that received 9 X-CpG
were 30-fold higher than those in mice injected with PBS (41
million/spleen in 9X-CpG vs 1.2 million/spleen in 9X-PBS). Similarly,
the total number of CD3+ T cells obtained from
spleens of mice treated with 9X-CpG was significantly higher than that
in animals that did not received this treatment (71 million/spleen in
9X-CpG vs 13 million/spleen in nontreated mice).
The large increase in DC numbers in spleens of CpG-treated mice could
result in the capacity of these APC to prime CTL in vitro during Ag
restimulation step of the T cell cultures. If this were the case, the
in vitro CTL priming could explain to some extent the magnitude of the
responses presented in Figs. 1
and 2 and Table I. However, this
possibility seems unlikely, because CTL responses to the SIINFEKL
peptide from OVA were not observed in spleen cell cultures derived from
mice that received 9X-CpG and were vaccinated with the PADRE HTL
peptide in IFA (without the CTL peptide), although these cultures were
restimulated with irradiated EG.7 cells, which express OVA (data not
shown). Nevertheless, to establish whether peptide vaccination combined
with 9X-CpG or a single injection of CpG-1826 results in the in vivo
expansion of CTL, precursor frequency analyses were performed. The
results presented in Table II indicate
that a single injection of CpG-1826 increased the number of CTL
precursors to this CTL epitope 5- to 15-fold (per spleen) compared with
that in mice that did not receive CpG. Furthermore, the effect of
9X-CpG was strikingly greater, because it increased 42–270 times the
number of CTL precursors (per mouse). These results indicate that the
potentiating effect of CpG requires the presence of Ag in vivo, and as
a result of CpG administration, Ag-specific CTL expand more effectively
in vivo than in mice receiving Ag alone.
|
2 TCR (present on the OT-1 T cells) were
studied for their increase in the expression of several activation
markers (CD44, CD25, and CD69) by cytofluorometric analysis. The
results presented in Table III indicate
that the percentage of OVA-specific CTL (as determined by
V2+ T cells) in lymph nodes of OT-1 mice did
not vary significantly in response to 9X-CpG or peptide vaccination.
However, when taking into account the overall increase in lymph node
size (and cell numbers), the mice that received 9X-CpG had 3 times
more V2+ T cells than the untreated mice.
Analyses of T cell activation molecules (CD44, CD25, and CD69) revealed
that the expression of these markers was increased only in
V2+ T cells from mice vaccinated with peptide
plus 9X-CpG therapy and not in the mice that received the 9X-CpG
treatment alone or the control untreated mice.
|
demonstrate that the CTL derived from
the peptide-immunized OT-1 mice had significant cytolytic activity
against peptide-pulsed EL4 cells and OVA-expressing EG.7 target cells.
On the other hand, considerably less activity was observed in the CTL
from the mice that did not receive peptide immunization. Taken
together, these results suggest that although repeated CpG
administration induces an overall expansion of T cells, Ag is required
to fully activate these cells into mature effector CTL.
|
Because HTL are believed to play an important role in CTL
responses mainly by producing growth factors for CTL (IL-2) and by
conditioning DC for presentation of Ag to CTL precursors, we routinely
include in our vaccination protocols a peptide that induces strong HTL
responses. To directly examine the role of HTL in the CTL responses
enhanced by 9X-CpG therapy, we performed experiments in CIIKO mice,
which lack CD4+ HTL. The results presented in
Fig. 4 show that, as in past experiments,
9X-CpG treatment increased CTL responses in normal mice immunized with
either SV40T or SIINFEKL peptide epitopes. On the other hand, 9X-CpG
therapy did not potentiate the CTL response of CIIKO mice to peptide
SV40-IV immunization. Nevertheless, a small enhancing effect of 9X-CpG
was observed on the response of CIIKO mice to SIINFEKL peptide
immunization (Fig. 4, C and D). These results
indicate that HTL participate in the potentiating effect of CpG in CTL
responses to peptide vaccination.
|
In general, CTL responses are difficult to generate when intact
soluble proteins are used as immunogens. Nevertheless, there are
reports that insoluble vaccine formulations, such as proteins bound to
polymer beads (32) or to ISCOMS (33), can
elicit CTL responses. It appears that the particle-bound protein
may become immunogenic for CTL by targeting the Ag into specialized
phagocytic cells that are able to process and present these Ags within
the MHC class I pathway. Because the particulate forms of protein Ag
tend to be difficult to produce and characterize, we evaluated whether
9X-CpG therapy would facilitate the induction of CTL to a soluble
protein. The results presented in Fig. 5
show that 9X-CpG therapy was successful in enhancing the generation of
CTL to OVA when this protein was administered in either IFA or PBS. The
responses in IFA were moderately higher than those obtained in PBS. On
the other hand, immunization with OVA protein in IFA in the absence of
9X-CpG failed to generate any detectable CTL. Because the CTL responses
to EL4 cells pulsed with the OVA peptide (SIINFEKL) were almost
identical with the responses observed to the EG.7 targets (which
express the whole OVA molecule), it is likely that the majority of the
CTL induced by the protein were directed toward this immunodominant
epitope. Thus, from these results it is evident that repeated
administration of CpG up-regulates the immune system to allow the
generation of CTL after the administration of vaccines prepared
containing soluble Ag. We have recently obtained similar results using
another protein (VP2 from Theiler’s virus; data not shown), suggesting
that this effect of CpG may extend various types of soluble proteins in
the absence of additional adjuvants.
|
To evaluate the physiological role of CTL induced by protein
vaccination in combination with 9X-CpG therapy, groups of five mice
were immunized once with OVA protein plus PADRE in IFA with and without
the 9X-CpG regimen. In addition, a third group was immunized with the
PADRE peptide alone in IFA in combination with 9X-CpG therapy, and a
fourth group received no treatment. One week after vaccination all mice
were challenged s.c. with 4 x 105 live B16
melanoma cells that express the OVA protein (B16-OVA). The data
presented in Fig. 6 indicate that the
animals that were not treated and those that received 9X-CpG with PADRE
in IFA in the absence of OVA rapidly developed tumors (by day 12), and
all died by day 20. Similarly, three of the mice that were injected
with OVA and PADRE in IFA without 9X-CpG therapy developed tumors by
day 17 and were dead by day 20. Nevertheless, two mice from this group
had a delay in their tumor growth, but died by day 50. In contrast,
four of five animals that received 9X-CpG treatment in conjunction with
protein vaccine remained tumor free and survived until day 60, when the
experiment was terminated. Furthermore, the only animal that developed
a tumor in this group survived for a significant longer period than the
mice that were not treated or those that received 9X-CpG and HTL
peptide without protein vaccination.
|
indicate that
the mice that received the protein vaccination without CpG therapy
developed tumors and died at approximately the same rate as those mice
that received 9X-CpG therapy in the absence of the protein vaccine. In
contrast, all five mice that received 9X-CpG therapy in combination
with the protein vaccine had a significant delay in the occurrence of
tumors, and their overall survival time approximately doubled compared
with those of the other two groups (Fig. 7).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Peptide vaccination, administered usually in IFA emulsions, is commonly thought to be an effective way to induce CTL responses, which in some cases provides protection against live tumor challenges (36). However, the magnitude and effectiveness of the CTL responses derived from peptide vaccination vary significantly depending on the specific peptide used and possibly due to other factors that are more difficult to control, such as the presence of stimulatory factors such as endotoxin (LPS) in the vaccine formulation or the presence of micro-organisms or their products in the animal’s living environment, which could provide the necessary "danger signals" to the immune system. Most importantly, it has been reported that in some circumstances peptide vaccination, even in the presence of adjuvant, may result in the induction of T cell tolerance/anergy, which would have the opposite effect desired for tumor immunotherapy (14). The most likely explanation of these variable effects is that to obtain an effector CTL response, peptides may need to be presented to the naive CTL precursors by a professional APC in the context of a danger signal (15). On the other hand, peptide presentation by non-APC or even by professional APC in the absence of such danger signals could result in T cell anergy or inactivation (37). Our results suggest that the repeated administration of CpG not only increases the total number of professional APC (DC), but also may provide the necessary danger signal to facilitate the activation and expansion of CTL to vaccination with poorly immunogenic peptides. In fact, it has been reported that CpG can induce activation and maturation of DC (28, 29), which is one of the effects caused by danger signals (LPS, TNF, necrosis) necessary for effective CTL induction (16).
It is thought that the ability of some peptides to induce CTL may be due to the lack of a processing requirement that may allow the peptides to bind directly to cell surface MHC molecules that are temporarily empty or by displacing low affinity binding peptides. In fact, the capacity of peptides to induce CTL responses derived from vaccination correlates with their MHC binding affinity (38). On the other hand, vaccines containing intact soluble proteins usually fail to elicit CTL responses, because the peptide epitopes need to be generated intracellularly through the MHC class I Ag-processing pathway. Furthermore, exogenous Ags that are endocytosed by most APC are more likely to generate MHC class II epitopes than class I CTL epitopes. Despite this, it has been reported that proteins in the form of particles (conjugated to beads, incorporated into immune-stimulating complexes (ISCOMS), liposomes, or in detergent micelles) are capable of inducing CTL responses, possibly by targeting the Ags to specialized APC that can ingest the particles, process the proteins, and target the epitopes to the class I MHC pathway (32, 33, 39, 40). Our results show that vaccination with soluble protein using the 9X-CpG regimen results in strong CTL responses that are not be observed in the absence of CpG. Thus, it appears that the APC that are generated and stimulated by 9X-CpG treatment are capable of capturing and processing soluble proteins into class I MHC CTL epitopes. In support of this, there are various examples that DC pulsed in vitro with intact soluble proteins are capable of inducing CTL responses when injected into mice (41). It is currently unknown whether the soluble protein is processed intra- or extracellularly by the APC in our system. The possibility that the OVA preparation used here may contain some peptide fragments including the SIINFEKL peptide was considered, but seems unlikely, because target cells (EL-4) incubated overnight with a high concentration of OVA protein (1 mg/ml) could not be sensitized for lysis by OVA-specific CTL (data not shown).
In addition to the production of high numbers of potent APC, 9X-CpG
therapy results in a substantial increase in T lymphocytes in
peripheral lymphoid organs. However, these T cells do not appear to be
fully activated, as determined by the presence of several cell surface
activation markers (CD25, CD44, and CD69). Furthermore, our results
show that Ag (in the form of either peptide or protein) is required in
vivo to produce CTL with lytic activity. The 5-fold increase in the
numbers of nonactivated T cells indicates that repeated administration
of CpG somehow disrupts the regulatory mechanisms involved in T cell
homeostasis that normally operate in both the thymus and the periphery
(42). Such an increase in T cell numbers could be the
result of an enhancement in the generation and efflux of these cells
from bone marrow and thymus and/or the product of cell expansion
occurring in the peripheral lymphoid organs. Experiments in
thymectomized and/or bone marrow chimeric mice should facilitate
identification of the source of the additional T cells (and DC)
resulting from 9X-CpG therapy.
The potentiating effect of 9X-CpG treatment in the generation of CTL with effector (cytolytic) activity appears to require the presence of CD4+ HTL, because the increase in CTL responses was minimal in CIIKO mice. However, 9X-CpG treatment in CIIKO resulted in an overall increase in DC and T cell numbers similar to those obtained in normal mice (data not shown), indicating that CD4+ HTL are not required for the expansion of T cell and DC numbers induced by this therapy. Th cells could participate in the enhancement of CTL responses in 9X-CpG-vaccinated mice via several mechanisms. First, Ag-stimulated HTL can activate DC via CD40/CD40 ligand interactions, although it is possible that CpG may directly activate DC in a CD40-independent way as previously suggested (18). Second, administration of CpG has been reported to preferentially stimulate Th1 vs Th2 responses that would be more conducive for the induction of CTL (17, 18). Indeed, we have observed that the PADRE-reactive HTL derived from the 9X-CpG therapy preferentially produce Th1 cytokines when challenged in vitro with Ag (unpublished observations). Thus, it is likely that 9X-CpG therapy enhances CTL responses not by a single mechanism, but possibly through a combination of immunostimulatory effects that this immune modulator exerts in DC, HTL, and CTL precursors.
The immune responses derived from protein or peptide vaccination combined with 9X-CpG were effective in the prevention and treatment of tumors in mice. Because vaccination using OVA protein generated strong CTL responses, we assume that CTL played a significant role in the in vivo destruction of B16-OVA cells, resulting in the delay of tumor growth and increased survival. However, it is possible that OVA-reactive HTL, which are probably generated by this immunization, may also play a significant role in anti-tumor immunity. Nonetheless, we have obtained similar results in experiments in which mice were vaccinated with the SIINFEKL peptide (plus the PADRE HTL epitope) instead of the intact OVA protein, suggesting that OVA-reactive HTL are not absolutely required in this system to obtain anti-tumor effects.
The occurrence of tumors in the 9X-CpG treated/protein-vaccinated mice (one of five in the prophylactic mode and five of five in the therapeutic mode) indicates that this mode of immunotherapy will require additional manipulations to achieve a higher degree of success. For instance, it is possible that the tumors that grow and kill the vaccinated mice cease to express either the relevant tumor Ag (OVA in this case) or class I MHC molecules, as has been reported to occur in human melanoma patients undergoing immunotherapy (43, 44). It is also possible that CTL responses in tumor-bearing mice are short-lived. For example, down-regulatory signals, such as those produced via CTLA-4, may contribute to the early dismissal of CTL before they have completed their task (45). If these possibilities do indeed constitute a serious threat to the success of CTL-based immunotherapy, the use of multiple tumor-associated Ags in a vaccine formulation together with CTLA-4 blockade should presumably improve the outcome of this therapeutic approach. In fact, in preliminary experiments we have observed that the administration of blocking anti-CTLA-4 mAbs significantly improved the efficacy of therapeutic peptide vaccination combined with 9X-CpG treatment (E. Davila, manuscript in preparation).
One final point worth discussing is that the capacity of synthetic peptides and soluble proteins to induce CTL responses when administered together with 9X-CpG has significant practical and economical implications for the production of vaccines. First, although insoluble proteins (coupled into latex or biodegradable beads, incorporated into immune-stimulating complexes or liposomes) can induce CTL, these vaccine formulations tend to be complicated and expensive to produce. Furthermore, particle-based vaccines require extensive quality control testing with respect to those parameters that may contribute to their immunogenicity, such as particle size, composition, and quantity of Ag per particle mass. Lastly, the stability of particulate forms of protein/peptide Ags is likely to be an issue, in contrast to pure soluble proteins or peptides that in most instances can be stably preserved in a lyophilized form for long periods of time. The results presented here indicate that soluble proteins may be employed as well-characterized and stable vaccine preparations to generate effective CTL responses when repeated CpG administration is used to generate large numbers of DC capable of capturing and processing soluble Ags into MHC class I T cell epitopes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Esteban Celis, Department of Immunology, GU-421A, Mayo Clinic, Rochester, MN 55905.
3 Abbreviations used in this paper: DC, dendritic cells; TAA, tumor-associated Ags; ODN, oligonucleotides; CpG, cytosine-phosphorothiolated guanine; HTL, Th lymphocytes; CIIKO, MHC class II knockout mice; PADRE, Pan DR epitope; 9X-CpG, nine daily injections of 100 µg of CpG-1826; LU, lytic unit; LU30, 30% specific lysis at an E:T cell ratio of 100:1.
Received for publication January 13, 2000. Accepted for publication April 13, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  C. Berchtold, K. Panthel, S. Jellbauer, B. Kohn, E. Roider, M. Partilla, J. Heesemann, S. Endres, C. Bourquin, and H. Russmann Superior Protective Immunity against Murine Listeriosis by Combined Vaccination with CpG DNA and Recombinant Salmonella enterica Serovar Typhimurium Infect. Immun., December 1, 2009; 77(12): 5501 - 5508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Cerkovnik, B. Jezersek Novakovic, V. Stegel, and S. Novakovic Class C CpG oligodeoxynucleotides as a single agent and in combination with radiotherapy efficiently delayed growth of subcutaneous B16F1 tumors Innate Immunity, October 1, 2009; 15(5): 313 - 321. [Abstract] [PDF]
|
|
|
|
 |
|
 N. Asprodites, L. Zheng, D. Geng, C. Velasco-Gonzalez, L. Sanchez-Perez, and E. Davila Engagement of Toll-like receptor-2 on cytotoxic T-lymphocytes occurs in vivo and augments antitumor activity FASEB J, October 1, 2008; 22(10): 3628 - 3637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. N. Haining, J. Davies, H. Kanzler, L. Drury, T. Brenn, J. Evans, J. Angelosanto, S. Rivoli, K. Russell, S. George, et al. CpG Oligodeoxynucleotides Alter Lymphocyte and Dendritic Cell Trafficking in Humans Clin. Cancer Res., September 1, 2008; 14(17): 5626 - 5634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zheng, N. Asprodites, A. H. Keene, P. Rodriguez, K. D. Brown, and E. Davila TLR9 engagement on CD4 T lymphocytes represses {gamma}-radiation-induced apoptosis through activation of checkpoint kinase response elements Blood, March 1, 2008; 111(5): 2704 - 2713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Celis Toll-like Receptor Ligands Energize Peptide Vaccines through Multiple Paths Cancer Res., September 1, 2007; 67(17): 7945 - 7947. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Kochenderfer, J. L. Simpson, C. D. Chien, and R. E. Gress Vaccination regimens incorporating CpG-containing oligodeoxynucleotides and IL-2 generate antigen-specific antitumor immunity from T-cell populations undergoing homeostatic peripheral expansion after BMT Blood, July 1, 2007; 110(1): 450 - 460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Nava-Parada, G. Forni, K. L. Knutson, L. R. Pease, and E. Celis Peptide Vaccine Given with a Toll-Like Receptor Agonist Is Effective for the Treatment and Prevention of Spontaneous Breast Tumors Cancer Res., February 1, 2007; 67(3): 1326 - 1334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. N. Kochenderfer, C. D. Chien, J. L. Simpson, and R. E. Gress Synergism between CpG-Containing Oligodeoxynucleotides and IL-2 Causes Dramatic Enhancement of Vaccine-Elicited CD8+ T Cell Responses J. Immunol., December 15, 2006; 177(12): 8860 - 8873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Kennedy and E. Celis T Helper Lymphocytes Rescue CTL from Activation-Induced Cell Death. J. Immunol., September 1, 2006; 177(5): 2862 - 2872. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Wakita, K. Chamoto, Y. Zhang, Y. Narita, D. Noguchi, H. Ohnishi, T. Iguchi, T. Sakai, H. Ikeda, and T. Nishimura An indispensable role of type-1 IFNs for inducing CTL-mediated complete eradication of established tumor tissue by CpG-liposome co-encapsulated with model tumor antigen Int. Immunol., March 1, 2006; 18(3): 425 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Iborra, J. Carrion, C. Anderson, C. Alonso, D. Sacks, and M. Soto Vaccination with the Leishmania infantum Acidic Ribosomal P0 Protein plus CpG Oligodeoxynucleotides Induces Protection against Cutaneous Leishmaniasis in C57BL/6 Mice but Does Not Prevent Progressive Disease in BALB/c Mice Infect. Immun., September 1, 2005; 73(9): 5842 - 5852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Radhakrishnan, E. Celis, and L. R. Pease B7-DC cross-linking restores antigen uptake and augments antigen-presenting cell function by matured dendritic cells PNAS, August 9, 2005; 102(32): 11438 - 11443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Kennedy, A. H. Undale, W. C. Kieper, M. S. Block, L. R. Pease, and E. Celis Direct Cross-Priming by Th Lymphocytes Generates Memory Cytotoxic T Cell Responses J. Immunol., April 1, 2005; 174(7): 3967 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Suzuki, D. Wakita, K. Chamoto, Y. Narita, T. Tsuji, T. Takeshima, H. Gyobu, Y. Kawarada, S. Kondo, S. Akira, et al. Liposome-Encapsulated CpG Oligodeoxynucleotides as a Potent Adjuvant for Inducing Type 1 Innate Immunity Cancer Res., December 1, 2004; 64(23): 8754 - 8760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Daftarian, G.-Y. Song, S. Ali, M. Faynsod, J. Longmate, D. J. Diamond, and J. D. I. Ellenhorn Two Distinct Pathways of Immuno-Modulation Improve Potency of p53 Immunization in Rejecting Established Tumors Cancer Res., August 1, 2004; 64(15): 5407 - 5414. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lu, Y. Higashimoto, E. Appella, and E. Celis Multiepitope Trojan Antigen Peptide Vaccines for the Induction of Antitumor CTL and Th Immune Responses J. Immunol., April 1, 2004; 172(7): 4575 - 4582. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rothenfusser, V. Hornung, M. Ayyoub, S. Britsch, A. Towarowski, A. Krug, A. Sarris, N. Lubenow, D. Speiser, S. Endres, et al. CpG-A and CpG-B oligonucleotides differentially enhance human peptide-specific primary and memory CD8+ T-cell responses in vitro Blood, March 15, 2004; 103(6): 2162 - 2169. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-F. Chen, C.-W. Lin, Y.-P. Tsao, and S.-L. Chen Cytotoxic-T-Lymphocyte Human Papillomavirus Type 16 E5 Peptide with CpG-Oligodeoxynucleotide Can Eliminate Tumor Growth in C57BL/6 Mice J. Virol., February 1, 2004; 78(3): 1333 - 1343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Lonsdorf, H. Kuekrek, B. V. Stern, B. O. Boehm, P. V. Lehmann, and M. Tary-Lehmann Intratumor CpG-Oligodeoxynucleotide Injection Induces Protective Antitumor T Cell Immunity J. Immunol., October 15, 2003; 171(8): 3941 - 3946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Beloeil, M. Tomkowiak, G. Angelov, T. Walzer, P. Dubois, and J. Marvel In Vivo Impact of CpG1826 Oligodeoxynucleotide on CD8 T Cell Primary Responses and Survival J. Immunol., September 15, 2003; 171(6): 2995 - 3002. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tritel, A. M. Stoddard, B. J. Flynn, P. A. Darrah, C.-y. Wu, U. Wille, J. A. Shah, Y. Huang, L. Xu, M. R. Betts, et al. Prime-Boost Vaccination with HIV-1 Gag Protein and Cytosine Phosphate Guanosine Oligodeoxynucleotide, Followed by Adenovirus, Induces Sustained and Robust Humoral and Cellular Immune Responses J. Immunol., September 1, 2003; 171(5): 2538 - 2547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Weigel, D. A. Rodeberg, A. M. Krieg, and B. R. Blazar CpG Oligodeoxynucleotides Potentiate the Antitumor Effects of Chemotherapy or Tumor Resection in an Orthotopic Murine Model of Rhabdomyosarcoma Clin. Cancer Res., August 1, 2003; 9(8): 3105 - 3114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Shah, P. A. Darrah, D. R. Ambrozak, T. N. Turon, S. Mendez, J. Kirman, C.-Y. Wu, N. Glaichenhaus, and R. A. Seder Dendritic Cells Are Responsible for the Capacity of CpG Oligodeoxynucleotides to Act as an Adjuvant for Protective Vaccine Immunity Against Leishmania major in Mice J. Exp. Med., July 21, 2003; 198(2): 281 - 291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Baines and E. Celis Immune-mediated Tumor Regression Induced by CpG-containing Oligodeoxynucleotides Clin. Cancer Res., July 1, 2003; 9(7): 2693 - 2700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Davila, R. Kennedy, and E. Celis Generation of Antitumor Immunity by Cytotoxic T Lymphocyte Epitope Peptide Vaccination, CpG-oligodeoxynucleotide Adjuvant, and CTLA-4 Blockade Cancer Res., June 15, 2003; 63(12): 3281 - 3288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang and A. M. Krieg Synergy between CpG- or non-CpG DNA and specific antigen for B cell activation Int. Immunol., February 1, 2003; 15(2): 223 - 231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Davila, M. G. Velez, C. J. Heppelmann, and E. Celis Creating space: an antigen-independent, CpG-induced peripheral expansion of naive and memory T lymphocytes in a full T-cell compartment Blood, September 18, 2002; 100(7): 2537 - 2545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Rhee, S. Mendez, J. A. Shah, C.-y. Wu, J. R. Kirman, T. N. Turon, D. F. Davey, H. Davis, D. M. Klinman, R. N. Coler, et al. Vaccination with Heat-killed Leishmania Antigen or Recombinant Leishmanial Protein and CpG Oligodeoxynucleotides Induces Long-Term Memory CD4+and CD8+T Cell Responses and Protection Against Leishmania major Infection J. Exp. Med., June 17, 2002; 195(12): 1565 - 1573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Knutson, K. Schiffman, M. A. Cheever, and M. L. Disis Immunization of Cancer Patients with a HER-2/neu, HLA-A2 Peptide, p369-377, Results in Short-lived Peptide-specific Immunity Clin. Cancer Res., May 1, 2002; 8(5): 1014 - 1018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Buteau, S. N. Markovic, and E. Celis Challenges in the Development of Effective Peptide Vaccines for Cancer Mayo Clin. Proc., April 1, 2002; 77(4): 339 - 349. [Abstract] [PDF]
|
|
|
|
|
|
T. Decker, S. Hipp, R. J. Kreitman, I. Pastan, C. Peschel, and T. Licht Sensitization of B-cell chronic lymphocytic leukemia cells to recombinant immunotoxin by immunostimulatory phosphorothioate oligodeoxynucleotides Blood, February 15, 2002; 99(4): 1320 - 1326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Miconnet, S. Koenig, D. Speiser, A. Krieg, P. Guillaume, J.-C. Cerottini, and P. Romero CpG Are Efficient Adjuvants for Specific CTL Induction Against Tumor Antigen-Derived Peptide J. Immunol., February 1, 2002; 168(3): 1212 - 1218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kawarada, R. Ganss, N. Garbi, T. Sacher, B. Arnold, and G. J. Hammerling NK- and CD8+ T Cell-Mediated Eradication of Established Tumors by Peritumoral Injection of CpG-Containing Oligodeoxynucleotides J. Immunol., November 1, 2001; 167(9): 5247 - 5253. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Auf, A. F. Carpentier, L. Chen, C. Le Clanche, and J.-Y. Delattre Implication of Macrophages in Tumor Rejection Induced by CpG-oligodeoxynucleotides Without Antigen Clin. Cancer Res., November 1, 2001; 7(11): 3540 - 3543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Blazar, A. M. Krieg, and P. A. Taylor Synthetic unmethylated cytosine-phosphate-guanosine oligodeoxynucleotides are potent stimulators of antileukemia responses in naive and bone marrow transplant recipients Blood, August 15, 2001; 98(4): 1217 - 1225. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or without CpG-1826 (
). The cytolytic
activity of splenocytes was determined in a 4-h cytotoxicity assay as
described in Materials and Methods
against the following targets cells: EL4 (A),
peptide-pulsed EL-4 (B), and 1803.1, a SV40 T-expressing
cell line (C).
). Seven days after vaccination, the
axillary lymph nodes were removed, and the cells were placed in tissue
culture for 4 days in the presence of 25 IU/ml IL-2. The cytotoxic
activity was determined in 4-h (A–C) or 8-h
(D–F) 51Cr release assays using the
following targets: EL4 without peptide (A and
D), EL4 plus SIINFEKL (B and
E), and EG.7 (C and F).
These experiments were repeated once more with almost identical
results.
).
A third group received OVA protein in IFA without the 9X-CpG regimen
(
). Seven days after vaccination, the spleen cells were restimulated
in tissue culture with irradiated EG.7 cells, and 1 wk later the
cytotoxic activity was measured against the following targets: unpulsed
EL4 (A), EL4 pulsed with SIINFEKL (B), or
EG.7 (C). These experiments were repeated several times
with almost identical results.
), were vaccinated with OVA protein and
PADRE peptide without 9X-CpG (